Compositions and methods for reducing cold-induced sweetening in potato
By introducing mutations in the VInvIn2En transcription enhancer, the expression of the potato vacuolar invertase gene is reduced during cold storage, addressing the issue of cold-induced sweetening and improving potato product quality.
Patent Information
- Application Number
- PCT/US2024/060189
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-14
- Filing Date
- 2024-12-13
- Publication Date
- 2025-06-19
AI Technical Summary
Cold storage of potatoes leads to the breakdown of starch and accumulation of reducing sugars, resulting in cold-induced sweetening (CIS), which affects the quality of processed potato products and increases the risk of acrylamide formation during high-temperature processing.
Introduction of mutations in the 200-bp transcription enhancer VInvIn2En of the potato vacuolar invertase gene (VInv) to reduce VInv transcription during cold storage, thereby minimizing the accumulation of reducing sugars.
The mutations in VInvIn2En significantly reduce VInv expression in cold-stored potatoes, leading to decreased reducing sugar accumulation and subsequent reduction in cold-induced sweetening, thereby improving the quality of potato products.
Smart Images

Figure US2024060189_19062025_PF_FP_ABST
Abstract
Description
MSU: TEC2024-0055 PCT / / MVS: P15076WO01 COMPOSITIONS AND METHODS FOR REDUCING COLD-INDUCED SWEETENING IN POTATO Cross-Reference to Related Applications
[0001] This international patent application claims the benefit of international patent application no: PCT / CN2023 / 138698, filed on December 14, 2023, the disclosure of which is incorporated herein by reference in its entirety. Federal Funding
[0002] This invention was made with government support under grant number 2011-51181- 30629 awarded by the U.S. Department of Agriculture, National Institute of Food and Agriculture, Specialty Crop Research Initiative (USDA-NIFA-SCRI). The government has certain rights in the invention. Incorporation of Sequence Listing
[0003] The instant application contains a Sequence Listing named “P15076WO01.xml” which has been submitted electronically in XML format, is 48,733 bytes in size, was created on December 13, 2024, and is herein incorporated by reference in its entirety. Background
[0004] Potato is the third most important food crop in the world in terms of human consumption (Devaux et al.). In addition, French fries and potato chips are among the most consumed snacks, especially in developed countries. Unlike the grain crops, storage is one of the most important issues related to the potato industry because tubers must be stored at cold temperatures to prevent sprouting and diseases. Unfortunately, cold storage triggers the breakdown of starch and accumulation of reducing sugars, which is referred to as “cold- induced sweetening” (CIS) (Dale and Bradshaw, 2003), a costly problem for the potato processing industry (Sowokinos, 2001). The reducing sugars in tubers will react with free amino acids via a nonenzymatic, Maillard-type reaction during high-temperature processing. This reaction results in products with dark color and bitter taste and producesMSU: TEC2024-0055 PCT / / MVS: P15076WO01 acrylamide, a potential carcinogen (Mottram et al., 2002; Stadler et al., 2002). Reducing sugars are the primary determinant for the acrylamide content in fried potato products (Amrein et al., 2003; Becalski et al., 2004; Zhu et al., 2016). Thus, developing methods to minimize reducing sugars in cold-stored tubers has been an important research focus to reduce acrylamide in fried potato products. SUMMARY
[0005] Described herein are potato (Solanum tuberosum) plants, potato plant cells, potato tubers or a portion of tubers, and potato plant seeds comprising at least one mutation in a 200-bp transcription enhancer, VInvIn2En, in the nucleic acid sequence of SEQ ID NO: 1 that modulates expression of a potato vacuolar invertase gene (VInv). Also provided are potato plants comprising the aforementioned potato plant cells. Cold storage temperatures of potatoes induce high transcription levels of the VInv gene, which causes the accumulation of reducing sugars and consequent problematic cold-induced sweetening of the potatoes. The mutations in one or more DNA motifs of VInvIn2En abolished the function of VInvIn2En as a transcriptional enhancer, thereby reducing VInv transcription during cold storage temperature.
[0006] Also provided are biological samples comprising a nucleic acid containing at least one mutation in the VInvIn2En enhancer of SEQ ID NO: 1 or an allelic variant thereof. Polynucleotides comprising the at least one mutation in the VInvIn2En enhancer of SEQ ID NO: 1 are provided. In some embodiments, the aforementioned polynucleotides are isolated.
[0007] Guide RNA molecules comprising a spacer RNA molecule which target the VInvIn2En enhancer of SEQ ID NO: 1 or an allelic variant thereof are provided. Guide RNA molecules comprising a spacer RNA encoded by SEQ ID NO: 37-46 are also provided. Gene editing systems comprising a CRISPR-Cas effector protein in association with a guide nucleic acid, wherein the guide nucleic acid comprises a spacer sequence that binds to the VInvIn2En enhancer of SEQ ID NO: 1 or allelic variant thereof are provided. Expression cassettes comprising a polynucleotide encoding CRISPR-Cas effector protein comprising a cleavage domain and a guide RNA molecule of the disclosure are also provided.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0008] Methods of cultivating such potato plant seeds, potato tubers or a portion of tubers, and potato plants are also described herein that include, for example, harvesting the potato plants, potato tubers, and potato seeds. Methods for determining whether a potato plant cell, potato tuber or a portion of tuber, or potato plant comprises at least one mutation in the VInvIn2En enhancer of SEQ ID NO: 1 or an allelic variant thereof are provided. In certain embodiments, the methods comprise analyzing a polynucleotide comprising a portion of SEQ ID NO: 1 or an allelic variant thereof from the plant cell, plant part, or plant, wherein an insertion, deletion, and / or substitution of one or more nucleotides in the polynucleotide is indicative of the presence of the at least one mutation.
[0009] Uses of the aforementioned potato plant cells, potato plant parts, potato tuber or a portion of tuber, and potato plants to produce potato seed or to grow a potato crop are provided are provided. Uses of the aforementioned guide RNA molecules, gene editing systems, and expression cassettes to introduce at least one mutation in the VInvIn2En enhancer of SEQ ID NO: 1 or an allelic variant thereof are provided. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figs.1A-1B. Discovery of a cold-responsive intronic enhancer in VInv gene. Fig.1A is a map of DNaseI hypersensitive sites (DHSs) associated with VInv gene developed from tuber tissue of DM1-3 potato. Two DHSs (bars 1 and 2), one at the 5′ of the gene and one in the second intron, were detected. Fig. 1B shows images of Katahdin tetraploid potato tubers expressing a GUS reporter gene in the second intron of VInv gene. Constructs using a mini35S and a full-length 35S promoters were used as negative and positive controls. Tubers from transgenic lines developed using the intronic construct (VInvIn2) and a reverse construct (VInvIn2R) showed minimal GUS signals under room temperature (22°C). Strong GUS signals were detected from tubers after 4 weeks of cold storage under 4°C.
[0011] Figs.2A-2F. Identification of transcriptional enhancers in intron 2 of VInv gene. Fig. 2A shows a diagram illustrating the sizes and positions of 10 sub-fragments derived from intron 2 of the VInv gene. The 1327-bp intron was divided into ten fragments (#1 to #10) using five breaks (b1 to b5). Fig.2B is a diagram illustrating the sizes and positions of the 13 fragments derived from the DNA fragment #11. A dashed line marks the middle point of the 600-bp segment #11. “+” and “-” indicate the derived transgenic seedlings showingMSU: TEC2024-0055 PCT / / MVS: P15076WO01 positive and negative GUS signals, respectively. Fig. 2C shows images of A. thaliana plants expressing a GUS reporter gene in the intron 2 in A. thaliana. Constructs using a mini35S and a full-length 35S promoters were used as negative and positive controls. Fig. 2D shows images of GUS expression patterns in representative A. thaliana transgenic seedlings derived from each of the ten constructs consisting of a fragment ligated with the mini35S promoter and the GUS reporter gene. Fig.2E shows images of GUS staining of 20 A. thaliana transgenic seedlings derived from constructs #11, #17, #19, and #21, respectively. Fig.2F shows images of GUS reporter gene assays of the 200 bp VInvIn2En enhancer in “Katahdin” potato tubers. Tubers from three independent transgenic lines showed minimal GUS signals under 22°C but strong signals from tubers after 4 weeks of cold storage under 4°C. All numbers above bars / lines in Figs. 2A and 2B indicate base pairs. The scale bar represents 2 mm in Figs. 2C and 2D and 1 cm in Figs. 2E and 2F. Fragment numbers with arrows in Figs. 2A, 2B, 2D, and 2E indicate representative constructs with full enhancer function.
[0012] Figs.3A-3B. Distribution and function of DNA motifs in intron 2 and the VInvIn2En enhancer. Fig. 3A provides maps showing the distribution of DNA motifs related to transcription factors (TFs) involved in response to cold stress. Each vertical bar represents a potential TF-binding site. Solid bars indicate that the binding sites of a relevant TF are enriched or exclusively located within the 200-bp enhancer. Fig. 3B shows transgenic assays of VInvIn2En with mutated DNA motifs related to five different TFs. Nucleotides with arrows indicate the replaced sequence(s) in each construct. No GUS signals were detected in any transgenic A. thaliana plants derived from the three constructs with mutated DNA motifs related to CCAAT Binding Factor / Nuclear factor Y (CBF / NF-Y), TCP1, and GATA2.1The TCP family of transcription factors is named after the first 4 characterized members, namely TEOSINTE BRANCHED1 (TB1) from maize (Zea mays), CYCLOIDEA (CYC) from snapdragon (Antirrhinum majus), as well as PROLIFERATING CELL NUCLEAR ANTIGEN FACTOR1 (PCF1) and PCF2 from rice (Oryza sativa). Phylogenic analysis of this plant-specific protein family unveils a conserved bHLH-containing DNA-binding motif known as the TCP domain.2GATA transcription factors (TFs), which have the consensus sequence W-G-A-T-A-R (W = T or A, R = G or A), are a class of regulators that exists in plants, fungi, and metazoans.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0013] Figs.4A-4G. Functional validation of the VInvIn2En enhancer using genome editing. Fig.4A is a diagram illustrating the positions of all sgRNAs within and outside of intron 2 of VInv gene. The bar labeled 200bp is the VInvIn2En enhancer. The position of sgRNAs R1, R2, R3, R4, 1a, 2a, 3a, 1b, 2b, and 3b are shown with arrows. Fig.4B is an image of gel electrophoresis of PCR products amplified from the three homozygous CRISPR / Cas9 deletion lines (2-2-8, 13-1-3, and 13-2-1) developed from DMF5-73-1 (WT). Fig.4C is a graph showing qRT-PCR-based transcription analysis of the VInv gene in cold-stored potato tissues from the three homozygous deletion lines (2-2-8, 13-1-3, and 13-2-1). All three lines showed significant reduction of VInv expression relative to the Actin97 reference gene. The y axis represents the relative expression level normalized by setting VInv expression in cold-stored tubers of the WT DMF5-73-1 to 1. Data are presented as mean ± SD from 3 biological replicates and were tested by the Student t test (*P < 0.05). Fig. 4D shows images of chipping of tubers from deletion line 13-1-3 and from the wild type DMF5-73-1. Note: (1) the dark color toward one end of each chip is caused by the “jelly end” problem (two examples are indicated by arrows) associated with both 13-1-3 and WT. (2) 13-1-3 is a selfed progeny of a T0 DMF5-73-1 (heterozygous) transgenic line. Thus, the tubers from the two lines show different shapes. Three tubers from each line were used for chipping, and 2 chips from each tuber were included in the illustration. Fig.4E is an image of gel electrophoresis of PCR products amplified from the genomic DNA of 3 T0 CRISPR / Cas9 lines (KV78, KV87, and KV108) developed from tetraploid potato cultivar Katahdin. Arrows indicate fragments resulted from deletions within VInvIn2En. Fig. 4F shows sequencing of PCR products amplified from cDNAs of the 3 CRISPR / Cas9 lines. Normal splicing between exon 1 and exon 3 was detected in all three lines. Fig. 4G is a graph showing qRT-PCR-based analysis of VInv expression relative to the Actin97 gene of the three CRISPR / Cas lines. Expression was analyzed using tubers after 2 wks of storage at 22 °C and 4 °C, respectively. The y axis represents the relative expression level normalized by setting VInv expression in 22 °C-stored tubers of the WT ‘Katahdin’ to 1. Data are presented as mean ± SD from 3 biological replicates and were tested by using PROC GLM ANOVA.
[0014] Fig.5 is a schematic illustration of the composition of introns and exons of VInv genes from different plant species.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0015] Figs.6A-6B are maps showing genotyping of homozygous CRISPR / Cas deletion lines developed from DMF5-73-1. The 200-bp VInvIn2En enhancer is shown with the positions of the four sgRNAs (R1, R2, R3, R4) within and outside of VInvIn2En. The positions of the six sgRNAs (1a, 2a, 3a, 1b, 2b, 3b) within and outside of VInvIn2En are also shown. Fig. 6A shows a 394-bp homozygous deletion spanning sgRNA 1a and 3b which was detected in lines 13-1-3 and 13-2-1. Note: T0 events for both 13-1-3 and 13-2-1 were regenerated from the same primary transformant hairy root culture. Fig.6B shows a 369- bp homozygous deletion spanning sgRNA 3a and 2b and a 5-bp deletion within sgRNA 2a which were detected in line 2-2-8. All three homozygous lines were generated from DMF5- 73-1 potato background by selfing a T0 event transformed with the CRISPR / Cas binary vector. Genotyping was conducted by PCR using primers VInv-mut-F1 / R1 and Sanger sequencing.
[0016] Fig. 7 is a nucleic acid sequence alignment of three haplotypes associated with the middle portion of intron 2 of VInv gene from tetraploid potato Katahdin. The 200-bp VInvIn2En from RH potato is indicated by bold underlining. The positions of the four sgRNAs (R1, R2, R3 and R4) and protospacer adjacent motif (PAM) sequences are marked below the sequence. The PAM sequences are identical nucleotides conserved among all haplotypes. Arrows to particular nucleotides are associated single nucleotide polymorphisms (SNPs) between haplotype A and haplotype C.
[0017] Fig. 8 shows maps of nucleic acid deletions within haplotype A and haplotype B in VInvIn2En of Katahdin. Sequence variants were detected in three T0 CRISPR / Cas9 lines (KV78, KV87 and KV108). Dotted lines represent deletions in different sizes. Insertions of single nucleotide are pointed by arrowheads. Percentages in brackets indicate the percentage of sequences with deletion / mutation in total number of sequences, including the wild type of haplotype A VInvIn2En or haplotype B VInvIn2En. The actual fragment lengths for different type of deletions are listed on the right. All numbers above lines indicate base pairs.
[0018] Fig. 9 shows images of potato chips processed from the three deletion lines and wild type Katahdin. Tubers were stored at 22°C for 2 weeks, or at 4°C for 2 weeks and 4 weeks, respectively. The vertical bars represent 5 cm.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 DETAILED DESCRIPTION
[0019] Definitions
[0020] The phrase “allelic variant” as used herein refers to a polynucleotide or polypeptide sequence variant that occurs in a particular gene at particular locus in a different strain, variety, or isolate of a given organism.
[0021] The term “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0022] As used herein, the phrase “biological sample” refers to either intact or non-intact (e.g., milled potato seed or potato plant tissue, chopped potato plant tissue, lyophilized tissue) potato plant tissue. It may also be an extract comprising intact or non-intact seed or potato plant tissue. The biological sample can comprise flour, meal, syrup, oil, starch, and cereals manufactured in whole or in part to contain potato plant by-products. In certain embodiments, the biological sample is “non-regenerable” (i.e., incapable of being regenerated into a potato plant or potato plant part).
[0023] As used herein, the terms “correspond,” “corresponding,” and the like, when used in the context of an nucleotide position, mutation, and / or substitution in any given polynucleotide (e.g., an allelic variant of SEQ ID NO: 1) with respect to the reference polynucleotide sequence (e.g., SEQ ID NO: 1) all refer to the position of the nucleotide in the given sequence that has identity to the nucleotide in the reference nucleotide sequence when the given polynucleotide is aligned to the reference polynucleotide sequence using a pairwise alignment algorithm (e.g., CLUSTAL O 1.2.4 with default parameters).
[0024] As used herein, the phrase “endogenous gene” refers to the native form of a gene unit in its natural location in the genome of an organism.
[0025] As used herein, the term “enhancer” refers to a cis-acting sequence that increases the transcription from a eukaryotic promoter and that can function at a variable distance from the promoter.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0026] As used herein, the term “expression” refers to the production of a functional end- product (e.g., an mRNA, guide RNA, or a protein) in either precursor or mature form.
[0027] As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.
[0028] As used herein, the term “isomorphic allele” refers to an allele of a gene having wild- type gene activity.
[0029] As used herein, the term “introduced” means providing a nucleic acid (e.g., expression construct) or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell and includes reference to the transient provision of a nucleic acid or protein to the cell. The term “introduced” includes reference to stable or transient transformation methods. Thus, “introduced” in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct / expression construct) into a cell, means “transfection” or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., nuclear chromosome, plasmid, plastid, chloroplast, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
[0030] As used herein, a “non-natural” or “non-naturally occurring” mutation refers to a mutation in a gene which is generated via human intervention or descended from the mutation generated via human intervention. Non-limiting examples of human intervention which can be used to generate a non-naturally occurring mutation include mutagenesis (e.g., chemical mutagenesis, ionizing radiation mutagenesis), mutagenesis followed by DNA sequence-based screening and selection (TILLING), and targeted genetic modifications (e.g., CRISPR-based methods, TALEN-based methods, zinc finger-based methods).
[0031] As used herein, the term "potato plant" is used in its broadest sense. It includes, but is not limited to, a plurality of plant cells or a structure that is present at any stage of a plant's development. Such structures include, but are not limited to, a seed, a tuber, a tiller, a sprig, a stolen, a plug, a rhizome, a shoot, a stem, a leaf, a flower petal, a fruit, a petiole, et cetera.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0032] The term “plant part” include any part(s) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); grain; stover; a plant cutting; a plant cell; a plant cell culture; or a plant organ (e.g., pollen, embryos, pods; flowers, fruits, shoots, leaves, roots, stems, and explants). A plant tissue or plant organ may be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may be capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating a plant having substantially the same genotype as the plant. Regenerable cells in a plant cell or tissue culture may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, flowers, or stalks. In contrast, some plant cells are not capable of being regenerated to produce plants and are referred to herein as “non-regenerable” plant cells.
[0033] As used herein, the term “promoter” refers to a regulatory region comprising the transcriptional start site) and binding sites for core transcription factor complexes that induce RNA polymerase II-mediated (RNA PolII-mediated) transcription of RNA PolII promoters.
[0034] As used herein, the term “variety” refers a group of similar plants that by one or more structural features, genetic features, and / or performance can be distinguished from other varieties within the same species. In certain embodiments, the term variety refers to the botanical taxonomic designation whereby variety is ranked below species or subspecies, as well as the legal definition whereby the term “variety” refers to a commercial plant that is protected under the terms outlined in the International Convention for the Protection of New Varieties of Plants.
[0035] As used herein, “isolated” means a nucleic acid or polypeptide has been removed from its natural or native cell. Thus, the nucleic acid or polypeptide can be physically isolated from the cell or the nucleic acid or polypeptide can be present or maintained in another cell where it is not naturally present or synthesized.
[0036] The term "transgenic" when used in reference to a plant or leaf or fruit, tuber, seed, or plant biomass, for example a "transgenic plant," transgenic leaf," "transgenic fruit," "transgenic fruit," "transgenic seed," "transgenic biomass," or a "transgenic host cell" refers to a plant or leaf or fruit or seed or tuber or biomass that contains at least one heterologousMSU: TEC2024-0055 PCT / / MVS: P15076WO01 or foreign gene in one or more of its cells. The term "transgenic plant material" refers broadly to a plant, a plant structure, a plant tissue, a plant seed, a plant tuber or portion of tuber, or a plant cell that contains at least one heterologous gene in one or more of its cells.
[0037] The term "transgene" refers to a foreign gene that is placed into an organism (e.g. a plant) or host cell by the process of transfection. The term "foreign gene" or heterologous gene refers to any nucleic acid (e.g., gene sequence) that is introduced into the genome of an organism or tissue of an organism or a host cell by experimental manipulations, such as those described herein, and may include gene sequences found in that organism so long as the introduced gene does not reside in the same location, as does the naturally occurring gene.
[0038] As used herein, the term “heterologous” when used in reference to a nucleic acid or protein refers to a nucleic acid or protein that has been manipulated in some way. For example, a heterologous nucleic acid includes a nucleic acid from one species introduced into another species. A heterologous nucleic acid also includes a nucleic acid that is native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, present in a locus within the genome, expressed from an autonomously replicating vector, linked to a non-native promoter, linked to a mutated promoter, or linked to an enhancer sequence, etc.). Heterologous nucleic acids may comprise plant gene sequences that comprise cDNA forms of a plant gene; the cDNA sequences may be expressed in either a sense (to produce mRNA) or anti-sense orientation (to produce an anti-sense RNA transcript that is complementary to the mRNA transcript). In some cases, heterologous nucleic acids are distinguished from endogenous plant genes in that the heterologous nucleic acids can be joined to nucleotide sequences comprising regulatory elements such as promoters that are not found naturally associated with the nucleic acid. In another example, the heterologous nucleic acids are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
[0039] As used herein, a “native” nucleic acid or polypeptide means a DNA, RNA or amino acid sequence or segment that has not been manipulated in vitro, i.e., has not been isolated, purified, and / or amplified.
[0040] As used herein, the term "wild-type" when made in reference to a gene refers to a functional gene common throughout an outbred population. As used herein, the term "wild-MSU: TEC2024-0055 PCT / / MVS: P15076WO01 type" when made in reference to a gene product refers to a functional gene product common throughout an outbred population. A functional wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the "normal" or "wild- type" form of the gene. As used herein, the term "wild-type" when made in reference to a plant refers to the plant type common throughout an outbred population that has not been genetically manipulated to contain an expression cassette, e.g., any of the expression cassettes described herein.
[0041] The term “selectively hybridize’’ includes hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence (e.g., any of the SEQ ID NOS: 1-4 nucleic acids) to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences. Such selective hybridization substantially excludes non target nucleic acids. Selectively hybridizing sequences typically have about at least 40% sequence identity, or at least 50% sequence identity, or at least 60% sequence identity, or at least 70% sequence identity, or at least 80% sequence identity, or at least 90% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or 60-99% sequence identity, or 70-99% sequence identity, or 80-99% sequence identity, or 90-95% sequence identity, or 90-99% sequence identity, or 95-97% sequence identity, or 97-99% sequence identity, or 100% sequence identity (or complementarity) with each other. In some embodiments, a selectively hybridizing sequence has about at least about 80% sequence identity or complementarity with SEQ ID NOS: 1-4.
[0042] Thus, the nucleic acids of the invention include those with about 50 of the same nucleotides as SEQ ID NOS: 1-4 or about 100 of the same nucleotides, or about 150 of the same nucleotides, or about 200 of the same nucleotides, or the same nucleotides as SEQ ID NO: 1-4. The identical nucleotides or amino acids can be distributed throughout the nucleic acid, and need not be contiguous.
[0043] Note that if a value of a variable that is necessarily an integer, e.g., the number of nucleotides or amino acids in a nucleic acid or protein, is described as a range, e.g., 90- 99% sequence identity what is meant is that the value can be any integer between 90 andMSU: TEC2024-0055 PCT / / MVS: P15076WO01 99 inclusive, i.e., 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99, or any range between 90 and 99 inclusive, e.g., 91-99%, 91-98%, 92-99%, etc.
[0044] The terms “stringent conditions’’ or “stringent hybridization conditions’’ include conditions under which a probe will hybridize to its target sequence to a detectably greater degree than other sequences (e.g., at least 2-fold over background).
[0045] Stringent conditions are somewhat sequence-dependent and can vary in different circumstances. By controlling the stringency of the hybridization and / or washing conditions, target sequences can be identified with up to 100% complementarity to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of sequence similarity are detected (heterologous probing). The probe can be approximately 20-500 nucleotides in length but can vary greatly in length from about 18 nucleotides to equal to the entire length of the target sequence. In some embodiments, the probe is about 10-50 nucleotides in length, or about 18-25 nucleotides in length, or about 18-50 nucleotides in length, or about 18-100 nucleotides in length.
[0046] Typically, stringent conditions will be those where the salt concentration is less than about 1.5 M Na+ ion (or other salts), typically about 0.01 to 1.0 M Na+ ion concentration (or other salts), at pH 7.0 to 8.3 and the temperature is at least about 30 °C for shorter probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for longer probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide or Denhardt’ s solution. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1M NaCl, 1% SDS (sodium dodecyl sulfate) at 37 °C, and a wash in 1 x SSC to 2 x SSC (where 20 x SSC is 3.0 M NaCl, 0.3 M trisodium citrate) at 50 to 55 °C Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1M NaCl, 1 % SDS at 37 °C, and a wash in 0.5 x SSC to 1 x SSC at 55 to 60 °C. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% SDS at 37° C, and a wash in 0.1 x SSC at 60 to 65 °C. Specificity is typically a function of post-hybridization washes, where the factors controlling hybridization include the ionic strength and temperature of the final wash solution. Thus, high stringency conditions can include a wash that includes 0.1 x SSC at 60 to 65 °C.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0047] For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (Anal. Biochem. 138:267-84 (1984)): Tm= 81.5 °C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% formamide) - 500 / L where M is the molarity of monovalent cations; % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % formamide is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. The Tm is reduced by about 1 °C for each 1 % of mismatching. Thus, the Tm, hybridization and / or wash conditions can be adjusted to hybridize to sequences of the desired sequence identity. For example, if sequences with greater than or equal to 90% sequence identity are sought, the Tm can be decreased 10 °C. Generally, stringent conditions are selected to be about 5 °C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH.
[0048] However, severely stringent conditions can include hybridization and / or a wash at 1, 2, 3 or 4° C lower than the thermal melting point (Tm). Moderately stringent conditions can include hybridization and / or a wash at 6, 7, 8, 9 or 10 °C lower than the thermal melting point (Tm). Low stringency conditions can include hybridization and / or a wash at 11, 12, 13, 14, 15 or 20 °C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and a desired Tm, those of ordinary skill can identify and isolate nucleic acids with sequences related to any of SEQ ID NOS disclosed herein.
[0049] Those of skill in the art also understand how to vary the hybridization and / or wash solutions to isolate desirable nucleic acids. For example, if the desired degree of mismatching results in a Tm of less than 45 °C (aqueous solution) or 32 °C (formamide solution), it may be preferred to increase the SSC concentration so that a higher temperature can be used.
[0050] An extensive guide to the hybridization of nucleic acids is found in Tijssen, LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY -HYBRIDIZATION WITH NUCLEIC ACID PROBES, part 1, chapter 2,“Overview of principles of hybridization and the strategy of nucleic acid probe assays,’’ Elsevier, N.Y. (1993); and in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, chapter 2, Ausubel, et ah, eds, Greene Publishing and Wiley-Interscience, New York (1995).MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0051] Unless otherwise stated, in the present application high stringency is defined as hybridization in 4 x SSC, 5 x Denhardt’s (5 g Ficoll, 5 g polyvinylpyrrolidone, 5 g bovine serum albumin in 500 ml of water), 0.1 mg / ml boiled salmon sperm DNA, and 25 mM Na phosphate at 65 °C, and a wash in 0.1 x SSC, 0.1% SDS at 65 °C.
[0052] However, because specificity is typically a function of post-hybridization washes, where the factors controlling hybridization include the ionic strength and temperature of the final wash solution, the high stringency conditions can more simply be expressed as including a wash in 0.1 x SSC at 60 to 65 °C.
[0053] The following terms are used to describe the sequence relationships between two or more nucleic acids or polypeptides: (a) “reference sequence,’’ (b) “comparison window,’’ (c) “sequence identity,’’ (d) “percentage of sequence identity’’ and (e) “substantial identity.’’
[0054] As used herein, “reference sequence’’ is a defined sequence used as a basis for sequence comparison. The reference sequence can be a nucleic acid sequence (e.g., any of SEQ ID NOS: 1-4). A reference sequence may be a subset or the entirety of a specified sequence. For example, a reference sequence may be a segment of a full-length cDNA or of a genomic DNA sequence, or the complete cDNA or complete genomic DNA sequence, or a domain of a polypeptide sequence.
[0055] As used herein, "comparison window" refers to a contiguous and specified segment of a nucleic acid or an amino acid sequence, wherein the nucleic acid / amino acid sequence can be compared to a reference sequence and wherein the portion of the nucleic acid / amino acid sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The comparison window can vary for nucleic acid and polypeptide sequences. Generally, for nucleic acids, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100 or more nucleotides. For amino acid sequences, the comparison window is at least about 10 amino acids, and can optionally be 15, 20, 30, 40, 50, 100 or more amino acids. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the nucleic acid or amino acid sequence, a gap penalty is typically introduced and is subtracted from the number of matches.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0056] Methods of alignment of nucleotide and amino acid sequences for comparison are well known in the art. The local homology algorithm (BESTFIT) of Smith and Waterman, (1981) Adv. Appl. Math 2:482, may permit optimal alignment of compared sequences; by the homology alignment algorithm (GAP) of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443-53; by the search for similarity method (Tfasta and Fasta) of Pearson and Lipman, (1988) Proc. Natl. Acad. Sci. USA 85:2444; by computerized implementations of these algorithms, including, but not limited to: CLUSTAL in the PC / Gene program by Intelligenetics, Mountain View, Calif., GAP, BESTFIT, BLAST, FASTA and TFASTA in the Wisconsin Genetics Software.
[0057] Package, Version 8 (available from Genetics Computer Group (GCG™ programs (Accelrys, Inc., San Diego, Calif.)). The CLUSTAL program is well described by Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp, (1989) CABIOS 5: 151-3; Corpet, et al., (1988) Nucleic Acids Res. 16: 10881-90; Huang, et al., (1992) Computer Applications in the Biosciences 8:155-65 and Pearson, et al., (1994) Meth. Mol. Biol. 24:307-31. An example of a good program to use for optimal global alignment of multiple sequences is PileUp (Feng and Doolittle, (1987) J. Mol. Evol., 25:351-60, which is similar to the method described by Higgins and Sharp, (1989) CABIOS 5:151-53 (and is hereby incorporated by reference). The BLAST family of programs that can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., eds., Greene Publishing and Wiley-Interscience, New York (1995).
[0058] GAP uses the algorithm of Needleman and Wunsch, (1970) J. Mol. Biol.48:443-53, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP makes a profit of gap creation penalty number of matches for eachMSU: TEC2024-0055 PCT / / MVS: P15076WO01 gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the Wisconsin Genetics Software Package are 8 and 2, respectively. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 100. Thus, for example, the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more.
[0059] GAP presents one member of the family of best alignments. There may be many members of this family. GAP displays four figures of merit for alignments: Quality, Ratio, Identity and Similarity. The Quality is the metric maximized to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the Wisconsin Genetics Software Package is BLOSUM62 (see, Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89:10915).
[0060] For example, sequence identity / similarity values provided herein can refer to the value obtained using the BLAST 2.0 suite of programs using default parameters (Altschul, et ah, (1997) Nucleic Acids Res.25:3389-402).
[0061] As those of ordinary skill in the art will understand, BLAST searches assume that proteins can be modeled as random sequences. However, many real proteins comprise regions of nonrandom sequences, which may be homopolymeric tracts, short-period repeats, or regions enriched in one or more amino acids. Such low-complexity regions may be aligned between unrelated proteins even though other regions of the protein are entirely dissimilar. A number of low-complexity filter programs can be employed to reduce such low-complexity alignments. For example, the SEG (Wooten and Federhen, (1993) Comput. Chem. 17:149-63) and XNU (Ci-ayerie and States, (1993) Comput. Chem. 17:191-201) low-complexity filters can be employed alone or in combination.
[0062] The terms “substantial identity’’ indicates that a polypeptide or nucleic acid comprises a sequence with between 55-100% sequence identity to a reference sequence, with at leastMSU: TEC2024-0055 PCT / / MVS: P15076WO01 55% sequence identity, or at least 60%, or at least 70%, or at least 80%, or at least 90% or at least 95% sequence identity, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or any percentage value within the range of 55-100% sequence identity relative to the reference sequence over a specified comparison window. Optimal alignment may be ascertained or conducted using the homology alignment algorithm of Needleman and Wunsch, supra.
[0063] To engineer healthy plants with reduced cold-induced sweetening (CIS), one of skill in the art can introduce a mutant VInvIn2En into the plants. For example, one of skill in the art can generate genetically-modified plants that contain nucleic acids encoding their mutant VInvIn2En within their somatic and / or germ cells. Such genetic modification can be accomplished by various procedures.
[0064] Non-limiting examples of methods of introducing a modification into the genome of a plant cell can include microinjection, viral delivery, recombinase technologies, homologous recombination, TALENS, CRISPR, and / or ZFN, see, e.g. Clark and Whitelaw Nature Reviews Genetics 4:825-833 (2003); which is incorporated by reference herein in its entirety. For example, nucleases such as zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and / or meganucleases can be employed with guide nucleic acid that allows the nuclease to target the genomic RFA site(s). In some cases of the various aspects described herein, a targeting vector can be used to introduce a transcriptional element, promotor, deletion, or modification of the genomic RFS chromosomal sites.
[0065] A "targeting vector" is a vector generally has a 5' flanking region and a 3' flanking region homologous to segments of the gene of interest. The 5' flanking region and a 3' flanking region can surround a DNA sequence comprising a modification and / or a foreign DNA sequence to be inserted into the gene. For example, foreign DNA to be inserted may encode a non-native promotor (as described below) and / or a selectable marker, such as an antibiotics resistance gene. Examples for suitable selectable markers include chloramphenicol resistance, gentamycin resistance, kanamycin resistance, spectinomycin resistance (SpecR), neomycin resistance gene (NEO) and hygromycin β- phosphotransferase markers (genes). The 5' flanking region and the 3' flanking region can be homologous to regions within the gene, or such flanking regions can flank the codingMSU: TEC2024-0055 PCT / / MVS: P15076WO01 region of gene to be deleted, mutated, or replaced with the unrelated DNA sequence. In some cases, the targeting vector does not comprise a selectable marker. DNA comprising the targeting vector and the native gene of interest are contacted under conditions that favor homologous recombination (e.g., by transforming plant cell(s) with the targeting vector).
[0066] A typical targeting vector contains nucleic acid fragments of not less than about 0.1 kb nor more than about 10.0 kb from both the 5' and the 3' ends of the genomic locus which encodes the gene to be modified (e.g. the genomic VInvIn2En site(s)). These two fragments can be separated by an intervening fragment of nucleic acid that includes the modification to be introduced. When the resulting construct recombines homologously with the chromosome at this locus, it results in the introduction of the modification, e.g. an insertion, substitution, or a deletion of a portion of the genomic RFS site(s).
[0067] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.
[0068] The present disclosure describes the modification of one or more nucleotides in a transcriptional enhancer of an endogenous potato VInv gene for providing potato plant cells, potato plant seeds, potato tubers or a portion of tubers, and potato plants that exhibit reduced cold-induced sweetening (CIS). The transcriptional enhancer of the potato vacuolar invertase gene (VInv). Described herein are also methods for elucidating regulatory mechanisms for expression of the VInv gene that are not controlled by the VInv gene promoter. VInvIn2En represents the first potato enhancer that is functionally dependent on sequence integrity for binding of multiple transcription factors (TFs). Thus, VInvIn2En provides methods to elucidate function and evolution of plant enhancers as well as regulation and adaptation of plant genes related to stress responses.
[0069] Cold-induced sweetening (CIS) was reported to be associated with numerous genetic loci based on genetic mapping (Menendez et al., 2002; Li et al., 2008; Braun et al., 2017), genome-wide association studies (GWAS) (Byrne et al., 2020), and comparative proteomics studies between CIS-resistant and CIS-susceptible potato cultivars (Fischer et al., 2013). Partial control of CIS was accomplished by manipulating the activity of the VInvMSU: TEC2024-0055 PCT / / MVS: P15076WO01 protein (Greiner et al. 1999; Agarwal et al. 2003) or the transcription of the VInv gene (Zrenner et al.1996; Zhang et al.2008). Silencing of VInv using RNAi resulted in nearly full control of CIS in at least some potato cultivars (Bhaskar et al.2010; Ye et al.2010). Interestingly, VInv gene transcription in tubers is maintained at a minimal level under room temperature. VInv is dramatically upregulated during cold storage in CIS-susceptible potato cultivars (Zrenner et al.1996; Bagnaresi et al.2008; Bhaskar et al.2010), causing rapid accumulation of reducing sugars. Silencing of the VInv gene has been proven to be an effective approach to control CIS in many potato cultivars (Bhaskar et al.2010; Ye et al.2010; Liu et al.2011; Wu et al.2011; Clasen et al.2016; Ly et al.2023). Concordantly, overexpression of StInvInh2, which encodes a vacuolar invertase inhibitor, can also reduce potato CIS (Liu et al.2013; Mckenzie et al.2013).
[0070] Invertases hydrolyze sucrose into glucose and fructose, thereby playing important roles in metabolism and development in plants (Ruan et al., 2010). Different plant invertases have been found to be specific to the cell wall, vacuole, or cytosol, respectively. Both cell wall and vacuolar invertases are also known to contribute to defense responses to abiotic and biotic stresses (Wan et al., 2018). Vacuolar invertases play essential roles in cell expansion and sugar accumulation, which are related to plant growth and development (Ruan et al., 2010; Wan et al., 2018). Therefore, silencing of the vacuolar invertase gene can cause major developmental defects in plants. For example, silencing of the vacuolar invertase gene in tomtao (Solanum lycopersicum) resulted in significantly smaller fruits (Klann et al., 1996). Major developmental defects were also reported in vacuolar invertase gene silencing lines of several other species, including carrot (Daucus carota) (Tang et al., 1999), muskmelon (Cucumis melo) (Yu et al., 2008), cotton (Gossypium hirsutum) (Wang et al., 2014; Wang and Ruan, 2016), and rice (Oryza sativa) (Lee et al., 2019; Deng et al., 2020).
[0071] VInv (Pain-1) is the only vacuolar invertase gene identified in the potato genome (Bhaskar et al., 2010; Draffehn et al., 2010). However, silencing of the VInv gene by RNAi in potato did not cause unambiguous defects in growth and development (Bhaskar et al., 2010). The potato RNAi lines did not show yield loss in field-based yield trials (Bhaskar et al., 2010). These results suggest that the VInv gene may not play a similarMSU: TEC2024-0055 PCT / / MVS: P15076WO01 developmental role in potato as compared to other plant species. Although VInv expresses in non-tuber tissues, the expression of VInv are not upregulated by cold stress in several non-tuber tissues, including petiole, stem, and root (unpublished data). Similarly, as described herein, the GUS signals in the transgenic A. thaliana plants derived from VInvIn2 and VInvIn2En constructs were not enhanced by cold stress. These results suggest that the VInv gene has adapted for a distinct role in the tuber-bearing species in response to cold stress. A high level of VInv expression at cold temperatures will generate more sugars in tuber cells. This in turn would affect the osmatic pressure and increase the freezing tolerance of tuber cells that contain a high percentage of water.
[0072] Several TFs, including CBF / NF-Y, TCP, and GATA, may play a role in VInvIn2En- mediated regulation of VInv under cold conditions, since mutations of the predicted binding sites of these TFs abolished the function of VInvIn2En as a transcriptional enhancer in A. thaliana (Fig.3B). CBF / NF-Y, TCP, and GATA are large TF families in plants and include 41, 31, and 49 genes, respectively, in the potato genome (Wang et al. 2019; Li et al.2021; Yu et al.2022). Although there are no reports yet on cold response associated with these TFs in potato, specific members from the CBF / NF-Y, TCP, and GATA families have been documented for playing a role in cold temperature response in other plant species. For example, a GATA-family TF in rice, OsGATA16, was induced by cold treatment and can improve cold tolerance by repressing some cold-related genes (Zhang et al. 2021). A TCP1 TF in Chrysanthemum morifolium, DgTCP1, was induced by cold temperature and can regulate peroxidase activity and reduce ROS accumulation (Li et al. 2022a). It is interesting to note the presence of 3 CBF / NF-Y binding sites in close vicinity within VInvIn2En. The NF-Y TFs have been documented to confer response to various types of abiotic stresses, including drought, salt, nutrient, and temperature (Zhang et al.2023). Thus, it will be essential to validate the functions of these TF-binding sites in potato and to identify a specific member(s) from these TF families that are responsible for the function of VInvIn2En.
[0073] VInvIn2En
[0074] The cold-induced transcription of VInv is not controlled by its promoter (Ou et al., 2013). The VInv promoter is required to respond to sucrose / glucose, indole-3-acetic acidMSU: TEC2024-0055 PCT / / MVS: P15076WO01 (IAA), and gibberellic acid (GA3), but not in response to cold temperatures (Ou et al., 2013). The present disclosure describes the discovery of a 200-bp transcriptional enhancer, VInvIn2En, located in the second intron of VInv. This enhancer is responsible for the cold- induced expression of the VInv gene. Several DNA motifs related to transcription factors (TFs) have been identified as being involved in the plant response to cold stress. Mutation of these motifs abolished the function of VInvIn2En. As described herein, deletion lines of VInvIn2En were developed in both diploid and tetraploid potato lines using CRISPR / Cas9- mediated genome editing. VInv transcription was significantly reduced in the deletion lines during cold storage. The VInvIn2En sequence was found to be highly conserved among distantly related plant species, revealing an evolutionary trajectory of the VInv gene in response to cold stress in the tuber-bearing Solanum species.
[0075] The endogenous 200bp wild-type nucleic acid sequence of VInvIn2En enhancer from potato (Solanum tuberosum) is shown below as SEQ ID NO: 1 and allelic variants thereof.
[0076] ATAATTGGGATTAACATGAGATCGTGTGGCAGCAAAGTTTTTTGGTTTTGGG TAATTTTCCAATAAAAATTAAACACATGATTGGCCAGTTTTATACAAGTTTGG AAATCAATCACGTTATGTGGGTCATACTTTTTTGTAGTAATGTAATAATTCCA TTAGTTGGCCCCCCATCCAAATTATTTGTCCATCTTTCCACT (Transcription factor binding motifs shown: CBF / NF-Y motifs are underlined in a solid line; TCP motifs are underlined in a dashed line; GATA motif in bold.)
[0077] Allelic variants of an endogenous potato VInvIn2En enhancer also include variants which comprise genomic DNA having at least 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to SEQ ID NO: 1. In certain embodiments, allelic variants of the endogenous potato VInvIn2En enhancer are isomorphic alleles of the endogenous potato VInvIn2En enhancer.
[0078] Potato plant cells, tubers or portion of tubers, plant parts, and plants comprising at least one mutation in the potato VInvIn2En enhancer of SEQ ID NO: 1 or an allelic variant thereof are provided. In certain embodiments, the at least one mutation is a non-natural mutation. In certain embodiments, the at least one mutation reduces expression of the endogenous VInv gene (e.g., by at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,MSU: TEC2024-0055 PCT / / MVS: P15076WO01 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) relative to a wild-type or control potato plant cell lacking the at least one mutation. In certain embodiments, the at least one mutation eliminates expression of the endogenous VInv gene. Examples of mutations can include a deletion, an insertion, and / or a substitution of one or more nucleotides of the potato VInvIn2En enhancer. The insertion, deletion, and / or substitution can be made anywhere in the potato VInvIn2En enhancer. In certain embodiments, the at least one mutation comprises, consists essentially of, or consists of a deletion, insertion, and / or substitution of at least one nucleotide (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, or 200 nucleotides) of the potato VInvIn2En enhancer of SEQ ID NO: 1 or an allelic variant thereof.
[0079] One or more mutation(s) in the VInvIn2En transcriptional enhancer can be used to reduce cold-induced expression of the VInv gene in potato. As described herein, the one or more mutations in VInvIn2En can comprise mutations in the CBF / NF-Y, TCP, and / or GATA DNA motifs. For example, the one or more mutation(s) can comprise one or more nucleotide mutation(s) within the GATA motif, which results in a complete loss of function of the VInvIn2En enhancer. An example mutation in the GATA motif of VInvIn2En that resulted in loss of expression of the VInv gene is shown below in SEQ ID NO: 2 (mutated nucleic acid is shown in bold underline; See Fig.3B and Example 4 below).
[0080] ATAATTGGGATTAACATGAGTTCGTGTGGCAGCAAAGTTTTTTGGTTTTGGG TAATTTTCCAATAAAAATTAAACACATGATTGGCCAGTTTTATACAAGTTTGG AAATCAATCACGTTATGTGGGTCATACTTTTTTGTAGTAATGTAATAATTCCA TTAGTTGGCCCCCCATCCAAATTATTTGTCCATCTTTCCACT (CBF / NF-Y motifs are underlined in a solid line; TCP motifs are underlined in a dashed line; GATA motif in bold with mutation of a nucleic acid at position 21 from A to T in bold underline.)MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0081] In embodiments, the one or more mutation(s) can comprise one or more nucleotide mutation(s) within the TCP motif. An example mutation in the TCP motif of VInvIn2En that resulted in loss of expression of the VInv gene is shown below in SEQ ID NO: 3 (mutated nucleic acids are shown in the boxes; See Fig.3B and Example 4 below).
[0082] ATAATTGGGATTAACATGAGATCGTGTGGCAGCAAAGTTTTTTGGTTTTGGG TAATTTTCCAATAAAAATTAAACACATGATTGGCCAGTTTTATACAAGTTTGG AAATCAATCACGTTATGTGGGTGAAACTTTTTTGTAGTAATGTAATAATTCCA TTAGTTAAACCCCCATCCAAATTATTTGTCCATCTTTCCACT (CBF / NF-Y motifs are underlined in a solid line; TCP motifs are underlined in a dashed line with mutation of nucleic acids at positions 128, 130, 165-167 nucleotides in bold / italics relative to SEQ ID NO:1; GATA motif in bold.)
[0083] In embodiments, the one or more mutation(s) can comprise one or more nucleotide mutation(s) within the CBF / NF-Y motif. An example mutation in the CBF / NF-Y motif of VInvIn2En that resulted in loss of expression of the VInv gene is shown below in SEQ ID NO: 4 (mutated nucleic acids are shown in the boxes; See Fig.3B and Example 4 below).
[0084] ATAATTGGGATTAACATGAGATCGTGTGGCAGCAAAGTTTTTTGGTTTTGGG TAATTTTCTTATAAAAATTAAACACATGATCCGCCAGTTTTATACAAGTTTGG AAATGAATCACGTTATGTGGGTCATACTTTTTTGTAGTAATGTAATAATTCCA TTAGTTGGCCCCCCATCCAAATTATTTGTCCATCTTTCCACT (CBF / NF-Y motifs are underlined in a solid line with mutation of nucleic acids at positions 62, 63, 84, 85, and 111 nucleotides in bold / italics relative to SEQ ID NO:1; TCP motifs are underlined in a dashed line; GATA motif in bold.)
[0085] In some cases, a Cas9 / CRISPR system can be used to create a modification in genomic VInvIn2En site(s). Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems are useful for, e.g. RNA-programmable genome editing (see e.g., Marraffini & Sontheimer. Nature Reviews Genetics 11: 181-190 (2010); Sorek et al. Nature Reviews Microbiology 20086: 181-6; Karginov and Hannon. Mol Cell 20101 :7-19; Hale et al. Mol Cell 2010:45:292-302; Jinek et al. Science 2012 337:815-820; Bikard and Marraffini Curr Opin Immunol 201224:15-20; Bikard et al. CellMSU: TEC2024-0055 PCT / / MVS: P15076WO01 Host & Microbe 201212: 177-186; all of which are incorporated by reference herein in their entireties). A CRISPR guide RNA can be used that can target a Cas enzyme to the desired location in the genome, where it generates a double strand break. This technique is available in the art and described, e.g. at Mali et al. Science 2013 339:823-6; which is incorporated by reference herein in its entirety and kits for the design and use of CRISPR- mediated genome editing are commercially available, e.g. the PRECISION X CAS9 SMART NUCLEASE™ System (Cat No. CAS900A-1) from System Biosciences, Mountain View, CA.
[0086] In another example, one of skill in the art can prepare an expression cassette or expression vector that can encode the mutant VInvIn2En enhancer nucleic acid sequence. Plant cells can be transformed by the expression cassette or expression vector, and whole plants (and their seeds or tubers) can be generated from the plant cells that were successfully transformed with the RFS nucleic acids. Some procedures for making such genetically modified plants and their seeds or tubers are described below.
[0087] In some embodiments, a cDNA clone encoding the mutant VInvIn2En enhancer nucleic acid sequence is isolated from plant tissue, for example, a root, stem, leaf, seed, tuber, or flower tissue. For example, cDNA clones from selected species (that encode the mutant VInvIn2En enhancer with homology to any of those described herein) are made from isolated mRNA from selected plant tissues. In another example, a nucleic acid encoding a mutant or modified VInvIn2En enhancer can be prepared by available methods or as described herein. For example, the nucleic acid encoding a mutant or modified VInvIn2En enhancer can be any nucleic acid with a coding region that hybridizes to a segment of a SEQ ID NOS: 1-4 nucleic acid.
[0088] 3' Sequences: When the expression cassette is to be introduced into a plant cell, the expression cassette can also optionally include 3' nontranslated plant regulatory DNA sequences that act as a signal to terminate transcription and allow for the polyadenylation of the resultant mRNA. The 3' nontranslated regulatory DNA sequence preferably includes from about 300 to 1,000 nucleotide base pairs and contains plant transcriptional and translational termination sequences. For example, 3' elements that can be used include those derived from the nopaline synthase gene of Agrobacterium tumefaciens (Bevan et ah, Nucleic Acid Research. 11:369-385 (1983)), or the terminator sequences for the T7MSU: TEC2024-0055 PCT / / MVS: P15076WO01 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and / or the 3' end of the protease inhibitor I or II genes from potato or tomato. Other 3' elements known to those of skill in the art can also be employed. These 3' nontranslated regulatory sequences can be obtained as described in Methods in Enzymology. 153:292 (1987). Many such 3' nontranslated regulatory sequences are already present in plasmids available from commercial sources such as Clontech, Palo Alto, California. The 3’ nontranslated regulatory sequences can be operably linked to the 3’ terminus of the RFS nucleic acids by standard methods.
[0089] Selectable and Screenable Marker Sequences: To improve identification of transformants, a selectable or screenable marker gene can be employed with the VInvIn2R nucleic acids. "Marker genes" are genes that impart a distinct phenotype to cells expressing the marker gene and thus allow such transformed cells to be distinguished from cells that do not have the marker. Such genes may encode either a selectable or screenable marker, depending on whether the marker confers a trait which one can ‘select’ for by chemical means, e.g., by use of a selective agent (e.g., an herbicide, antibiotic, or the like), or whether it is simply a trait that one can identify through observation or testing, i.e., by ‘screening’ (e.g., the R-locus trait). Of course, many examples of suitable marker genes are known to the art and can be employed in the practice of the invention.
[0090] Included within the terms selectable or screenable marker genes are also genes which encode a “secretable marker” whose secretion can be detected as a means of identifying or selecting for transformed cells. Examples include markers which encode a secretable antigen that can be identified by antibody interaction, or secretable enzymes that can be detected by their catalytic activity. Secretable proteins fall into a number of classes, including small, diffusible proteins detectable, e.g., by ELISA; and proteins that are inserted or trapped in the cell wall (e.g., proteins that include a leader sequence such as that found in the expression unit of extensin or tobacco PR-S).
[0091] With regard to selectable secretable markers, the use of a gene that encodes a polypeptide that becomes sequestered in the cell wall, where the polypeptide includes a unique epitope may be advantageous. Such a secreted antigen marker can employ an epitope sequence that would provide low background in plant tissue, a promoter-leader sequence that imparts efficient expression and targeting across the plasma membrane andMSU: TEC2024-0055 PCT / / MVS: P15076WO01 can produce protein that is bound in the cell wall and yet is accessible to antibodies. A normally secreted wall protein modified to include a unique epitope would satisfy such requirements.
[0092] Examples of proteins suitable for modification in this manner include extensin or hydroxyproline rich glycoprotein (HPRG). For example, the maize HPRG (Stiefel et al., The Plant Cell. 2:785-793 (1990)) is well characterized in terms of molecular biology, expression, and protein structure and therefore can readily be employed. However, any one of a variety of extensins and / or glycine-rich wall proteins (Keller et ah, EMBO J.8:1309- 1314 (1989)) could be modified by the addition of an antigenic site to create a screenable marker.
[0093] Numerous other possible selectable and / or screenable marker genes will be apparent to those of skill in the art in addition to those forth herein below. Therefore, it will be understood that the discussion herein is exemplary rather than exhaustive. In light of the techniques disclosed herein and the general recombinant techniques that are known in the art, the present invention readily allows the introduction of any gene, including marker genes, into a recipient cell to generate a transformed plant cell.
[0094] Possible selectable markers for use in connection with the present invention include, but are not limited to, a neo gene (Potrykus et al., Mol. Gen. Genet.199: 183-188 (1985)) which codes for kanamycin resistance and can be selected for using kanamycin, G418, and the like; a bar gene which codes for bialaphos resistance; a gene which encodes an altered EPSP synthase protein (Hinchee et al., Bio / Technology.6:915-922 (1988)) thus conferring glyphosate resistance; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., Science. 242:419-423 (1988)); a mutant acetolactate synthase gene (ALS) which confers resistance to imidazolinone, sulfonylurea or other ALS-inhibiting chemicals (European Patent Application 154,204 (1985)); a methotrexate-resistant DHFR gene (Thillet et al., J. Biol. Chem.263:12500-12508 (1988)); a dalapon dehalogenase gene that confers resistance to the herbicide dalapon; or a mutated anthranilate synthase gene that confers resistance to 5 -methyl tryptophan. Where a mutant EPSP synthase gene is employed, additional benefit may be realized through the incorporation of a suitable chloroplast transit peptide, CTP (European Patent Application 0218571 (1987)).MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0095] An illustrative embodiment of a selectable marker gene capable of being used in systems to select transformants is the gene that encode the enzyme phosphinothricin acetyltransferase, such as the bar gene from Streptomyces hygroscopicus or the pat gene from Streptomyces viridochromogenes (Ei.S. Patent No. 5,550,318). The enzyme phosphinothricin acetyl transferase (PAT) inactivates the active ingredient in the herbicide bialaphos, phosphinothricin (PPT). PPT inhibits glutamine synthetase, (Murakami et al., Mol. Gen. Genet. 205:42-50 (1986); Twell et al., Plant Physiol. 91:1270-1274 (1989)) causing rapid accumulation of ammonia and cell death. The success in using this selective system in conjunction with monocots was surprising because of the major difficulties that have been reported in transformation of cereals (Potrykus, Trends Biotech. 7:269-273 (1989)).
[0096] Screenable markers that may be employed include, but are not limited to, a b- glucuronidase or u id A gene (GUS) that encodes an enzyme for which various chromogenic substrates are known; an R- locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al., In: Chromosome Structure and Function: Impact of New Concepts , 18* Stadler Genetics Symposium, J.P. Gustafson and R. Appels, eds. (New York: Plenum Press) pp. 263-282 (1988)); a b-lactamase gene (Sutcliffe, Proc. Natl. Acad. Sci. USA.75:3737-3741 (1978)), which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a xylE gene (Zukowsky et al., Proc. Natl. Acad. Sci. USA.80:1101 (1983)) which encodes a catechol dioxygenase that can convert chromogenic catechols; an a-amylase gene (Ikuta et al., Bio / technology 8:241-242 (1990)); a tyrosinase gene (Katz et al., J. Gen. Microbiol.129:2703-2714 (1983)) which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in turn condenses to form the easily detectable compound melanin; a b-galactosidase gene, which encodes an enzyme for which there are chromogenic substrates; a luciferase (lux) gene (Ow et al., Science.234:856-859.1986), which allows for bioluminescence detection; or an aequorin gene (Prasher et al., Biochem. Biophys. Res. Comm.126: 1259-1268 (1985)), which may be employed in calcium-sensitive bioluminescence detection, or a green or yellow fluorescent protein gene (Niedz et al., Plant Cell Reports.14:403 (1995)).MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0097] For example, genes from the maize R gene complex can be used as screenable markers. The R gene complex in maize encodes a protein that acts to regulate the production of anthocyanin pigments in most seed and plant tissue. Maize strains can have one, or as many as four, R alleles that combine to regulate pigmentation in a developmental and tissue specific manner. A gene from the R gene complex does not harm the transformed cells. Thus, an R gene introduced into such cells will cause the expression of a red pigment and, if stably incorporated, can be visually scored as a red sector. If a maize line carries dominant alleles for genes encoding the enzymatic intermediates in the anthocyanin biosynthetic pathway (C2, Al, A2, Bzl and Bz2), but carries a recessive allele at the R locus, transformation of any cell from that line with R will result in red pigment formation. Exemplary lines include Wisconsin 22 that contains the rg-Stadler allele and TR112, a K55 derivative that is r-g, b, PI. Alternatively any genotype of maize can be utilized if the Cl and R alleles are introduced together.
[0098] The R gene regulatory regions may be employed in chimeric constructs to provide mechanisms for controlling the expression of chimeric genes. More diversity of phenotypic expression is known at the R locus than at any other locus (Coe et al., in Corn and Corn Improvement, eds. Sprague, G.F. & Dudley, J.W. (Am. Soc. Agron., Madison, WI), pp. 81-258 (1988)). It is contemplated that regulatory regions obtained from regions 5' to the structural R gene can be useful in directing the expression of genes, e.g., insect resistance, drought resistance, herbicide tolerance or other protein coding regions. For the purposes of the present invention, it is believed that any of the various R gene family members may be successfully employed (e.g., P, S, Fc, etc.). However, one that can be used is Sn (particularly Sn:bol3). Sn is a dominant member of the R gene complex and is functionally similar to the R and B loci in that Sn controls the tissue specific deposition of anthocyanin pigments in certain seedling and plant cells, therefore, its phenotype is similar to R.
[0099] A further screenable marker contemplated for use in the present invention is firefly luciferase, encoded by the lux gene. The presence of the lux gene in transformed cells may be detected using, for example, X-ray film, scintillation counting, fluorescent spectrophotometry, low-light video cameras, photon counting cameras or multiwell luminometry. It is also envisioned that this system may be developed for populationMSU: TEC2024-0055 PCT / / MVS: P15076WO01 screening for bioluminescence, such as on tissue culture plates, or even for whole plant screening.
[0100] Other Optional Sequences: An expression cassette of the invention can also further comprise plasmid DNA. Plasmid vectors include additional DNA sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic and eukaryotic cells, e.g., pUC-derived vectors such as pUC8, pUC9, pUC18, pUC19, pUC23, pUC119, and pUC120, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, or pBS-derived vectors. The additional DNA sequences include origins of replication to provide for autonomous replication of the vector, additional selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert DNA sequences or genes encoded in the expression cassette and sequences that enhance transformation of prokaryotic and eukaryotic cells.
[0101] Another vector that is useful for expression in both plant and prokaryotic cells is the binary Ti plasmid (as disclosed in Schilperoort et ah, U.S. Patent No. 4,940,838) as exemplified by vector pGA582. This binary Ti plasmid vector has been previously characterized by An (Methods in Enzymology.153:292 (1987)) and is available from Dr. An. This binary Ti vector can be replicated in prokaryotic bacteria such as E. coli and Agrobacterium. The Agrobacterium plasmid vectors can be used to transfer the expression cassette to dicot plant cells, and under certain conditions to monocot cells, such as rice cells. The binary Ti vectors preferably include the nopaline T DNA right and left borders to provide for efficient plant cell transformation, a selectable marker gene, unique multiple cloning sites in the T border regions, the co / El replication of origin and a wide host range replicon. The binary Ti vectors carrying an expression cassette of the invention can be used to transform both prokaryotic and eukaryotic cells but is preferably used to transform dicot plant cells.
[0102] In Vitro Screening of Expression Cassettes: Once the expression cassette is constructed and subcloned into a suitable plasmid, it can be screened for the ability to substantially inhibit the translation of an mRNA coding for a seed storage protein by standard methods such as hybrid arrested translation. For example, for hybrid selection or arrested translation, a preselected antisense DNA sequence is subcloned into an SP6 / T7 containing plasmidsMSU: TEC2024-0055 PCT / / MVS: P15076WO01 (as supplied by ProMega Corp.). For transformation of plants cells, suitable vectors include plasmids such as described herein. Typically, hybrid arrest translation is an in vitro assay that measures the inhibition of translation of an mRNA encoding a particular seed storage protein. This screening method can also be used to select and identify preselected antisense DNA sequences that inhibit translation of a family or subfamily of zein protein genes. As a control, the corresponding sense expression cassette is introduced into plants and the phenotype assayed.
[0103] DNA Delivery of the DNA Molecules into Host Cells: The present invention generally includes steps directed to introducing VInvIn2R nucleic acids into a recipient cell to create a transformed cell. In some instances, the frequency of occurrence of cells taking up exogenous (foreign) DNA may be low. Moreover, it is most likely that not all recipient cells receiving DNA segments or sequences will result in a transformed cell wherein the DNA is stably integrated into the plant genome and / or expressed. Some may show only initial and transient gene expression. However, certain cells from potato species may be stably transformed, and these cells regenerated into transgenic potato plants, through the application of the techniques disclosed herein.
[0104] Transformation of the cells of the plant tissue source can be conducted by any one of a number of methods known to those of skill in the art. Examples are:
[0105] Transformation by direct DNA transfer into plant cells by electroporation (U.S. Patent No.5,384,253 and U.S. Patent No.5,472,869, Dekeyser et ah, The Plant Cell.2:591-602 (1990)); direct DNA transfer to plant cells by PEG precipitation (Hayashimoto et al, Plant Physiol. 93:857-863 (1990)); direct DNA transfer to plant cells by microprojectile bombardment (McCabe et ah, Bio / Technology. 6:923-926 (1988); Gordon-Kamm et ah, The Plant Cell.2:603-618 (1990); U.S. Patent No.5,489,520; U.S. Patent No.5,538,877; and U.S. Patent No. 5,538,880) and DNA transfer to plant cells via infection with Agrobacterium. Methods such as microprojectile bombardment or electroporation can be carried out with “naked” DNA where the expression cassette may be simply carried on any E. coli-derived plasmid cloning vector. In the case of viral vectors, it is desirable that the system retain replication functions, but lack functions for disease induction.
[0106] One method for dicot transformation, for example, involves infection of plant cells with Agrobacterium tumefaciens using the leaf-disk protocol (Horsch et ak, Science 227:1229-MSU: TEC2024-0055 PCT / / MVS: P15076WO01 1231 (1985). Monocots such as Zea mays can be transformed via microprojectile bombardment of embryogenic callus tissue or immature embryos, or by electroporation following partial enzymatic degradation of the cell wall with a pectinase-containing enzyme (U.S. Patent No. 5,384,253; and U.S. Patent No. 5,472,869). For example, embryogenic cell lines derived from immature Zea mays embryos can be transformed by accelerated particle treatment as described by Gordon-Kamm et al. (The Plant Cell.2:603- 618 (1990)) or U.S. Patent No.5,489,520; U.S. Patent No.5,538,877 and U.S. Patent No. 5,538,880, cited above. Excised immature embryos can also be used as the target for transformation prior to tissue culture induction, selection and regeneration as described in U.S. application Serial No.08 / 112,245 and PCT publication WO 95 / 06128. Furthermore, methods for transformation of monocotyledonous plants utilizing Agrobacterium tumefaciens have been described by Hiei et al. (European Patent 0604662, 1994) and Saito et al. (European Patent 0672752, 1995).
[0107] Methods such as microprojectile bombardment or electroporation are carried out with “naked” DNA where the expression cassette may be simply carried on any E. coli-derived plasmid cloning vector. In the case of viral vectors, it is desirable that the system retain replication functions, but lack functions for disease induction.
[0108] The choice of plant tissue source for transformation will depend on the nature of the host plant and the transformation protocol. Useful tissue sources include callus, suspension culture cells, protoplasts, leaf segments, stem segments, tassels, pollen, embryos, hypocotyls, tuber segments, meristematic regions, and the like. The tissue source is selected and transformed so that it retains the ability to regenerate whole, fertile plants following transformation, i.e., contains totipotent cells. Type I or Type II embryonic maize callus and immature embryos are preferred Zea mays tissue sources. Similar tissues can be transformed for softwood or hardwood species. Selection of tissue sources for transformation of monocots is described in detail in U.S. Application Serial No.08 / 112,245 and PCT publication WO 95 / 06128.
[0109] The transformation is carried out under conditions directed to the plant tissue of choice. The plant cells or tissue are exposed to the DNA or RNA carrying the VInvIn2R nucleic acids for an effective period of time. This may range from a less than one second pulse of electricity for electroporation to a 2-3 days co-cultivation in the presence of plasmid-MSU: TEC2024-0055 PCT / / MVS: P15076WO01 bearing Agrobacterium cells. Buffers and media used will also vary with the plant tissue source and transformation protocol. Many transformation protocols employ a feeder layer of suspended culture cells (tobacco or Black Mexican Sweet corn, for example) on the surface of solid media plates, separated by a sterile filter paper disk from the plant cells or tissues being transformed.
[0110] Electroporation: Where one wishes to introduce DNA by means of electroporation, it is contemplated that the method of Krzyzek et al. (U.S. Patent No. 5,384,253) may be advantageous. In this method, certain cell wall-degrading enzymes, such as pectin- degrading enzymes, are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells. Alternatively, recipient cells can be made more susceptible to transformation, by mechanical wounding.
[0111] To effect transformation by electroporation, one may employ either friable tissues such as a suspension cell cultures, or embryogenic callus, or alternatively, one may transform immature embryos or other organized tissues directly. The cell walls of the preselected cells or organs can be partially degraded by exposing them to pectin-degrading enzymes (pectinases or pectolyases) or mechanically wounding them in a controlled manner. Such cells would then be receptive to DNA uptake by electroporation, which may be carried out at this stage, and transformed cells then identified by a suitable selection or screening protocol dependent on the nature of the newly incorporated DNA.
[0112] Microprojectile Bombardment: A further advantageous method for delivering transforming DNA segments to plant cells is microprojectile bombardment. In this method, microparticles may be coated with DNA and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like.
[0113] It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. In an illustrative embodiment, non-embryogenic BMS cells were bombarded with intact cells of the bacteria E. coli or Agrobacterium tumefaciens containing plasmids with either the b-glucoronidase or bar gene engineered for expression in maize. Bacteria were inactivated by ethanol dehydration prior to bombardment. A low level of transient expression of the b-glucoronidase gene was observed 24-48 hours following DNA delivery. In addition, stable transformants containing the bar gene were recoveredMSU: TEC2024-0055 PCT / / MVS: P15076WO01 following bombardment with either E. coli or Agrobacterium tumefaciens cells. It is contemplated that particles may contain DNA rather than be coated with DNA. Hence it is proposed that particles may increase the level of DNA delivery but are not, in and of themselves, necessary to introduce DNA into plant cells.
[0114] The microprojectile bombardment is an effective means of reproducibly stably transforming monocots that avoids the need to prepare and isolate protoplasts (Christou et al., PNAS.84:3962-3966 (1987)), avoids the formation of partially degraded cells, and the susceptibility to Agrobacterium infection is not required. An illustrative embodiment of a method for delivering DNA into maize cells by acceleration is a Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with maize cells cultured in suspension (Gordon-Kamm et al., The Plant Cell. 2:603-618 (1990)). The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectile aggregate and may contribute to a higher frequency of transformation, by reducing damage inflicted on the recipient cells by an aggregated projectile.
[0115] For bombardment, cells in suspension are preferably concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate. If desired, one or more screens are also positioned between the acceleration device and the cells to be bombarded. Using techniques set forth herein, one may obtain up to 1000 or more foci of cells transiently expressing a marker gene. The number of cells in a focus which express the exogenous gene product 48 hours post-bombardment often range from about 1 to 10 and average about 1 to 3.
[0116] In bombardment transformation, one may optimize the prebombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment can influence transformation frequency. Physical factors are those that involve manipulating the DNA / microprojectile precipitate or those that affect the path and velocity of either theMSU: TEC2024-0055 PCT / / MVS: P15076WO01 macro- or microprojectiles. Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearized DNA or intact supercoiled plasmid DNA.
[0117] One may wish to adjust various bombardment parameters in small scale studies to fully optimize the conditions and / or to adjust physical parameters such as gap distance, flight distance, tissue distance, and helium pressure. One may also minimize the trauma reduction factors (TRFs) by modifying conditions which influence the physiological state of the recipient cells and which may therefore influence transformation and integration efficiencies. For example, the osmotic state, tissue hydration and the subculture stage or cell cycle of the recipient cells may be adjusted for optimum transformation. Execution of such routine adjustments will be known to those of skill in the art.
[0118] An Example of Production and Characterization of Stable Transgenic Plants: After effecting delivery of a VInvIn2R nucleic acid to recipient cells by any of the methods discussed above, the transformed cells can be identified for further culturing and plant regeneration. As mentioned above, to improve the ability to identify transformants, one may desire to employ a selectable or screenable marker gene as, or in addition to, the VInvIn2R nucleic acids. In this case, one would then generally assay the potentially transformed cell population by exposing the cells to a selective agent or agents, or one would screen the cells for the desired marker gene trait.
[0119] Selection: An exemplary embodiment of methods for identifying transformed cells involves exposing the bombarded cultures to a selective agent, such as a metabolic inhibitor, an antibiotic, herbicide or the like. Cells which have been transformed and have stably integrated a marker gene conferring resistance to the selective agent used, will grow and divide in culture. Sensitive cells will not be amenable to further culturing.
[0120] To use the har-bialaphos or the EPSPS-glyphosate selective system, bombarded tissue is cultured for about 0-28 days on nonselective medium and subsequently transferred to medium containing from about 1-3 mg / 1 bialaphos or about 1-3 mM glyphosate, as appropriate. While ranges of about 1-3 mg / 1 bialaphos or about 1-3 mM glyphosate can be employed, it is proposed that ranges of at least about 0.1-50 mg / 1 bialaphos or at least about 0.1-50 mM glyphosate will find utility in the practice of the invention. Tissue can beMSU: TEC2024-0055 PCT / / MVS: P15076WO01 placed on any porous, inert, solid or semi solid support for bombardment, including but not limited to filters and solid culture medium. Bialaphos and glyphosate are provided as examples of agents suitable for selection of transformants, but the technique of this invention is not limited to them.
[0121] An example of a screenable marker trait is the red pigment produced under the control of the R-locus in maize. This pigment may be detected by culturing cells on a solid support containing nutrient media capable of supporting growth at this stage and selecting cells from colonies (visible aggregates of cells) that are pigmented. These cells may be cultured further, either in suspension or on solid media. The R-locus is useful for selection of transformants from bombarded immature embryos. In a similar fashion, the introduction of the Cl and B genes will result in pigmented cells and / or tissues.
[0122] The enzyme luciferase is also useful as a screenable marker in the context of the present invention. In the presence of the substrate luciferin, cells expressing luciferase emit light which can be detected on photographic or X-ray film, in a luminometer (or liquid scintillation counter), by devices that enhance night vision, or by a highly light sensitive video camera, such as a photon counting camera. All of these assays are nondestructive and transformed cells may be cultured further following identification. The photon counting camera is especially valuable as it allows one to identify specific cells or groups of cells which are expressing luciferase and manipulate those in real time.
[0123] It is further contemplated that combinations of screenable and selectable markers may be useful for identification of transformed cells. For example, selection with a growth inhibiting compound, such as bialaphos or glyphosate at concentrations below those providing 100% inhibition followed by screening of growing tissue for expression of a screenable marker gene such as luciferase would allow one to recover transformants from cell or tissue types that are not amenable to selection alone. In an illustrative embodiment embryogenic Type II callus of Zea mays L. can be selected with sub-lethal levels of bialaphos. Slowly growing tissue was subsequently screened for expression of the luciferase gene and transformants can be identified.
[0124] Regeneration and Seed Production: Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, are cultured in media that supports regeneration of plants. One example of a growth regulator that can be usedMSU: TEC2024-0055 PCT / / MVS: P15076WO01 for such purposes is dicamba or 2,4-D. However, other growth regulators may be employed, including NAA, NAA + 2,4-D or perhaps even picloram. Media improvement in these and like ways can facilitate the growth of cells at specific developmental stages. Tissue can be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration, at least two weeks, then transferred to media conducive to maturation of embryoids. Cultures are typically transferred every two weeks on this medium. Shoot development signals the time to transfer to medium lacking growth regulators.
[0125] The transformed cells, identified by selection or screening and cultured in an appropriate medium that supports regeneration, can then be allowed to mature into plants. Developing plantlets are transferred to soilless plant growth mix, and hardened, e.g., in an environmentally controlled chamber at about 85% relative humidity, about 600 ppm CO2, and at about 25-250 microeinsteins / sec-m of light. Plants can be matured either in a growth chamber or greenhouse. Plants are regenerated from about 6 weeks to 10 months after a transformant is identified, depending on the initial tissue. During regeneration, cells are grown on solid media in tissue culture vessels. Illustrative embodiments of such vessels are petri dishes and Plant Con™. Regenerating plants can be grown at about 19 °C to 28 °C. After the regenerating plants have reached the stage of shoot and root development, they may be transferred to a greenhouse for further growth and testing.
[0126] Mature plants are then obtained from cell lines that are known to express the trait. In some embodiments, the regenerated plants are self-pollinated. In addition, pollen obtained from the regenerated plants can be crossed to seed grown plants of agronomically important inbred lines. In some cases, pollen from plants of these inbred lines is used to pollinate regenerated plants. The trait is genetically characterized by evaluating the segregation of the trait in first and later generation progeny. The heritability and expression in plants of traits selected in tissue culture are of interest if the traits are to be commercially useful.
[0127] Regenerated plants can be repeatedly crossed to inbred plants to introgress the VInvIn2R nucleic acids into the genome of the inbred plants. This process is referred to as backcross conversion. When a sufficient number of crosses to the recurrent inbred parent have been completed to produce a product of the backcross conversion process that isMSU: TEC2024-0055 PCT / / MVS: P15076WO01 substantially isogenic with the recurrent inbred parent except for the presence of the introduced VInvIn2R nucleic acids, the plant is self-pollinated at least once to produce a homozygous backcross converted inbred containing the RFS nucleic acids. Progeny of these plants are true breeding.
[0128] Alternatively, seed from transformed monocot plants regenerated from transformed tissue cultures is grown in the field and self-pollinated to generate true breeding plants.
[0129] Seed from the fertile transgenic plants can then be evaluated for the presence and / or expression of the VInvIn2R nucleic acid. Transgenic plant and / or seed tissue can be analyzed for VInvIn2R transcriptional enhancement using standard methods such as SDS polyacrylamide gel electrophoresis, liquid chromatography (e.g., HPLC) or other means of detecting a product of RFS activity (e.g., increased glucan content and / or good growth).
[0130] Once a transgenic seed containing the VInvIn2R nucleic acid sequence and having a reduced expression of VInv protein is identified, the seed can be used to develop true breeding plants. The true breeding plants are used to develop a line of plants with a reduced CIS while still maintaining other desirable functional agronomic traits. Adding the trait of reduced CIS and normal growth of the plant can be accomplished by back-crossing with this trait and with plants that do not exhibit this trait and studying the pattern of inheritance in segregating generations. Those plants expressing the target trait in a dominant fashion are preferably selected.
[0131] Back-crossing is carried out by crossing the original fertile transgenic plants with a plant from an inbred line exhibiting desirable functional agronomic characteristics while not necessarily expressing the trait of reduced CIS. The resulting progeny are then crossed back to the parent that expresses the increased reduced CIS trait. The progeny from this cross will also segregate so that some of the progeny carry the trait and some do not. This back-crossing is repeated until an inbred line with the desirable functional agronomic traits, and with expression of the trait involving reduced CIS. Such expression of reduced CIS can be expressed in a dominant fashion.
[0132] Determination of Stably Transformed Plant Tissues: To confirm the presence of the VInvIn2R nucleic acids in the regenerating plants, or seeds or progeny derived from the regenerated plant, a variety of assays may be performed. Such assays include, for example, molecular biological assays available to those of skill in the art, such as Southern andMSU: TEC2024-0055 PCT / / MVS: P15076WO01 Northern blotting and PCR; biochemical assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf, seed or root assays; and also, by analyzing the phenotype of the whole regenerated plant.
[0133] Whereas DNA analysis techniques may be conducted using DNA isolated from any part of a plant, RNA may only be expressed in particular cells or tissue types and so RNA for analysis can be obtained from those tissues. PCR techniques may also be used for detection and quantification of RNA produced from introduced VInvIn2R nucleic acids. PCR also be used to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then this DNA can be amplified by use of conventional PCR techniques. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and give information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and also demonstrate the presence or absence of an RNA species.
[0134] While Southern blotting and PCR may be used to detect the RFS nucleic acid in question, they do not provide information as to whether the preselected DNA segment is being expressed. Expression may be evaluated by specifically identifying the protein products of the introduced RFS nucleic acids or evaluating the phenotypic changes brought about by their expression.
[0135] Assays for the production and identification of specific proteins may make use of physical-chemical, structural, functional, or other properties of the proteins. Unique physical-chemical or structural properties allow the proteins to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focusing, or by chromatographic techniques such as ion exchange, liquid chromatography or gel exclusion chromatography. The unique structures of individual proteins offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as Western blotting in which antibodies are used to locate individual gene products that have been separated by electrophoretic techniques.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0136] The expression of a gene product can also be determined by evaluating the phenotypic results of its expression. These assays also may take many forms including but not limited to analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Chemical composition may be altered by expression of preselected DNA segments encoding storage proteins which change amino acid composition and may be detected by amino acid analysis.
[0137] The following non-limiting Examples illustrate how aspects of the technology have been developed and can be made and used. Additional embodiments of the disclosure reside in specific examples and data described in more detail herein. Examples
[0138] Example 1: Materials and Methods
[0139] This example describes some of the materials and methods used in developing the technology.
[0140] 1. Enhancer validation using transgenic assays in potato.
[0141] An intronic DHS within intron 2 of VInv gene was identified from the DHS data published previously (Zeng et al., 2019). The entire intron 2 from the VInv gene of RH potato was used for enhancer validation using a GUS reporter system (Zhu et al., 2015). The forward (VInvIn2) and reverse (VInvIn2R) sequences of intron 2 were amplified from genomic DNA of RH potato using PCR with primers VIT-F6 / R6 and VIT-F8 / R8 (Table 1), respectively, and were subsequently cloned into pKGWFS 7.0 vector containing a minimal 35S promoter (-50 to - 2 bp) (mini35S) and the GUS reporter (Zhu et al., 2015). Constructs were transferred into Agrobacterium tumefaciens strain GV3101 (pMP90), followed by transformation of potato variety Katahdin using methods described previously (Bhaskar et al., 2008; Bhaskar et al., 2010).
[0142] Table 1. Primers for GUS reporter, CRISPR / Cas-based genome editing, and splicing.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 Gene / Prime pair Forward primer Reverse primer Product Detection (5'-3') (5'-3') length VInvIn2-VIT-F6 / R6caccGTGAGTTCAAAGTCggaattcCTGTTGACCAA 1339 bp p p p 40MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0143] Twenty transgenic Katahdin lines derived from the forward or reverse construct were obtained and screened using PCR with the kanamycin gene-specific primers Kan-F / R and the construct-specific primers (Table 1). All transgenic lines were grown in greenhouses using photoperiod of 16-h daylight at 22°C and 8-h darkness at 16°C (50%-70% humidity), and light intensity of 500 μmol m-2 s-1 until leaves became senesced naturally. Tubers harvested from each line were divided into two groups. Each group was stored in dark at RT (22°C, 50%-70% humidity) and cold condition (4°C, 60%-70% humidity) for 4 weeks, respectively. Tuber slices prepared by slicing longitudinal sections 2-mm thick from the center of individual tubers were examined for GUS activity. Tuber slices were placed in a plastic plate (70 x 15 mm) and soaked in GUS-staining solution (100 mM sodium phosphate, pH 7.0, 10 mM EDTA, 0.1% [v / v] Triton X-100, 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferricyanide, and 0.05% [w / v] XGluc), with vacuum infiltration for 30 min and incubation in dark at 37°C overnight. Tuber slices were washed in 80% ethanol several times. Images of tuber slices were captured using an EPSON Perfection 4180 scanner.
[0144] 2. Enhancer dissection using transgenic assays in A. thaliana.
[0145] Seeds of A. thaliana ecotype Col-0 were germinated in one-half-strength Murashige and Skoog (0.5 x MS) medium, and the seedlings were transplanted in potting soil and grown in greenhouses with 16 / 8 h light / dark cycles at 23°C and light intensity of 150 μ mol m-2 s-1 until flowering. The VInvIn2 and VInvIn2R constructs were initially used to transform A. thaliana ecotype Col-0 using the floral dip method (Clough and Bent, 1998). Transgenic seedlings were screened on solid 0.5 x MS medium containing kanamycin (50 μg mL-1) and were grown in an illumination incubator with the same light-dark condition described above and were examined for GUS activity according to published potocols (Zhu et al., 2015).
[0146] To map the position of the enhancer within the intron 2 of VInv, we divided the intron 2 into ten DNA fragments (#1 to #10) using five breaks (b1 to b5) for transgenic assays. The stem / petiole-specific enhancer (within DNA fragment #11) was further divided into 14 (#11 to #24) sub-fragments. All target DNA fragments were synthesized from GenScriptMSU: TEC2024-0055 PCT / / MVS: P15076WO01 Inc. and cloned into the pKGWFS 7.0 vector containing the mini35S and the GUS reporter gene (Zhu et al., 2015). Images of transgenic A. thaliana seedlings were captured using the EPSON Perfection 4180 scanner to record the GUS signals.
[0147] 3. Analysis of TF-binding motifs.
[0148] TF-binding motifs and their corresponding TFs within intron 2 of VInv were identified using two independent programs of CIS-BP (Weirauch et al., 2014) and PlantPAN 3.0 (Chow et al., 2019) with default parameters. DNA motifs consistently detected by both programs were used for further analysis. Motifs reported to be associated with cold response in one or multiple plant species were mapped to the intron 2 of VInv using Tbtools (Chen et al., 2020).
[0149] 4. Development of CRISPR / Cas deletion lines.
[0150] A self-compatible diploid potato clone DMF5-73-1 was developed from a cross between S. tuberosum Gp. Phureja DM 1-3 516 R44 (DM1-3) and S. chacoense (M6) (Endelman and Jansky, 2016) and has been self-pollinated for five generations. Wild type (WT) and CRISPR / Cas lines were propagated in vitro on Murashige and Skoog (MS) medium (MS basal salts plus vitamins, 3% sucrose, 0.7% plant agar, pH 5.8) (Murashige and Skoog, 1962). In vitro plants were maintained in growth chambers with 16-h-light / 8- h-dark photoperiod at 22°C and average light intensity of 200 μmoles m-2s-1.
[0151] The Csy4-based CRISPR / Cas9 system (Cermak et al., 2017) was used to develop VInvIn2En deletion lines in DMF5-73-1. In brief, five sgRNAs flanking VInvIn2En (1a, 2a, 3a, 1b and 2b) and a single sgRNA (3b) targeting VInvIn2En (Table 2) were designed using program of CRISPR-P v2.0 (Liu et al., 2017). The six gRNAs were linked by Csy4 binding sites and then cloned into the Csy4 multiplexing vector based on published methods (Cermak et al., 2017). The construct was delivered into A. tumefaciens GV3101 (pMP90) and was used to conduct hairy root-based Agrobacterium transformation (Butler et al., 2020). T0 CRISPR / Cas lines showing the expected smaller PCR products were further confirmed by Sanger sequencing using VInv-mut-F1 / R1 primers (Table 1). Several T0 lines with large deletion of VInvIn2En were grown under greenhouse conditions asMSU: TEC2024-0055 PCT / / MVS: P15076WO01 described above, followed by subsequent self-pollination to obtain homozygous T1 deletion lines.
[0152] A tetraploid potato cultivar Katahdin was used to develop deletion lines using the U3 / U6- based CRISPR / Cas9 system (Hu et al., 2019). Four sgRNAs, including R1 outside of VInvIn2En, R2, R3, and R4 inside the VInvIn2En (Table 2), were designed using CRISPR-P v2.0 (Liu et al., 2017). The sgRNAs were assembled into four expression cassettes (AtU3b:gRNA1, AtU3d:gRNA2, AtU6-29:gRNA3, and AtU6-29:gRNA4), which were cloned into the pHNCas9 vector by using the Golden Gate cloning strategy (Ma et al., 2015; Xie et al., 2015; Ma et al., 2016; Hu et al., 2019). The construct pHNCas9::VInvIn2En was introduced into A. tumefaciens GV3101 (pMP90) and was used to transform Katahdin according to published protocols (Bhaskar et al., 2008). Positive transformants were screened using PCR with primers Kan-F3 / R3, Cas-F1 / R1, and VInv- Edit-F / R (Table 1). Transgenic lines containing additional smaller bands (2% agarose gel) were further confirmed by Sanger sequencing. PCR products were purified by using QIAquick PCR Purification Kit (Qiagen) and were cloned into E. coli using pMDTM19-T vector (TaKaRa). A minimum of 60 randomly selected positive colonies derived from each deletion line were fully sequenced. Statistical analysis of different types of deletions was conducted on each of the Katahdin CRISPR / Cas deletion lines containing three haplotypes, A (2 copies), B, and C.
[0153] Table 2: sgRNA used in CRISPR / Cas experiments sgRNA Name SEQ ID NO: sgRNA Sequence (5’-3’) 133GATTGGAGGTAGTACTAATTAGGTTGAGGGGGTGGGCT
[0154] 5. Greenhouse trials, tuber sample preparation, and chipping analysis.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0155] Each of 10 seed tubers of RH potato was planted in potting soil under normal greenhouse conditions as described above. Standard cultivation and management practices were followed throughout the growing period. Tubers were harvested 120 days after seedling emergence when leaves senesced naturally. Tubers harvested from two pots were combined together as one biological replicate. Tubers of five biological replicates were stored in dark at RT (22°C, 50%-70% humidity) for 10 d and then divided into two groups. Each group was stored in dark at RT (22°C, 50%-70% humidity) and cold (4°C, 60%-70% humidity) for 0, 2, 4, 8, and 16 weeks, respectively.
[0156] Three T0 CRISPR / Cas deletion lines (three plants for each line) developed from Katahdin were grown under normal greenhouse conditions as described above. Tubers harvested from the same line were combined together and stored under dark at room temperature (RT, 22°C) for 10 days, and then divided into two groups for RT (22°C, 50%- 70% humidity) and cold (4°C, 60%-70% humidity) treatments, and each group of tubers with three replicates were treated for 2 and 4 weeks, respectively.
[0157] Tuber samples of 1.5-mm thick slices (1-3 slices for each tuber) prepared from apical to basal end of the tuber were taken for chipping analysis. The remaining tuber samples were frozen in liquid nitrogen and used for analysis of VInv expression. Tuber slices were fried in cottonseed oil at 191°C for 2 min or until the cessation of bubbles. Chip color of cold-stored tubers is compared to that of the corresponding controls.
[0158] 6. VInv transcription and splicing assays.
[0159] RNAs were extracted from tuber tissues using Plant RNA Isolation Mini Kit (Agilent) following the manufacturer’s instructions and were reverse transcribed to cDNAs using Invitrogen SuperScript™ III Reverse Transcriptase Kit (Invitrogen) with oligo(dT)20 primer. VInv transcripts were quantified by quantitative real time-PCR (qRT-PCR) using the SYBR Advantage qPCR Premix (Clontech) with the specific primers for VInv and the reference gene Actin97 described previously (Zhu et al., 2014; Zhu et al., 2016). qRT-PCR was performed on the CFX96 TouchTMReal-Time PCR Detection System (Bio-Rad) with a program of 30 s at 95°C, 40 cycles of 10 s at 95°C, 20 s at 60°C for VInv and Actin97, and 30 s at 72°C, followed by a plate read. Then 2s at 50°C to 95°C with 0.2°C steps for melting curve, followed by a final extension step of 10 min at 72°C. Relative expressionMSU: TEC2024-0055 PCT / / MVS: P15076WO01 levels of VInv gene were calculated using Gene Expression Macro software version 1.1 (Bio-Rad Laboratories). Data for each treatment are presented as standard error (SE) of means of the three biological replicates. Analyses of variance (ANOVA) were carried out using PROC GLM in the Statistical Analysis System version 9.1 (SAS v9.1) (SAS Institute Inc, Cary, NC).
[0160] To examine whether VInvIn2En deletions affect VInv gene splicing, we prepared cDNAs from tuber tissues of the three Katahdin CRISPR / Cas lines. Exon 1 to exon 3 of VInv was amplified using primers Splicing-F / R (Table 1, amplicon size: 612 bp). The RT- PCR products 16 -were purified by using QIAquick PCR Purification Kit (Qiagen) and then used for Sanger sequencing.
[0161] 7. Analysis of VInv evolution.
[0162] A total of 28 Solanaceous species (https: / / solgenomics.net / ) (Tang et al., 2022) and several other dicot species, including A. thaliana, cucumber (C. sativus), and soybean (G. max), were selected for evolutionary analysis of the VInv gene. Information on evolutionary timescale of life for all 31 species were collected from the TimeTree 5 database (http: / / www.timetree.org / ) (Kumar et al., 2022) and visualized in MEGA X software (Kumar et al., 2018).
[0163] Protein sequences of VInv gene from the 31 different plant species were extracted and aligned to that from RH potato using the NCBI BLASTp program (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The intron and exon composition of the VInv gene from 31 plant species were analyzed using the online tool GSDS 2.0 (Hu et al., 2015). The 1327-bp intron 2 and the 200-bp VInvIn2En sequences from RH were used to align the intron 2 sequences from other 30 species to identify homologous sequences using program of NCBI BLASTn.
[0164] Example 2: Discovery of a cold-responsive intronic enhancer within VInv gene
[0165] Genomic regions containing active cis-regulatory elements (CREs), such as promoters and transcriptional enhancers, can be identified as DNase I hypersensitive sites (DHSs) (Zhang et al.2012; Jiang 2015; Zhao et al.2018). We previously developed genome-wide DHS maps in DM1-3 potato using chromatin isolated from tuber tissue (Zeng et al.2019).MSU: TEC2024-0055 PCT / / MVS: P15076WO01 DM1-3 is a homozygous diploid clone and was developed from chromosome doubling of a monoploid derived from an S. tuberosum Phureja Group clone (Mribu and Veilleux 1990; Paz and Veilleux 1999) and has been fully sequenced (2n = 2x = 24) (The Potato Genome Sequencing Consortium 2011; Pham et al. 2020). We detected a 475 bp DHS within the second intron of VInv (Fig.1A), suggesting that this intron may play a role in the regulation of the expression of VInv. We have recently demonstrated the enhancer function of several intronic DHSs in Arabidopsis (Arabidopsis thaliana) (Meng et al.2021).
[0166] To confirm its cis-regulatory function, we cloned the entire VInv second intron (1,327 bp) from RH potato, which is a heterozygous diploid clone (van Os et al. 2006) and has recently been fully sequenced (Zhou et al.2020). RH is susceptible to CIS. The intron was cloned into the pKGWFS 7.0 vector containing a minimal 35S promoter (−50 to −2 bp) (m35S) and the β-glucuronidase (GUS) reporter gene (Zhu et al.2015). ‘Katahdin,’ a CIS- susceptible tetraploid cultivar (Bhaskar et al. 2010), was used for transformation. We developed 20 transgenic ‘Katahdin’ lines from the intron construct (VInvIn2) and 20 lines from a reverse construct (VInvIn2R) in which the sequence orientation of the cloned intron is reversed. We detected minimal GUS signals in transgenic tubers stored at room temperature (22 °C). In contrast, substantially enhanced GUS signals were detected in the transgenic tubers after 4 wks of cold storage (4 °C) (Fig. 1B). These results indicate that intron 2 of VInv contains an enhancer that is responsible for its cold-induced expression.
[0167] Example 3: Dissection of intronic enhancers via reporter gene assays in A. thaliana
[0168] Since the entire intron 2 from RH potato was used for GUS reporter assays, the precise size and position of the predicted enhancer within intron 2 could not be determined. We attempted to fine-map the enhancer using reporter gene assay in A. thaliana. We first examined the GUS signal profiles of transgenic A. thaliana plants using the VInvIn2 and VInvIn2R constructs. Consistent and strong GUS signals were detected in stems and petioles in transgenic plants derived from both constructs. In addition, relatively weak and sporadic GUS signals were also detected in roots (Fig.2C). The VInv gene is expressed at relatively high levels in several nontuber tissues of potato, including both petiole and stem (The Potato Genome Sequencing Consortium 2011; Zhou et al. 2020). Thus, the GUSMSU: TEC2024-0055 PCT / / MVS: P15076WO01 signal patterns observed in the transgenic A. thaliana plants correspond well with the VInv expression patterns in potato tissues.
[0169] We next divided the 1,327 bp intron 2 into 10 DNA fragments (#1 to #10) using 5 breaks (b1 to b5; Fig.2A). Each fragment was ligated to the m35S promoter and cloned into the pKGWFS 7.0 vector. Transgenic plants derived from DNA fragments #1, #2, #9, and #10 showed strong GUS signals in stems and petioles, which were similar to the transgenic plants developed from the VInvIn2 and VInvIn2R constructs. Similar but weaker signals were detected from transgenic plants derived from fragment #8 (Fig. 2D). These results indicated that the enhancer driving GUS expression in stems and petioles is located between b2 and b4, which was named fragment #11 (Fig.2B).
[0170] We next further divided the 600 bp fragment #11 into 13 subfragments (#12 to #24; Fig.2B) for GUS reporter assays. Transgenic plants derived from construct #21 (200 bp) showed strong GUS signals in stems and petioles. In contrast, transgenic plants derived from constructs #17 and #19 did not show GUS signals (Fig.2E). Thus, the core enhancer in intron 2 was mapped within the 200 bp #21 sequence and was named as VInvIn2En thereafter. VInvIn2En spans 678 to 877 bp in the intron and is located within the 475 bp DHS, which spans 597 to 1,071 bp in the intron (Fig.1A).
[0171] To confirm the function of VInvIn2En in potato, we developed transgenic lines using a VInvIn2En-m35S-GUS construct in ‘Katahdin’ potato. We detected minimal GUS signals in tubers stored at room temperature (22 °C) but strong GUS signals in cold-stored tubers (4 °C) from 3 independent transgenic lines (Fig.2F). Thus, the VInvIn2En sequence retains the same function as the entire intron 2 in potato (Fig.1B).
[0172] Example 4: Identification of DNA motifs related to VInvIn2En function
[0173] We speculated that VInvIn2En contains DNA motifs bound by TFs involved in plant response to cold stress. We identified putative DNA motifs related to a total of 15 TFs in the intron 2 sequence of RH (Zhou et al.2020). These motifs were consistently detected by 2 independent programs using both CIS-BP (Weirauch et al.2014) and PlantPAN 3.0 (Chow et al. 2019). Interestingly, 10 of these 15 TFs were previously reported to be associated with responses to cold stress in 1 or multiple plant species (Fig.3A), including AT-hook (Dahro et al.2022), C2H2 ZF (He et al.2019), MADS-box (Chen et al.2019),MSU: TEC2024-0055 PCT / / MVS: P15076WO01 NAC / NAM (Li et al.2016), bHLH (Xie et al.2012), CBF / NF-Y (Zhou et al.2022; Zhang et al.2023), Bzip (Liu et al.2018; Li et al.2022b), B3 (Verma and Bhatia 2019), TCP (Li et al.2022a), and GATA (Zhang et al.2021).
[0174] Several TF motifs were enriched in the 200 bp VInvIn2En, including bHLH and CBF / NF-Y. In addition, motifs related to TCP and GATA were found only in the 200 bp enhancer region (Fig.3A). We designed mutated versions of VInvIn2En to test the function of the DNA motifs related to B3, bHLH, CBF / NF-Y, TCP, and GATA. In each construct, the target motif(s) were mutated by replacing 1 to 3 nucleotide(s) within the sequence (Fig. 3B, Table 3). Transgenic A. thaliana plants using VInvIn2En with a mutated B3 motif showed similar GUS signal patterns as those from wild-type (WT) VInvIn2En. Reduced GUS signals were detected from transgenic plants using VInvIn2En with 2 mutated bHLH motifs. In contrast, we did not detect any GUS signals from transgenic plants derived from the 3 constructs with mutated motifs related to CBF / NF-Y, TCP, and GATA. Most strikingly, a single-nucleotide mutation within the GATA motif resulted in a complete loss of function of the VInvIn2En enhancer (Fig.3B). These results indicated that CBF / NF-Y, TCP, and GATA all play important roles for VInvIn2En driving GUS expression in stems and petioles.
[0175] Table 3: Sequences and mutated nucleotides within the 200-bp VInvIn2En of SEQ ID NO: 1. Target Motif Position within Original sequence (5’-3’) Mutated sequence (5’-3’) VInvIn2En (b )MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0176] Example 5: Genome editing of VInvIn2En in diploid potato
[0177] The in vivo function of a predicted enhancer can be validated by mutation or deletion using genome editing (Meng et al.2021; Zhao et al.2022; Fang et al.2023). We attempted to develop VInvIn2En deletion lines in potato to validate its in vivo function. We first conducted CRISPR / Cas experiments using a self-compatible diploid clone DMF5-73-1. This clone was self-pollinated for 5 generations from a self-compatible diploid hybrid DM1-3 × M6 (Endelman and Jansky 2016). DMF5-73-1 is amenable to Agrobacterium- mediated transformation (Butler et al.2020). Five sgRNAs flanking VInvIn2En (1a (SEQ ID NO:37), 2a (SEQ ID NO:38), 3a (SEQ ID NO:39), 1b (SEQ ID NO:42), and 2b (SEQ ID NO:41)) and a single sgRNA (3b (SEQ ID NO:40)) targeting VInvIn2En (Fig. 4A, Table 2) were designed and assembled into a single construct. Primary transformants were generated using a hairy root-based procedure to create stable CRISPR / Cas mutants in the first generation (T0) (Butler et. al.2020). T0 events carrying targeted deletions were self- pollinated, and the progeny were screened for homozygous mutations (T1). We identified 3 homozygous T1 deletion lines (Fig. 4B). Two lines, 13-1-3 and 13-2-1, were derived from the same hairy root culture. Sequencing analysis showed that deletion line 2-2-8 lost 369 bp, including the entire 200 bp VInvIn2En. Lines 13-1-3 and 13-2-1 lost 394 bp, including the first 122 bp of VInvIn2En (Fig. 6B), which spans the GATA and the 3 CBF / NF-Y motifs.
[0178] DMF5-73-1 is not susceptible to CIS and expresses a weak CIS genotype. Tubers harvested from the three deletion lines were stored at 12.8°C for 6 weeks followed by at 6.7°C for nine additional weeks, a storage procedure used to maximize the CIS phenotype. Tuber tissues were then sampled for RNA extraction and qRT-PCR analysis. We found that the expression of VInv gene was reduced by 54% for 2-2-8, 45% for 13-1-3, and 41% for 13-2-1, respectively, compared to the wild-type DMF5-73-1 (Fig.4C). However, it was challenging to perform chipping analysis from the deletion lines because all three lines have small tubers and are associated with the “jelly end” defect derived from the parental clone DM1-3 (Endelman and Jansky, 2016) (Fig. 4D). Nevertheless, potato chips processed from cold-stored tubers of line 13-1-3 showed a lighter color compared to those processed from wild-type DMF5-73-1 (Fig.4D).MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0179] Example 6: Genome editing of VInvIn2En in tetraploid potato
[0180] DMF5-73-1 is ideal for CRISPR / Cas experiments due to its self- compatibility that allows for identification of homozygous deletions. However, DMF5-73-1 is not an ideal line to accurately evaluate the impact of VInvIn2En on CIS since it is resistant to CIS and has poor tuber traits. In addition, DMF5-73-1 retains a significant level of heterozygosity. Hence, the homozygous deletion lines developed from this clone are phenotypically different from the parental DMF5-73-1 (Fig. 4D). We next attempted to conduct CRISPR / Cas experiments in ‘Katahdin,’ a tetraploid potato cultivar that is highly susceptible to CIS (Bhaskar et al.2010). We first amplified and sequenced intron 2 of VInv from ‘Katahdin.’ We identified 3 haplotypes: A (2 copies), B, and C. These haplotypes are differentiated by SNPs and small indels, including those within the VInvIn2En region (Fig. 7). We designed 4 sgRNAs, including R1 outside of VInvIn2En and R2, R3, and R4 inside the VInvIn2En boundary (Fig.4A, Fig.7, Table 2). The 4 sgRNAs were assembled into a single construct for CRISPR / Cas experiments.
[0181] We identified 3 different T0 CRISPR / Cas9 lines, KV78, KV87, and KV108. PCR amplifications using primers VInv-Edit-F / R that span the 4 sgRNAs (Fig. 7, Table 1) produced additional smaller bands as well as the WT band (Fig.4E), suggesting that all 3 T0 lines contain both intact and deleted intron 2, possibly derived from different lineages of cells. We then isolated and mixed all DNA fragments visible mixed DNA fragments were cloned, and a minimum of 60 randomly selected clones from each line were fully sequenced. Sequence analysis confirmed that each of the 3 T0 lines contained different types of deletions within VInvIn2En, ranging from 3 to 124 bp deletions within VInvIn2En associated with haplotype A and 1 to 15 bp deletions within VInvIn2En associated with haplotype B. However, no deletions were detected in VInvIn2En associated with haplotype C, probably due to the SNPs located in the PAM sequences downstream of sgRNAs R2 and R3. Based on the number of individual sequences related to VInvIn2En, 67.7% of the haplotype A sequences from KV78 contained a deletion ranging from 4 to 97 bp; 64.7% of the haplotype A sequences from KV87 contained a deletion of 3 to 64 bp; 59.3% of the haplotype A sequences from KV108 contained a 4 to 124 bp deletion (Fig.8).MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0182] We amplified the cDNAs of VInv from the 3 CRISPR / Cas lines using primers Splicing- F / R spanning exons 1 to 3 (Table 1). Sequencing of the PCR products showed that the transcripts from the 3 CRISPR / Cas lines were identical to those from WT ‘Katahdin’ (Fig. 4F). Thus, the deletions occurred in VInvIn2En did not affect the splicing of the VInv gene. We next analyzed the expression of the VInv gene in the 3 CRISPR / Cas lines using RNAs isolated from tubers stored for 2 wks under 22 °C and 4 °C, respectively. A similar and minimal level of VInv expression was observed in 22 °C- stored tubers from WT ‘Katahdin’ and all 3 CRISPR / Case lines. In contrast, the expression level of VInv in 4 °C-stored tubers of the 3 CRISPR / Cas lines was only 6.6%, 16.4%, and 27.3%, respectively, of the WT ‘Katahdin’ (Fig.4G). Potato chipping was performed using tubers stored under 22 °C and 4 °C, respectively. Potato chips processed from tubers stored under 22 °C showed a similar color from all 3 lines as well as WT ‘Katahdin’ (Fig.9). After the 4 wks of storage of the tubers under 4 °C, chips from KV78, KV87, and KV108 all showed a lighter color than those from ‘Katahdin’ (Fig.9).
[0183] Collectively, these results showed that although the deletions associated with VInvIn2En of ‘Katahdin’ are in heterozygous and mosaic conditions in the 3 T0 CRISPR / Cas lines, the deletions resulted in a significant reduction of VInv expression under cold storage condition, confirming the cold-responsive function of VInvIn2En in ‘Katahdin.’
[0184] Example 7: Evolution of VInv gene and VInvIn2En enhancer
[0185] We computationally extracted the DNA sequence of VInv gene from a total of 28 sequenced Solanaceous species. Sequences from several distantly related species, including A. thaliana, cucumber (Cucumis sativus), and soybean (Glycine max), were used as outgroups in evolutionary analysis. The VINV protein of potato shared 92% to 99% sequence similarity with those from tomato and wild Solanum species. In addition, the structure of the VInv genes is also highly conserved among different species (Fig.5). The distinct small exon 2 (9 bp) was detected in all Solanaceous species, as well as in several distantly related plant species. In addition, a large intron 2 was identified following the small exon 2 in all species (Fig.5), with sizes ranging from 780 bp to 2,997 bp.MSU: TEC2024-0055 PCT / / MVS: P15076WO01
[0186] The 1,327-bp intron 2 sequence from RH (Zhou et al., 2020) was used to align the intron 2 sequences from other Solanaceous species. Homologous sequences were detected in the same intron of the VInv gene from all Solanum species, as well as from several distantly related species, including eggplant (Solanum melongena) and pepper (Capsicum annuum). We next aligned the 200-bp VInvIn2En sequence from RH to the intron 2 sequences from different species. Surprisingly, the VInvIn2En sequences were even more conserved than the intron 2 sequences among the species analyzed. Furthermore, the DNA motifs related to CBF / NF-Y, TCP and GATA were detected in the VInvIn2En sequences from distantly related Solanum species, including tomato. Therefore, VInvIn2En represents a conserved enhancer sequence in Solanum species.
[0187] All patents and publications referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced patent or publication is hereby specifically incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such cited patents or publications.
[0188] Embodiments
[0189] Various embodiments of the plants, genomes, methods, biological samples, and other compositions described herein are set forth in the following list of numbered embodiments. 1. A modified potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant comprising at least one targeted modification in an endogenous transcriptional enhancer of the potato vacuolar invertase gene (VInvIn2En) relative to a reference potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant lacking the modification, wherein: the targeted modification in VInvIn2En enhancer comprises an insertion, replacement, and / or deletion of one or more nucleotides; and the modification reduces the expression of a VInv gene to thereby reduce cold- induced sweetening of potatoes derived from the potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 2. A modified potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiment 1, wherein the VInvIn2En enhancer comprises the DNA molecule set forth in SEQ ID NO: 1 or an allelic variant thereof. 3. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiments 1 or 2, wherein the targeted modification comprises at least one mutation in the VInvIn2En enhancer nucleic acid sequence of SEQ ID NO: 1. 4. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiments 2 or 3, comprises one or more mutation(s) in a CBF / NF-Y, TCP, and / or GATA DNA binding motif. 5. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiment 4, wherein the one or more mutation(s) in the GATA DNA motif comprises a mutation of nucleic acid at position 21 of SEQ ID NO: 1 from A to T. 6. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiment 4, wherein the one or more mutation(s) in the GATA DNA motif comprises the DNA molecule set forth in SEQ ID NO: 2. 7. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiment 4, wherein the wherein the one or more mutation(s) in the TCP DNA motifs comprises a mutation of one or more nucleic acids at position 128, 130, 165, 166, and / or 167 of SEQ ID NO:1. 8. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiment 4, wherein the one or more mutation(s) in the TCP DNA motif comprises the DNA molecule set forth in SEQ ID NO: 3. 9. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiment 4, wherein the wherein the one or more mutation(s) in the CBF / NF-Y DNA motifs comprise a mutation of one or more nucleic acids at positions 62, 63, 84, 85, and / or 111 of SEQ ID NO:1.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 10. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiment 4, wherein the one or more mutation(s) in the CBF / NF-Y DNA motif comprises the DNA molecule set forth in SEQ ID NO: 4. 11. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of embodiments 1 to 10, wherein the potato plant cell, potato plant tuber, or potato plant contains one to four copies of the at least one mutation in the VInvIn2En enhancer nucleic acid sequence. 12. A modified potato plant cell containing a chromosome comprising the targeted modification(s) in the endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of embodiments 1 to 11. 13. A tissue culture of regenerable cells comprising the modified potato plant cell of embodiment 12. 14. A modified potato plant part containing a chromosome comprising the targeted modification(s) in the endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of embodiments 1 to 11. 15. The modified potato plant part of embodiment 14, wherein the plant part is a leaf, stem, root, tuber, or petiole. 16. A DNA molecule comprising the modified endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of embodiment 1 to 11 and at least 100 base pairs of adjoining endogenous potato chromosomal DNA located centromere-proximal and telomere-proximal to the modified endogenous potato VInvIn2En enhancer. 17. A biological sample comprising the DNA molecule of embodiment 16. 18. A method for generating a potato tuber from a potato plant seed or potato plant, wherein the potato tuber exhibits reduced cold-induced sweetening, comprising: introducing at least one mutation into a VInvIn2En enhancer nucleic acid sequence of a VInv gene in the genome of the potato plant seed or potato plant, wherein the VInvIn2En enhancer has a nucleic acid sequence of SEQ ID NO: 1 or an allelicMSU: TEC2024-0055 PCT / / MVS: P15076WO01 variant thereof, and wherein the mutation reduces expression of the VInv gene a potato tuber derived from the potato plant seed or potato plant relative to a potato tuber derived from a potato plant seed or potato plant without the VInvIn2En enhancer mutation in conditions where the temperature is less than about 15°C; and cultivating the potato plant tuber, potato plant seed, or potato plant to produce a mature potato plant. 19. The method of embodiment 18, wherein the at least one mutation in the VInvIn2En enhancer nucleic acid sequence of SEQ ID NO: 1 comprises one or more mutation(s) in a CBF / NF-Y, TCP, and / or GATA DNA binding motif. 20. The method of embodiment 19, wherein the one or more mutation(s) in the GATA DNA motif comprises a mutation of nucleic acid at position 21 of SEQ ID NO: 1 from A to T. 21. The method of embodiment 19, wherein the one or more mutation(s) in the GATA DNA motif comprises the DNA molecule set forth in SEQ ID NO: 2 or at least 90% sequence identity thereto. 22. The method of embodiment 19, wherein the one or more mutation(s) in the TCP DNA motif comprises a mutation of one or more nucleic acids at position 128, 130, 165, 166, and / or 167 of SEQ ID NO:1. 23. The method of embodiment 19, wherein the one or more mutation(s) in the TCP DNA motif comprises the DNA molecule set forth in SEQ ID NO: 3 or at least 90% sequence identity thereto. 24. The method of embodiment 19, wherein the one or more mutation(s) in the CBF / NF- Y DNA motifs comprise a mutation of one or more nucleic acids at positions 62, 63, 84, 85, and / or 111 of SEQ ID NO:1. 25. The method of embodiment 19, wherein the one or more mutation(s) in the CBF / NF- Y DNA motifs comprises the DNA molecule set forth in SEQ ID NO: 4 or at least 90% sequence identity thereto.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 26. The method of embodiment 18, further comprising harvesting potatoes from the mature plant. 27. The method of embodiment 26, further comprising storing the potatoes at temperatures of less than approximately 15°C. 28. The method of embodiment 26, further comprising storing the potatoes at temperatures of approximately 4°C. 29. The method of embodiments 27 and 28, wherein the potatoes are stored for approximately one month at approximately 4°C. 30. The method of embodiments 27 and 28, wherein the potatoes are stored up to approximately nine months at approximately 4°C. 31. A method of producing potato plant material, the method comprising: (a) providing the modified potato plant of any one of embodiments 1 to 11; and (b) growing the modified potato plant; (c) harvesting potato tubers from the modified potato plant; (d) storing the potato tubers under conditions that allow for reduced expression of the endogenous the VInv gene at levels that are less than expression levels of the endogenous potato VInv gene in a reference potato plant which lacks the modifications. 32. The method of embodiment 31, wherein the plant material comprises a seed, optionally wherein the method further comprises harvesting the seed from the plant. 33. A method of identifying a biological sample comprising a DNA molecule containing the targeted modification(s) in the endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of embodiments 1 to 11, comprising the step of detecting the presence of the DNA molecule in the biological sample. 34. A method of reducing the expression of an endogenous VInv gene in a potato plant, the method comprising introducing the targeted modification(s) in the endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of embodiments 1 to 11.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 35. The method of embodiment 18, wherein the at least one mutation is introduced by: (i) directing both: (a) a guide RNA (gRNA) molecule comprising a spacer RNA molecule which targets the VInvIn2En enhancer nucleic acid sequence set forth in SEQ ID NO: 1 or an allelic variant thereof, or a spacer RNA molecule comprising the RNA encoded by any of SEQ ID NO: 33-42; and (b) an RNA dependent endonuclease (RDE) which recognizes the gRNA molecule to the genome of a target potato plant cell; and (ii) isolating a potato plant cell or potato plant comprising the at least one mutation in the VInvIn2En enhancer nucleic acid sequence of SEQ ID NO: 1 or an allelic variant thereof. 36. The method of embodiment 18, wherein the directing of the gRNA and the RDE to the genome of the target potato plant cell comprises introducing the gRNA, the RDE, a gRNA / RDE complex, a nucleic acid encoding the gRNA, and / or a nucleic acid encoding the RDE into the target potato plant cell. 37. A gene editing system comprising: a CRISPR-Cas effector protein in association with a guide nucleic acid, wherein the guide nucleic acid comprises a spacer sequence that binds to the VInvIn2En enhancer nucleic acid sequence set forth in SEQ ID NO: 1 or an allelic variant thereof.
[0190] References
[0191] References in the present disclosure are as follows: Amrein, T.M., Bachmann, S., Noti, A., Biedermann, M., Barbosa, M.F., Biedermann-Brem, S., Grob, K., Keiser, A., Realini, P., Escher, F., and Amado, R. (2003). Potential of acrylamide formation, sugars, and free asparagine in potatoes: A comparison of cultivars and farming systems. J Agr Food Chem 51, 5556-5560. Bagnaresi, P., Moschella, A., Beretta, O., Vitulli, F., Ranalli, P., and Perata, P. (2008). Heterologous microarray experiments allow the identification of the early events associated with potato tuber cold sweetening. Bmc Genomics 9, 176. Becalski, A., Lau, B.P.Y., Lewis, D., Seaman, S.W., Hayward, S., Sahagian, M., Ramesh, M., and Leclerc, Y. (2004). Acrylamide in french fries: Influence of free amino acids and sugars. J Agr Food Chem 52, 3801-3806.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 Bhaskar, P.B., Raasch, J.A., Kramer, L.C., Neumann, P., Wielgus, S.M., Austin- Phillips, S., and Jiang, J.M. (2008). Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blight. BMC Plant Biol.8, 8. Bhaskar, P.B., Wu, L., Busse, J.S., Whitty, B.R., Hamernik, A.J., Jansky, S.H., Buell, C.R., Bethke, P.C., and Jiang, J.M. (2010). Suppression of the vacuolar invertase gene prevents cold-induced sweetening in potato. Plant Physiol.154, 939-948. Braun, S.R., Endelman, J.B., Haynes, K.G., and Jansky, S.H. (2017). Quantitative trait loci for resistance to common scab and cold-induced sweetening in diploid potato. Plant Genome 10, DOI: 10.3835 / plantgenome2016.3810.0110. Brummell, D.A., Chen, R.K.Y., Harris, J.C., Zhang, H.B., Hamiaux, C., Kralicek, A.V., and McKenzie, M.J. (2011). Induction of vacuolar invertase inhibitor mRNA in potato tubers contributes to cold-induced sweetening resistance and includes spliced hybrid mRNA variants. J Exp Bot 62, 3519-3534. Butler, N.M., Jansky, S.H., and Jiang, J.M. (2020). First-generation genome editing in potato using hairy root transformation. Plant Biotechnol J 18, 2201-2209. Byrne, S., Meade, F., Mesiti, F., Griffin, D., Kennedy, C., and Milbourne, D. (2020). Genome-wide association and genomic prediction for fry color in potato. Agronomy- Basel 10, 90. Cermak, T., Curtin, S.J., Gil-Humanes, J., Cegan, R., Kono, T.J.Y., Konecna, E., Belanto, J.J., Starker, C.G., Mathre, J.W., Greenstein, R.L., and Voytasa, D.F. (2017). A multipurpose toolkit to enable advanced genome engineering in plants. Plant Cell 29, 1196-1217. Chen, C.J., Chen, H., Zhang, Y., Thomas, H.R., Frank, M.H., He, Y.H., and Xia, R. (2020). TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol Plant 13, 1194-1202. Chen, R.G., Ma, J.H., Luo, D., Hou, X.M., Ma, F., Zhang, Y.M., Meng, Y.C., Zhang, H.F., and Guo, W.L. (2019). CaMADS, a MADS-box transcription factor from pepper, plays an important role in the response to cold, salt, and osmotic stress. Plant Sci 280, 164-174. Chow, C.N., Lee, T.Y., Hung, Y.C., Li, G.Z., Tseng, K.C., Liu, Y.H., Kuo, P.L., Zheng, H.Q., and Chang, W.C. (2019). PlantPAN3.0: a new and updated resource forMSU: TEC2024-0055 PCT / / MVS: P15076WO01 reconstructing transcriptional regulatory networks from ChIP-seq experiments in plants. Nucleic Acids Res 47, D1155-D1163. Clasen, B.M., Stoddard, T.J., Luo, S., Demorest, Z.L., Li, J., Cedrone, F., Tibebu, R., Davison, S., Ray, E.E., Daulhac, A., Coffman, A., Yabandith, A., Retterath, A., Haun, W., Baltes, N.J., Mathis, L., Voytas, D.F., and Zhang, F. (2016). Improving cold storage and processing traits in potato through targeted gene knockout. Plant Biotechnol J 14, 169-176. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J.16, 735-743. Dahro, B., Wang, Y., Khan, M., Zhang, Y., Fang, T., Ming, R.H., Li, C.L., and Liu, J.H. (2022). Two AT-Hook proteins regulate A / NINV7 expression to modulate sucrose catabolism for cold tolerance in Poncirus trifoliata. New Phytol 235, 2331-2349. Dale, M.F.B., and Bradshaw, J.E. (2003). Progress in improving processing attributes in potato. Trends Plant Sci 8, 310-312. Deng, X.S., Han, X.H., Yu, S.C., Liu, Z.J., Guo, D.M., He, Y., Li, W.Y., Tao, Y., Sun, C.W., Xu, P.Z., Liao, Y.X., Chen, X.Q., Zhang, H.Y., and Wu, X.J. (2020). OsINV3 and its homolog, OsINV2, control grain size in rice. Int J Mol Sci 21, 2199. Devaux, A., Goffart, J.-P., Petsakos, A., Kromann, P., Gatto, M., Okello, J., Suarez, V., and Hareau, G. (2020). Global food security, contributions from sustainable potato agri-food systems. In The potato crop: its agricultural, nutritional and social contribution to humankind, H. Campos, Ortiz, O., ed (Dordrecht: Springer), pp.3-35. Draffehn, A.M., Meller, S., Li, L., and Gebhardt, C. (2010). Natural diversity of potato (Solanum tuberosum) invertases. Bmc Plant Biology 10, 271. Endelman, J.B., and Jansky, S.H. (2016). Genetic mapping with an inbred line-derived F2 population in potato. Theor Appl Genet 129, 935-943. Fischer, M., Schreiber, L., Colby, T., Kuckenberg, M., Tacke, E., Hofferbert, H.R., Schmidt, J., and Gebhardt, C. (2013). Novel candidate genes influencing natural variation in potato tuber cold sweetening identified by comparative proteomics and association mapping. Bmc Plant Biology 13, 113.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 He, F., Li, H.G., Wang, J.J., Su, Y.Y., Wang, H.L., Feng, C.H., Yang, Y.L., Niu, M.X., Liu, C., Yin, W.L., and Xia, X.L. (2019). PeSTZ1, a C2H2-type zinc finger transcription factor from Populus euphratica, enhances freezing tolerance through modulation of ROS scavenging by directly regulating PeAPX2. Plant Biotechnol J 17, 2169-2183. Hu, B., Jin, J.P., Guo, A.Y., Zhang, H., Luo, J.C., and Gao, G. (2015). GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics 31, 1296-1297. Hu, N., Xian, Z.Q., Li, N., Liu, Y.D., Huang, W., Yan, F., Su, D.D., Chen, J.X., and Li, Z.G. (2019). Rapid and user-friendly open-source CRISPR / Cas9 system for single- or multi-site editing of tomato genome. Hortic Res-England 6, 7. Klann, E.M., Hall, B., and Bennett, A.B. (1996). Antisense acid invertase (TIV1) gene alters soluble sugar composition and size in transgenic tomato fruit. Plant Physiol.112, 1321-1330. Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. (2018). MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35, 1547-1549. Kumar, S., Suleski, M., Craig, J.M., Kasprowicz, A.E., Sanderford, M., Li, M., Stecher, G., and Hedges, S.B. (2022). TimeTree 5: an expanded resource for species divergence times. Molecular Biology and Evolution 39, msac174. Lee, D.W., Lee, S.K., Rahman, M.M., Kim, Y.J., Zhang, D.B., and Jeon, J.S. (2019). The role of rice vacuolar invertase2 in seed size control. Molecules and Cells 42, 711- 720. Li, L., Paulo, M.J., Strahwald, J., Lubeck, J., Hofferbert, H.R., Tacke, E., Junghans, H., Wunder, J., Draffehn, A., van Eeuwijk, F., and Gebhardt, C. (2008). Natural DNA variation at candidate loci is associated with potato chip color, tuber starch content, yield and starch yield. Theor. Appl. Genet.116, 1167-1181. Li, X., Yang, Q., Liao, X.Q., Tian, Y.C., Zhang, F., Zhang, L., and Liu, Q.L. (202a). A natural antisense RNA improves chrysanthemum cold tolerance by regulating the transcription factor DgTCP1. Plant Physiol 190, 605-620. Li, X.D., Zhuang, K.Y., Liu, Z.M., Yang, D.Y., Ma, N.N., and Meng, Q.W. (2016). Overexpression of a novel NAC-type tomato transcription factor, SlNAM1, enhances the chilling stress tolerance of transgenic tobacco. J Plant Physiol 204, 54-65.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 Li, Z.Y., Fu, D.Y., Wang, X., Zeng, R., Zhang, X., Tian, J.G., Zhang, S.S., Yang, X.H., Tian, F., Lai, J.S., Shi, Y.T., and Yang, S.H. (2022b). The transcription factor bZIP68 negatively regulates cold tolerance in maize. Plant Cell 34, 2833-2851. Liu, C.T., Ou, S.J., Mao, B.G., Tang, J.Y., Wang, W., Wang, H.R., Cao, S.Y., Schlappi, M.R., Zhao, B.R., Xiao, G.Y., Wang, X.P., and Chu, C.C. (2018). Early selection of bZIP73 facilitated adaptation of japonica rice to cold climates. Nat Commun 9, 3302. Liu, H., Ding, Y.D., Zhou, Y.Q., Jin, W.Q., Xie, K.B., and Chen, L.L. (2017). CRISPR-P 2.0: an improved CRISPR-Cas9 tool for genome editing in plants. Mol Plant 10, 530-532. Liu, X., Song, B.T., Zhang, H.L., Li, X.Q., Xie, C.H., and Liu, J. (2010). Cloning and molecular characterization of putative invertase inhibitor genes and their possible contributions to cold-induced sweetening of potato tubers. Mol Genet Genomics 284, 147-159. Liu, X., Zhang, C., Ou, Y.B., Lin, Y., Song, B.T., Xie, C.H., Liu, J., and Li, X.Q. (2011). Systematic analysis of potato acid invertase genes reveals that a cold-responsive member, StvacINV1, regulates cold-induced sweetening of tubers. Mol Genet Genomics 286, 109- 118. Liu, X., Lin, Y., Liu, J., Song, B.T., Ou, Y.B., Zhang, H.L., Li, M., and Xie, C.H. (2013). StInvInh2 as an inhibitor of StvacINV1 regulates the cold-induced sweetening of potato tubers by specifically capping vacuolar invertase activity. Plant Biotechnol J 11, 640-647. Ly, D.N.P., Iqbal, S., Fosu-Nyarko, J., Milroy, S., and Jones, M.G.K. (2023). Multiplex CRISPR-Cas9 gene-editing can deliver potato cultivars with reduced browning and acrylamide. Plants 12, 379. Ma, X.L., Zhu, Q.L., Chen, Y.L., and Liu, Y.G. (2016). CRISPR / Cas9 platforms for genome editing in plants: developments and applications. Mol Plant 9, 961-974. Ma, X.L., Zhang, Q.Y., Zhu, Q.L., Liu, W., Chen, Y., Qiu, R., Wang, B., Yang, Z.F., Li, H.Y., Lin, Y.R., Xie, Y.Y., Shen, R.X., Chen, S.F., Wang, Z., Chen, Y.L., Guo, J.X., Chen, L.T., Zhao, X.C., Dong, Z.C., and Liu, Y.G. (2015). A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8, 1274-1284.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 Mckenzie, M.J., Chen, R.K.Y., Harris, J.C., Ashworth, M.J., and Brummell, D.A. (2013). Post-translational regulation of acid invertase activity by vacuolar invertase inhibitor affects resistance to cold-induced sweetening of potato tubers. Plant Cell Environ 36, 176-185. Menendez, C.M., Ritter, E., Schafer-Pregl, R., Walkemeier, B., Kalde, A., Salamini, F., and Gebhardt, C. (2002). Cold sweetening in diploid potato: Mapping quantitative trait loci and candidate genes. Genetics 162, 1423-1434. Meng, F.L., Zhao, H.N., Zhu, B., Zhang, T., Yang, M.Y., Li, Y., Han, Y.P., and Jiang, J.M. (2021). Genomic editing of intronic enhancers unveils their role in fine- tuning tissue-specific gene expression in Arabidopsis thaliana. Plant Cell 33, 1997-2014. Mottram, D.S., Wedzicha, B.L., and Dodson, A.T. (2002). Acrylamide is formed in the Maillard reaction. Nature 419, 448-449. Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum 15, 473-497. Ou, Y.B., Song, B.T., Liu, X., Xie, C.H., Li, M., Lin, Y., Zhang, H.L., and Liu, J. (2013). Promoter regions of potato vacuolar invertase gene in response to sugars and hormones. Plant Physiol Bioch 69, 9-16. Pham, G.M., Hamilton, J.P., Wood, J.C., Burke, J.T., Zhao, H.N., Vaillancourt, B., Ou, S.J., Jiang, J.M., and Buell, C.R. (2020). Construction of a chromosome-scale long-read reference genome assembly for potato. Gigascience 9, giaa100. Ruan, Y.L., Jin, Y., Yang, Y.J., Li, G.J., and Boyer, J.S. (2010). Sugar input, metabolism, and signaling mediated by invertase: roles in development, yield potential, and response to drought and heat. Mol Plant 3, 942-955. Sowokinos, J.R. (2001). Biochemical and molecular control of cold-induced sweetening in potatoes. Am. J. Potato Res.78, 221-236. Stadler, R.H., Blank, I., Varga, N., Robert, F., Hau, J., Guy, P.A., Robert, M.C., and Riediker, S. (2002). Acrylamide from Maillard reaction products. Nature 419, 449-450. Tang, D., Jia, Y.X., Zhang, J.Z., Li, H.B., Cheng, L., Wang, P., Bao, Z.G., Liu, Z.H., Feng, S.S., Zhu, X.J., Li, D.W., Zhu, G.T., Wang, H.R., Zhou, Y., Zhou, Y.F., Bryan, G.J., Buell, C.R., Zhang, C.Z., and Huang, S.W. (2022). Genome evolution and diversity of wild and cultivated potatoes. Nature 606, 535-541.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 Tang, G.Q., Luscher, M., and Sturm, A. (1999). Antisense repression of vacuolar and cell wall invertase in transgenic carrot alters early plant development and sucrose partitioning. Plant Cell 11, 177-189. The_Potato_Genome_Sequencing_Consortium. (2011). Genome sequence and analysis of the tuber crop potato. Nature 475, 189-195. Thomashow, M.F. (1999). Plant cold acclimation: Freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Phys 50, 571-599. Verma, S., and Bhatia, S. (2019). A comprehensive analysis of the B3 superfamily identifies tissue-specific and stress-responsive genes in chickpea (Cicer arietinum L.).3 Biotech 9, 346. Wan, H.J., Wu, L.M., Yang, Y.J., Zhou, G.Z., and Ruan, Y.L. (2018). Evolution of sucrose metabolism: the dichotomy of invertases and beyond. Trends Plant Sci 23, 163- 177. Wang, L., and Ruan, Y.L. (2016). Critical roles of vacuolar invertase in floral organ development and male and female fertilities are revealed through characterization of GhVIN1-RNAi cotton plants. Plant Physiol 171, 405-423. Wang, L., Cook, A., Patrick, J.W., Chen, X.Y., and Ruan, Y.L. (2014). Silencing the vacuolar invertase gene GhVIN1 blocks cotton fiber initiation from the ovule epidermis, probably by suppressing a cohort of regulatory genes via sugar signaling. Plant J 78, 686- 696. Weirauch, M.T., Yang, A., Albu, M., Cote, A.G., Montenegro-Montero, A., Drewe, P., Najafabadi, H.S., Lambert, S.A., Mann, I., Cook, K., Zheng, H., Goity, A., van Bakel, H., Lozano, J.C., Galli, M., Lewsey, M.G., Huang, E.Y., Mukherjee, T., Chen, X.T., Reece-Hoyes, J.S., Govindarajan, S., Shaulsky, G., Walhout, A.J.M., Bouget, F.Y., Ratsch, G., Larrondo, L.F., Ecker, J.R., and Hughes, T.R. (2014). Determination and inference of eukaryotic transcription factor sequence specificity. Cell 158, 1431-1443. Wu, L., Bhaskar, P.B., Busse, J.S., Zhang, R.F., Bethke, P.C., and Jiang, J.M. (2011). Developing cold-chipping potato varieties by silencing the vacuolar invertase gene. Crop Sci.51, 981-990. Xie, K.B., Minkenberg, B., and Yang, Y.N. (2015). Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci USA 112, 3570-3575.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 Xie, X.B., Li, S., Zhang, R.F., Zhao, J., Chen, Y.C., Zhao, Q., Yao, Y.X., You, C.X., Zhang, X.S., and Hao, Y.J. (2012). The bHLH transcription factor MdbHLH3 promotes anthocyanin accumulation and fruit colouration in response to low temperature in apples. Plant Cell Environ 35, 1884-1897. Ye, J., Shakya, R., Shrestha, P., and Rommens, C.M. (2010). Tuber-specific silencing of the acid invertase gene substantially lowers the acrylamide forming potential of potato. J Agr Food Chem 58, 12162-12167. Yu, X.Y., Wang, X.F., Zhang, W.Q., Qian, T.T., Tang, G.M., Guo, Y.K., and Zheng, C.C. (2008). Antisense suppression of an acid invertase gene (MAI1) in muskmelon alters plant growth and fruit development. J. Exp. Bot.59, 2969-2977. Zeng, Z.X., Zhang, W.L., Marand, A.P., Zhu, B., Buell, C.R., and Jiang, J.M. (2019). Cold stress induces enhanced chromatin accessibility and bivalent histone modifications H3K4me3 and H3K27me3 of active genes in potato. Genome Biol 20, 123. Zhang, H., Wu, T., Li, Z., Huang, K., Kim, N.E., Ma, Z.M., Kwon, S.W., Jiang, W.Z., and Du, X.L. (2021). OsGATA16, a GATA transcription factor, confers cold tolerance by repressing OsWRKY45-1 at the seedling stage in rice. Rice 14. Zhang, W.L., Zhang, T., Wu, Y.F., and Jiang, J.M. (2012). Genome-wide identification of regulatory DNA elements and protein-binding footprints using signatures of open chromatin in Arabidopsis. Plant Cell 24, 2719-2731. Zhao, H.N., Zhang, W.L., Chen, L.F., Wang, L., Marand, A.P., Wu, Y.F., and Jiang, J.M. (2018). Proliferation of regulatory DNA elements derived from transposable elements in the maize genome. Plant Physiol 176, 2789-2803. Zhao, H.N., Yang, M.Y., Bishop, J., Teng, Y.H., Cao, Y.X., Beall, B.D., Li, S.L., Liu, T.X., Fang, Q.X., Fang, C., Xin, H.Y., Nutzmann, H.W., Osbourn, A., Meng, F.L., and Jiang, J.M. (2022). Identification and functional validation of super-enhancers in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America 119, e2215328119. Zhou, H., Zeng, R.F., Liu, T.J., Ai, X.Y., Ren, M.K., Zhou, J.J., Hu, C.G., and Zhang, J.Z. (2022). Drought and low temperature-induced NF-YA1 activates FT expression to promote citrus flowering. Plant Cell Environ 45, 3505-3522. Zhou, Q., Tang, D., Huang, W., Yang, Z.M., Zhang, Y., Hamilton, J.P., Visser, R.G.F., Bachem, C.W.B., Buell, C.R., Zhang, Z.H., Zhang, C.Z., and Huang, S.W. (2020). Haplotype-resolved genome analyses of a heterozygous diploid potato. Nat Genet 52,MSU: TEC2024-0055 PCT / / MVS: P15076WO01 1018-1023. Zhu, B., Zhang, W.L., Zhang, T., Liu, B., and Jiang, J.M. (2015). Genome-wide prediction and validation of intergenic enhancers in Arabidopsis using open chromatin signatures. Plant Cell 27, 2415-2426. Zhu, X.B., Richael, C., Chamberlain, P., Busse, J.S., Bussan, A.J., Jiang, J.M., and Bethke, P.C. (2014). Vacuolar invertase gene silencing in potato (Solanum tuberosum L.) improves processing quality by decreasing the frequency of sugar-end defects. Plos One 9, e93381. Zhu, X.B., Gong, H.L., He, Q.Y., Zeng, Z.X., Busse, J.S., Jin, W.W., Bethke, P.C., andJiang, J.M. (2016). Silencing of vacuolar invertase and asparagine synthetase genes and its impact on acrylamide formation of fried potato products. Plant Biotechnol J 14, 709-718. Zrenner, R., Schuler, K., and Sonnewald, U. (1996). Soluble acid invertase determines the hexose-to-sucrose ratio in cold-stored potato tubers. Planta 198, 246-252.
[0192] All cited patents and patent publications referred to in this application are incorporated herein by reference in their entirety. All of the materials and methods disclosed and claimed herein can be made and used without undue experimentation as instructed by the above disclosure and illustrated by the examples. Although the materials and methods of this disclosure have been described in terms of embodiments and illustrative examples, it will be apparent to those of skill in the art that substitutions and variations can be applied to the materials and methods described herein without departing from the concept, spirit, and scope of the disclosure. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope, and concept of the disclosure as encompassed by the embodiments of the disclosures recited herein and the specification and appended claims.
Claims
MSU: TEC2024-0055 PCT / / MVS: P15076WO01 What is claimed is:
1. A modified potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant comprising at least one targeted modification in an endogenous transcriptional enhancer of the potato vacuolar invertase gene (VInvIn2En) relative to a reference potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant lacking the modification, wherein: the targeted modification in VInvIn2En enhancer comprises an insertion, replacement, and / or deletion of one or more nucleotides; and the modification reduces the expression of a VInv gene to thereby reduce cold- induced sweetening of potatoes derived from the potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant.
2. A modified potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claim 1, wherein the VInvIn2En enhancer comprises the DNA molecule set forth in SEQ ID NO: 1 or an allelic variant thereof.
3. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claims 1 or two, wherein the targeted modification comprises at least one mutation in the VInvIn2En enhancer nucleic acid sequence of SEQ ID NO:
1.
4. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claims 2 or 3, comprises one or more mutation(s) in a CBF / NF-Y, TCP, and / or GATA DNA binding motif.
5. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claim 4, wherein the one or more mutation(s) in the GATA DNA motif comprises a mutation of nucleic acid at position 21 of SEQ ID NO: 1 from A to T.
6. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claim 4, wherein the one or more mutation(s) in the GATA DNA motif comprises the DNA molecule set forth in SEQ ID NO: 2.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 7. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claim 4, wherein the wherein the one or more mutation(s) in the TCP DNA motifs comprises a mutation of one or more nucleic acids at position 128, 130, 165, 166, and / or 167 of SEQ ID NO:
1.
8. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claim 4, wherein the one or more mutation(s) in the TCP DNA motif comprises the DNA molecule set forth in SEQ ID NO:
3.
9. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claim 4, wherein the wherein the one or more mutation(s) in the CBF / NF- Y DNA motifs comprise a mutation of one or more nucleic acids at positions 62, 63, 84, 85, and / or 111 of SEQ ID NO:
1.
10. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claim 4, wherein the one or more mutation(s) in the CBF / NF-Y DNA motif comprises the DNA molecule set forth in SEQ ID NO:
4.
11. The potato plant cell, potato plant tuber or portion of a tuber, potato plant seed, or potato plant of claims 1 to 10, wherein the potato plant cell, potato plant tuber, or potato plant contains one to four copies of the at least one mutation in the VInvIn2En enhancer nucleic acid sequence.
12. A modified potato plant cell containing a chromosome comprising the targeted modification(s) in the endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of claims 1 to 11.
13. A tissue culture of regenerable cells comprising the modified potato plant cell of claim 12.
14. A modified potato plant part containing a chromosome comprising the targeted modification(s) in the endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of claims 1 to 11.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 15. The modified potato plant part of claim 14, wherein the plant part is a leaf, stem, root, tuber, or petiole.
16. A DNA molecule comprising the modified endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of claims 1 to 11 and at least 100 base pairs of adjoining endogenous potato chromosomal DNA located centromere-proximal and telomere-proximal to the modified endogenous potato VInvIn2En enhancer.
17. A biological sample comprising the DNA molecule of claim 16.
18. A method for generating a potato tuber from a potato plant seed or potato plant, wherein the potato tuber exhibits reduced cold-induced sweetening, comprising: introducing at least one mutation into a VInvIn2En enhancer nucleic acid sequence of a VInv gene in the genome of the potato plant seed or potato plant, wherein the VInvIn2En enhancer has a nucleic acid sequence of SEQ ID NO: 1 or an allelic variant thereof, and wherein the mutation reduces expression of the VInv gene a potato tuber derived from the potato plant seed or potato plant relative to a potato tuber derived from a potato plant seed or potato plant without the VInvIn2En enhancer mutation in conditions where the temperature is less than about 15°C; and cultivating the potato plant tuber, potato plant seed, or potato plant to produce a mature potato plant.
19. The method of claim 18, wherein the at least one mutation in the VInvIn2En enhancer nucleic acid sequence of SEQ ID NO: 1 comprises one or more mutation(s) in a CBF / NF-Y, TCP, and / or GATA DNA binding motif.
20. The method of claim 19, wherein the one or more mutation(s) in the GATA DNA motif comprises a mutation of nucleic acid at position 21 of SEQ ID NO: 1 from A to T.
21. The method of claim 19, wherein the one or more mutation(s) in the GATA DNA motif comprises the DNA molecule set forth in SEQ ID NO: 2 or at least 90% sequence identity thereto.MSU: TEC2024-0055 PCT / / MVS: P15076WO01 22. The method of claim 19, wherein the one or more mutation(s) in the TCP DNA motif comprises a mutation of one or more nucleic acids at position 128, 130, 165, 166, and / or 167 of SEQ ID NO:
1.
23. The method of claim 19, wherein the one or more mutation(s) in the TCP DNA motif comprises the DNA molecule set forth in SEQ ID NO: 3 or at least 90% sequence identity thereto.
24. The method of claim 19, wherein the one or more mutation(s) in the CBF / NF-Y DNA motifs comprise a mutation of one or more nucleic acids at positions 62, 63, 84, 85, and / or 111 of SEQ ID NO:
1.
25. The method of claim 19, wherein the one or more mutation(s) in the CBF / NF-Y DNA motifs comprises the DNA molecule set forth in SEQ ID NO: 4 or at least 90% sequence identity thereto.
26. The method of claim 18, further comprising harvesting potatoes from the mature plant.
27. The method of claim 26, further comprising storing the potatoes at temperatures of less than approximately 15°C.
28. The method of claim 26, further comprising storing the potatoes at temperatures of approximately 4°C.
29. The method of claims 27 and 28, wherein the potatoes are stored for approximately one month at approximately 4°C.
30. The method of claims 27 and 28, wherein the potatoes are stored up to approximately nine months at approximately 4°C.
31. A method of producing potato plant material, the method comprising: (a) providing the modified potato plant of any one of claims 1 to 11; and (b) growing the modified potato plant; (c) harvesting potato tubers from the modified potato plant;MSU: TEC2024-0055 PCT / / MVS: P15076WO01 (d) storing the potato tubers under conditions that allow for reduced expression of the endogenous the VInv gene at levels that are less than expression levels of the endogenous potato VInv gene in a reference potato plant which lacks the modifications.
32. The method of claim 31, wherein the plant material comprises a seed, optionally wherein the method further comprises harvesting the seed from the plant.
33. A method of identifying a biological sample comprising a DNA molecule containing the targeted modification(s) in the endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of claims 1 to 11, comprising the step of detecting the presence of the DNA molecule in the biological sample.
34. A method of reducing the expression of an endogenous VInv gene in a potato plant, the method comprising introducing the targeted modification(s) in the endogenous VInvIn2En enhancer nucleic acid sequence set forth in any one of claims 1 to 11.
35. The method of claim 18, wherein the at least one mutation is introduced by: (i) directing both: (a) a guide RNA (gRNA) molecule comprising a spacer RNA molecule which targets the VInvIn2En enhancer nucleic acid sequence set forth in SEQ ID NO: 1 or an allelic variant thereof, or a spacer RNA molecule comprising the RNA encoded by any of SEQ ID NO: 33-42; and (b) an RNA dependent endonuclease (RDE) which recognizes the gRNA molecule to the genome of a target potato plant cell; and (ii) isolating a potato plant cell or potato plant comprising the at least one mutation in the VInvIn2En enhancer nucleic acid sequence of SEQ ID NO: 1 or an allelic variant thereof.
36. The method of claim 18, wherein the directing of the gRNA and the RDE to the genome of the target potato plant cell comprises introducing the gRNA, the RDE, a gRNA / RDE complex, a nucleic acid encoding the gRNA, and / or a nucleic acid encoding the RDE into the target potato plant cell.
37. A gene editing system comprising:MSU: TEC2024-0055 PCT / / MVS: P15076WO01 a CRISPR-Cas effector protein in association with a guide nucleic acid, wherein the guide nucleic acid comprises a spacer sequence that binds to the VInvIn2En enhancer nucleic acid sequence set forth in SEQ ID NO: 1 or an allelic variant thereof.
Citation Information
Patent Citations
Control of cold-induced sweetening and reduction of acrylamide levels in potato or sweet potato
US20160194648A1
Novel plant cells, plants, and seeds
WO2018140899A1