Methods for rapid engineering of cells

By employing multiple genome editing tools delivered via lipid nanoparticles, the method enhances cell survival, expansion, and editing efficiency, addressing the limitations of existing technologies in performing multiple genetic edits in cells.

WO2025137301A1PCT designated stage expired Publication Date: 2025-06-26INTELLIA THERAPEUTICS INC
View PDF 34 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/061062
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-20
Filing Date
2024-12-19
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Existing cell engineering technologies face challenges in efficiently performing multiple genetic edits in cells while maintaining cell viability and desired phenotypes, leading to poorer cell survival and decreased genomic editing efficiencies.

Method used

The use of at least two genome editing tools for multiplex genome editing applications, allowing for simultaneous or sequential administration of lipid nanoparticles containing these tools, to efficiently deliver multiple genome editing tools to cells in fewer steps and within a shorter time period.

Benefits of technology

This approach results in cells with improved survival and expansion rates, maintaining high editing rates and reducing the time required for manufacturing while requiring lower efficacious cell doses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024061062_26062025_PF_FP_ABST
    Figure US2024061062_26062025_PF_FP_ABST
Patent Text Reader

Abstract

Methods and compositions for rapid engineering of cells are provided.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS FOR RAPID ENGINEERING OF CELLSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of United States Provisional Application No. 63 / 612,757, filed December 20, 2023, the content of which is hereby incorporated by reference in its entirety.SEQUENCE LISTING

[0002] The present application contains a sequence listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on December 18, 2024, is named “01155-0069-00PCT.xml” and is 3,135,604 bytes in size.INTRODUCTION AND SUMMARY

[0003] The ability to introduce multiple genetic edits into a cell is of interest for genomic editing and clinical therapeutic applications. For example, adoptive cell therapy approaches using genetically modified immune cells have become an attractive modality to treat a variety of conditions and diseases, including cancers, to reconstitute cell lineages and immune system defense. However, the clinical application of cell product therapies has been challenging in part due to the complex genetic engineering requirements. The ability to engineer multiple attributes into a single cell depends on the ability to efficiently perform edits in multiple targeted genes, including knockouts and in locus insertions, while retaining viability and desired cell phenotypes.

[0004] CRISPR / Cas9 genome editing has been demonstrated to be highly efficient; however, simultaneous edits in different loci have been reported to result in poorer cell survival, increased translocations, which potentially impair the quality and safety of the cell product, and decreased genomic editing efficiencies as the number of edits increase. Existing cell engineering technologies present limitations in providing the necessary cell quality and yield using a sequential editing process due to the cumulative toxicity to the cell. Existing cell engineering technologies also present limitations in performing the desired edits within a short time period.

[0005] Thus, there is a need for safer, more efficient processes for delivering multiple genome editing tools to a cell and for performing multiplexed genomic editing, for example with fewer steps or within a shorter time period.

[0006] The methods provided herein comprise using at least two genome editing tools for multiplex genome editing applications, providing substantial advantages over traditional methods.

[0007] In some embodiments, the methods provided herein produce cells with greater survival and expansion, while maintaining high editing rates, thereby shortening the time required for manufacturing, increasing yield, and maintaining desirable properties of the cells.BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Fig. 1 shows fold expansion of T cells from time of edit to time of harvest

[0009] Figs. 2A and 2B show marker profiles associated with memory T cell phenotypes for CD4+ and CD8+ engineered cells, respectively.

[0010] Figs. 3 A shows total area of tumor cells for Rapid protocol CAR T cells serially challenged with GFP+ tumor cells.[0001 1] Fig. 3B shows total area of tumor cells for Standard protocol CAR T cells serially challenged with GFP+ tumor cells.

[0012] Figs. 4A-4D show cytokine release into media after the third round of stimulation. Statistically significant differences are denoted with brackets and

[0013] Fig. 5 shows comparison of cell growth between rapidly engineered cells compared to standard engineered cells after the second round of stimulation.

[0014] Fig. 6A shows mean percent of CD8+ cells with Tscm and Tn marker profiles.

[0015] Fig. 6B shows mean percent of CD8+ cells with Tcm marker profile.

[0016] Fig. 6C shows mean percent of CD8+ cells with Ttm and Tern marker profiles.

[0017] Fig. 6D shows mean percent of CD4+ cells with Tscm and Tn marker profiles.

[0018] Fig. 6E shows mean percent of CD4+ cells with Tcm marker profile.

[0019] Fig. 6F shows mean percent of CD4+ cells with Ttm and Tern marker profiles.BRIEF DESCRIPTION OF DISCLOSED SEQUENCESDETAILED DESCRIPTION

[0020] The present disclosure provides, e.g., platform methods of genetically modifying a population of cells over a short period of time (i.e., rapid engineered). The methods provide, for example, multiplex genome editing in a population of cells without significant cellular side effects. The methods also provide delivering multiple genome editing tools to a population of cells in fewer steps, allowing for multi-editing within a shorter time period, while preserving desirable properties of the cells. The desirable properties include, for example, sternness of the cells. Increased sternness can result in, for example, better efficacy with in vivo cell expansion and persistence after the cells have been administered to a subject. Another desirable property includes a lower efficacious cell dose required for the rapid engineered cells as compared to a cell dose required for cells engineered by a standard method, e.g., requiring 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the cell dose required for standard engineered cells. For example, rapid engineered cells may require 50% of the dose needed for standard engineered cells to achieve comparable efficacy.

[0021] In some embodiments, the platform relates to manufacturing methods to prepare cells in vitro or ex vivo for subsequent therapeutic administration to a subject. In some embodiments, the platform relates to multiplex genome editing via simultaneous or sequential administration of lipid nanoparticles (LNPs) comprising at least two genome editing tools. The platform is relevant to any cell type but is particularly advantageous in preparing cells that require multiple genome edits for full therapeutic applicability, e.g., in primary immune cells. The methods may exhibit improved properties as compared to prior delivery technologies; for example, the methods provide efficient delivery of nucleic acids such as the at least two genome editing tools, while providing greater sternness, survival, and expansion of the cells.

[0022] As provided herein, the platform methods apply to “a cell” or to “a cell population” (or “population of cells”). When referring to delivery or genomic editing methods for “a cell” herein, it is understood that the methods may be used for delivery or genomic editing to “a cell population.” And when referring to delivery or genomic editing methods for “a population of cells” herein, it is understood that the methods may be used for delivery or genomic editing to “a cell.”

[0023] In some embodiments, provided herein is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool, wherein the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

[0024] In some embodiments, provided herein is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool, wherein the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor; and (b-2) contacting the population of cells with a second genome editing tool, wherein the second genome editing tool comprises a second genomic editor and at least one gRNA that targets at least one genomic locus and that is cognate to the second genomic editor, wherein the first genomic editor is orthogonal to the second genomic editor, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

[0025] In some embodiments, provided herein is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool comprising a first genomic editor comprising a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the base editor; and (b-2) contacting the population of cells with a second genome editing tool comprising a second genomic editor comprising an RNA-guided cleavase and at least one gRNA that targets at least one genomic locus and that is cognate to the RNA-guided cleavase, wherein the base editor is orthogonal to the RNA- guided cleavase, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

[0026] In some embodiments, provided herein is a cell or a population of cells treated ex vivo with any method or composition disclosed herein. In some embodiments, provided herein is a cell or population of cells treated in vivo with any method or composition disclosed herein. In some embodiments, provided herein is a population of cells comprising any cell disclosed herein.

[0027] In some embodiments, provided herein is use of any cell, population of cells, or composition disclosed herein for treating cancer or an autoimmune disease. In some embodiments, provided herein is use of any cell, population of cells, or composition disclosed herein for preparation of a medicament for treating cancer or an autoimmune disease.

[0028] The present disclosure includes the following numbered embodiments:

[0029] Embodiment 1 is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool, wherein the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

[0030] Embodiment 2 is the method of embodiment 1, wherein the first genomic editor comprises a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

[0031] Embodiment 3 is the method of embodiment 1 or 2, wherein the first genomic editor comprises a base editor, optionally a C to T base editor or an A to G base editor.

[0032] Embodiment 4 is the method of embodiment 1 or 2, wherein the first genomic editor comprises a cleavase.

[0033] Embodiment 5 is the method of any one of embodiments 1-3, wherein the first genomic editor comprises an N. meningitidis (Nme) RNA-guided nickase.

[0034] Embodiment 6 is the method of any one of embodiments 1, 2, and 4, wherein the first genomic editor comprises an TV. meningitidis (Nme) RNA-guided cleavase.

[0035] Embodiment 7 is the method of any one of embodiments 1-3, wherein the first genomic editor comprises an S. pyogenes (Spy) RNA-guided nickase.

[0036] Embodiment 8 is the method of any one of embodiments 1, 2, and 4, wherein the first genomic editor comprises an S. pyogenes (Spy) RNA-guided cleavase.

[0037] Embodiment 9 is the method of any one of embodiments 1-8, wherein the first genomic editor comprises an NmelCas9, an Nme2Cas9, an Nme3Cas9, or SpyCas9.

[0038] Embodiment 10 is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool, wherein the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor; and (b-2) contacting the population of cells with a second genome editing tool, wherein the second genome editing tool comprises a second genomic editor and at least one gRNA that targets at least one genomic locus and that is cognate to the second genomic editor, wherein the first genomic editor is orthogonal to the second genomic editor, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

[0039] Embodiment 11 is the method of embodiment 10, wherein the first genomic editor comprises a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

[0040] Embodiment 12 is the method of embodiment 10 or 11, wherein the second genomic editor comprises a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

[0041] Embodiment 13 is the method of any one of embodiments 10-12, wherein one of the first genomic editor and the second genomic editor comprises a base editor, optionallya C to T base editor or an A to G base editor, and the other of the first genomic editor and the second genomic editor comprises a cleavase.

[0042] Embodiment 14 is the method of any one of embodiments 10-13, wherein one of the first genomic editor and second genomic editor comprises an TV. meningitidis (Nme) RNA-guided nickase or cleavase, and the other of the first genomic editor and the second genomic editor comprises an S. pyogenes (Spy) RNA-guided nickase or cleavase.

[0043] Embodiment 15 is the method of any one of embodiments 10-14, wherein the first genomic editor or the second genomic editor comprises an NmelCas9, an Nme2Cas9, an Nme3Cas9, or SpyCas9.

[0044] Embodiment 16 is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool comprising a first genomic editor comprising a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the base editor; and (b-2) contacting the population of cells with a second genome editing tool comprising a second genomic editor comprising an RNA-guided cleavase and at least one gRNA that targets at least one genomic locus and that is cognate to the RNA-guided cleavase, wherein the base editor is orthogonal to the RNA-guided cleavase, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

[0045] Embodiment 17 is the method of any one of embodiments 1-16, further comprising: (b-3) contacting the population of cells with a nucleic acid encoding at least one exogenous gene.

[0046] Embodiment 18 is the method of any one of embodiments 1-17, wherein step (a) and step (b-1) are performed on the same day.

[0047] Embodiment 19 is the method of any one of embodiments 10-18, wherein step (a), step (b-1), and step (b-2) are performed on the same day.

[0048] Embodiment 20 is the method of any one of embodiments 17-19, wherein step (a), step (b-1), step (b-2), and step (b-3) are performed on the same day.

[0049] Embodiment 21 is the method of any one of embodiments 10-20, wherein step (b-1) and step (b-2) are performed on the same day.

[0050] Embodiment 22 is the method of any one of embodiments 10-21, wherein step (b-1) and step (b-2) are performed simultaneously.

[0051] Embodiment 23 is the method of any one of embodiments 17-22, wherein step (b-1), step (b-2), and step (b-3) are performed on the same day.

[0052] Embodiment 24 is the method of any one of embodiments 17-23, wherein step (b-1), step (b-2), and step (b-3) are performed simultaneously.

[0053] Embodiment 25 is the method of any one of embodiments 1-24, wherein step (c) is performed no later than 7 days, no later than 6 days, no later than 5 days, no later than 4 days, no later than 3 days, no later than 2 days, or no later than 1 day after the day on which step (a) is performed.

[0054] Embodiment 26 is the method of any one of embodiments 1-25, wherein step (c) is performed no later than 4 days after the day on which step (a) is performed.

[0055] Embodiment 27 is the method of any one of embodiments 1-26, wherein step (c) is performed 4 days, 3 days, or 2 days after the day on which step (a) is performed.

[0056] Embodiment 28 is the method of any one of embodiments 1-27, wherein step (c) is performed 4 days or 2 days after the day on which step (a) is performed.

[0057] Embodiment 29 is the method of any one of embodiments 1-28, wherein step (c) is performed 4 days after the day on which step (a) is performed.

[0058] Embodiment 30 is the method of any one of embodiments 1-28, wherein step(c) is performed 2 days after the day on which step (a) is performed.

[0059] Embodiment 31 is the method of any one of embodiments 1-30, further comprising: (d) storing the population of edited cells, wherein step (d) is performed no later than 2 days after the day on which step (c) is performed.

[0060] Embodiment 32 is the method of embodiment 31, wherein step (d) is performed no later than 1 day after the day on which step (c) is performed.

[0061] Embodiment 33 is the method of embodiment 31 or 32, wherein step (d) is performed 2 days or 1 day after the day on which step (c) is performed, or wherein step (d) and step (c) are performed on the same day.

[0062] Embodiment 34 is the method of any one of embodiments 31-33, wherein step(d) and step (c) are performed on the same day.

[0063] Embodiment 35 is the method of any one of embodiments 31-34, wherein the storing the population of edited cells comprises freezing the population of edited cells.

[0064] Embodiment 36 is the method of any one of embodiments 2, 3, 5, 7, 9, and 11- 35, wherein the base editor is a C to T base editor, optionally comprising a cytidine deaminase, or is an A to G base editor, optionally comprising an adenosine deaminase.

[0065] Embodiment 37 is the method of any one of embodiments 1-36, wherein some cells in the population of edited cells comprise at least two genomic edits.

[0066] Embodiment 38 is the method of embodiment 37, wherein one of the at least two genomic edits is located at the at least one genomic locus targeted by the at least one gRNA that is cognate to the first genomic editor or the base editor, and wherein another one of the at least two genomic edits is located at the at least one genomic locus targeted by the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase.

[0067] Embodiment 39 is the method of embodiment 37 or 38, wherein one of the at least two genome edits comprises a double-stranded break, and another one of the at least two genome edits comprises a transition or base edit (e.g., A to G or C to T).

[0068] Embodiment 40 is the method of any one of embodiments 1-39, wherein the first genome editing tool or the second genome editing tool is delivered to the population of cells via at least one lipid nanoparticle (LNP).

[0069] Embodiment 41 is the method of any one of embodiments 17-40, wherein the nucleic acid encoding the at least one exogenous gene is delivered to the population of cells via a virus, optionally wherein the nucleic acid is a viral vector.

[0070] Embodiment 42 is the method of embodiment 41, wherein the virus is an adeno-associated virus (AAV), optionally wherein the nucleic acid is an AAV vector.

[0071] Embodiment 43 is the method of embodiment 41, wherein the virus is a lentivirus, optionally wherein the nucleic acid is a lentiviral vector.

[0072] Embodiment 44 is the method of any one of embodiments 1-43, wherein the first genome editing tool or the second genome editing tool is delivered as at least one nucleic acid encoding the first genome editing tool or the second genome editing tool.

[0073] Embodiment 45 is the method of embodiment 44, wherein the at least one nucleic acid comprises at least one mRNA.

[0074] Embodiment 46 is the method of any one of embodiments 1-45, wherein the at least one gRNA is delivered to the population of cells as at least one polynucleotide that encodes the gRNA.

[0075] Embodiment 47 is the method of any one of embodiments 2, 3, 5, 7, 9, and 11- 46, wherein the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are comprised in a single polypeptide.

[0076] Embodiment 48 is the method of any one of embodiments 2, 3, 5, 7, 9, and 11- 46, wherein the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are comprised in different polypeptides.

[0077] Embodiment 49 is the method of any one of embodiments 2, 3, 5, 7, 9, and 11- 48, wherein the base editor comprises a cytidine deaminase and an RNA-guided nickase.

[0078] Embodiment 50 is the method of embodiment 49, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in a single polypeptide.

[0079] Embodiment 51 is the method of embodiment 49, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in different polypeptides.

[0080] Embodiment 52 is the method of embodiment 49, wherein the cytidine deaminase and the RNA-guided nickase are comprised in a single polypeptide, and wherein the UGI is comprised in a different polypeptide.

[0081] Embodiment 53 is the method of any one of embodiments 1-3, 7, and 9-52, wherein the first genomic editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3 or the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1 or 2.

[0082] Embodiment 54 is the method of any one of embodiments 1-3, 5, and 9-52, wherein the first genomic editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 146.

[0083] Embodiment 55 is the method of any one of embodiments 1-3, 5, and 9-52, and 54, wherein the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 310.

[0084] Embodiment 56 is the method of any one of embodiments 1, 2, 4, and 8-53, wherein the first genomic editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 156.

[0085] Embodiment 57 is the method of any one of embodiments 1, 2, 4, 8-53, and 56, wherein the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 295.

[0086] Embodiment 58 is the method of any one of embodiments 10-53, wherein the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1 or 2, and the second genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 180-183 and 185-190.

[0087] Embodiment 59 is the method of any one of embodiments 10-52, 54, and 55, wherein the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 147 or 310, and the second genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 293 or 295.

[0088] Embodiment 60 is the method of any one of embodiments 1-3, 5, 7, and 9-53, wherein the first genomic editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 9, 18, and 21.

[0089] Embodiment 61 is the method of any one of embodiments 1-3, 5, 7, 9-53, and 60, wherein the first genomic editor or the base editor comprises a cytidine deaminase, and wherein the cytidine deaminase comprises an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 22.

[0090] Embodiment 62 is the method of embodiment 61, wherein the cytidine deaminase comprises an APOBEC3 A deaminase (A3 A).

[0091] Embodiment 63 is the method of any one of embodiments 1-3, 5, 7, and 10-52, wherein the first genomic editor or the base editor comprises a Cas9 nickase.

[0092] Embodiment 64 is the method of embodiment 63, wherein the first genomic editor or the base editor comprises an N. meningitidis (Nme) Cas9 nickase.

[0093] Embodiment 65 is the method of embodiment 63 or 64, wherein the first genomic editor or the base editor comprises a D16A NmeCas9 nickase, optionally a D16A Nme2Cas9.

[0094] Embodiment 66 is the method of any one of embodiments 63, 74, and 75, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising the nucleotide sequence of any one of SEQ ID NOs: 151 or a nucleotide sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NOs: 151.

[0095] Embodiment 67 is the method of any one of embodiments 1-3, 5, 9-52, 54, 55, and 59-62, wherein the first genomic editor or the base editor comprises the amino acid sequence of SEQ ID NO: 146 or 149 or wherein the first genomic editor or the base editor comprises a sequence that is at least 80%, 85%, 90%, 95%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 146 or 149.

[0096] Embodiment 68 is the method of any one of embodiments 10-67, wherein the second genomic editor or the RNA-guided cleavase comprises a Cas9 cleavase.

[0097] Embodiment 69 is the method of embodiment 68, wherein the second genomic editor or the RNA-guided cleavase comprises an S. pyogenes (Spy) Cas9 cleavase.

[0098] Embodiment 70 is the method of any one of embodiments 10-52, 54, 55, 59-69, wherein the second genomic editor or the RNA-guided cleavase comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 156.

[0099] Embodiment 71 is the method of any one of embodiments 10-52, 54, 55, 59-70, wherein the second genomic editor or the RNA-guided cleavase comprises the amino acid sequence of SEQ ID NO: 156.[000100] Embodiment 72 is the method of any one of embodiments 10-52, 54, 55, 59-71, wherein the second genomic editor or the RNA-guided cleavase is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 295 or 293.[000101] Embodiment 73 is the method of any one of embodiments 10-52, 54, 55, 59-72, wherein the second genomic editor or the RNA-guided cleavase is delivered to the cell as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 295 or 293.[000102] Embodiment 74 is the method of embodiment 63, wherein the first genomic editor or the base editor comprises an S. pyogenes (Spy) Cas9 nickase.[000103] Embodiment 75 is the method of embodiment 63 or 74, wherein the first genomic editor or the base editor comprises a D10A SpyCas9 nickase.[000104] Embodiment 76 is the method of any one of embodiments 63, 74, and 75, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising the nucleotide sequence of any one of SEQ ID NOs: 42, 44, and 46 or a nucleotide sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NOs: 42, 44, and 46.[000105] Embodiment 77 is the method of any one of embodiments 63 and 74-76, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising the nucleotide sequence of any one of SEQ ID NOs: 42, 44, and 46-58.[000106] Embodiment 78 is the method of any one of embodiments 63 and 74-77, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 1.[000107] Embodiment 79 is the method of any one of embodiments 63 and 74-77, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acidcomprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 4.[000108] Embodiment 80 is the method of embodiment 68, wherein the second genomic editor or the RNA-guided cleavase comprises an N. meningitidis (Nme) Cas9 cleavase.[000109] Embodiment 81 is the method of embodiment 68 or 80, wherein the second genomic editor or the RNA-guided cleavase comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 157-167, 191, 198, 212, and 219.[000110] Embodiment 82 is the method of any one of embodiments 68, 80, and 81, wherein the second genomic editor or the RNA-guided cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 157-167, 191, 198, 212, and 219.[0001 11] Embodiment 83 is the method of any one of embodiments 68 and 80-82, wherein the second genomic editor or the RNA-guided cleavase is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 168-190, 192-197, 199- 204, 206-211, 213-218, and 220-225.[0001 12] Embodiment 84 is the method of any one of embodiments 68 and 80-83, wherein the second genomic editor or the RNA-guided cleavase is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence of any one of SEQ ID NOs: 168- 190, 192-197, 199-204, 206-211, 213-218, and 220-225.[0001 13] Embodiment 85 is the method of any one of embodiments 10-84, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor is non-cognate to the second genomic editor or the RNA-guided cleavase.[000114] Embodiment 86 is the method of any one of embodiments 10-85, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase is non-cognate to the first genomic editor or the base editor.[000115] Embodiment 87 is the method of any one of embodiments 1-86, wherein the at least one gRNA comprises at least one single guide RNA (sgRNA).[0001 16] Embodiment 88 is the method of any one of embodiments 1-87, wherein the at least one sgRNA comprises a short-single guide RNA (short-sgRNA) comprising a conserved portion of an sgRNA comprising a hairpin region, wherein the hairpin region lacks at least 5- 10 nucleotides and wherein the short-sgRNA comprises a 5’ end modification or a 3’ end modification or both.[000117] Embodiment 89 is the method of any one of embodiments 1-88, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least two gRNAs that target at least two different genomic loci.[000118] Embodiment 90 is the method of any one of embodiments 10-89, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least two gRNAs that target at least two different genomic loci.[000119] Embodiment 91 is the method of any one of embodiments 1-90, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least three gRNAs that target at least three different genomic loci.[000120] Embodiment 92 is the method of any one of embodiments 10-91, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least three gRNAs that target at least three different genomic loci.[000121] Embodiment 93 is the method of any one of embodiments 1-92, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least four gRNAs that target at least four different genomic loci.[000122] Embodiment 94 is the method of any one of embodiments 10-93, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least four gRNAs that target at least four different genomic loci.[000123] Embodiment 95 is the method of any one of embodiments 1-94, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least five gRNAs that target at least five different genomic loci.[000124] Embodiment 96 is the method of any one of embodiments 10-95, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least five gRNAs that target at least five different genomic loci.[000125] Embodiment 97 is the method of any one of embodiments 1-96, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor targets one or more genomic loci chosen from the TRBC locus, the HLA-A locus, the HLA-B locus, the CIITA locus, the HLA-DR locus, the HLA-DQ locus, and the HLA-DP locus.[000126] Embodiment 98 is the method of any one of embodiments 10-97, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase targets one or more genomic loci chosen from the TRAC locus, the AAVS1 locus, and the CIITA locus.[000127] Embodiment 99 is the method of any one of embodiments 10-98, wherein (i) the at least one gRNA that is cognate to the first genomic editor or the base editor comprisesa gRNA that targets the HLA-A locus and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (ii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (iii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (iv) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (v) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus and a gRNA that targets the HLA-DR locus, the HLA- DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (vi) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (vii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA- DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (viii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA- DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (ix) the at least one gRNA that is cognate to the first genomic editor or the base editorcomprises a gRNA that targets the TRAC locus, a gRNA that targets the TRBC locus, a gRNA that targets the CIITA locus, and a gRNA that targets the HLA-A locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (x) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus; (xi) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus; (xii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus; or (xiii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus.[000128] Embodiment 100 is the method of any one of embodiments 1-99, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus or the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus. [000129] Embodiment 101 is the method of embodiment 100, wherein the gRNA that targets the TRAC locus comprises the guide sequence of SEQ ID NO: 315.[000130] Embodiment 102 is the method of any one of embodiments 1-101, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus.[000131] Embodiment 103 is the method of embodiment 102, wherein the gRNA that targets the HLA-A locus comprises the guide sequence of SEQ ID NO: 366.[000132] Embodiment 104 is the method of any one of embodiments 1-103, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-B locus.[000133] Embodiment 105 is the method of embodiment 104, wherein the gRNA that targets the HLA-B locus comprises the guide sequence of SEQ ID NO: 388.[000134] Embodiment 106 is the method of any one of embodiments 1-105, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the CIITA locus.[000135] Embodiment 107 is the method of embodiment 106, wherein the gRNA that targets the CIITA locus comprises the guide sequence of SEQ ID NO: 384.[000136] Embodiment 108 is the method of any one of embodiments 1-107, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TGFBR2 locus.[000137] Embodiment 109 is the method of embodiment 108, wherein the gRNA that targets the TGFBR2 locus comprises the guide sequence of SEQ ID NO: 455.[000138] Embodiment 110 is the method of any one of embodiments 17-109, wherein the at least one exogenous gene comprises a T cell receptor (TCR) or a chimeric antigen receptor (CAR).[000139] Embodiment 111 is the method of any one of embodiments 40-110, wherein the LNP comprises an ionizable lipid.[000140] Embodiment 112 is the method or composition of embodiment 111, wherein the ionizable lipid comprises a biodegradable ionizable lipid.[000141] Embodiment 113 is the method of any one of embodiments any one of embodiments 40-112, wherein the LNP comprises a lipid component and the lipid component comprises: about 50-60 mol % amine lipid such as Lipid A; about 8-10 mol % neutral lipid; and about 2.5-4 mol % stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N / P ratio of the lipid LNP is about 3-7.[000142] Embodiment 114 is the method of any one of embodiments 40-112, wherein the LNP comprises a lipid component and the lipid component comprises: about 25-45 mol % amine lipid, such as Lipid A; about 10-30 mol % neutral lipid; about 25-65 mol % helper lipid; and about 1.5-3.5 mol % stealth lipid (e.g., PEG lipid), and wherein the N / P ratio of the LNP is about 3-7.[000143] Embodiment 115 is the method of any one of embodiments 1-114, wherein the population of cells is a population of cells isolated from human donor PBMCs or leukopaks.[000144] Embodiment 116 is the method of any one of embodiments 1-115, wherein the population of cells is a population of immune cells.[000145] Embodiment 117 is the method of any one of embodiments 1-116, wherein the population of cells is a population of T cells.[000146] Embodiment 118 is the method of embodiment 117, wherein in the population of T cells, a ratio of CD4+ T cells to CD8+ T cells is 1 : 1.[000147] Embodiment 119 is a population of edited cells, prepared ex vivo using the method of any one of embodiments 1-118.[000148] Embodiment 120 is the population of edited cells of embodiment 119, wherein on the day step (c) is performed, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of the cells in the population of edited cells express the at least one exogenous gene.[000149] Embodiment 121 is the population of edited cells of embodiment 119 or 120, wherein on the day step (c) is performed, no more than 20%, no more than 18%, no more than 16%, no more than 14%, no more than 12%, no more than 10%, no more than 8%, no more than 6%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, no more than 0.4%, no more than 0.3%, no more than 0.2%, or no more than 0.1% of the cells in the population of edited cells express an endogenous T cell receptor (TCR).[000150] Embodiment 122 is the population of edited cells of any one of embodiments 119-121, wherein on the day step (c) is performed, at least 60%, at least 62%, at least 64%, at least 66%, at least 68%, at least 70%, at least 72%, at least 74%, at least 76%, at least 78%, at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, or at least 98% of the cells in the population of edited cells are naive T cells (Tn cells), stem cell like memory T cells (Tscm cells), or central memory T cells (Tcm cells), optionally wherein the Tn cells or the Tscm cells are CD45RO- and CCR7+, and optionally wherein the Tcm cells are CD45RO+ and CCR7+.[000151 ] Embodiment 123 is the population of edited cells of any one of embodiments 119-122, wherein on the day step (c) is performed, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, or at least 20% of the cells in the population of edited cells are naive T cells (Tn cells) or stem cell like memory T cells (Tscm cells), optionally wherein the Tn cells or the Tscm cells are CD45RO- and CCR7+.[000152] Embodiment 124 is the population of edited cells of any one of embodiments 119-123, wherein on the day step (c) is performed, at least 44%, at least 46%, at least 48%, at least 50%, at least 52%, at least 54%, at least 56%, at least 58%, at least 60%, at least 62%, at least 64%, at least 66%, at least 68%, at least 70%, at least 72%, at least 74%, at least 76%, at least 78%, at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, or at least 90% of the cells in the population of edited cells are central memory T cells (Tcm cells), optionally wherein the Tcm cells are CD45RO+ and CCR7+.[000153] Embodiment 125 is the population of edited cells of any one of embodiments 119-124, wherein on the day step (c) is performed, the population of edited cells has expanded no more than 9-fold, no more than 8.5-fold, no more than 8-fold, no more than 7.5- fold, no more than 7-fold, no more than 6.5-fold, no more than 6-fold, no more than 5.5-fold, no more than 5-fold, no more than 4.5-fold, no more than 4-fold, no more than 3.5-fold, no more than 3-fold, no more than 2.5-fold, or no more than 2-fold, compared to the population of cells on the day step (a) is performed.[000154] Embodiment 126 is the population of edited cells of any one of embodiments 119-125, wherein when contacted with tumor cells, the population of edited cells is capable of releasing at least 8-fold, at least 12-fold, at least 16-fold, at least 20-fold, at least 24-fold, at least 28-fold, at least 32-fold, at least 36-fold, at least 40-fold, at least 44-fold, at least 48- fold, at least 52-fold, or at least 56-fold higher TNF-ct compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.[000155] Embodiment 127 is the population of edited cells of any one of embodiments 119-126, wherein when contacted with tumor cells, the population of edited cells is capable of releasing at least 10-fold, at least 12-fold, at least 14-fold, at least 16-fold, at least 18-fold, at least 20-fold, at least 22-fold, at least 24-fold, at least 26-fold, or at least 28-fold higher GM-CSF compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.[000156] Embodiment 128 is the population of edited cells of any one of embodiments 119-127, wherein when contacted with tumor cells, the population of edited cells is capable of releasing at least 4-fold, at least 6-fold, at least 8-fold, at least 10-fold, at least 12-fold, at least 14-fold, at least 16-fold, at least 18-fold, at least 20-fold, , at least 22-fold or at least 24-fold higher IL-2 compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.[000157] Embodiment 129 is the population of edited cells of any one of embodiments 119-128, wherein when contacted with tumor cells, the population of edited cells is capable of releasing at least 4-fold, at least 8-fold, at least 12-fold, at least 16-fold, at least 20-fold, at least 24-fold, at least 28-fold, or at least 32-fold higher IFN-y compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.[000158] Embodiment 130 is the population of edited cells of any one of embodiments 119-129, wherein when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, or at least 8-fold higher compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.[000159] Embodiment 131 is the population of edited cells of any one of embodiments 126-130, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed 10 days after the day on which step (a) is performed.[000160] Embodiment 132 is an edited cell comprised in the population of edited cells of any one of embodiments 119-131, wherein the edited cell comprises the at least two genomic edits.[000161] Embodiment 133 is the edited cell of embodiment 132, wherein the at least two genomic edits comprises at least three genomic edits.[000162] Embodiment 134 is the edited cell of embodiment 133, wherein the at least three genomic edits comprises at least four genomic edits.[000163] Embodiment 135 is the edited cell of any one of embodiments 132-134, wherein the at least two genomic edits comprises an edit located at the HLA-A locus, an edit located at the CIITA locus, an edit located at the TRAC locus, and an edit located at the TRBC locus.[000164] Embodiment 136 is the edited cell of any one of embodiments 132-135, wherein the at least two genomic edits comprises an edit located at the HLA-A locus, an edit located at the HLA-B locus, an edit located at the CIITA locus, and an edit located at the TRAC locus.[000165] Embodiment 137 is the edited cell of any one of embodiments 132-136, wherein the edited cell comprises the at least one exogenous gene.[000166] Embodiment 138 is the edited cell of embodiment 137, wherein the least one exogenous gene comprises a CAR.[000167] Embodiment 139 is a method for treating a disease in a subject, comprising administering the population of edited cells or the edited cell of any one of embodiments 119- 138 to the subject.[000168] Embodiment 140 is the population of edited cells or the edited cell of any one of embodiments 119-138, for use in treating a disease in a subject.[000169] Embodiment 141 is the use of the population of edited cells or the edited cell of any one of embodiments 119-138, in the manufacture of a medicament for treating a disease in a subject.[000170] Embodiment 142 is the method, edited population or cell for use, or use of any one of embodiments 139-141, wherein the disease is cancer or an autoimmune disease.[000171 ] Embodiment 143 is the method, edited population or cell for use, or use of any one of embodiments 139-141, wherein the population of edited cells or the edited cell is allogeneic to the subject.I. Definitions[000172] Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:[000173] “Polynucleotide” and “nucleic acid” are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof. A nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugarphosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy, 2’ halide, or 2’-O-(2-methoxyethyl) (2’-O-moe) substitutions. Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or Nl- methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N4- methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5-methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6-methylaminopurine, O6-methylguanine, 4- thio-pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazine-pyrimidines, and O4-alkyl- pyrimidines; US Pat. No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11thed., 1992). Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (US Pat. No. 5,585,481). A nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2’ methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acid includes “locked nucleic acid” (LNA), an analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42): 13233-41). Nucleic acid includes “unlocked nucleic acid” enables the modulation of the thermodynamic stability and also provides nuclease stability. RNA and DNA have different sugar moieties and can differ by the presence of uracil or analogs thereof in RNA and thymine or analogs thereof in DNA.[000174] “Polypeptide” as used herein refers to a multimeric compound comprising amino acid residues that can adopt a three-dimensional conformation. Polypeptides include but are not limited to enzymes, enzyme precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, antibodies, etc. Polypeptides may, but do not necessarily, comprise post-translational modifications, non-natural amino acids, prosthetic groups, and the like.[000175] As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to a guide RNA together with an RNA-guided DNA binding agent, such as a Cas nuclease, e.g., a Cas cleavase, Cas nickase, or dCas DNA binding agent (e.g., Cas9). In some embodiments, the guide RNA guides the RNA-guided DNA binding agent such as Cas9 to a target sequence, and the guide RNA hybridizes with the target sequence and the agent binds to the target sequence; in cases where the agent is a cleavase or nickase, binding can be followed by cleaving or nicking.[000176] As used herein, an “RNA-guided DNA binding agent” means a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the presence of a PAM and the sequence of the guide RNA. Exemplary RNA-guided DNA binding agents include Cas cleavases / nickases and inactivated forms thereof (“dCas DNA binding agents”). “Cas nuclease”, also called “Cas protein” as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents. Cas cleavases / nickases and dCas DNA binding agents include a Csm or Cmr complex of a type III CRISPR system, the Cas 10, Csml, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases. As used herein, a “Class 2 Cas nuclease” is a single-chain polypeptide with RNA-guided DNA binding activity. Class 2 Cas nucleases include Class 2 Cas cleavases / nickases (e.g., H840A, D10A, or N863A variants), which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpfl, C2cl, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698 A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060 A variants), and eSPCas9(l. l) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpfl protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like nuclease domain. Cpfl sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables SI and S3. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).[000177] As used herein, the term “genomic editor” or “editor” refers to an agent comprising a polypeptide that is capable of making a modification within a nucleic acid sequence (e.g., DNA or RNA). In some embodiments, the editor is a cleavase, such as a Cas9 cleavase. In some embodiments, the editor is capable of deaminating a base within a nucleic acid, and it may be called a base editor. In some embodiments, the editor is capable of deaminating a base within a DNA molecule. In some embodiments, the editor is capable of deaminating a cytosine (C) in DNA. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to a cytidine deaminase domain. In some embodiments, the editor is a combination of an RNA-guided nickase and a cytidine deaminase domain. In some embodiments, the editor is a fusion protein comprising an RNA- guided nickase fused to an APOBEC3 A deaminase (A3 A). In some embodiments, the editor comprises a Cas9 nickase fused to an APOBEC3 A deaminase (A3 A). In some embodiments,the editor is a fusion protein comprising an enzymatically inactive RNA-guided DNA- binding protein fused to a cytidine deaminase domain. In some embodiments, the editor is a nickase fused to a DNA polymerase.[000178] As used herein, the term “genome editing tool” refers to an agent comprising a genomic editor and at least one guide RNA cognate to a nuclease or nickase component of the genomic editor.[000179] A genomic editor, for example, may comprise a C to T base editor, and may or may not comprise a uracil glycosylase inhibitor (UGI). A genomic editor, for example, may comprise a cytidine deaminase, an RNA-guided nickase, and a UGI, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in a single polypeptide, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in different polypeptides, or wherein the deaminase and the RNA-guided nickase are comprised in a single polypeptide, and the UGI is comprised in a different polypeptide. In some embodiments, the deaminase comprises a cytidine deaminase.[000180] As used herein, the term “orthogonal” refers to any two genomic editors (e.g., base editors, nucleases, nickases, or cleavases) where each is capable of recognizing its own target(s) via its cognate guide RNA(s) but not compatible with the guide RNA(s) cognate to the other genomic editor, e.g., each is not capable of recognizing the target(s) of the other genomic editor via the guide RNA(s) cognate to the other genomic editor. For example, an N. meningitidis Cas9 (NmeCas9) nickase may be capable of recognizing a genomic locus via a guide RNA cognate to the NmeCas9 nickase, and an S. pyogenes Cas9 (SpyCas9) cleavase may be capable of recognizing another genomic locus via a guide RNA cognate to the SpyCas9 cleavase. In this example, the NmeCas9 nickase and the SpyCas9 cleavase are orthogonal to each other. Genome editors or genome editing components may be engineered to be orthogonal. Although in this example, the NmeCas9 nickase and the SpyCas9 cleavase are derived from different organisms, two genomic editors need not be derived from different organisms to be orthogonal to each other.[000181 ] As used herein, a “cytidine deaminase” means a polypeptide or complex of polypeptides that is capable of cytidine deaminase activity, that is catalyzing the hydrolytic deamination of cytidine or deoxycytidine, typically resulting in uridine or deoxyuridine. Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and in particular, enzymes of the APOB EC family (APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminase (AID or AICDA) and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol. 22:367-77, 2005;Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol. Chem. 274: 18470-6, 1999); Carrington et al., Cells 9:1690 (2020)). In some embodiments, variants of any known cytidine deaminase or APOBEC protein are encompassed. Variants include proteins having a sequence that differs from wild-type protein by one or several mutations (i.e., substitutions, deletions, insertions), such as one or several single point substitutions. For instance, a shortened sequence could be used, e.g., by deleting N-terminal, C-terminal, or internal amino acids, preferably one to four amino acids at the C-terminus of the sequence. As used herein, the term “variant” refers to allelic variants, splicing variants, and natural or artificial mutants, which are homologous to a reference sequence. The variant is “functional” in that it shows a catalytic activity of DNA editing.[000182] As used herein, the term “APOBEC3 A” refers to a cytidine deaminase such as the protein expressed by the human A3 A gene. The APOBEC3 A may have catalytic DNA editing activity. An amino acid sequence of APOBEC3 A has been described (UniPROT accession ID: p31941) and is included herein as SEQ ID NO: 22. In some embodiments, the APOBEC3 A protein is a human APOBEC3 A protein or a wild-type protein. Variants include proteins having a sequence that differs from wild-type APOBEC3 A protein by one or several mutations (i.e., substitutions, deletions, insertions), such as one or several single point substitutions. For instance, a shortened APOBEC3 A sequence could be used, e.g. by deleting N-terminal, C-terminal, or internal amino acids, preferably one to four amino acids at the C- terminus of the sequence. As used herein, the term “variant” refers to allelic variants, splicing variants, and natural or artificial mutants, which are homologous to an APOBEC3 A reference sequence. The variant is “functional” in that it shows a catalytic activity of DNA editing. In some embodiments, an APOBEC3 A (such as a human APOBEC3 A) has a wild-type amino acid position 57 (as numbered in the wild-type sequence). In some embodiments, an APOBEC3 A (such as a human APOBEC3 A) has an asparagine at amino acid position 57 (as numbered in the wild-type sequence).[000183] As used herein, a “nickase” is an enzyme that creates a single-strand break (also known as a “nick”) in double strand DNA, i.e., cuts one strand but not the other of the DNA double helix. As used herein, an “RNA-guided nickase” means a polypeptide or complex of polypeptides having DNA nickase activity, wherein the DNA nickase activity is sequence-specific and depends on the sequence of the RNA. Exemplary RNA-guided nickases include Cas nickases. Cas nickases include, but are not limited to, nickase forms of a Csm or Cmr complex of a type III CRISPR system, the CaslO, Csml, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2Cas nucleases. Class 2 Cas nickases include, polypeptides in which either the HNH or RuvC catalytic domain is inactivated, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9 or D16A variant of NmeCas9). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain or RuvC or RuvC-like domains for N. meningitidis includeNme2Cas9D16A (HNH nickase) and Nme2Cas9H588A (RuvC nickase). Class 2 Cas nickases include, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9), Cpfl, C2cl, C2c2, C2c3, HF Cas9 (e.g., N497A, R661 A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(l. l) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpfl protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like protein domain. Cpfl sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables SI and S3. “Cas9” encompasses S. pyogenes (Spy) Cas9, the variants of Cas9 listed herein, and equivalents thereof. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).[000184] As used herein, the term “fusion protein” refers to a hybrid polypeptide which comprises polypeptides from at least two different proteins or sources. One polypeptide may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxyterminal (C- terminal) protein thus forming an “amino-terminal fusion protein” or a “carboxy-terminal fusion protein,” respectively. Any of the proteins provided herein may be produced by any method known in the art. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference.[000185] The term “linker,” as used herein, refers to a chemical group or a molecule linking two adjacent molecules or moi eties. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein) such as a 16-amino acid residue “XTEN” linker, or a variant thereof (See, e.g., the Examples; and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequenceSGSETPGTSESATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27). In some embodiments, the linker comprises one or more sequences selected from SEQ ID NOs: 25-39 and 72-133.[000186] As used herein, the term “uracil glycosylase inhibitor”, “uracil-DNA glycosylase inhibitor” or “UGI” refers to a protein that is capable of inhibiting a uracil-DNA glycosylase (UDG) base-excision repair enzyme e.g., UniPROT ID: P14739; SEQ ID NO: 15; SEQ ID NO: 24).[000187] As used herein, the terms “nuclear localization signal” (NLS) or “nuclear localization sequence” refers to an amino acid sequence which induces transport of molecules comprising such sequences or linked to such sequences into the nucleus of eukaryotic cells. The nuclear localization signal may form part of the molecule to be transported. In some embodiments, the NLS may be fused to the molecule by a covalent bond, hydrogen bonds or ionic interactions. In some embodiments, the NLS may be fused to the molecule via a linker. [000188] As used herein, “open reading frame” or “ORF” of a gene refers to a sequence consisting of a series of codons that specify the amino acid sequence of the protein that the gene codes for. The ORF generally begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon, e.g., TAA, TAG or TGA in DNA or UAA, UAG, or UGA in RNA.[000189] “Guide RNA”, “gRNA”, and “guide” are used herein interchangeably to refer to either a crRNA (also known as CRISPR RNA), or the combination of a crRNA and a trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA). “Guide RNA” or “gRNA” refers to each type. The trRNA may be a naturally-occurring sequence, or a trRNA sequence with modifications or variations compared to naturally-occurring sequences.[000190] As used herein, a “guide sequence” or “guide region” or “targeting sequence” or “spacer” or “spacer sequence” and the like refers to a sequence within a gRNA that is complementary to a target sequence and functions to direct a gRNA to a target sequence for binding or modification (e.g., cleavage) by an RNA-guided nickase. A guide sequence can be 20 nucleotides in length, e.g., in the case of Streptococcus pyogenes (i.e., Spy Cas9 (also referred to as Sp Cas9)) and related Cas9 homologs / orthologs. Shorter or longer sequences can also be used as guides, e.g., 15-, 16-, 17-, 18-, 19-, 21-, 22-, 23-, 24-, or 25-nucleotides in length. A guide sequence can be 20-25 nucleotides in length, e.g., in the case of Nme Cas9,e.g., 20-, 21-, 22-, 23-, 24-or 25-nucleotides in length. For example, a guide sequence of 24 nucleotides in length can be used with Nme Cas9, e.g., Nme2 Cas9.[000191] In some embodiments, the target sequence is in a genomic locus or on a chromosome, for example, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, where the total length of the target sequence is at least 17, 18, 19, 20 or more base pairs. In some embodiments, the guide sequence and the target region may contain 1-4 mismatches where the guide sequence comprises at least 17, 18, 19, 20 or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches where the guide sequence comprises 20 nucleotides. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence is at least 80%, 85%, 90%, or 95%, for example when, the guide sequence comprises a sequence 24 contiguous nucleotides. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch, i.e., one nucleotide that is not identical or not complementary, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1-2, preferably no more than 1 mismatch, where the total length of the target sequence is 19, 20, 21, 22, 23, or 24, nucleotides, or more. In some embodiments, the guide sequence and the target region may contain 1-2 mismatches where the guide sequence comprises at least 24 nucleotides, or more. In some embodiments, the guide sequence and the target region may contain 1-2 mismatches where the guide sequence comprises 24 nucleotides.[000192] As used herein, a “target sequence” or “genomic target sequence” refers to a sequence of nucleic acid in a target genomic locus, in either the positive or the negative strand, that has complementarity to the guide sequence of the gRNA, i.e., that is sufficiently complementary to the guide sequence of the gRNA to permit specific binding of the guide to the target sequence. The interaction of the target sequence and the guide sequence directs an RNA-guided DNA binding agent to bind, and potentially nick or cleave (depending on the activity of the agent), within the target sequence. The specific length of the target sequence and the number of mismatches possible between the target sequence and the guide sequencedepend, for example, on the identity of the Cas9 nuclease being directed by the gRNA. Target sequences for Cas proteins include both the positive and negative strands of genomic DNA (j.e., the sequence given and the sequence’s reverse complement), as a nucleic acid substrate for a Cas protein is a double stranded nucleic acid. Accordingly, where a guide sequence is said to be “complementary to a target sequence,” it is to be understood that the guide sequence may direct an RNA-guided DNA binding agent (e.g., dCas9 or impaired Cas9) to bind to the reverse complement of a target sequence. Thus, in some embodiments, where the guide sequence binds the reverse complement of a target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence not including the PAM) except for the substitution of U for T in the guide sequence.[000193] As used herein, a first sequence is considered to “comprise a sequence with at least X% identity to” a second sequence if an alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence in its entirety are matched by the first sequence. For example, the sequence AAGA comprises a sequence with 100% identity to the sequence AAG because an alignment would give 100% identity in that there are matches to all three positions of the second sequence. The differences between RNA and DNA (generally the exchange of uridine for thymidine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity among polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine as a complement). Thus, for example, the sequence 5’-AXG where X is any modified uridine, such as pseudouridine, N1 -methyl pseudouridine, or 5- methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5’-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well-known in the art. One skilled in the art will understand what choice of algorithm and parameter settings are appropriate for a given pair of sequences to be aligned; for sequences of generally similar length and expected identity >50% for amino acids or >75% for nucleotides, the Needleman- Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server are generally appropriate.[000194] “mRNA” is used herein to refer to a polynucleotide that is not DNA and comprises an open reading frame that can be translated into a polypeptide (z.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs). mRNA can comprise oneor more modifications, e.g. as provided below. In general, mRNAs do not contain a substantial quantity of thymidine residues (e.g., 0 residues or fewer than 30, 20, 10, 5, 4, 3, or 2 thymidine residues; or less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1% thymidine content). An mRNA can contain modified uridines at some or all of its uridine positions.[000195] “Modified uridine” is used herein to refer to a nucleoside other than thymidine with the same hydrogen bond acceptors as uridine and one or more structural differences from uridine. In some embodiments, a modified uridine is a substituted uridine, i.e., a uridine in which one or more non-proton substituents (e.g., alkoxy, such as methoxy) takes the place of a proton. In some embodiments, a modified uridine is pseudouridine. In some embodiments, a modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more non-proton substituents (e.g., alkyl, such as methyl) takes the place of a proton. In some embodiments, a modified uridine is any of a substituted uridine, pseudouridine, or a substituted pseudouridine.[000196] “Uridine position” as used herein refers to a position in a polynucleotide occupied by a uridine or a modified uridine. Thus, for example, a polynucleotide in which “100% of the uridine positions are modified uridines” contains a modified uridine at every position that would be a uridine in a conventional RNA (where all bases are standard A, U, C, or G bases) of the same sequence. Unless otherwise indicated, a U in a polynucleotide sequence of a sequence table or sequence listing in or accompanying this disclosure can be a uridine or a modified uridine.[000197] As used herein, the “minimal uridine codon(s)” for a given amino acid is the codon(s) with the fewest uridines (usually 0 or 1 except for a codon for phenylalanine, where the minimal uridine codon has 2 uridines). Modified uridine residues are considered equivalent to uridines for the purpose of evaluating uridine content.[000198] As used herein, the “uridine dinucleotide (UU) content” of an ORF can be expressed in absolute terms as the enumeration of UU dinucleotides in an ORF or on a rate basis as the percentage of positions occupied by the uridines of uridine dinucleotides (for example, AUUAU would have a uridine dinucleotide content of 40% because 2 of 5 positions are occupied by the uridines of a uridine dinucleotide). Modified uridine residues are considered equivalent to uridines for the purpose of evaluating uridine dinucleotide content. [000199] As used herein, the “minimal adenine codon(s)” for a given amino acid is the codon(s) with the fewest adenines (usually 0 or 1 except for a codon for lysine andasparagine, where the minimal adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenines for the purpose of evaluating adenine content.[000200] As used herein, the “adenine dinucleotide content” of an ORF can be expressed in absolute terms as the enumeration of AA dinucleotides in an ORF or on a rate basis as the percentage of positions occupied by the adenines of adenine dinucleotides (for example, UAAUA would have an adenine dinucleotide content of 40% because 2 of 5 positions are occupied by the adenines of an adenine dinucleotide). Modified adenine residues are considered equivalent to adenines for the purpose of evaluating adenine dinucleotide content.[000201 ] As used herein, the term “genomic locus,” when used in the context of a genomic locus being targeted by a guide RNA, includes one or more parts of a genome, the targeting of which affects the expression of the gene that is associated with the locus. For example, a genomic locus may include a coding sequence of a gene, an intron sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splicing site, or a non-coding sequence between genes (e.g., intergenic space).[000202] As used herein, the term “contact” refers to providing at least one component so that the component physically contacts a cell or a population of cells, including physically contacting the cell surface, cytosol, and / or nucleus of the cell or of a cell of the population of cells. “Contacting” a cell or a population of cells with a polypeptide encompasses, for example, contacting the cell or the population of cells with a nucleic acid that encodes the polypeptide and allowing the cell or the population of cells to express the polypeptide. [000203] As used herein, “day” refers to a period of 24 hours and not necessarily a calendar day (12 AM to 12 AM). If a later step or activity is performed x day(s) after the day on which an earlier step or activity is performed, then the later step or activity is performed about (x * 24) ± y hours after when the earlier step or activity is performed, wherein y is from 0 to 24. If multiple steps or activities are performed on the same day, then x is 0. In some embodiments, y is from 0 to 12. In some embodiments, y is from 0 to 11. In some embodiments, y is from 0 to 10. In some embodiments, y is from 0 to 9. In some embodiments, y is from 0 to 8. In some embodiments, y is from 0 to 7. In some embodiments, y is from 0 to 6. In some embodiments, y is from 0 to 5. In some embodiments, y is from 0 to 4. In some embodiments, y is from 0 to 3. In some embodiments, y is from 0 to 2. In some embodiments, is from 0 to 1. In some embodiments, y is 12. In some embodiments, y is 11. In some embodiments, y is 10. In some embodiments, y is 9. In some embodiments, y is 8. Insome embodiments, is 7. In some embodiments, y is 6. In some embodiments, y is 5. In some embodiments, y is 4. In some embodiments, y is 3. In some embodiments, y is 2. In some embodiments, is 1. In some embodiments, y is 0.[000204] As used herein, “thawed,” when used in the context of a day on which the population of cells was thawed, refers to the day on which the population of cells was most recently thawed, if the population of cells was thawed more than once.[000205] As used herein, the term “simultaneous,” when used in the context of contacting a cell or a population of cells with at least two genome editing tools (e.g., compositions, polypeptides, nucleic acids, or combinations thereof), refers to the contacting of the cell with one of the at least two genome editing tools being no more than 48 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 36 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 24 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 18 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 12 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 6 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 4 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 3 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 2 hours from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 1 hour from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 30 minutes from the contacting of the cell with the other of the at least two genome editing tools.In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 15 minutes from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 10 minutes from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is no more than 5 minutes from the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the contacting of the cell with one of the at least two genome editing tools is at the same time as the contacting of the cell with the other of the at least two genome editing tools. In some embodiments, the two genome editing tools are premixed prior to contacting the cell.[000206] As used herein, “indel” refers to an insertion or deletion mutation consisting of a number of nucleotides that are either inserted, deleted, or inserted and deleted, e.g., at the site of double-stranded breaks (DSBs), in a target nucleic acid. As used herein, when indel formation results in an insertion, the insertion is a random insertion at the site of a DSB and is not generally directed by or based on a template sequence.[000207] As used herein, “knockdown” refers to a decrease in expression of a particular gene product (e.g., protein, mRNA, or both). Knockdown of a protein can be measured either by detecting protein secreted by tissue or population of cells (e.g., in serum or cell media) or by detecting total cellular amount of the protein from a tissue or cell population of interest. Methods for measuring knockdown of mRNA are known and include sequencing of mRNA isolated from a tissue or cell population of interest. In some embodiments, “knockdown” may refer to some loss of expression of a particular gene product, for example a decrease in the amount of mRNA transcribed or a decrease in the amount of protein expressed or secreted by a population of cells (including in vivo populations such as those found in tissues).[000208] As used herein, “knockout” refers to a loss of expression of a particular protein in a cell. Knockout can be measured either by detecting the amount of protein secretion from a tissue or population of cells (e.g., in serum or cell media) or by detecting total cellular amount of a protein a tissue or a population of cells. In some embodiments, the methods of the disclosure “knockout” a target protein one or more cells (e.g., in a population of cells including in vivo populations such as those found in tissues). In some embodiments, a knockout is not the formation of mutant of the target protein, for example, created by indels, but rather the complete loss of expression of the target protein in a cell, i.e., decrease of expression to below the level of detection of the assay used.[000209] As used herein, a “population of edited cells,” a “cell population comprising edited cells,” or a “population of cells comprising edited cells,” or the like refers to a cell population that comprises edited cells, however not all cells in the population must be edited. A cell population comprising edited cells may also include non-edited cells. The percentage of edited cells within a cell population comprising edited cells may be determined by counting the number of cells within the population that are edited in the population as determined by standard cell counting methods. For example, in some embodiments, a cell population comprising edited cells comprising a single genome edit will have at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the cells in the population with the single edit. In some embodiments, a cell population comprising edited cells comprising at least two genome edits will have at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the cells in the population with at least two genome edits.[000210] “CIITA” or “CIITA” or “C2TA,” as used herein, refers to the nucleic acid sequence or protein sequence of “class II major histocompatibility complex transactivator;” the human gene has accession number NC_000016.10 (range 10866208..10941562), reference GRCh38.pl3. The CIITA protein in the nucleus acts as a positive regulator of MHC class II gene transcription and is required for MHC class II protein expression.[000211] As used herein, “MHC” or “MHC molecule(s)” or “MHC protein” or “MHC complex(es),” refers to a major histocompatibility complex molecule (or plural), and includes, e.g., MHC class I and MHC class II molecules. In humans, MHC molecules are referred to as “human leukocyte antigen” complexes or “HLA molecules” or “HLA protein.” The use of terms “MHC” and “HLA” are not meant to be limiting; as used herein, the term “MHC” may be used to refer to human MHC molecules, i.e., HLA molecules. Therefore, the terms “MHC” and “HLA” are used interchangeably herein.[000212] The term “HL A- A,” as used herein in the context of HL A- A protein, refers to the MHC class I protein molecule, which is a heterodimer consisting of a heavy chain (encoded by the HLA-A gene) and a light chain (i.e., beta-2 microglobulin). The term “HLA- A” or “HLA-A gene,” as used herein in the context of nucleic acids refers to the gene encoding the heavy chain of the HLA-A protein molecule. The HLA-A gene is also referred to as “HLA class I histocompatibility, A alpha chain;” the human gene has accession number NC_000006.12 (29942532..29945870). The HLA-A gene is known to have thousands of different versions (also referred to as “alleles”) across the population (and an individual may receive two different alleles of the HLA-A gene). A public database for HLA-A alleles, including sequence information, may be accessed at IPD-IMGT / HLA:https: / / www.ebi.ac.uk / ipd / imgt / hla / . All alleles of HLA-A are encompassed by the terms “HLA-A” and “HLA-A gene.”[000213] “HLA-B” as used herein in the context of nucleic acids refers to the gene encoding the heavy chain of the HLA-B protein molecule. The HLA-B is also referred to as “HLA class I histocompatibility, B alpha chain;” the human gene has accession number NC_000006.12 (31353875..31357179).[000214] “HLA-C” as used herein in the context of nucleic acids refers to the gene encoding the heavy chain of the HLA-C protein molecule. The HLA-C is also referred to as “HLA class I histocompatibility, C alpha chain;” the human gene has accession number NC_000006.12 (31268749..31272092).[000215] “TRBC1” and “TRBC2” as used herein in the context of nucleic acids refer to two homologous genes encoding the T-cell receptor P-chain. “TRBC” or “TRBC1 / 2” is used herein to refer to TRBC1 and TRBC2. The human wild-type TRBC1 sequence is available at NCBI Gene ID: 28639; Ensembl: ENSG00000211751. T-cell receptor Beta Constant, V segment Translation Product, BV05S1J2.2, TCRBC1, and TCRB are gene synonyms for TRBC1. The human wild-type TRBC2 sequence is available at NCBI Gene ID: 28638;Ensembl: ENSG00000211772. T-cell receptor Beta Constant, V_segment Translation Product, and TCRBC2 are gene synonyms for TRBC2.[000216] “TRAC” is used to refer to the nucleic acid sequence or amino acid sequence of the “T cell receptor a chain”. A human wild-type TRAC sequence is available at NCBI Gene ID: 28755; Ensembl: ENSG00000277734. T-cell receptor Alpha Constant, TCRA, IMD7, TRCA and TRA are gene synonyms for TRAC.[000217] “TRBC” is used to refer to the nucleic acid sequence or amino acid sequence of the “T-cell receptor P-chain”, e.g., TRBC1 and TRBC2. “TRBC1” and “TRBC2” refer to two homologous genes encoding the T-cell receptor P-chain, which are the gene products of the TRBC1 or TRBC2 genes.[000218] A human wild-type TRBC1 sequence is available at NCBI Gene ID: 28639;Ensembl: ENSG00000211751. T-cell receptor Beta Constant, V segment Translation Product, BV05S1J2.2, TCRBC1, and TCRB are gene synonyms for TRBC1.[000219] A human wild-type TRBC2 sequence is available at NCBI Gene ID: 28638;Ensembl: ENSG00000211772. T-cell receptor Beta Constant, V_segment Translation Product, and TCRBC2 are gene synonyms for TRBC2.[000220] As used herein, the term “homozygous” refers to having two identical alleles of a particular gene.[000221 ] As used herein, “treatment” refers to any administration or application of a therapeutic for disease or disorder in a subject, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including reoccurrence of the symptom. [000222] As used herein, “delivering” and “administering” are used interchangeably, and include ex vivo and in vivo applications.[000223] Co-administration, as used herein, means that a plurality of substances are administered sufficiently close together in time so that the agents act together. Coadministration encompasses administering substances together in a single formulation and administering substances in separate formulations close enough in time so that the agents act together.[000224] As used herein, the phrase “pharmaceutically acceptable” means that which is useful in preparing a pharmaceutical composition that is generally non-toxic and is not biologically undesirable and that are not otherwise unacceptable for pharmaceutical use. Pharmaceutically acceptable generally refers to substances that are non-pyrogenic. Pharmaceutically acceptable can refer to substances that are sterile, especially for pharmaceutical substances that are for injection or infusion.[000225] As used herein, a “subject” refers to any member of the animal kingdom. In some embodiments, “subject” refers to humans. In some embodiments, “subject” refers to non-human animals. In some embodiments, “subject” refers to primates. In some embodiments, subjects include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, or worms. In certain embodiments, the non-human subject is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, a subject may be a transgenic animal, genetically-engineered animal, or a clone. In certain embodiments of the present invention the subject is an adult, an adolescent, or an infant. In some embodiments, terms “individual” or “patient” are used and are intended to be interchangeable with “subject”.[000226] As used herein, “reduced or eliminated” expression of a protein on a cell refers to a partial or complete loss of expression of the protein relative to an unmodified cell. In some embodiments, the surface expression of a protein on a cell is measured by flow cytometry and has “reduced or eliminated” surface expression relative to an unmodified cell as evidenced by a reduction in fluorescence signal upon staining with the same antibody against the protein. A cell that has “reduced or eliminated” surface expression of a protein by flow cytometry relative to an unmodified cell may be referred to as “negative” for expressionof that protein as evidenced by a fluorescence signal similar to a cell stained with an isotype control antibody. The “reduction or elimination” of protein expression can be measured by other known techniques in the field with appropriate controls known to those skilled in the art. As used herein, “eliminated” expression is understood as a reduction of expression to below the level of detection of the protein by the method used.[000227] The term “about” or “approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, or a degree of variation that does not substantially affect the properties of the described subject matter, or within the tolerances accepted in the art, e.g., within 10%, 5%, 2%, or 1% or within two standard deviations of a set of values. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.[000228] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention is described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims and included embodiments.[000229] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, reference to “a conjugate” includes a plurality of conjugates and reference to “a cell” includes a plurality of cells and the like.[000230] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. Also, the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general descriptionand detailed description are exemplary and explanatory only and are not restrictive of the teachings.[000231] Unless specifically noted in the specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of’ or “consisting essentially of’ the recited components; embodiments in the specification that recite “consisting of’ various components are also contemplated as “comprising” or “consisting essentially of’ the recited components; and embodiments in the specification that recite “consisting essentially of’ various components are also contemplated as “consisting of’ or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims).[000232] The term “or” is used in an inclusive sense, z.e., equivalent to “and / or,” unless the context clearly indicates otherwise.[000233] The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined in this specification or any other express content of this specification, this specification controls. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.II. Methods of Genetically Modifying Cells[000234] In some embodiments, provided herein is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool, wherein the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.[000235] In some embodiments, provided herein is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool comprising a first genomic editor comprising a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the base editor, thereby producing a population of editedcells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.[000236] In some embodiments, provided herein is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-2) contacting the population of cells with a second genome editing tool comprising a second genomic editor comprising an RNA-guided cleavase and at least one gRNA that targets at least one genomic locus and that is cognate to the RNA-guided cleavase, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.[000237] In some embodiments, provided herein is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool, wherein the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor; and (b-2) contacting the population of cells with a second genome editing tool, wherein the second genome editing tool comprises a second genomic editor and at least one gRNA that targets at least one genomic locus and that is cognate to the second genomic editor, wherein the first genomic editor is orthogonal to the second genomic editor, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.[000238] In some embodiments, provided herein is an ex vivo method of genetically modifying a population of cells, comprising: (a) activating the population of cells; (b-1) contacting the population of cells with a first genome editing tool comprising a first genomic editor comprising a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the base editor; and (b-2) contacting the population of cells with a second genome editing tool comprising a second genomic editor comprising an RNA-guided cleavase and at least one gRNA that targets at least one genomic locus and that is cognate to the RNA-guided cleavase, wherein the base editor is orthogonal to the RNA- guided cleavase, thereby producing a population of edited cells; and (c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.[000239] In some embodiments, any of the methods provided herein further comprises (b-3) contacting the population of cells with a nucleic acid encoding at least one exogenousgene. The nucleic acid may be, for example, any of the donor nucleic acids described in this application, including those described in the Donor Nucleic Acid section below.[000240] In some embodiments, step (a) and step (b-1) are performed on the same day. In some embodiments, step (b-1) is performed 1 day after the day on which step (a) is performed. In some embodiments, step (b-1) is performed 2 days after the day on which step (a) is performed. In some embodiments, step (b-1) is performed 3 days after the day on which step (a) is performed. In some embodiments, step (b-1) is performed 4 days after the day on which step (a) is performed. In some embodiments, step (b-1) is performed 5 days after the day on which step (a) is performed. In some embodiments, step (b-1) is performed 6 days after the day on which step (a) is performed. In some embodiments, step (b-1) is performed 7 days after the day on which step (a) is performed.[000241] In some embodiments, step (a) and step (b-2) are performed on the same day. In some embodiments, step (b-2) is performed 1 day after the day on which step (a) is performed. In some embodiments, step (b-2) is performed 2 days after the day on which step (a) is performed. In some embodiments, step (b-2) is performed 3 days after the day on which step (a) is performed. In some embodiments, step (b-2) is performed 4 days after the day on which step (a) is performed. In some embodiments, step (b-2) is performed 5 days after the day on which step (a) is performed. In some embodiments, step (b-2) is performed 6 days after the day on which step (a) is performed. In some embodiments, step (b-2) is performed 7 days after the day on which step (a) is performed.[000242] In some embodiments, step (a) and step (b-3) are performed on the same day. In some embodiments, step (b-3) is performed 1 day after the day on which step (a) is performed. In some embodiments, step (b-3) is performed 2 days after the day on which step (a) is performed. In some embodiments, step (b-3) is performed 3 days after the day on which step (a) is performed. In some embodiments, step (b-3) is performed 4 days after the day on which step (a) is performed. In some embodiments, step (b-3) is performed 5 days after the day on which step (a) is performed. In some embodiments, step (b-3) is performed 6 days after the day on which step (a) is performed. In some embodiments, step (b-3) is performed 7 days after the day on which step (a) is performed.[000243] In some embodiments, step (b-1) and step (b-2) are performed on the same day. In some embodiments, step (b-1) and step (b-2) are performed simultaneously. In some embodiments, step (b-2) is performed 1 day after the day on which step (b-1) is performed. In some embodiments, step (b-2) is performed 2 days after the day on which step (b-1) is performed. In some embodiments, step (b-2) is performed 3 days after the day on which step(b-1) is performed. In some embodiments, step (b-2) is performed 4 days after the day on which step (b-1) is performed. In some embodiments, step (b-2) is performed 5 days after the day on which step (b-1) is performed.[000244] In some embodiments, step (b-1) and step (b-3) are performed on the same day. In some embodiments, step (b-1) and step (b-3) are performed simultaneously. In some embodiments, step (b-3) is performed 1 day after the day on which step (b-1) is performed. In some embodiments, step (b-3) is performed 2 days after the day on which step (b-1) is performed. In some embodiments, step (b-3) is performed 3 days after the day on which step (b-1) is performed. In some embodiments, step (b-3) is performed 4 days after the day on which step (b-1) is performed. In some embodiments, step (b-3) is performed 5 days after the day on which step (b-1) is performed.[000245] In some embodiments, step (b-2) and step (b-3) are performed on the same day. In some embodiments, step (b-2) and step (b-3) are performed simultaneously. In some embodiments, step (b-3) is performed 1 day after the day on which step (b-2) is performed. In some embodiments, step (b-3) is performed 2 days after the day on which step (b-2) is performed. In some embodiments, step (b-3) is performed 3 days after the day on which step (b-2) is performed. In some embodiments, step (b-3) is performed 4 days after the day on which step (b-2) is performed. In some embodiments, step (b-3) is performed 5 days after the day on which step (b-2) is performed.[000246] In some embodiments, step (a), step (b-1), and step (b-2) are performed on the same day. In some embodiments, step (b-1), and step (b-2), and step (b-3) are performed on the same day. In some embodiments, step (b-1), step (b-2), and step (b-3) are performed simultaneously. In some embodiments, step (a), step (b-1), step (b-2), and step (b-3) are performed on the same day.[000247] In some embodiments, step (a) is performed no later than 7 days, no later than 6 days, no later than 5 days, no later than 4 days, no later than 3 days, no later than 2 days, or no later than 1 day after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed no later than 7 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed 7 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed no later than 6 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed 6 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed no later than 5 days after the day the population of cellswas thawed or collected from a donor. In some embodiments, step (a) is performed 5 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed no later than 4 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed 4 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed no later than 3 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed 3 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed no later than 2 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed no later than 2 days after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed no later than 1 day after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed 1 day after the day the population of cells was thawed or collected from a donor. In some embodiments, step (a) is performed on the day the population of cells was thawed or on the day on which the population of cells was collected from a donor.[000248] In some embodiments, any of the methods provided herein further comprises (d) storing the population of edited cells, wherein step (d) is performed no later than 2 days after the day on which step (c) is performed. In some embodiments, step (d) is performed 2 days after the day on which step (c) is performed. In some embodiments, step (d) is performed no later than 1 day after the day on which step (c) is performed. In some embodiments, step (d) is performed 1 day after the day on which step (c) is performed. In some embodiments, step (d) is performed on the day on which step (c) is performed. In some embodiments, the storing the population of edited cells comprises freezing the population of edited cells.III. First Genome Editing Tool[000249] In some embodiments, the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor. In some embodiments, the first genome editing tool comprises a first genomic editor comprising a base editor, and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the base editor. [000250] In some embodiments, the first genomic editor is delivered to the population of cells as at least one polypeptide or at least one mRNA. In some embodiments, the firstgenomic editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the first genomic editor comprises a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.[000251] In some embodiments, the first genomic editor comprises a Cas nuclease. In some embodiments, the Cas nuclease is a Cas9. In some embodiments, the Cas9 is Streptococcus pyogenes Cas9 (SpyCas9), S. aureus Cas9 (SauCas9), C. diphtheriae Cas9 (CdiCas9), Streptococcus thermophilus Cas9 (StlCas9), A. cellulolyticus Cas9 (AceCas9), C. jejuni Cas9 (CjeCas9). R. palustris Cas9 (RpaCas9), R. rubrum Cas9 (RruCas9), A. naeslundii Cas9 (AnaCas9), Francisella novicida Cas9 (FnoCas9), or N. meningitidis (NmeCas9). In some embodiments, the Cas9 is an NmelCas9, an Nme2Cas9, an Nme3Cas9, or SpyCas9. In some embodiments, the Cas nuclease is a Class 2 Cas nuclease. In some embodiments, the Cas nuclease is a Casl2. In some embodiments, the Casl2 is Lachnospiraceae bacterium Casl2a (LbCasl2a) or the Casl2 is Acidaminococcus sp. Casl2a (AsCasl2a). In some embodiments, the Cas nuclease is an Eubacterium siraeum Casl3d (EsCasl3d).[000252] In some embodiments, the first genomic editor or the base editor comprises a cytidine deaminase (e.g., A3 A). In some embodiments, the first genomic editor or the base editor comprises a cytidine deaminase (including any one of the cytidine deaminases disclosed herein, e.g., A3 A), and an RNA-guided nickase (including any one of the RNA- guided nickases disclosed herein). In some embodiments, the base editor is a C to T base editor, optionally comprising a cytidine deaminase, or an A to G base editor, optionally comprising an adenosine deaminase.[000253] In some embodiments, the first genomic editing tool may be combined with any second genomic editing tool disclosed herein.A. UGI[000254] In some embodiments, the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are comprised in a single polypeptide. In some embodiments, the first genome editing tool comprises a UGI, and the UGI and the base editor are comprised in different polypeptides. In some embodiments, the base editor comprises a cytidine deaminase and an RNA-guided nickase. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in a single polypeptide. In some embodiments, the cytidine deaminase, the RNA-guidednickase, and the UGI are comprised in different polypeptides. In some embodiments, the cytidine deaminase and the RNA-guided nickase are comprised in a single polypeptide, and wherein the UGI is comprised in a different polypeptide.[000255] Without being bound by any theory, providing a UGI together with a polypeptide comprising a deaminase may be helpful in the methods described herein by inhibiting cellular DNA repair machinery (e.g., UDG and downstream repair effectors) that recognize a uracil in DNA as a form of DNA damage or otherwise would excise or modify the uracil and / or surrounding nucleotides. It should be understood that the use of a UGI may increase the editing efficiency of an enzyme that is capable of deaminating C residues. [000256] Suitable UGI protein and nucleotide sequences are provided herein and additional suitable UGI sequences are known to those in the art, and include, for example, those published in Wang et al., Uracil-DNA glycosylase inhibitor gene of bacteriophage PBS2 encodes a binding protein specific for uracil-DNA glycosylase. J. Biol. Chem. 264: 1163-1171(1989); Lundquist et al., Site-directed mutagenesis and characterization of uracil- DNA glycosylase inhibitor protein. Role of specific carboxylic amino acids in complex formation with Escherichia coli uracil-DNA glycosylase. J. Biol. Chem. 272:21408- 21419(1997); Ravishankar et al., X-ray analysis of a complex of Escherichia coli uracil DNA glycosylase (EcUDG) with a proteinaceous inhibitor. The structure elucidation of a prokaryotic UDG. Nucleic Acids Res. 26:4880-4887(1998); and Putnam et al., Protein mimicry of DNA from crystal structures of the uracil-DNA glycosylase inhibitor protein and its complex with Escherichia coli uracil-DNA glycosylase. J. Mol. Biol. 287:331-346(1999), the entire contents of each are incorporated herein by reference. It should be appreciated that any proteins that are capable of inhibiting a uracil-DNA glycosylase base-excision repair enzyme are within the scope of the present disclosure. Additionally, any proteins that block or inhibit base-excision repair are also within the scope of this disclosure. In some embodiments, a uracil glycosylase inhibitor is a protein that binds uracil. In some embodiments, a uracil glycosylase inhibitor is a protein that binds uracil in DNA. In some embodiments, a uracil glycosylase inhibitor is a single-stranded binding protein. In some embodiments, a uracil glycosylase inhibitor is a catalytically inactive uracil DNA-glycosylase protein. In some embodiments, a uracil glycosylase inhibitor is a catalytically inactive uracil DNA-glycosylase protein that does not excise uracil from the DNA. In some embodiments, a uracil glycosylase inhibitor is a catalytically inactive UDG.[000257] In some embodiments, a uracil glycosylase inhibitor (UGI) disclosed herein comprises an amino acid sequence with at least 80% to SEQ ID NO: 15 or 24. In someembodiments, any of the foregoing levels of identity is at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the UGI comprises an amino acid sequence with at least 90% identity to SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence with at least 95% identity to SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence with at least 98% identity to SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence with at least 99% identity to SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises the amino acid sequence of SEQ ID NO: 15 or 24.B. Cytidine Deaminase[000258] Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and in particular, enzymes of the APOB EC family (APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminase (AID or AICDA) and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol. 22:367- 77, 2005; Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol. Chem. 274: 18470-6, 1999); and Carrington et al., Cells 9: 1690 (2020)).[000259] In some embodiments, the cytidine deaminase disclosed herein is an enzyme of APOBEC family. In some embodiments, the cytidine deaminase disclosed herein is an enzyme of APOBEC 1, APOBEC2, APOBEC4, and APOBEC3 subgroups. In some embodiments, the cytidine deaminase disclosed herein is an enzyme of APOBEC3 subgroup. In some embodiments, the cytidine deaminase disclosed herein is an APOBEC3 A deaminase (A3A).[000260] In some embodiments, the cytidine deaminase is a cytidine deaminase comprising an amino acid sequence having at least 80%, 85% 87%, 90%, 95%, 98%, 99%, or 100% identity to SEQ ID NO: 22. / . APOBEC3A Deaminase[000261] In some embodiments, an APOBEC3A deaminase (A3 A) disclosed herein is a human A3 A. In some embodiments, the A3 A is a wild-type A3 A.[000262] In some embodiment, the A3 A is an A3 A variant. A3 A variants share homology to wild-type A3 A, or a fragment thereof. In some embodiments, a A3 A variant has at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about99.9% identity to a wild type A3 A. In some embodiments, the A3A variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid changes compared to a wild type A3 A. In some embodiments, the A3 A variant comprises a fragment of an A3 A, such that the fragment has at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity to the corresponding fragment of a wild-type A3 A.[000263] In some embodiments, an A3 A variant is a protein having a sequence that differs from a wild-type A3 A protein by one or several mutations, such as substitutions, deletions, insertions, one or several single point substitutions. In some embodiments, a shortened A3 A sequence could be used, e.g., by deleting N-terminal, C-terminal, or internal amino acids. In some embodiments, a shortened A3 A sequence is used where one to four amino acids at the C-terminus of the sequence is deleted. In some embodiments, an APOBEC3 A (such as a human APOBEC3 A) has a wild-type amino acid position 57 (as numbered in the wild-type sequence). In some embodiments, an APOBEC3 A (such as a human APOBEC3 A) has an asparagine at amino acid position 57 (as numbered in the wildtype sequence).[000264] In some embodiments, the wild-type A3 A is a human A3 A (UniPROT accession ID: p319411, SEQ ID NO: 22).[000265] In some embodiments, the A3A disclosed herein comprises an amino acid sequence having at least 80% identity to SEQ ID NO: 22. In some embodiments, the level of identity is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the A3 A comprises an amino acid sequence having at least 87% identity to SEQ ID NO: 22. In some embodiments, the A3A comprises an amino acid sequence with at least 90% identity to SEQ ID NO: 22. In some embodiments, the A3A comprises an amino acid sequence with at least 95% identity to SEQ ID NO: 22. In some embodiments, the A3 A comprises an amino acid sequence with at least 98% identity to SEQ ID NO: 22. In some embodiments, the A3A comprises an amino acid sequence with at least 99% identity to A3A SEQ ID NO: 22. In some embodiments, the A3A comprises the amino acid sequence of SEQ ID NO: 22.C. Linkers[000266] In some embodiments, the first genomic editor or the base editor described herein further comprises a linker that connects the deaminase and the RNA-guided nickase. In some embodiments, the linker is an organic molecule, polymer, or chemical moiety. In some embodiments, the linker is a peptide linker. In some embodiments, the nucleic acid encoding the polypeptide comprising the deaminase and the RNA-guided nickase further comprises a sequence encoding the peptide linker. mRNAs encoding the deaminase-linker- RNA-guided nickase fusion protein are provided.[000267] In some embodiments, the peptide linker is any stretch of amino acids having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, or more amino acids.[000268] In some embodiments, the peptide linker is the 16 residue “XTEN” linker, or a variant thereof (See, e.g., Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises a sequence that is any one of SGSETPGTSESATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27). In some embodiments, the XTEN linker consists of the sequence SGSETPGTSESATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27).[000269] In some embodiments, the peptide linker comprises a (GGGGS)n (e.g., SEQ ID NOs: 73, 77, 82, 101), a (G)n, an (EAAAK)n (e.g., SEQ ID NOs: 74, 80, 128), a (GGS)n, an SGSETPGTSESATPES (SEQ ID NO: 25) motif (see, e.g., Guilinger J P, Thompson D B, Liu D R. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 2014; 32(6): 577-82; the entire contents are incorporated herein by reference), or an (XP)nmotif (SEQ ID NO: 407), or a combination of any of these, wherein n is independently an integer between 1 and 30. See, W02015089406, e.g., paragraph

[0012] , the entire content of which is incorporated herein by reference.[000270] In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NOs: 25-39 and 72-133. In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131. SEQ ID NO: 132 and SEQID NO: 133. In some embodiments, the peptide linker comprises a sequence of SEQ ID NO: 129.D. RNA-guided nickase[000271] In some embodiments, an RNA-guided nickase disclosed herein is a Cas nickase. In some embodiments, an RNA-guided nickase is from a specific Cas nuclease with its catalytic domain(s) being inactivated. In some embodiments, the RNA-guided nickase is a Class 2 Cas nickase, such as a Cas9 nickase or a Cpfl nickase. In some embodiments, the RNA-guided nickase is an S. pyogenes Cas9 nickase. In some embodiments, the RNA-guided nickase is Neisseria meningitidis Cas9 nickase.[000272] In some embodiments, the RNA-guided nickase is a modified Class 2 Cas protein or derived from a Class 2 Cas protein. In some embodiments, the RNA-guided nickase is modified or derived from a Cas protein, such as a Class 2 Cas nuclease (which may be, e.g., a Cas nuclease of Type II, V, or VI). Class 2 Cas nuclease include, for example, Cas9, Cpfl (Cas 12a), C2cl, C2c2, and C2c3 proteins and modifications thereof. Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, e.g., the list in the next paragraph), and modified (e.g., engineered or mutant) versions thereof. See, e.g., US2016 / 0312198 Al; US 2016 / 0312199 Al, which is incorporated by reference in its entirety. Other examples of Cas nucleases include a Csm or Cmr complex of a type III CRISPR system or the Cas 10, Csml, or Cmr2 subunit thereof; and a Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof. In some embodiments, the Cas nuclease may be from a Type-IIA, Type-IIB, or Type-IIC system. For discussion of various CRISPR systems and Cas nucleases, see, e.g., Makarova et al., NAT. REV. MICROBIOL. 9:467-477 (2011); Makarova et al., NAT. REV. MICROBIOL, 13: 722-36 (2015); Shmakov et al., MOLECULAR CELL, 60:385-397 (2015).[000273] A Cas nickase described herein may be a nickase form of a Cas nuclease from the species including, but not limited to, Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacteriumsibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaerawatsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalter omonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, or Acaryochloris marina.[000274] In some embodiments, the Cas nickase is a nickase form of the Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nickase is a nickase form of the Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nickase is a nickase form of the Cas9 nuclease from Neisseria meningitidis. See e.g., WO / 2020081568, describing an Nme2Cas9 D16A nickase. In some embodiments, the Cas nickase is a nickase form of the Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nickase is a nickase form of the Cpfl nuclease from Francisella novicida. In some embodiments, the Cas nickase is a nickase form of the Cpfl nuclease from Acidaminococcus sp. In some embodiments, the Cas nickase is a nickase form of the Cpfl nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nickase is a nickase form of the Cpfl nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nickase is a nickase form of a Cpfl nuclease from an Acidaminococcus or Lachnospiraceae . As discussed elsewhere, a nickase may be derived from (i.e., related to) a specific Cas nuclease in that the nickase is a form of the nuclease in which one of its two catalytic domains is inactivated, e.g., by mutating an active site residue essential for nucleolysis, such as DIO, H840, or N863 in Spy Cas9. One skilled in the art will be familiar with techniques for easily identifyingcorresponding residues in other Cas proteins, such as sequence alignment and structural alignment, which is discussed in detail below.[000275] In other embodiments, the Cas nickase may relate to a Type-I CRISPR / Cas system. In some embodiments, the Cas nickase may be a component of the Cascade complex of a Type-I CRISPR / Cas system. In some embodiments, the Cas nickase may be a Cas3 protein. In some embodiments, the Cas nickase may be from a Type-III CRISPR / Cas system. [000276] In some embodiments, a Cas nickase is a nickase form of a Cas nuclease or a modified Cas nuclease in which an endonucleolytic active site is inactivated, e.g., by one or more alterations (e.g., point mutations) in a catalytic domain. See, e.g., US Pat. No. 8,889,356 for discussion of Cas nickases and exemplary catalytic domain alterations.[000277] Wild type S. pyogenes Cas9 has two catalytic domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, a Cas nuclease may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22: 163(3): 759-771. In some embodiments, the Cas nuclease may comprise an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the . pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain or RuvC or RuvC-like domains for N. meningitidis include Nme2Cas9D16A (HNH nickase) and Nme2Cas9H588A (RuvC nickase). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpfl (FnCpfl) sequence (UniProtKB - A0Q7Q2 (CPF1 FRATN)).[000278] In some embodiments, a Cas nickase such as a Cas9 nickase has an inactivated RuvC or HNH domain. In some embodiments, a nickase is used having a RuvC domain with reduced activity. In some embodiments, a nickase is used having an inactive RuvC domain. In some embodiments, a nickase is used having an HNH domain with reduced activity. In some embodiments, a nickase is used having an inactive HNH domain.[000279] In some embodiments, a Cas9 nickase has an active HNH nuclease domain and is able to cleave the non-targeted strand of DNA, i.e., the strand bound by the gRNA and has an inactive RuvC nuclease domain and is not able to cleave the targeted strand of the DNA, i.e., the strand where base editing by deaminase is desired.[000280] An exemplary Cas9 nickase amino acid sequence is provided as SEQ ID NO: 41. An exemplary Cas9 nickase mRNA coding sequence, suitable for inclusion in a fusion protein, is provided as SEQ ID NO: 42.[000281] In some embodiments, the RNA-guided nickase is a Class 2 Cas nickase described herein. In some embodiments, the RNA-guided nickase is a Cas9 nickase described herein.[000282] In some embodiments, the RNA-guided nickase is an S. pyogenes Cas9 nickase described herein.[000283] In some embodiments, the RNA-guided nickase is a D10A SpyCas9 nickase described herein. In some embodiments, the RNA-guided nickase comprises an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NO: 41, 43, or 45. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 41.[000284] In some embodiments, the nucleic acid or the first ORF encoding the polypeptide comprises a nucleotide sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity to the nucleotide sequence of any one of SEQ ID NOs: 42, 44, or 46. In some embodiments, the nucleic acid or the first ORF encoding the polypeptide comprises a nucleotide sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity to the nucleotide sequence of any one of SEQ ID NOs: 42, 44, and 46-58. In some embodiments, the level of identity is at least 90%. In some embodiments, the level of identity is at least 95%. In some embodiments, the level of identity is at least 98%. In some embodiments, the level of identity is at least 99%. In some embodiments, the level of identity is at least 100%. In some embodiments, the sequence encoding the RNA-guided nickase comprises the nucleotide sequence of any one of SEQ ID NOs: 42, 44, and 46.[000285] In some embodiments, the RNA-guided nickase is Neisseria meningitidis (Nme) Cas9 nickase described herein.[000286] In some embodiments, the RNA-guided nickase is a D16A NmeCas9 nickase described herein. In some embodiments, the D16A NmeCas9 nickase is a D16A Nme2Cas9 nickase. In some embodiments, the D16A Nme2Cas9 nickase comprises an amino acid sequence at least 80%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 149. In some embodiments, the sequence encoding the D16A Nme2Cas9 comprises a nucleotide sequence at least 80%, 90%, 95%, 98%, 99% or 100% identical to any one of SEQ ID NOs: 150-155.E. Compositions comprising a cytidine deaminase and an RNA-guided nickase[000287] In some embodiments, the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor. In some embodiments, the first genome editing tool comprises a first genomic editor comprising a base editor, and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the base editor.[000288] In some embodiments, the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are comprised in a single polypeptide. In some embodiments, the first genome editing tool comprises a UGI, and the UGI and the base editor are comprised in different polypeptides. In some embodiments, the base editor comprises a cytidine deaminase and an RNA-guided nickase. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in a single polypeptide. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in different polypeptides. In some embodiments, the cytidine deaminase and the RNA-guided nickase are comprised in a single polypeptide, and wherein the UGI is comprised in a different polypeptide. / . Exemplary Compositions[000289] In some embodiments, a first genomic editor (e.g., base editor) comprising a deaminase (e.g., a cytidine deaminase) and an RNA-guided nickase is provided. In some embodiments, an enzyme of APOBEC family and an RNA-guided nickase is provided. In some embodiments, the first genomic editor comprises an enzyme of APOBEC 1 subgroup and an RNA-guided nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC2 subgroup and an RNA-guided nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC4 subgroup and an RNA-guided nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and an RNA-guided nickase.[000290] In some embodiments, a first genomic editor or a base editor comprising a deaminase (e.g., a cytidine deaminase) and an RNA-guided nickase is provided. In some embodiments, an enzyme of APOBEC family and a D10A SpyCas9 nickase is provided. In some embodiments, the first genomic editor comprises an enzyme of APOBEC 1 subgroup and a D10A SpyCas9 nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC2 subgroup and a D10A SpyCas9 nickase. In some embodiments, thefirst genomic editor comprises an enzyme of APOBEC 4 subgroup and a D10A SpyCas9 nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D10A SpyCas9 nickase.[000291] In some embodiments, a first genomic editor or a base editor comprising a deaminase (e.g., a cytidine deaminase) and an RNA-guided nickase is provided. In some embodiments, an enzyme of APOBEC family and a D16A NmeCas9 nickase is provided. In some embodiments, an enzyme of APOBEC family and a D16A Nme2Cas9 nickase is provided. In some embodiments, the first genomic editor comprises an enzyme of APOBEC 1 subgroup and a D16A Nme2Cas9 nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC2 subgroup and a D16A Nme2Cas9 nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC4 subgroup and a D16A Nme2Cas9 nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D16A Nme2Cas9 nickase.[000292] In some embodiments, the first genomic editor lacks a UGI. In some embodiments, the first genomic editor contains one or more UGIs.[000293] In some embodiments, the cytidine deaminase and the RNA-guided nickase are linked via a linker. In some embodiments, the cytidine deaminase and the RNA-guided nickase are linked via a peptide linker. In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NOs: 25-39 and 72-133.[000294] In some embodiments, the first genomic editor further comprises one or more additional heterologous functional domains. In some embodiments, the first genomic editor further comprises one or more nuclear localization sequences (NLSs) (described herein) at the C-terminal of the polypeptide or the N-terminal of the polypeptide.[000295] In some embodiments, a first genomic editor or a base editor comprising a deaminase (e.g., a cytidine deaminase) and an RNA-guided nickase is provided. In some embodiments, an enzyme of APOBEC family and an RNA-guided nickase is provided. In some embodiments, the first genomic editor comprises an enzyme of APOBEC 1 subgroup and an RNA-guided nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC2 subgroup and an RNA-guided nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC4 subgroup and an RNA-guided nickase. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and an RNA-guided nickase.[000296] In some embodiments, a first genomic editor or a base editor comprising a deaminase (e.g., a cytidine deaminase) and an RNA-guided nickase is provided. In someembodiments, an enzyme of APOBEC family and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC family and the D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D10A SpyCas9 nickase, and a nuclear localization sequence (NLS) at the C-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D10A SpyCas9 nickase, and a NLS at the N-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC family and the D10A SpyCas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D10A SpyCas9 nickase, optionally via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC family and the D10A SpyCas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D10A SpyCas9 nickase, optionally via a linker.[000297] In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D16A NmeCas9 nickase, wherein the enzyme of APOBEC family and the D16A NmeCas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC family and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D16A Nme2Cas9 nickase, and a nuclear localization sequence (NLS) at the C- terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D16A Nme2Cas9 nickase, and a NLS at the N-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC family and the D16A Nme2Cas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D16A Nme2Cas9 nickase, optionally via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC family and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC family and the D16A Nme2Cas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D16A Nme2Cas9 nickase, optionally via a linker.[000298] In some embodiments, the first genomic editor comprises an enzyme of APOBEC 1 subgroup and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC 1 subgroup and the D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC 1 subgroup and a D10A SpyCas9nickase, and a nuclear localization sequence (NLS) at the C-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D10A SpyCas9 nickase, and a NLS at the N-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC1 subgroup and the D10A SpyCas9 nickase are fused via a linker, and a NLS fused to the C- terminus of the D10A SpyCas9 nickase, optionally via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC1 subgroup and the D10A SpyCas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D10A SpyCas9 nickase, optionally via a linker.[000299] In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC1 subgroup and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC1 subgroup and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D16A Nme2Cas9 nickase, and a nuclear localization sequence (NLS) at the C-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D16A Nme2Cas9 nickase, and a NLS at the N-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC1 subgroup and the D16A Nme2Cas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D16A Nme2Cas9 nickase, optionally via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC1 subgroup and a D16A Nme2Cas9 nickase, wherein the enzyme of APOB EC 1 subgroup and the D16A Nme2Cas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D16A Nme2Cas9 nickase, optionally via a linker.[000300] In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC3 subgroup and the D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D10A SpyCas9 nickase, and a nuclear localization sequence (NLS) at the C-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme ofAP0BEC3 subgroup and a D10A SpyCas9 nickase, and a NLS at the N-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC3 subgroup and the D10A SpyCas9 nickase are fused via a linker, and a NLS fused to the C- terminus of the D10A SpyCas9 nickase, optionally via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D10A SpyCas9 nickase, wherein the enzyme of APOBEC3 subgroup and the D10A SpyCas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D10A SpyCas9 nickase, optionally via a linker.[000301 ] In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC3 subgroup and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC3 subgroup and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D16A Nme2Cas9 nickase, and a nuclear localization sequence (NLS) at the C-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D16A Nme2Cas9 nickase, and a NLS at the N-terminus of the fused polypeptide. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC3 subgroup and the D16A Nme2Cas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D16A Nme2Cas9 nickase, optionally via a linker. In some embodiments, the first genomic editor comprises an enzyme of APOBEC3 subgroup and a D16A Nme2Cas9 nickase, wherein the enzyme of APOBEC3 subgroup and the D16A Nme2Cas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D16A Nme2Cas9 nickase, optionally via a linker.[000302] In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminasecomprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In any of the foregoing embodiments, the D10A SpyCas9 nickase may comprise an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 41, 43, and 45.[000303] In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In any of the foregoing embodiments, the D16A Nme2Cas9 nickase may comprise an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 149.[000304] In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genomic editor comprises aD10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In any of the foregoing embodiments, the D10A SpyCas9 comprises an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 41, 43, and 45.[000305] In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genomic editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In any of the foregoing embodiments, the D16A Nme2Cas9 nickase comprises an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 149.[000306] The first genomic editor may be organized in any number of ways to form a single chain. The NLS can be N- or C-terminal, or both N- and C-terminals, and the cytidine deaminase can be N- or C-terminal as compared the RNA-guided nickase. In some embodiments, the first genomic editor comprises, from N to C terminus, a cytidine deaminase, an optional linker, an RNA-guided nickase, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an RNA-guided nickase, an optional linker, a cytidine deaminase, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, anRNA-guided nickase, an optional linker, and a cytidine deaminase. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, and a cytidine deaminase, and an optional NLS.[000307] In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an enzyme of APOBEC family, an optional linker, an RNA- guided nickase, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, an enzyme of APOBEC family and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, an enzyme of APOBEC family, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, an enzyme of APOBEC family, and an optional NLS.[000308] In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an enzyme of APOBEC3 subgroup, an optional linker, an RNA- guided nickase, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, an enzyme of APOBEC3 subgroup and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, an enzyme of APOBEC3 subgroup, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, an enzyme of APOBEC3 subgroup, and an optional NLS.[000309] In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an enzyme of APOBEC family, an optional linker, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional linker, an enzyme of APOBEC family and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional linker, an enzyme of APOBEC family, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional linker, and an enzyme of APOBEC family, and an optional NLS.[000310] In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an enzyme of APOBEC3 subgroup, an optional linker, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional linker, an enzyme of APOBEC3 subgroup and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional linker, an enzyme of APOBEC3 subgroup, and an optional NLS. In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional linker, and an enzyme of APOBEC3 subgroup, and an optional NLS.[000311] In some embodiments, the first genomic editor comprises, from N to C terminus, an optional NLS, an enzyme of APOBEC3 subgroup, an optional linker, a D16A Nme2Cas9 nickase.[000312] In some embodiments, the first genomic editor comprises, from N to C terminus, (i) an optional NLS; (ii) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 22; (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39 and 72-133, (iv) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and (v) an optional NLS.[000313] In some embodiments, the first genomic editor comprises, from N to C terminus, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 22, and (v) an optional NLS.[000314] In some embodiments, the first genomic editor comprises, from N to C terminus, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 22, and (v) an optional NLS.[000315] In some embodiments, the first genomic editor comprises, from N to C terminus, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39 and 72-133, (iv) cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 22, and (v) an optional NLS.[000316] In some embodiments, the first genomic editor comprises, from N to C terminus, (i) an optional NLS, (ii) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 22; (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39 and 72-133, (iv) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and (v) an optional NLS.[000317] In some embodiments, the first genomic editor comprises, from N to C terminus, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 22, and (v) an optional NLS.[000318] In some embodiments, the first genomic editor comprises, from N to C terminus, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 22, and (v) an optional NLS.[000319] In some embodiments, the first genomic editor comprises, from N to C terminus, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39 and 72-133, and (iv) cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 22, and (v) an optional NLS.2. Compositions comprising an APOBEC3A deaminase and an RNA-guided nickase[000320] In some embodiments, a first genome editing tool comprising a first genomic editor is provided. In some embodiments, the first genomic editor comprises a base editor. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and an RNA-guided nickase. In some embodiments, the first genomic editor or the base editor comprises a wild-type A3 A and an RNA-guided nickase. In some embodiments, the first genomic editor or the base editor comprises an A3 A variant and an RNA-guided nickase. In some embodiments, the first genomic editor or the base editor comprises an A3 A and a Cas9 nickase. In some embodiments, the first genomic editor or the base editor comprises an A3 A and a D10A SpyCas9 nickase. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D10A SpyCas9 nickase. In some embodiments, the first genomic editor or the base editor comprises an A3 A variant and a D10A SpyCas9 nickase. Insome embodiments, the first genomic editor or the base editor lacks a UGI. In some embodiments, the first genomic editor or the base editor comprises one or more UGIs. In some embodiments, the first genomic editor or the base editor comprises two UGIs. In some embodiments, the A3 A and the RNA-guided nickase are linked via a linker. In some embodiments, the first genomic editor or the base editor further comprises one or more additional heterologous functional domains. In some embodiments, the first genomic editor or the base editor further comprises a nuclear localization sequence (NLS) (described herein) at the C-terminal of the polypeptide or the N-terminal of the polypeptide.[000321] In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D10A SpyCas9 nickase, wherein the human A3 A and the D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D10A SpyCas9 nickase, and a nuclear localization sequence (NLS) at the C-terminus of the fused polypeptide. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D10A SpyCas9 nickase, and a NLS at the N-terminus of the fused polypeptide. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D10A SpyCas9 nickase, wherein the human A3 A and the D10A SpyCas9 nickase are fused via a linker, and a NLS fused to the C- terminus of the D10A SpyCas9 nickase, optionally via a linker. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D10A SpyCas9 nickase, wherein the human A3 A and the D10A SpyCas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D10A SpyCas9 nickase, optionally via a linker.[000322] In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D16A NmeCas9 nickase, wherein the human A3 A and the D16A NmeCas9 nickase are fused via a linker. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D16A NmeCas9 nickase, and a nuclear localization sequence (NLS) at the C-terminus of the fused polypeptide. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D16A NmeCas9 nickase, and a NLS at the N-terminus of the fused polypeptide. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D16A NmeCas9 nickase, wherein the human A3 A and the D16A NmeCas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D16A NmeCas9 nickase, optionally via a linker. In some embodiments, the first genomic editor or the base editor comprises a human A3 A and a D16A NmeCas9 nickase, wherein the human A3 A and the D16ANmeCas9 nickase are fused via a linker, and a NLS fused to the C-terminus of the D16A NmeCas9 nickase, optionally via a linker.[000323] The first genomic editor or the base editor may be organized in any number of ways to form a single chain. The NLS can be N- or C-terminal, or both N- and C-terminals. and the A3 A can be N- or C-terminal as compared the RNA-guided nickase. In some embodiments, the first genomic editor or the base editor comprises, from N to C terminus, an A3 A, an optional linker, an RNA-guided nickase, and an optional NLS. In some first genomic editor or the base editor, the polypeptide comprises, from N to C terminus, an RNA- guided nickase, an optional linker, an A3 A, and an optional NLS. In some first genomic editor or the base editor, the polypeptide comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, and an A3 A. In some embodiments, the first genomic editor or the base editor comprises, from N to C terminus, an optional NLS, an RNA-guided nickase, an optional linker, and an A3 A, and an optional NLS.[000324] In any of the foregoing embodiments, the first genomic editor or the base editor may comprise an amino acid sequence having at least 80% identity to SEQ ID NO: 3, 6, or 146. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence with at least 90% identity to SEQ ID NO: 3, 6, or 146. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence with at least 95% identity to SEQ ID NO: 3, 6, or 146. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence with at least 98% identity to SEQ ID NO: 3, 6, or 146. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence with at least 99% identity to SEQ ID NO: 3, 6, or 146. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence of SEQ ID NO: 3, 6, or 146.[000325] In any of the foregoing embodiments, a nucleic acid or ORF encoding the first genomic editor or the base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity to SEQ ID NO: 2, 5, or 147. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.[000326] In any of the foregoing embodiments, a nucleic acid or ORF encoding the first genomic editor or the base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 4. In some embodiments, any of theforegoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.[000327] In any of the foregoing embodiments, the first genomic editor or the base editor may comprise an amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 9, 18, and 21. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence with at least 90% identity to any one of SEQ ID NOs: 9, 18, and 21. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence with at least 95% identity to any one of SEQ ID NOs: 9, 18, and 21. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence with at least 98% identity to any one of SEQ ID NOs: 9, 18, and 21. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence with at least 99% identity to any one of SEQ ID NOs: 9, 18, and 21. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence of any one of SEQ ID NOs: 9, 18, and 21.[000328] In any of the foregoing embodiments, a nucleic acid or ORF encoding the first genomic editor or the base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 8, 11, 17, and 20. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.[000329] In any of the foregoing embodiments, a nucleic acid or ORF encoding the first genomic editor or the base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 7, 10, 16, and 19. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.[000330] In any of the foregoing embodiments, the first genomic editor or the base editor may comprise an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 136, 139, 142, or 145. In some embodiments, the first genomic editor or the base editor disclosed herein may comprise an amino acid sequence of SEQ ID NO: 136, 139, 142, or 145. In any of the foregoing embodiments, a nucleic acid or ORF encoding the first genomic editor or the base editor disclosed herein may comprise a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to SEQ ID NOs: SEQ ID NO: 135,138, 141, or 144. In some embodiments, a nucleic acid or ORF encoding the first genomic editor or the base editor disclosed herein comprises a nucleic acid sequence of SEQ ID NOs: SEQ ID NO: 135, 138, 141, or 144. In any of the foregoing embodiments, a nucleic acid or ORF encoding the first genomic editor or the base editor disclosed herein may comprise a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 134, 137, 140, or 143. In any of the foregoing embodiments, a nucleic acid or ORF encoding the first genomic editor or the base editor disclosed herein may comprise a nucleic acid sequence of SEQ ID NO: 134, 137, 140, or 143. [000331] In any of the foregoing embodiments, the A3 A may comprise an amino acid sequence having at least 80% identity to SEQ ID NO: 22. In some embodiments, the level of identity is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the A3A comprises an amino acid sequence of SEQ ID NO: 22.[000332] In any of the foregoing embodiments, the RNA-guided nickase may comprise an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NO: 41, 43, or 45. In some embodiments, the level of identity is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 41. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 43. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 45.[000333] In any of the foregoing embodiments, the A3 A may comprise an amino acid sequence having at least 80% identity to SEQ ID NO: 22 and the RNA-guided nickase may comprise an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NO: 41, 43, or 45. In some embodiments, the A3A comprises an amino acid sequence of SEQ ID NO: 22 and the RNA-guided nickase comprises an amino acid sequence of SEQ ID NO: 41.[000334] In any of the foregoing embodiments, the a nucleic acid of ORF encoding the first genomic editor or the base editor comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1. In any of the foregoing embodiments, a nucleic acid of ORF encoding the first genomic editor or the base editor comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 147. In any of the foregoing embodiments, a nucleic acid of ORFencoding the first genomic editor or the base editor comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 310.IV. Second Genome Editing Tool[000335] In some embodiments, the second genome editing tool comprises a second genomic editor and at least one gRNA that targets at least one genomic locus and that is cognate to the second genomic editor, wherein the first genomic editor is orthogonal to the second genomic editor. In some embodiments, the second genome editing tool comprises a second genomic editor comprising an RNA-guided cleavase, and at least one gRNA that targets at least one genomic locus and that is cognate to the RNA-guided cleavase, wherein the base editor is orthogonal to the RNA-guided cleavase.[000336] In some embodiments, the second genomic editor is delivered to the population of cells as at least one polypeptide or at least one mRNA. In some embodiments, the second genomic editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the second genomic editor comprises a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.[000337] In some embodiments, one of the first genomic editor and the second genomic editor comprises a base editor, optionally a C to T base editor or an A to G base editor, and the other of the first genomic editor and the second genomic editor comprises a cleavase. In some embodiments, one of the first genomic editor and the second genomic editor comprises a C to T base editor, and the other of the first genomic editor and the second genomic editor comprises an A to G base editor. In some embodiments, one of the first genomic editor and second genomic editor comprises an A. meningitidis (Nme) RNA-guided nickase or cleavase, and the other of the first genomic editor and the second genomic editor comprises an S. pyogenes (Spy) RNA-guided nickase or cleavase.[000338] In some embodiments, the second genomic editor or the RNA-guided cleavase is a Cas nuclease. In some embodiments, the Cas nuclease is a Cas9. In some embodiments, the Cas9 is Streptococcus pyogenes Cas9 (SpyCas9), S. aureus Cas9 (SauCas9), C. diphtheriae Cas9 (CdiCas9), Streptococcus thermophilus Cas9 (StlCas9), A. cellulolyticus Cas9 (AceCas9), C. jejuni Cas9 (CjeCas9). R. palustris Cas9 (RpaCas9), R. rubrum Cas9 (RruCas9), A. naeslundii Cas9 (AnaCas9), Francisella novicida Cas9 (FnoCas9), or N. meningitidis (NmeCas9). In some embodiments, the Cas9 is an NmelCas9, an Nme2Cas9, an Nme3Cas9, or SpyCas9. In some embodiments, the Cas nuclease is a Class 2 Cas nuclease.In some embodiments, the Cas nuclease is a Casl2. In some embodiments, the Casl2 is Lachnospiraceae bacterium Casl2a (LbCasl2a) or the Casl2 is Acidaminococcus sp. Casl2a (AsCasl2a). In some embodiments, the Cas nuclease is an Eubacterium siraeum Casl3d (EsCasl3d).[000339] In some embodiments, the second genomic editor or the RNA-guided cleavase is a Cas9 cleavase. In some embodiments, the second genomic editor or the RNA-guided cleavase is Streptococcus pyogenes Cas9 (SpyCas9) cleavase. In some embodiments, the SpyCas9 cleavase comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 156. In some embodiments, the SpyCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 156.[000340] In some embodiments, the second genome editing tool, the nucleic acid encoding the RNA-guided cleavase, the second nucleic acid comprising the second ORF, or the second ORF comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 295 or 293. In some embodiments, the second genome editing tool, the nucleic acid encoding the RNA-guided cleavase, the second nucleic acid comprising the second ORF, or the second ORF comprises the nucleotide sequence of SEQ ID NO: 295 or 293.[000341] In some embodiments, the second genomic editor or the RNA-guided cleavase is a Cas9 cleavase. In some embodiments, the second genomic editor or the RNA-guided cleavase is N meningitidis Cas9 (NmeCas9) cleavase. In some embodiments, the NmeCas9 cleavase comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 157, 158- 167, 191, 198, 212, and 219. In some embodiments, the NmeCas9 cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 157, 158-167, 191, 198, 212, and 219.[000342] In some embodiments, the second genome editing tool, the nucleic acid encoding the RNA-guided cleavase, the second nucleic acid comprising the second ORF, or the second ORF comprises a polynucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 168, 169- 178, 180, 181-190, 192-197, 199-204, 206-211, 213-218, and 220-225. In some embodiments, the second genome editing tool, the nucleic acid encoding the RNA-guided cleavase, the second nucleic acid comprising the second ORF, or the second ORF comprises the polynucleotide sequence of any one of SEQ ID NOs: 168, 169-178, 180, 181-190, 192- 197, 199-204, 206-211, 213-218, and 220-225.[000343] In some embodiments, the second genome editing tool comprises an RNA- guided cleavase. In some embodiments, the RNA-guided cleavase, when used with the at least one gRNA cognate to the cleavase, provides for simultaneous knock-out of the genomic locus targeted by the at least one gRNA and knock-in of an exogeneous gene.[000344] In some embodiments, the second genome editing tool comprises a fusion protein comprising a DNA polymerase and a nickase. In some embodiments, the fusion protein comprising a DNA polymerase and a nickase, when used with the at least one gRNA cognate to the nickase, provides for targeted knock-in of an exogeneous nucleic acid.[000345] In some embodiments, the second genome editing tool may be combined with any first genome editing tool disclosed herein. In some embodiments, the second nucleic acid comprising any second ORF may be combined with any first nucleic acid comprising any first ORF disclosed herein. Use of a Cas9 nickase and a Cas9 cleavase that are orthologous to each other in the first genome editing tool and the second genome editing tool may prevent cross-utilization.[000346] In some embodiments, the first genome editing tool comprises a first genomic editor or a base editor comprising a deaminase (e.g., a cytidine deaminase) of the APOBEC family and a D16A NmeCas9 nickase, and at least one gRNA that targets at least one genomic locus and that is cognate to the nickase. In some embodiments, the first genomic editor or the base editor comprises one or more UGIs. In some embodiments, the second genome editing tool comprises an S. pyogenes Cas9 (SpyCas9) cleavase, and at least one gRNA that targets at least one genomic locus and that is cognate to the SpyCas9 cleavase. [000347] In some embodiments, the first genome editing tool comprises a first genomic editor or a base editor comprising a deaminase (e.g., a cytidine deaminase) of the APOBEC family and a D16A NmeCas9 nickase, and at least one gRNA that targets at least one genomic locus and that is cognate to the nickase. In some embodiments, the first genomic editor or the base editor does not comprise any UGIs. In some embodiments, the first genome editing tool further comprises at least one UGI in a polypeptide different from the first genomic editor or the base editor. In some embodiments, the second genome editing tool comprises an S. pyogenes Cas9 (SpyCas9) cleavase, and at least one gRNA that targets at least one genomic locus and that is cognate to the SpyCas9cleavase.[000348] In some embodiments, the first genome editing tool comprises a first genomic editor or a base editor comprising a deaminase (e.g., a cytidine deaminase) of the APOBEC family and a D10A SpyCas9 nickase, and at least one gRNA that targets at least one genomic locus and that is cognate to the nickase. In some embodiments, the first genomic editor or thebase editor comprises one or more UGIs. In some embodiments, the second genome editing tool comprises an NmeCas9 cleavase, and at least one gRNA that targets at least one genomic locus and that is cognate to the NmeCas9 cleavase.[000349] In some embodiments, the first genome editing tool comprises a first genomic editor or a base editor comprising a deaminase (e.g., a cytidine deaminase) of the APOBEC family and a D10A SpyCas9 nickase, and at least one gRNA that targets at least one genomic locus and that is cognate to the nickase. In some embodiments, the first genomic editor or the base editor does not comprise any UGIs. In some embodiments, the first genome editing tool further comprises at least one UGI in a polypeptide different from the first genomic editor or the base editor. In some embodiments, the second genome editing tool comprises an NmeCas9 cleavase, and at least one gRNA that targets at least one genomic locus and that is cognate to the NmeCas9 cleavase.V. Additional Features[000350] The following section provides additional features of the first genomic editor, the base editor, the second genomic editor, and the nucleic acid encoding the same. In any of the embodiments set forth herein, the nucleic acid may be an expression construct comprising a promoter operably linked to an ORF encoding the first genomic editor, the base editor, or the second genomic editor disclosed herein.A. Codon-optimization[000351 ] In some embodiments, the nucleic acid encoding the first genomic editor, the base editor, or the second genomic editor comprises an ORF comprising a codon optimized nucleic acid sequence. In some embodiment, the codon optimized nucleic acid sequence comprises minimal adenine codons and / or minimal uridine codons.[000352] A given ORF can be reduced in uridine content or uridine dinucleotide content, for example, by using minimal uridine codons in a sufficient fraction of the ORF. For example, an amino acid sequence for the first genomic editor, the base editor, or the second genomic editor described herein can be back-translated into an ORF sequence by converting amino acids to codons, wherein some or all of the ORF uses the exemplary minimal uridine codons shown below. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are codons listed in Table 1.Table 1. Exemplary minimal uridine codons[000353] In some embodiments, the ORF may consist of a set of codons of which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 1.[000354] A given ORF can be reduced in adenine content or adenine dinucleotide content, for example, by using minimal adenine codons in a sufficient fraction of the ORF. For example, an amino acid sequence for the first genomic editor, the base editor, or the second genomic editor described herein can be back-translated into an ORF sequence by converting amino acids to codons, wherein some or all of the ORF uses the exemplary minimal adenine codons shown below. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are codons listed in Table 2.Table 2. Exemplary minimal adenine codons[000355] In some embodiments, the ORF may consist of a set of codons of which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 2.[000356] To the extent feasible, any of the features described above with respect to low adenine content can be combined with any of the features described above with respect to low uridine content. So too for uridine and adenine dinucleotides. Similarly, the content of uridine nucleotides and adenine dinucleotides in the ORF may be as set forth above.Similarly, the content of uridine dinucleotides and adenine nucleotides in the ORF may be as set forth above.[000357] A given ORF can be reduced in uridine and adenine nucleotide or dinucleotide content, for example, by using minimal uridine and adenine codons in a sufficient fraction of the ORF. For example, an amino acid sequence for the polypeptide, the second genomic editor, or the RNA-guided cleavase described herein can be back-translated into an ORF sequence by converting amino acids to codons, wherein some or all of the ORF uses the exemplary minimal uridine and adenine codons shown below. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are codons listed in Table 3.Table 3. Exemplary minimal uridine and adenine codons[000358] In some embodiments, the ORF may consist of a set of codons of which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 3. As can be seen in Table 3, each of the three listed serine codons contains either one A or one U. In some embodiments, uridine minimization is prioritized by using AGC codons for serine. In some embodiments, adenine minimization is prioritized by using UCC or UCG codons for serine.[000359] In some embodiments, the ORF may have codons that increase translation in a mammal, such as a human. In further embodiments, ORF is an mRNA and comprises codons that increase translation in an organ, such as the liver, of the mammal, e.g., a human. In further embodiments, the ORF may have codons that increase translation in a cell type, such as a hepatocyte, of the mammal, e.g., a human. An increase in translation in a mammal, cell type, organ of a mammal, human, organ of a human, etc., can be determined relative to the extent of translation wild-type sequence of the ORF, or relative to an ORF having a codon distribution matching the codon distribution of the organism from which the ORF was derived or the organism that contains the most similar ORF at the amino acid level.Alternatively, in some embodiments, an increase in translation for a Cas9 sequence in a mammal, cell type, organ of a mammal, human, organ of a human, etc., is determined relative to translation of an ORF with the sequence of SEQ ID NO: 2 or 5 with all else equal, including any applicable point mutations, heterologous domains, and the like. In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons corresponding to highly expressed tRNAs (e.g., the highest- expressed tRNA for each amino acid) in a mammal, such as a human. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons corresponding to highly expressed tRNAs (e.g., the highest-expressed tRNA for each amino acid) in a mammalian organ, such as a human organ.[000360] Alternatively, codons corresponding to highly expressed tRNAs in an organism (e.g., human) in general may be used.[000361] Any of the foregoing approaches to codon selection can be combined with the minimal uridine or adenine codons shown above, e.g., by starting with the codons of Table 1, Table 2, or Table 3, and then where more than one option is available, using the codon that corresponds to a more highly-expressed tRNA, either in the organism (e.g., human) in general, or in an organ or cell type of interest(e.g., human liver or human hepatocytes).[000362] In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons from a codon set shown in Table 4 (e.g., the low U 1, low A, or low A / U codon set). The codons in the low U 1, low G, low A, and low A / U sets use codons that minimize the indicated nucleotides while also using codons corresponding to highly expressed tRNAs where more than one option is available. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons from the low U 1 codon set shown in Table 4. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons from the low A codon set shown in Table 4. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons from the low A / U codon set shown in Table 4.Table 4. Exemplary Codon Sets.B. Heterologous functional domains; nuclear localization signals (NLS)[000363] In some embodiments, the first genomic editor, the base editor, or the second genomic editor disclosed herein further comprises one or more additional heterologous functional domains (e.g., is or comprises a ternary or higher-order fusion polypeptide).[000364] In some embodiments, the heterologous functional domain may facilitate transport of the first genomic editor, the base editor, or the second genomic editor into thenucleus of a cell. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with 1-10 NLS(s). In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with 1-5 NLS(s). In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with one NLS. Where one NLS is used, the NLS may be fused at the N- terminus or the C-terminus of first genomic editor, the base editor, or the second genomic editor sequence. In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused C-terminally to at least one NLS. An NLS may also be inserted within the polypeptide, the second genomic editor, or the RNA-guided cleavase sequence. In other embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with more than one NLS. In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the first genomic editor, the base editor, or the second genomic editor is fused to two SV40 NLS sequences at the carboxy terminus. In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with two NLSs, one at the N-terminus and one at the C-terminus. In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with 3 NLSs. In some embodiments, the first genomic editor, the base editor, or the second genomic editor may be fused with no NLS. In some embodiments, the NLS may be a monopartite sequence, such as, e.g., the SV40 NLS, PKKKRKV (SEQ ID NO: 40) or PKKKRRV (SEQ ID NO: 70). In some embodiments, the NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 71). In a specific embodiment, a single PKKKRKV (SEQ ID NO: 40) NLS may be fused at the C- terminus of the first genomic editor, the base editor, or the second genomic editor. One or more linkers are optionally included at the fusion site (e.g., between the first genomic editor, the base editor, or the second genomic editor and NLS). In some embodiments, one or more NLS(s) according to any of the foregoing embodiments are present in the first genomic editor, the base editor, or the second genomic editor in combination with one or more additional heterologous functional domains, such as any of the heterologous functional domains described below.[000365] In some embodiments, the cytidine deaminase (e.g., A3 A) is located N- terminal to the RNA-guided nickase in the first genomic editor or the base editor. In some embodiments, the RNA-guided nickase comprises a nuclear localization signal (NLS). In some embodiments, the NLS is fused to the C-terminus of the RNA-guided nickase. In some embodiments, the NLS is fused to the C-terminus of the RNA-guided nickase via a linker. In some embodiments, the NLS is fused to the N-terminus of the RNA-guided nickase. In some embodiments, the NLS is fused to the N-terminus of the RNA-guided nickase via a linker (e.g., SEQ ID NO: 39). In some embodiments, the NLS comprises a sequence having at least 80%, 85%, 90%, or 95% identity to any one of SEQ ID NOs: 40 and 59-71. In some embodiments, the NLS comprises the sequence of any one of SEQ ID NOs: 40 and 59-71. In some embodiments, the NLS is encoded by a sequence having at least 80%, 85%, 90%, 95%, 98% or 100% identity to the sequence of any one of SEQ ID NOs: 40 and 59-71.[000366] In some embodiments, the heterologous functional domain may be capable of modifying the intracellular half-life of the A3 A or the RNA-guided nickase in the first genomic editor or the base editor. In some embodiments, the half-life of the A3 A or the RNA-guided nickase in the polypeptide may be increased. In some embodiments, the halflife of the A3 A or the RNA-guided nickase in the first genomic editor or the base editormay be reduced. In some embodiments, the heterologous functional domain may be capable of increasing the stability of the A3 A or the RNA-guided nickase in the first genomic editor or the base editor. In some embodiments, the heterologous functional domain may be capable of reducing the stability of the A3 A or the RNA-guided nickase in the first genomic editor or the base editor. In some embodiments, the heterologous functional domain may act as a signal peptide for protein degradation. In some embodiments, the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain may comprise a PEST sequence. In some embodiments, the polypeptide may be modified by addition of ubiquitin or a polyubiquitin chain. In some embodiments, the ubiquitin may be a ubiquitin- like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin- like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon- stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronal-precursor-cell- expressed developmentally downregulated protein-8 (NEDD8, also called Rubl in S. cerevisiae), human leukocyte antigen F-associated (FAT 10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold-modifier- 1 (UFM1), and ubiquitin-like protein-5 (UBL5).[000367] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Any known fluorescent proteins may be used as the marker domain such as GFP, YFP, EBFP, ECFP, DsRed or any other suitable fluorescent protein. In some embodiments, the marker domain may be a purification tag or an epitope tag. Nonlimiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, SI, T7, V5, VSV-G, 6xHis (SEQ ID NO: 401), 8xHis (SEQ ID NO: 402), biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. In some embodiments, the marker domain may be a reporter gene. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent proteins.[000368] In additional embodiments, the heterologous functional domain may target the first genomic editor, the base editor, or the second genomic editor to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the first genomic editor, the base editor, or the second genomic editor to mitochondria.C. UTRs; Kozak sequences[000369] In some embodiments, the nucleic acid (e.g., mRNA) disclosed herein comprises a 5’ UTR, 3’ UTR, or 5’ and 3’ UTRs from Hydroxysteroid 17-Beta Dehydrogenase 4 (HSD17B4 or HSD) or globin such as human alpha globin (HBA), human beta globin (HBB), Xenopus laevis beta globin (XBG), bovine growth hormone, cytomegalovirus (CMV), mouse Hba-al, heat shock protein 90 (Hsp90), glyceraldehyde 3- phosphate dehydrogenase (GAPDH), beta-actin, alpha-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).[000370] In some embodiments, the nucleic acid described herein does not comprise a 5’ UTR, e.g., there are no additional nucleotides between the 5’ cap and the start codon. In some embodiments, the nucleic acid comprises a Kozak sequence (described below) between the 5’ cap and the start codon, but does not have any additional 5’ UTR. In some embodiments, the nucleic acid does not comprise a 3’ UTR, e.g., there are no additional nucleotides between the stop codon and the poly-A tail.[000371 ] In some embodiments, the nucleic acid herein comprises a Kozak sequence. The Kozak sequence can affect translation initiation and the overall yield of a polypeptide translated from an mRNA. A Kozak sequence includes a methionine codon that can function as the start codon. A minimal Kozak sequence is NNNRUGN wherein at least one of the following is true: the first N is A or G and the second N is G. In the context of a nucleotide sequence, R means a purine (A or G). In some embodiments, the Kozak sequence is RNNRUGN, NNNRUGG, RNNRUGG, RNNAUGN, NNNAUGG, RNNAUGG, or GCCACCAUG.D. Poly-A tail[000372] In some embodiments, the nucleic acid disclosed herein further comprises a poly-adenylated (poly-A) tail. The poly-A tails may comprise at least 8 consecutive adenine nucleotides, but also comprise one or more non-adenine nucleotide. As used herein, “nonadenine nucleotides” refer to any natural or non-natural nucleotides that do not comprise adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the poly-A tails on the nucleic acid described herein may comprise consecutive adenine nucleotides located 3’ to nucleotides encoding a polypeptide of interest. In some instances, the poly-A tails on the nucleic acid comprise non-consecutive adenine nucleotides located 3’ to nucleotides encoding the polypeptide, wherein non-adenine nucleotides interrupt the adenine nucleotides at regular or irregularly spaced intervals.[000373] In some embodiments, the poly-A tail is encoded in a plasmid used for in vitro transcription of an mRNA and becomes part of the transcript. The poly-A sequence encoded in the plasmid, z.e., the number of consecutive adenine nucleotides in the poly-A sequence, may not be exact, e.g., a 100 poly-A sequence (SEQ ID NO: 403) in the plasmid may not result in a precisely 100 poly-A sequence (SEQ ID NO: 403) in the transcribed mRNA. In some embodiments, the poly-A tail is not encoded in the plasmid, and is added by PCR tailing or enzymatic tailing, e.g., using E. coli poly(A) polymerase.[000374] In some embodiments, the one or more non-adenine nucleotides are positioned to interrupt the consecutive adenine nucleotides so that a poly(A) binding protein can bind to a stretch of consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotide(s) is located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides (SEQ ID NO: 404). In some embodiments, the one or more non-adenine nucleotide is located after 8-50 consecutive adenine nucleotides (SEQ ID NO: 405). In some embodiments, the one ormore non-adenine nucleotide is located after 8-100 consecutive adenine nucleotides (SEQ ID NO: 406).[000375] In some embodiments, the poly-A tail comprises or contains one non-adenine nucleotide or one consecutive stretch of 2-10 non-adenine nucleotides.[000376] In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. In some instances, where more than one non-adenine nucleotide is present, the non- adenine nucleotide may be selected from: a) guanine and thymine nucleotides; b) guanine and cytosine nucleotides; c) thymine and cytosine nucleotides; or d) guanine, thymine and cytosine nucleotides.E. Modified nucleotides[000377] In some embodiments, the nucleic acid disclosed herein comprises a modified uridine at some or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5 position, e.g., with a halogen or C1-C3 alkoxy. In some embodiments, the modified uridine is a pseudouridine modified at the 1 position, e.g., with a C1-C3 alkyl. The modified uridine can be, for example, pseudouridine, N1 -methylpseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof.[000378] In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the uridine positions in the nucleic acid disclosed herein are modified uridines. In some embodiments, 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75-85%, 85-95%, or 90- 100% of the uridine positions in an mRNA disclosed herein are modified uridines, e.g., 5- methoxyuridine, 5-iodouridine, N1 -methyl pseudouridine, pseudouridine, or a combination thereof.[000379] In some embodiments, at least 10% of the uridine is substituted with a modified uridine. In some embodiments, 15% to 45% of the uridine is substituted with the modified uridine. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the uridine is substituted with the modified uridine.F. 5’ Cap[000380] In some embodiments, the nucleic acid disclosed herein comprises a 5’ cap, such as a CapO, Capl, or Cap2. A 5’ cap is generally a 7-methylguanine ribonucleotide (which may be further modified, as discussed below e.g., with respect to ARCA) linkedthrough a 5 ’-triphosphate to the 5’ position of the first nucleotide of the 5’-to-3’ chain of the nucleic acid, i.e., the first cap-proximal nucleotide. In CapO, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’-hydroxyl. In Capl, the riboses of the first and second transcribed nucleotides of the nucleic acid comprise a 2’- methoxy and a 2’ -hydroxyl, respectively. In Cap2, the riboses of the first and second cap- proximal nucleotides of the nucleic acid both comprise a 2’-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33): 12025-30; Abbas et al. (2017) Proc Natl Acad Set USA 114(1 l):E2106-E2115. Most endogenous higher eukaryotic nucleic acids, including mammalian nucleic acids such as human nucleic acids, comprise Capl or Cap2. CapO and other cap structures differing from Capl and Cap2 may be immunogenic in mammals, such as humans, due to recognition as “non-self ’ by components of the innate immune system such as IFIT-1 and IFIT-5, which can result in elevated cytokine levels including type I interferon. Components of the innate immune system such as IFIT-1 and IFIT-5 may also compete with eIF4E for binding of a nucleic acids with a cap other than Capl or Cap2, potentially inhibiting translation of the nucleic acid.[000381] A cap can be included co-transcriptionally. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific Cat. No. AM8045) is a cap analog comprising a 7- methylguanine 3 ’-m ethoxy-5’ -triphosphate linked to the 5’ position of a guanine ribonucleotide which can be incorporated in vitro into a transcript at initiation. ARCA results in a CapO cap or a CapO-like cap in which the 2’ position of the first cap-proximal nucleotide is hydroxyl. See, e.g., Stepinski et al., (2001) “Synthesis and properties of mRNAs containing the novel ‘anti-reverse’ cap analogs 7-methyl(3'-O-methyl)GpppG and 7- methyl(3'deoxy)GpppG,” RNA 7: 1486-1495. The ARCA structure is shown below.[000382] CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies Cat. No. N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies Cat.No. N-7133) can be used to provide a Capl structure co-transcriptionally. 3’-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as Cat. Nos. N-7413 and N-7433, respectively. The CleanCap™ AGstructure is shown below. CleanCap™ structures are sometimes referred to herein using the last three digits of the catalog numbers listed above (e.g., “CleanCap™ 113” for TriLink Biotechnologies Cat. No. N-7113).[000383] Alternatively, a cap can be added to an RNA post-transcriptionally. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Cat. No. M2080S) and has RNA triphosphatase and guanylyltransferase activities, provided by its DI subunit, and guanine methyltransferase, provided by its D 12 subunit. As such, it can add a 7-methylguanine to an RNA, so as to give CapO, in the presence of S-adenosyl methionine and GTP. See, e.g., Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For additional discussion of caps and capping approaches, see, e.g., WO2017 / 053297 and Ishikawa et al., Nucl. Acids. Symp. Ser. (2009) No. 53, 129-130.VI. Cells and Uses Thereof[000384] In some embodiments, a population of cells is treated in vitro with any method or composition disclosed herein. In some embodiments, a population of cells is treated ex vivo with any method or composition disclosed herein.[000385] In some embodiments, a population of cells for any of the methods disclosed herein is a population of human cells.[000386] In some embodiments, some cells in the population of edited cells obtained using any of the methods disclosed herein comprise at least two genomic edits. In some embodiments, one of the at least two genomic edits is located at the at least one genomic locus targeted by the at least one gRNA that is cognate to the first genomic editor or the base editor, and wherein another one of the at least two genomic edits is located at the at least one genomic locus targeted by the at least one gRNA that is cognate to the second genomic editoror the RNA-guided cleavase. In some embodiments, some cells in the population of edited cells comprise two genomic edits. In some embodiments, some cells in the population of edited cells comprise three genomic edits. In some embodiments, some cells in the population of edited cells comprise four genomic edits. In some embodiments, some cells in the population of edited cells comprise five genomic edits. In some embodiments, some cells in the population of edited cells comprise six genomic edits. In some embodiments, some cells in the population of edited cells comprise seven genomic edits. In some embodiments, some cells in the population of edited cells comprise eight genomic edits.[000387] In some embodiments, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus. In some embodiments, the gRNA that targets the TRAC locus comprises the guide sequence of SEQ ID NO: 315. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus. In some embodiments, the gRNA that targets the HLA-A locus comprises the guide sequence of SEQ ID NO: 366. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-B locus. In some embodiments, the gRNA that targets the HLA-B locus comprises the guide sequence of SEQ ID NO: 388. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the CIITA locus. In some embodiments, the gRNA that targets the CIITA locus comprises the guide sequence of SEQ ID NO: 384. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TGFBR2 locus. In some embodiments, the gRNA that targets the TGFBR2 locus comprises the guide sequence of SEQ ID NO: 455. In some embodiments, some cells in the population of edited cells comprises at least one exogenous gene, including any exogenous gene disclosed herein. In some embodiments, the least one exogenous gene comprises a CAR.[000388] In some embodiments, the population of cells in any of the embodiments provided herein is engineered by a first genome editing tool and a second genome editing tool. In some embodiment, the first genome editing tool comprises a C to T base editor or an A to G base editor. In some embodiments, the first genome editing tool comprises a first genomic editor comprising a cytidine deaminase and an RNA-guided nickase, or a nucleic acid encoding the polypeptide. In some embodiments, the cytidine deaminase is APOBEC3 A deaminase (A3 A). In some embodiments, the first genomic editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3 orSEQ ID NO: 146. In some embodiments, the nucleic acid encoding the first genomic editor comprises a sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 147, or SEQ ID NO: 310. In some embodiments, the first genomic editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 9, 18, and 21.[000389] In some embodiments, the first genome editing tool or the second genome editing tool is delivered to the population of cells via electroporation. In some embodiments, the first genome editing tool or the second genome editing tool is delivered to the population of cells via at least one lipid nanoparticle (LNP). In some embodiments, the first genome editing tool or the second genome editing tool is contained in at least one LNP. In some embodiments, the first genome editing tool or the second genome editing tool is delivered to the cell on at least one vector. In some embodiments, the first genome editing tool or the second genome editing tool comprises at least one vector. In some embodiments, the first genome editing tool or the second genome editing tool is delivered as at least one nucleic acid encoding the first genome editing tool or the second genome editing tool. In some embodiments, the first genome editing tool or the second genome editing tool comprises at least one nucleic acid encoding the first genome editing tool or the second genome editing tool. In some embodiments, the first genome editing tool comprises at least one polypeptide comprising the first genome editing tool or at least one nucleic acid encoding the first genome editing tool. In some embodiments, the second genome editing tool comprises at least one polypeptide comprising the second genome editing tool or at least one nucleic acid encoding the second genome editing tool. In some embodiments, the at least one nucleic acid comprises at least one mRNA. In some embodiments, the first genomic editor or the second genomic editor is delivered to the population of cells as at least one polypeptide or at least one mRNA. In some embodiments, the first genomic editor or the second genomic editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the at least one gRNA is delivered to the population of cells as at least one polynucleotide that encodes the gRNA. In some embodiments, the population of cells is contacted with a nucleic acid encoding at least one exogenous gene for insertion into a genomic locus. In some embodiments, the cell is contacted with a nucleic acid encoding at least one exogenous gene for insertion into the TRAC or AAVS1 locus.[000390] In some embodiments, in any of the methods disclosed herein, step (b-1) and step (b-2) of contacting the cell are performed simultaneously. In some embodiments, step (b- 1) and step (b-2) of contacting the cell are performed in any order over a time period of about5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 30 hours, 36 hours, or 48 hours. In some embodiments, each of step (b-1) and step (b-2) is independently performed over a time period of about 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 30 hours, 36 hours, or 48 hours. [000391] In some embodiments, the population of cells is a population of immune cells. In some embodiments, the population of cells is a population of cells isolated from human donor peripheral blood mononuclear cells (PBMCs) or leukopaks. As used herein, “immune cell” refers to a cell of the immune system, including e.g., a lymphocyte (e.g., T cell, B cell, natural killer cell (“NK cell”, and NKT cell, or iNKT cell)), monocyte, macrophage, mast cell, dendritic cell, or granulocyte (e.g., neutrophil, eosinophil, and basophil). In some embodiments, the cell is a primary immune cell. In some embodiments, the immune system cell may be selected from CD3+, CD4+and CD8+T cells, regulatory T cells (Tregs), B cells, NK cells, and dendritic cells (DC). In some embodiments, the immune cell is allogeneic.[000392] In some embodiments, the cell is a lymphocyte. In some embodiments, the cell is an adaptive immune cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a NK cell.[000393] As used herein, a T cell can be defined as a cell that expresses a T cell receptor (“TCR” or “aP TCR” or “y5 TCR”), however in some embodiments, the TCR of a T cell may be genetically modified to reduce its expression (e.g., by genetic modification to the TRAC or TRBC genes), therefore expression of the protein CD3 may be used as a marker to identify a T cell by standard flow cytometry methods. CD3 is a multi-subunit signaling complex that associates with the TCR. Thus, a T cell may be referred to as CD3+. In some embodiments, a T cell is a cell that expresses a CD3+ marker and either a CD4+ or CD8+ marker.[000394] In some embodiments, the T cell expresses the glycoprotein CD8 and therefore is CD8+ by standard flow cytometry methods and may be referred to as a “cytotoxic” T cell. In some embodiments, the T cell expresses the glycoprotein CD4 and therefore is CD4+ by standard flow cytometry methods and may be referred to as a “helper” T cell. CD4+ T cells can differentiate into subsets and may be referred to as a Thl cell, Th2 cell, Th9 cell, Thl7 cell, Th22 cell, T regulatory (“Treg”) cell, or T follicular helper cells (“Tfh”). Each CD4+ subset releases specific cytokines that can have either proinflammatoryor anti-inflammatory functions, survival or protective functions. A T cell may be isolated from a subject by CD4+ or CD8+ selection methods. In some embodiments, in a population of T cells for any of the methods disclosed herein, a ratio of CD4+ T cells to CD8+ T cells is 1 : 1.[000395] In some embodiments, the T cell is a memory T cell. In the body, a memory T cell has encountered antigen. A memory T cell can be located in the secondary lymphoid organs (central memory T cells) or in recently infected tissue (effector memory T cells). A memory T cell may be a CD8+ T cell. A memory T cell may be a CD4+ T cell.[000396] As used herein, an “early stem-cell memory T cell” or “stem cell like memory T cell” (or “Tscm”) can be defined as a T cell that expresses CD27 and CD45RA, and therefore is CD27+ and CD45RA+ by standard flow cytometry methods. A Tscm does not express the CD45 isoform CD45RO, therefore a Tscm will further be CD45RO- if stained for this isoform by standard flow cytometry methods. A CD45RO- CD27+ cell is therefore also an early stem-cell memory T cell. Tscm cells further express CD62L and CCR7, therefore may be detected as CD62L+ and CCR7+ by standard flow cytometry methods. Early stemcell memory T cells have been shown to correlate with increased persistence and therapeutic efficacy of cell therapy products.[000397] As used herein, a “central memory T cell” (or “Tern”) can be defined as an antigen-experienced T cell, and for example, may express CD62L and CD45RO. A central memory T cell may be detected as CD62L+ and CD45RO+ by central memory T cells also express CCR7, therefore may be detected as CCR7+ by standard flow cytometry methods. [000398] In some embodiments, the cell is a B cell. As used herein, a “B cell” can be defined as a cell that expresses CD 19 or CD20, or B cell mature antigen (“BCMA”), and therefore a B cell is CD19+, or CD20+, or BCMA+ by standard flow cytometry methods. A B cell is further negative for CD3 and CD56 by standard flow cytometry methods. The B cell may be a plasma cell. The B cell may be a memory B cell. The B cell may be a naive B cell. The B cell may be IgM+ or has a class-switched B cell receptor (e.g., IgG+, or IgA+).[000399] In some embodiments, the cell is a mononuclear cell, such as from bone marrow or peripheral blood. In some embodiments, the cell is a peripheral blood mononuclear cell (“PBMC”). In some embodiments, the cell is a PBMC, e.g. a lymphocyte or monocyte. In some embodiments, the cell is a peripheral blood lymphocyte (“PBL”).[000400] In some embodiments, the cell is derived from a progenitor cell before editing. In some embodiments, the cell is an induced pluripotent stem cell (iPSC).[000401 ] Cells used in ACT therapy are included, such as mesenchymal stem cells e.g., isolated from bone marrow (BM), peripheral blood (PB), placenta, umbilical cord (UC) or adipose); hematopoietic stem cells (HSCs; e.g. isolated from BM); mononuclear cells (e.g., isolated from BM or PB); endothelial progenitor cells (EPCs; isolated from BM, PB, and UC); neural stem cells (NSCs); limbal stem cells (LSCs); or tissue-specific primary cells or cells derived therefrom (TSCs). Cells used in ACT therapy further include induced pluripotent stem cells (iPSCs; see e.g., Mahla, International J. Cell Biol. 2016 (Article ID 6940283): 1-24 (2016)) that may be induced to differentiate into other cell types including e.g., islet cells, neurons, and blood cells; ocular stem cells; pluripotent stem cells (PSCs); embryonic stem cells (ESCs); cells for organ or tissue transplantations such as islet cells, cardiomyocytes, thyroid cells, thymocytes, neuronal cells, skin cells, retinal cells, chondrocytes, myocytes, and keratinocytes.[000402] In some embodiments, the cell is a human cell, such as a cell from a subject. In some embodiments, the cell is isolated from a human subject. In some embodiments, the cell is isolated from a patient. In some embodiments, the cell is isolated from a donor. In some embodiments, the cell is isolated from human donor PBMCs or leukopaks. In some embodiments, the cell is from a subject with a condition, disorder, or disease. In some embodiments, the cell is from a human donor with Epstein Barr Virus (“EBV”).[000403] In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the cell contains a genetic modification in the HL A- A gene and is homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the cell is homozygous for HLA-A and homozygous for HLA-C. In some embodiments, the cell contains a genetic modification in the HLA-B gene and is homozygous for HLA-A and homozygous for HLA-C. In some embodiments, the cell is homozygous for HLA-C. In some embodiments, the cell contains a genetic modification in the HLA-A gene and a genetic modification in the HLA-B gene and is homozygous for HLA-C.[000404] In some embodiments, the methods disclosed herein are carried out ex vivo. As used herein, “ex vivo” refers to an in vitro method wherein the cell is capable of being transferred into a subject, e.g. as an ACT therapy. In some embodiments, an ex vivo method is an in vitro method involving an ACT therapy cell or cell population.[000405] In some embodiments, the cell is maintained in culture. In some embodiments, the cell is transplanted into a patient. In some embodiments, the cell is removed from a subject, genetically modified ex vivo, and then administered back to the same patient. In someembodiments, the cell is removed from a subject, genetically modified ex vivo, and then administered to a subject other than the subject from which it was removed.[000406] In some embodiments, the cell is from a cell line. In some embodiments, the cell line is derived from a human subject. In some embodiments, the cell line is a lymphoblastoid cell line (“LCL”). The cell may be cryopreserved and thawed. The cell may not have been previously cryopreserved.[000407] In some embodiments, the cell is from a cell bank. In some embodiments, the cell is genetically modified and then transferred into a cell bank. In some embodiments the cell is removed from a subject, genetically modified ex vivo, and transferred into a cell bank. In some embodiments, a genetically modified population of cells is transferred into a cell bank. In some embodiments, a genetically modified population of immune cells is transferred into a cell bank. In some embodiments, a genetically modified population of immune cells comprising a first and second subpopulations, wherein the first and second sub-populations have at least one common genetic modification and at least one different genetic modification are transferred into a cell bank.[000408] In some embodiments, a population of edited cells that is prepared, e.g., ex vivo, using any of the methods disclosed herein is provided.[000409] In some embodiments, some of the cells in the population of edited cells express at least one exogenous gene, such as any one of the exogenous genes described herein. In some embodiments, on the day step (c) is performed, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of the cells in the population of edited cells express the at least one exogenous gene. In some embodiments, on the day step (c) is performed, at least 30% of the cells in the population of edited cells express the at least one exogenous gene. In some embodiments, on the day step (c) is performed, at least 40% of the cells in the population of edited cells express the at least one exogenous gene. In some embodiments, on the day step (c) is performed, at least 50% of the cells in the population of edited cells express the at least one exogenous gene. In some embodiments, on the day step (c) is performed, at least 60% of the cells in the population of edited cells express the at least one exogenous gene. In some embodiments, on the day step (c) is performed, at least 70% of the cells in the population of edited cells express the at least one exogenous gene. In some embodiments, on the day step (c) is performed, at least 80% of the cells in the population of edited cells express the at least one exogenous gene.[000410] In some embodiments, only some of the cells in the population of edited cells express a certain endogenous protein, such as an endogenous T cell receptor (TCR). In someembodiments, on the day step (c) is performed, no more than 20%, no more than 18%, no more than 16%, no more than 14%, no more than 12%, no more than 10%, no more than 8%, no more than 6%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, no more than 0.4%, no more than 0.3%, no more than 0.2%, or no more than 0.1% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 20% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 18% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 16% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 14% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 12% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 10% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 8% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 6% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 5% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 4% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 3% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 2% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 1% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 0.5% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 0.4% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) Is performed, no more than 0.3% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the day step (c) is performed, no more than 0.2% of the cells in the population of edited cells express an endogenous TCR. In some embodiments, on the daystep (c) is performed, no more than 0.1% of the cells in the population of edited cells express an endogenous TCR.[000411] In some embodiments, some cells in the population of edited cells are naive T cells (Tn cells), stem cell like memory T cells (Tscm cells), or central memory T cells (Tcm cells). In some embodiments, the Tn cells or the Tscm cells are CD45RO- and CCR7+. In some embodiments, the Tcm cells are CD45RO+ and CCR7+.[000412] In some embodiments, on the day step (c) is performed, at least 60%, at least62%, at least 64%, at least 66%, at least 68%, at least 70%, at least 72%, at least 74%, at least76%, at least 78%, at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, at least90%, at least 92%, at least 94%, at least 96%, or at least 98% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 60% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 62% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 64% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 66% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 68% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 70% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 72% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 74% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 76% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 78% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 80% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 82% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 84% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 86% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In someembodiments, on the day step (c) is performed, at least 88% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 90% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 92% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 94% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 96% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells. In some embodiments, on the day step (c) is performed, at least 98% of the cells in the population of edited cells are Tn cells, Tscm cells, or Tcm cells.[000413] In some embodiments, on the day step (c) is performed, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, or at least 20% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 1% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 2% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 3% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 4% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 5% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 6% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 7% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 8% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 9% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 10% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 11% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 12% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 13% of the cells in the population of edited cells are Tn cells orTscm cells. In some embodiments, on the day step (c) is performed, at least 14% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 15% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 16% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 17% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 18% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 19% of the cells in the population of edited cells are Tn cells or Tscm cells. In some embodiments, on the day step (c) is performed, at least 20% of the cells in the population of edited cells are Tn cells or Tscm cells.[000414] In some embodiments, on the day step (c) is performed, at least 44%, at least 46%, at least 48%, at least 50%, at least 52%, at least 54%, at least 56%, at least 58%, at least60%, at least 62%, at least 64%, at least 66%, at least 68%, at least 70%, at least 72%, at least74%, at least 76%, at least 78%, at least 80%, at least 82%, at least 84%, at least 86%, at least88%, or at least 90% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 44% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 46% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 48% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 50% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 52% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 54% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 56% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 58% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 60% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 62% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 64% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 66% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 68% of the cells in the population of edited cells are Tcmcells. In some embodiments, on the day step (c) is performed, at least 70% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 72% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 74% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 76% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 78% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 80% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 82% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 84% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 86% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 88% of the cells in the population of edited cells are Tcm cells. In some embodiments, on the day step (c) is performed, at least 90% of the cells in the population of edited cells are Tcm cells.[000415] In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 9-fold, no more than 8.5-fold, no more than 8-fold, no more than 7.5-fold, no more than 7-fold, no more than 6.5-fold, no more than 6-fold, no more than 5.5-fold, no more than 5-fold, no more than 4.5-fold, no more than 4-fold, no more than 3.5-fold, no more than 3-fold, no more than 2.5-fold, or no more than 2-fold, compared to the population of cells on the day step (a) is performed and / or on the day the population of cells was thawed or on the day the population of cells was collected from the donor. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 9-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 8.5-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 8-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 7.5-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 7-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 6.5-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 6-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 5.5-fold. In some embodiments, on theday step (c) is performed, the population of edited cells has expanded no more than 5-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 4.5-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 4-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 3.5-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 3-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 2.5-fold. In some embodiments, on the day step (c) is performed, the population of edited cells has expanded no more than 2-fold. [000416] In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing higher amounts of cytokines, and / or proliferating at a higher rate, compared to another population of edited cells modified using another method. In some embodiments, the other population of edited cells modified using the other method is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed and / or more than 8 days after the day on which the population of cells was thawed or collected from a donor. In some embodiments, the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed 10 days after the day on which step (a) is performed and / or 11 days after the day on which the population of cells was thawed or collected from the donor. In some embodiments, the contacting of the population of edited cells with the tumor cells is a tumor rechallenge assay.[000417] In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 8-fold, at least 12-fold, at least 16-fold, at least 20- fold, at least 24-fold, at least 28-fold, at least 32-fold, at least 36-fold, at least 40-fold, at least 44-fold, at least 48-fold, at least 52-fold, or at least 56-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, the other population of edited cells modified using the other method is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed and / or more than 8 days after the day on which the population of cells was thawed or collected from a donor. In some embodiments, the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed 10 days after the day on which step (a) is performed and / or 11 days after the day on which the population of cells was thawed or collected from the donor. In some embodiments, when contacted with tumor cells, the population of editedcells is capable of releasing at least 8-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 12-fold higher TNF- a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 16-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 20-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 24-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 28-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 32-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 36-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 40-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 44-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 48-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 52-fold higher TNF-a compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 56-fold higher TNF-a compared to the other population of edited cells modified using the other method.[000418] In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 10-fold, at least 12-fold, at least 14-fold, at least16-fold, at least 18-fold, at least 20-fold, at least 22-fold, at least 24-fold, at least 26-fold, or at least 28-fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, the other population of edited cells modified using the other method is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed and / or more than 8 days after the day on which the population of cells was thawed or collected from a donor. In some embodiments, the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed 10 days after the day on which step (a) is performed and / or 11 days after the day on which the population of cells was thawed or collected from the donor. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 10-fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 12-fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 14-fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 16-fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 18- fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 20-fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 22- fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 24-fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 26- fold higher GM-CSF compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population ofedited cells is capable of releasing at least 28-fold higher GM-CSF compared to the other population of edited cells modified using the other method.[000419] In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 4-fold, at least 6-fold, at least 8-fold, at least 10- fold, at least 12-fold, at least 14-fold, at least 16-fold, at least 18-fold, at least 20-fold, at least 22-fold, or at least 24-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 4-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, the other population of edited cells modified using the other method is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed and / or more than 8 days after the day on which the population of cells was thawed or collected from a donor. In some embodiments, the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed 10 days after the day on which step (a) is performed and / or 11 days after the day on which the population of cells was thawed or collected from the donor. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 6-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 8-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 10-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 12-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 14-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 16-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 18-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable ofreleasing at least 20-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 22-fold higher IL-2 compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 24-fold higher IL-2 compared to the other population of edited cells modified using the other method.[000420] In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 4-fold, at least 8-fold, at least 12-fold, at least 16- fold, at least 20-fold, at least 24-fold, at least 28-fold, or at least 32-fold higher IFN-y compared to the other population of edited cells modified using the other method. In some embodiments, the other population of edited cells modified using the other method is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed and / or more than 8 days after the day on which the population of cells was thawed or collected from a donor. In some embodiments, the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed 10 days after the day on which step (a) is performed and / or 11 days after the day on which the population of cells was thawed or collected from the donor. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 4-fold higher IFN-y compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 8-fold higher IFN-y compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 12-fold higher IFN-y compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 16-fold higher IFN-y compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 20-fold higher IFN-y compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 24-fold higher IFN-y compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least28-fold higher IFN-y compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of releasing at least 32-fold higher IFN-y compared to the other population of edited cells modified using the other method.[000421] In some embodiments, when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, or at least 8-fold higher compared to the other population of edited cells modified using the other method. In some embodiments, the other population of edited cells modified using the other method is modified using step (a), step (b- 1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed and / or more than 8 days after the day on which the population of cells was thawed or collected from a donor. In some embodiments, the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed 10 days after the day on which step (a) is performed and / or 11 days after the day on which the population of cells was thawed or collected from the donor. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 2-fold higher compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 3-fold higher compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 4-fold higher compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 5-fold higher compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 6-fold higher compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 7-fold higher compared to the other population of edited cells modified using the other method. In some embodiments, when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 8-fold higher compared to the other population of edited cells modified using the other method.[000422] In some embodiments, a population of cells comprises non-activated immune cells. In some embodiments, the population of cells comprises activated immune cells.[000423] In some embodiments, a population of cells comprises T cells and is responsive to repeat stimulation after editing. In some embodiments, the population of cells is cultured, expanded, differentiated, or proliferated ex vivo.[000424] In some embodiments, a method for treating a disease in a subject, comprising administering to the subject a population of edited cells or edited cell prepared using any of the methods disclosed herein, is provided. In some embodiments, the disease is cancer. In some embodiments, the disease is an autoimmune disease. In some embodiments, the population of edited cells or the edited cell is allogeneic to the subject.VII. Guide RNAs and Donor Nucleic Acids[000425] In some embodiments, the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor. In some embodiments, the first genome editing tool comprises a first genomic editor comprising a base editor, and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the base editor.[000426] In some embodiments, the second genome editing tool comprises a comprises a second genomic editor and at least one gRNA that targets at least one genomic locus and that is cognate to the second genomic editor, wherein the first genomic editor is orthogonal to the second genomic editor. In some embodiments, the second genome editing tool comprises a second genomic editor comprising an RNA-guided cleavase, and at least one gRNA that targets at least one genomic locus and that is cognate to the RNA-guided cleavase, wherein the base editor is orthogonal to the RNA-guided cleavase.[000427] In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor is non-cognate to the second genomic editor or the RNA- guided cleavase. In some embodiments, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase is non-cognate to the first genomic editor or the base editor.[000428] In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least two gRNAs that target at least two different genomic loci. In some embodiments, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least two gRNAs that target at least two different genomic loci. In some embodiments, the at least one gRNA that iscognate to the first genomic editor or the base editor comprises at least three gRNAs that target at least three different genomic loci. In some embodiments, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least three gRNAs that target at least three different genomic loci. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least four gRNAs that target at least four different genomic loci. In some embodiments, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least four gRNAs that target at least four different genomic loci. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least five gRNAs that target at least five different genomic loci. In some embodiments, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least five gRNAs that target at least five different genomic loci. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least six gRNAs that target at least six different genomic loci. In some embodiments, the first genomic editor and one, two, three, four, five, or six of the at least one gRNA that are cognate to the first genomic editor or the base editor and target different genomic loci are contained in a same lipid nanoparticle (LNP). In some embodiments, the base editor or the at least one gRNA that is cognate to the second genomic editor or the RNA- guided cleavase comprises at least six gRNAs that target at least six different genomic loci.A. Target Sequences and Genes[000429] In some embodiments, the methods and compositions of the present disclosure utilize a CRISPR / Cas system to cleave a target sequence of at least one genomic loci targeted by a guide RNA. For example, a target sequence may be recognized and cleaved by a Cas nuclease. In some embodiments, a target sequence for a Cas nuclease is located near the nuclease’s cognate PAM sequence. In some embodiments, a Class 2 Cas nuclease may be directed by a gRNA to a target sequence of a gene, where the gRNA hybridizes with and the Class 2 Cas protein cleaves the target sequence. In some embodiments, the guide RNA hybridizes with and a Class 2 Cas nuclease cleaves the target sequence adjacent to or comprising its cognate PAM. In some embodiments, the target sequence may be complementary to a targeting sequence of the guide RNA. In some embodiments, the degree of complementarity between a targeting sequence of a guide RNA and the portion of the corresponding target sequence that hybridizes to the guide RNA may be about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the percent identity between atargeting sequence of a guide RNA and the portion of the corresponding target sequence that hybridizes to the guide RNA may be about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the homology region of the target is adjacent to a cognate PAM sequence. In some embodiments, the target sequence may comprise a sequence 100% complementary with the targeting sequence of the guide RNA. In other embodiments, the target sequence may comprise at least one mismatch, deletion, or insertion, as compared to the targeting sequence of the guide RNA.[000430] The length of the target sequence may depend on the nuclease system used. For example, the targeting sequence of a guide RNA for a CRISPR / Cas system may comprise 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more than 50 nucleotides in length and the target sequence is a corresponding length, optionally adjacent to a PAM sequence. In some embodiments, the target sequence may comprise 15-24 nucleotides in length. In some embodiments, the target sequence may comprise 17-21 nucleotides in length. In some embodiments, the target sequence may comprise 20 nucleotides in length. In some embodiments, the target sequence may comprise 24 nucleotides in length. When nickases are used, the target sequence may comprise a pair of target sequences recognized by a pair of nickases that cleave opposite strands of the DNA molecule. In some embodiments, the target sequence may comprise a pair of target sequences recognized by a pair of nickases that cleave the same strands of the DNA molecule. In some embodiments, the target sequence may comprise a part of target sequences recognized by one or more Cas nucleases.[000431 ] The target nucleic acid molecule may be any DNA or RNA molecule that is endogenous or exogenous to a cell. In some embodiments, the target nucleic acid molecule may be an episomal DNA, a plasmid, a genomic DNA, viral genome, or chromosomal DNA. In some embodiments, the target sequence of the gene may be a genomic sequence from a cell or in a cell, including a human cell.[000432] In further embodiments, the target sequence may be a viral sequence. In further embodiments, the target sequence may be a pathogen sequence. In yet other embodiments, the target sequence may be a synthesized sequence. In further embodiments, the target sequence may be a chromosomal sequence. In certain embodiments, the target sequence may comprise a translocation junction, e.g., a translocation associated with a cancer. In some embodiments, the target sequence may be on a eukaryotic chromosome, such as a human chromosome.[000433] In some embodiments, the target sequence may be located in a genomic locus; for example, the target sequence may be located in a coding sequence of a gene, an intron sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splicing site, or a non-coding sequence between genes (e.g., intergenic space). In some embodiments, the gene may be a protein coding gene. In other embodiments, the gene may be a non-coding RNA gene. In some embodiments, the target sequence may comprise all or a portion of a disease-associated gene. In some embodiments, the target sequence may be located in a non-genic functional site in the genome, for example a site that controls aspects of chromatin organization, such as a scaffold site or locus control region.[000434] In some embodiments involving a Cas nuclease, such as a Class 2 Cas nuclease, the target sequence may be adjacent to a protospacer adjacent motif (“PAM”). In some embodiments, the PAM may be adjacent to or within 1, 2, 3, or 4, nucleotides of the 3’ end of the target sequence. The length and the sequence of the PAM may depend on the Cas protein used. For example, the PAM may be selected from a consensus or a particular PAM sequence for a specific Spy Cas9 protein or Spy Cas9 ortholog, including those disclosed in Figure 1 of Ran et al., Nature, 520: 186-191 (2015), and Figure S5 of Zetsche 2015, the relevant disclosure of each of which is incorporated herein by reference. In some embodiments, the PAM may be 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NGG, NGGNG, NG, NAAAAN, NNAAAAW, NNNNACA, GNNNCNNA, TTN, and NNNNGATT (wherein N is defined as any nucleotide, and W is defined as either A or T). In some embodiments, the PAM sequence may be NGG. In some embodiments, the PAM sequence may be NGGNG. In some embodiments, the PAM sequence may be TTN. In some embodiments, the PAM sequence may be NNAAAAW.[000435] In some embodiments, the PAM may be selected from a consensus or a particular PAM sequence for a specific Nme Cas9 protein or Nme Cas9 ortholog (Edraki et al., 2019). In some embodiments, the Nme Cas9 PAM may comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NCC, N4GAYW, N4GYTT, N4GTCT, NNNNCC(a) , NNNNCAAA (wherein N is defined as any nucleotide, W is defined as either A or T, and R is defined as either A or G; and (a) is a preferred, but not required, A after the second C)). In some embodiments, the PAM sequence may be NCC. [000436] In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor or the at least one gRNA that is cognate to the secondgenomic editor or the RNA-guided cleavase comprises at least one single guide RNA (sgRNA). In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor or the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase is a short-single guide RNA (short-sgRNA) comprising a conserved portion of an sgRNA comprising a hairpin region, wherein the hairpin region lacks at least 5-10 nucleotides and wherein the short-sgRNA comprises a 5’ end modification or a 3’ end modification or both.[000437] In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor targets one or more genes chosen from the TRBC locus, the HLA-A locus, the HLA-B locus, the CIITA locus, the HLA-DR locus, the HLA-DQ locus, and the HLA-DP locus. In some embodiments, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase targets one or more genomic loci chosen from the TRAC locus, the AAVS1 locus, and the CIITA locus.[000438] In some embodiments, (i) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(ii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(iii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(iv) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (v) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (vi) the at least one gRNA that iscognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (vii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA- guided cleavase comprises a gRNA that targets the TRAC locus; (viii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (ix) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRAC locus, a gRNA that targets the TRBC locus, a gRNA that targets the CIITA locus, and a gRNA that targets the HLA-A locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus; (x) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus; (xi) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus; (xii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the HLA-DR locus, the HLA- DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus; (xiii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus.[000439] In some embodiments, in any one of subparts (i)-(ix) above, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a further gRNA that targets the AAVS1 locus. In some embodiments, in any one of subparts (x)-(xiii) above, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a further gRNA that targets the TRAC locus. In some embodiments, the population of cells is contacted with the further gRNA that targets the AAVS1 locus after the population of cells is contacted with the gRNA that targets the TRAC locus. In some embodiments, the population of cells is contacted with the further gRNA that targets the TRAC locus after the population of cells is contacted with the gRNA that targets the AAVS1 locus.[000440] In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor or the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA comprising a guide sequence described in International Application No. PCT / US2023 / 068498, filed June 15, 2023, International Application No. PCT / US2023 / 068499, filed June 15, 2023, and / or International Application No. PCT / US2023 / 068507, filed June 15, 2023, the content of each of which is hereby incorporated by reference. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor or the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA described in Table 18 or a gRNA comprising a guide sequence described in Table 18.[000441 ] In some embodiments, the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus. In some embodiments, the gRNA that targets the TRAC locus comprises the guide sequence of SEQ ID NO: 315. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus. In some embodiments, the gRNA that targets the HLA-A locus comprises the guide sequence of SEQ ID NO: 366. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-B locus. In some embodiments, the gRNA that targets the HLA-B locus comprises the guide sequence of SEQ ID NO: 388. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the CIITA locus. In someembodiments, the gRNA that targets the CIITA locus comprises the guide sequence of SEQ ID NO: 384. In some embodiments, the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TGFBR2 locus. In some embodiments, the gRNA that targets the TGFBR2 locus comprises the guide sequence of SEQ ID NO: 455.B. Modified gRNAs[000442] In the case of a sgRNA, the above guide sequences may further comprise additional nucleotides to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3’ end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 226) in 5’ to 3’ orientation.[000443] In the case of a sgRNA, the above guide sequences may further comprise additional nucleotides to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3’ end of the guide sequence:GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 227) in 5’ to 3’ orientation. [000444] In the case of a sgRNA, the guide sequences may be integrated into the following modified motif: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 228), where “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage to the adjacent nucleotide residue; and wherein the N’s are collectively the nucleotide sequence of a guide sequence. In the context of a modified sequence, unless otherwise indicated, A, C, G, N, and U are an unmodified RNA nucleotide, i.e., a 2’-OH sugar moiety with a phosphodiesterase linkage to the adjacent nucleotide residue, or a 5 ’-terminal PO4.[000445] In the case of a sgRNA, the guide sequences may further comprise a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is shown in Table 16 (SEQ ID NO: 226: GUUUUAGAGC UAGAAAUAGC AAGUUAAAAU AAGGCUAGUC CGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGC - “Exemplary SpyCas9sgRNA-1”), included at the 3’ end of the guide sequence, and provided with the domains as shown in Table 16 below. LS is lower stem. B is bulge. US is upper stem. Hl and H2 are hairpin 1 and hairpin 2, respectively. Collectively Hl and H2 are referred to as the hairpin region. A model of the structure is provided in Figure 10A of WO2019237069 which is incorporated herein by reference.[000446] The nucleotide sequence of Exemplary SpyCas9 sgRNA-1 may serve as a template sequence for specific chemical modifications, sequence substitutions and truncations.[000447] In certain embodiments, the gRNA is an sgRNA or a dgRNA, for example, and it optionally comprises a chemical modification. In some embodiments, the modified sgRNA comprises a guide sequence and a SpyCas9 sgRNA sequence, e.g., Exemplary SpyCas9 sgRNA-1. A gRNA, such as an sgRNA, may include modifications on the 5’ end of the guide sequence or on the 3’ end of the SpyCas9 sgRNA sequence, such as, e.g., Exemplary SpyCas9 sgRNA-1 at one or more of the terminal nucleotides, e.g., at 1, 2, 3, or 4 of the nucleotides at the 3’ end or at the 5’ end. In certain embodiments, the modified nucleotide is selected from a 2’-O-methyl (2’-0me) modified nucleotide, a 2’-O-(2- methoxy ethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, or an inverted abasic modified nucleotide; or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0me modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage. In certain embodiments, the modified nucleotide includes a 2’-0me modified nucleotide and a PS linkage.[000448] In certain embodiments, using SEQ ID NO: 226 (“Exemplary SpyCas9 sgRNA-1”) as an example, the Exemplary SpyCas9 sgRNA-1 further includes one or more of: (A) a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein (1) at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl- 10, or Hl -4 and Hl -9, and the hairpin 1 region optionally lacks (a) any one or two of Hl -5 through Hl-8, (b) one, two, or three of the following pairs of nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl -10, and Hl -4 and Hl -9, or (c) 1-8 nucleotides of hairpin 1 region; or (2) the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides, and (a) one or more of positions Hl-1, Hl-2, or Hl-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226), or (b) one or more of positions Hl-6 through Hl-10 is substituted relative to Exemplary SpyCas9 sgRNA-l(SEQ ID NO: 226); or(3) the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, Hl-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226); or (B) a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226); or (C) a substitution relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or (D) an Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region, wherein (1) the modified nucleotide is optionally selected from a 2’-O-methyl (2’-0me) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’ -fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof; or (2) the modified nucleotide optionally includes a 2’-0me modified nucleotide.[000449] In some embodiments, the sgRNA comprises a modified motif disclosed herein, including the modified motif of any one of SEQ ID Nos: 228-242 and 246-250, 312- 314 or any other modified motif shown in the Table of Sequences, where “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O- methyl modified nucleotide, and * is a phosphorothioate linkage to the adjacent nucleotide residue; and wherein the N’s are collectively the nucleotide sequence of a guide sequence. [000450] In certain embodiments, using SEQ ID NO: 400 (“Exemplary NmeCas9 sgRNA-1” as shown in Table 17) as an example, the Exemplary NmeCas9 sgRNA-1 includes: (A) A guide RNA (gRNA) comprising a guide region and a conserved region, the conserved region comprising one or more of: (a) a shortened repeat / anti-repeat region, wherein the shortened repeat / anti-repeat region lacks 2-24 nucleotides , wherein (i) one or more of nucleotides 37-48 and 53-64 is deleted and optionally one or more of nucleotides 37- 64 is substituted relative to SEQ ID NO: 400; and (ii) nucleotide 36 is linked to nucleotide 65 by at least 2 nucleotides; or (b) a shortened hairpin 1 region, wherein the shortened hairpin 1 lacks 2-10, optionally 2-8 nucleotides, wherein (i) one or more of nucleotides 82-86 and OIOS is deleted and optionally one or more of positions 82-96 is substituted relative to SEQ ID NO: 400; and (ii) nucleotide 81 is linked to nucleotide 96 by at least 4 nucleotides ; or (c) ashortened hairpin 2 region, wherein the shortened hairpin 2 lacks 2-18 , optionally 2-16 nucleotides, wherein (i) one or more of nucleotides 113-121 and 126-134 is deleted and optionally one or more of nucleotides 113-134 is substituted relative to SEQ ID NO: 400; and (ii) nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; wherein one or both nucleotides 144-145 are optionally deleted relative to SEQ ID NO: 400; wherein optionally at least 10 nucleotides are modified nucleotides.[000451] Exemplary unmodified conserved portion nucleotide sequences include: GUUGUAGCUCCCUUUCUCAUUUCGGAAACGAAAUGAGAACCGUUGCUACAAU AAGGCCGUCUGAAAAGAUGUGCCGCAACGCUCUGCCCCUUAAAGCUUCUGCUU UAAGGGGCAUCGUUUA (SEQ ID NO: 243);GUUGUAGCUCCCUGAAACCGUUGCUACAAUAAGGCCGUCGAAAGAUGUGCCGC AACGCUCUGCCUUCUGGCAUCGUU (SEQ ID NO: 244), and GUUGUAGCUCCCUGGAAACCCGUUGCUACAAUAAGGCCGUCGAAAGAUGUGCC GCAACGCUCUGCCUUCUGGCAUCGUUUAUU (SEQ ID NO: 245).[000452] In the case of a sgRNA, the guide sequences may be integrated into one of the following exemplary modified conserved portion motifs: GUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGm CCmGmUmCmGmAmAmAmGmAmUGUGCmCGCmAmAmCmGCUCUmGmCCmUmU mCmUGmGCmAmUC*mG*mU*mU (SEQ ID NO: 246) and GUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGm CCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmC mUGGCAUCG*mU*mU (SEQ ID NO: 247).[000453] In certain embodiments, the guide sequence is 20-25 nucleotides in length ((N)20-25), wherein each nucleotide may be independently modified. In certain embodiments, each of nucleotides 1-3 of the 5’ end of the guide is independently modified. In certain embodiments, each of nucleotides 1-3 of the 5’ end of the guide is independently modified with a 2’-0me modification. In certain embodiments, each of nucleotides 1-3 of the 5’ end of the guide is independently modified with a phosphorothioate linkage to the adjacent nucleotide residue. In certain embodiments, each of nucleotides 1-3 of the 5’ end of the guide is independently modified with a 2’-0me modification and a phosphorothioate linkage to the adjacent nucleotide residue.[000454] In the case of a sgRNA, modified guide sequences may be integrated into one of the following exemplary modified conserved portion motifs: mN*mNNNNNNNNmNNNmNNNNNNNNNNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAm UGUGCmCGCmAmAmCmGCUCUmGmCCmUmUmCmUGmGCmAmUC*mG*mU*mU (SEQ ID NO: 248);(N)2O-25 GUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AA GmGmCCmGmUmCmGm Am Am AmGm AmUGUGC mCGCm Am AmCmGCUCUmGm CcmUmUmCmUGmGCmAmUC*mG*mU*mU (SEQ ID NO: 249); mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmC UCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU* AAGmGmCCmGmUmCmGmA mAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU* mU (SEQ ID NO: 250); or any one of mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmC UCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAUAAGmGmCCmGmUmCmGmAm AmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*m U (SEQ ID NO: 312), mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmC UCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU* AAGmGmCCmGmUmCmGmA mAmAmGmAmUGUGCmCGmCAAmCGmCmUmCmUmGmCCmUmUmCmUGGCAUC G*mU*mU (SEQ ID NO: 313); mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmC UCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAUAAGmGmCCmGmUmCmGmAm AmAmGmAmUGUGCmCGmCAAmCGmCmUmCmUmGmCCmUmUmCmUGGCAUCG *mU*mU (SEQ ID NO: 314).[000455] In certain embodiments, Exemplary SpyCas9 sgRNA-1, or an sgRNA, such as an sgRNA comprising an Exemplary SpyCas9 sgRNA-1, further includes a 3’ tail, e.g., a 3’ tail of 1, 2, 3, 4, or more nucleotides. In certain embodiments, the tail includes one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from a 2’- O-methyl (2’-0me) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’ -fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide; or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0me modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage between nucleotides. In certain embodiments, the modified nucleotide includes a 2’-0me modified nucleotide and a PS linkage between nucleotides.[000456] In certain embodiments, the hairpin region includes one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from a 2’-O-methyl (2’-0me) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide; or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0me modified nucleotide.[000457] In certain embodiments, the upper stem region includes one or more modified nucleotides. In certain embodiments, the modified nucleotide selected from a 2’-O-methyl (2’-0me) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide; or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0me modified nucleotide.[000458] In certain embodiments, the Exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, wherein Y is a pyrimidine, wherein the YA dinucleotide includes a modified nucleotide. In certain embodiments, the modified nucleotide selected from a 2’-O- methyl (2’-0me) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’ -fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0me modified nucleotide.[000459] In certain embodiments, the Exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, wherein Y is a pyrimidine, wherein the YA dinucleotide includes a sequence substituted nucleotide, wherein the pyrimidine is substituted for a purine. In certain embodiments, when the pyrimidine forms a Watson-Crick base pair in the single guide, the Watson-Crick based nucleotide of the sequence substituted pyrimidine nucleotide is substituted to maintain Watson-Crick base pairing.[000460] In some embodiments, the gRNA is chemically modified. A gRNA comprising one or more modified nucleosides or nucleotides is called a “modified” gRNA or “chemically modified” gRNA, to describe the presence of one or more non-naturally or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues. In some embodiments, a modified gRNA is synthesized with a non-canonical nucleoside or nucleotide, is here called “modified.” Modified nucleosides and nucleotides can include one or more of (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii)alteration, e.g., replacement, of a constituent of the ribose sugar, e.g., of the 2’ hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); and (iv) modification of the 3’ end or 5’ end of the oligonucleotide to provide exonuclease stability, e.g., with 2’ O-me, 2’ halide, or 2’ deoxy substituted ribose; or inverted abasic terminal nucleotide, or replacement of phosphodiester with phosphothioate. [000461] Chemical modifications such as those listed above can be combined to provide modified gRNAs or mRNAs comprising nucleosides and nucleotides (collectively “residues”) that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase. In certain embodiments, all, or substantially all, of the phosphate groups of a gRNA molecule are replaced with phosphorothioate groups. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 5’ end of the RNA. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 3’ end of the RNA.[000462] In some embodiments, the gRNA comprises one, two, three or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, 10%, 15%, preferably at least 20%, 25%, 30%, 35%, 40%, 45%, or 50%) of the positions in a modified gRNA are modified nucleosides or nucleotides. In some embodiments, at least 5% of the positions in the modified guide RNA are modified nucleotides or nucleosides. In some embodiments, at least 10% of the positions in the modified guide RNA are modified nucleotides or nucleosides. In some embodiments at least 15% of the positions in the modified gRNA are modified nucleotides or nucleosides. In some embodiments preferably at least 20% of the positions in the modified gRNA are modified nucleotides or nucleosides. In some embodiments, no more than 65% of the positions in the modified gRNA are modified nucleotides. In some embodiments, no more than 55% of the positions in the modified gRNA are modified nucleotides. In some embodiments, no more than 50% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 10-70% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-70% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-50% of the positions in the modified gRNA are modified nucleotides and the nuclease is a SpyCas9 nuclease. In some embodiments, 30-70% of the positions in the modified gRNA are modified nucleotides and the nuclease is an NmeCas9 nuclease.[000463] Unmodified nucleic acids can be prone to degradation by, e.g., intracellular nucleases or those found in serum. For example, nucleases can hydrolyze nucleic acidphosphodiester bonds. Accordingly, in one aspect the gRNAs described herein can contain one or more modified nucleosides or nucleotides, e.g., to introduce stability toward intracellular or serum-based nucleases. In some embodiments, the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into a population of cells, both in vivo and ex vivo. The term “innate immune response” includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, which involves the induction of cytokine expression and release, particularly the interferons, and cell death.[000464] In some embodiments of a backbone modification, the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent. Further, the modified residue, e.g., modified residue present in a modified nucleic acid, can include the replacement of an unmodified phosphate moiety with a modified phosphate group as described herein. In some embodiments, the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.[000465] Examples of modified phosphate groups include, phosphorothioate, borano phosphate esters, methyl phosphonates, phosphoroamidates, phosphodithioate, alkyl or aryl phosphonates and phosphotriesters. The phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral. The stereogenic phosphorous atom can possess either the “R” configuration (herein Rp) or the “S” configuration (herein Sp). The backbone can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). The replacement can occur at either linking oxygen or at both of the linking oxygens.[000466] The phosphate group can be replaced by non-phosphorus containing connectors in certain backbone modifications, e.g., an amide linkage. In some embodiments, the charge...

Claims

What is claimed is:

1. An ex vivo method of genetically modifying a population of cells, comprising:(a) activating the population of cells;(b-1) contacting the population of cells with a first genome editing tool, wherein the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor, thereby producing a population of edited cells; and(c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

2. The method of claim 1, wherein the first genomic editor comprises a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

3. The method of claim 1 or 2, wherein the first genomic editor comprises a base editor, optionally a C to T base editor or an A to G base editor.

4. The method of claim 1 or 2, wherein the first genomic editor comprises a cleavase.

5. The method of any one of claims 1-3, wherein the first genomic editor comprises an N meningitidis (Nme) RNA-guided nickase.

6. The method of any one of claims 1, 2, and 4, wherein the first genomic editor comprises an N meningitidis (Nme) RNA-guided cleavase.

7. The method of any one of claims 1-3, wherein the first genomic editor comprises an S. pyogenes (Spy) RNA-guided nickase.

8. The method of any one of claims 1, 2, and 4, wherein the first genomic editor comprises an S. pyogenes (Spy) RNA-guided cleavase.

9. The method of any one of claims 1-8, wherein the first genomic editor comprises an NmelCas9, an Nme2Cas9, an Nme3Cas9, or SpyCas9.

10. An ex vivo method of genetically modifying a population of cells, comprising:(a) activating the population of cells;(b-1) contacting the population of cells with a first genome editing tool, wherein the first genome editing tool comprises a first genomic editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the first genomic editor; and (b-2) contacting the population of cells with a second genome editing tool, wherein the second genome editing tool comprises a second genomic editor and at least one gRNA that targets at least one genomic locus and that is cognate to the second genomic editor,wherein the first genomic editor is orthogonal to the second genomic editor, thereby producing a population of edited cells; and(c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

11. The method of claim 10, wherein the first genomic editor comprises a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

12. The method of claim 10 or 11, wherein the second genomic editor comprises a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

13. The method of any one of claims 10-12, wherein one of the first genomic editor and the second genomic editor comprises a base editor, optionally a C to T base editor or an A to G base editor, and the other of the first genomic editor and the second genomic editor comprises a cleavase.

14. The method of any one of claims 10-13, wherein one of the first genomic editor and second genomic editor comprises an A. meningitidis (Nme) RNA-guided nickase or cleavase, and the other of the first genomic editor and the second genomic editor comprises an S. pyogenes (Spy) RNA-guided nickase or cleavase.

15. The method of any one of claims 10-14, wherein the first genomic editor or the second genomic editor comprises an NmelCas9, an Nme2Cas9, an Nme3Cas9, or SpyCas9.

16. An ex vivo method of genetically modifying a population of cells, comprising:(a) activating the population of cells;(b-1) contacting the population of cells with a first genome editing tool comprising a first genomic editor comprising a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and that is cognate to the base editor; and(b-2) contacting the population of cells with a second genome editing tool comprising a second genomic editor comprising an RNA-guided cleavase and at least one gRNA that targets at least one genomic locus and that is cognate to the RNA-guided cleavase, wherein the base editor is orthogonal to the RNA-guided cleavase, thereby producing a population of edited cells; and(c) harvesting the population of edited cells, wherein step (c) is performed no later than 7 days after the day on which step (a) is performed.

17. The method of any one of claims 1-16, further comprising:(b-3) contacting the population of cells with a nucleic acid encoding at least one exogenous gene.

18. The method of any one of claims 1-17, wherein step (a) and step (b-1) are performed on the same day.

19. The method of any one of claims 10-18, wherein step (a), step (b-1), and step (b-2) are performed on the same day.

20. The method of any one of claims 17-19, wherein step (a), step (b-1), step (b-2), and step (b-3) are performed on the same day.

21. The method of any one of claims 10-20, wherein step (b-1) and step (b-2) are performed on the same day.

22. The method of any one of claims 10-21, wherein step (b-1) and step (b-2) are performed simultaneously.

23. The method of any one of claims 17-22, wherein step (b-1), step (b-2), and step (b-3) are performed on the same day.

24. The method of any one of claims 17-23, wherein step (b-1), step (b-2), and step (b-3) are performed simultaneously.

25. The method of any one of claims 1-24, wherein step (c) is performed no later than 7 days, no later than 6 days, no later than 5 days, no later than 4 days, no later than 3 days, no later than 2 days, or no later than 1 day after the day on which step (a) is performed.

26. The method of any one of claims 1-25, wherein step (c) is performed no later than 4 days after the day on which step (a) is performed.

27. The method of any one of claims 1-26, wherein step (c) is performed 4 days, 3 days, or 2 days after the day on which step (a) is performed.

28. The method of any one of claims 1-27, wherein step (c) is performed 4 days or 2 days after the day on which step (a) is performed.

29. The method of any one of claims 1-28, wherein step (c) is performed 4 days after the day on which step (a) is performed.

30. The method of any one of claims 1-28, wherein step (c) is performed 2 days after the day on which step (a) is performed.

31. The method of any one of claims 1-30, further comprising:(d) storing the population of edited cells, wherein step (d) is performed no later than 2 days after the day on which step (c) is performed.

32. The method of claim 31, wherein step (d) is performed no later than 1 day after the day on which step (c) is performed.

33. The method of claim 31 or 32, wherein step (d) is performed 2 days or 1 day after the day on which step (c) is performed, or wherein step (d) and step (c) are performed on the same day.

34. The method of any one of claims 31-33, wherein step (d) and step (c) are performed on the same day.

35. The method of any one of claims 31-34, wherein the storing the population of edited cells comprises freezing the population of edited cells.

36. The method of any one of claims 2, 3, 5, 7, 9, and 11-35, wherein the base editor is a C to T base editor, optionally comprising a cytidine deaminase, or is an A to G base editor, optionally comprising an adenosine deaminase.

37. The method of any one of claims 1-36, wherein some cells in the population of edited cells comprise at least two genomic edits.

38. The method of claim 37, wherein one of the at least two genomic edits is located at the at least one genomic locus targeted by the at least one gRNA that is cognate to the first genomic editor or the base editor, and wherein another one of the at least two genomic edits is located at the at least one genomic locus targeted by the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase.

39. The method of claim 37 or 38, wherein one of the at least two genome edits comprises a double-stranded break, and another one of the at least two genome edits comprises a transition or base edit (e.g., A to G or C to T).

40. The method of any one of claims 1-39, wherein the first genome editing tool or the second genome editing tool is delivered to the population of cells via at least one lipid nanoparticle (LNP).

41. The method of any one of claims 17-40, wherein the nucleic acid encoding the at least one exogenous gene is delivered to the population of cells via a virus, optionally wherein the nucleic acid is a viral vector.

42. The method of claim 41, wherein the virus is an adeno-associated virus (AAV), optionally wherein the nucleic acid is an AAV vector.

43. The method of claim 41, wherein the virus is a lentivirus, optionally wherein the nucleic acid is a lentiviral vector.

44. The method of any one of claims 1-43, wherein the first genome editing tool or the second genome editing tool is delivered as at least one nucleic acid encoding the first genome editing tool or the second genome editing tool.

45. The method of claim 44, wherein the at least one nucleic acid comprises at least one mRNA.

46. The method of any one of claims 1-45, wherein the at least one gRNA is delivered to the population of cells as at least one polynucleotide that encodes the gRNA.

47. The method of any one of claims 2, 3, 5, 7, 9, and 11-46, wherein the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are comprised in a single polypeptide.

48. The method of any one of claims 2, 3, 5, 7, 9, and 11-46, wherein the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are comprised in different polypeptides.

49. The method of any one of claims 2, 3, 5, 7, 9, and 11-48, wherein the base editor comprises a cytidine deaminase and an RNA-guided nickase.

50. The method of claim 49, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in a single polypeptide.

51. The method of claim 49, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in different polypeptides.

52. The method of claim 49, wherein the cytidine deaminase and the RNA-guided nickase are comprised in a single polypeptide, and wherein the UGI is comprised in a different polypeptide.

53. The method of any one of claims 1-3, 7, and 9-52, wherein the first genomic editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3 or the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1 or 2.

54. The method of any one of claims 1-3, 5, and 9-52, wherein the first genomic editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 146.

55. The method of any one of claims 1-3, 5, and 9-52, and 54, wherein the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 310.

56. The method of any one of claims 1, 2, 4, and 8-53, wherein the first genomic editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 156.

57. The method of any one of claims 1, 2, 4, 8-53, and 56, wherein the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 295.

58. The method of any one of claims 10-53, wherein the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1 or 2, and the second genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 180-183 and 185-190.

59. The method of any one of claims 10-52, 54, and 55, wherein the first genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 147 or 310, and the second genomic editor is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 293 or 295.

60. The method of any one of claims 1-3, 5, 7, and 9-53, wherein the first genomic editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 9, 18, and 21.

61. The method of any one of claims 1-3, 5, 7, 9-53, and 60, wherein the first genomic editor or the base editor comprises a cytidine deaminase, and wherein the cytidine deaminase comprises an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 22.

62. The method of claim 61, wherein the cytidine deaminase comprises an APOBEC3A deaminase (A3 A).

63. The method of any one of claims 1-3, 5, 7, and 10-52, wherein the first genomic editor or the base editor comprises a Cas9 nickase.

64. The method of claim 63, wherein the first genomic editor or the base editor comprises an N. meningitidis (Nme) Cas9 nickase.

65. The method of claim 63 or 64, wherein the first genomic editor or the base editor comprises a D16A NmeCas9 nickase, optionally a D16A Nme2Cas9.

66. The method of any one of claims 63, 74, and 75, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising the nucleotide sequence of any one of SEQ ID NOs: 151 or a nucleotide sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NOs: 151.

67. The method of any one of claims 1-3, 5, 9-52, 54, 55, and 59-62, wherein the first genomic editor or the base editor comprises the amino acid sequence of SEQ ID NO: 146 or 149 or wherein the first genomic editor or the base editor comprises a sequence that is at least 80%, 85%, 90%, 95%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 146 or 149.

68. The method of any one of claims 10-67, wherein the second genomic editor or the RNA- guided cleavase comprises a Cas9 cleavase.

69. The method of claim 68, wherein the second genomic editor or the RNA-guided cleavase comprises an S. pyogenes (Spy) Cas9 cleavase.

70. The method of any one of claims 10-52, 54, 55, 59-69, wherein the second genomic editor or the RNA-guided cleavase comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 156.

71. The method of any one of claims 10-52, 54, 55, 59-70, wherein the second genomic editor or the RNA-guided cleavase comprises the amino acid sequence of SEQ ID NO: 156.

72. The method of any one of claims 10-52, 54, 55, 59-71, wherein the second genomic editor or the RNA-guided cleavase is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 295 or 293.

73. The method of any one of claims 10-52, 54, 55, 59-72, wherein the second genomic editor or the RNA-guided cleavase is delivered to the cell as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 295 or 293.

74. The method of claim 63, wherein the first genomic editor or the base editor comprises an S. pyogenes (Spy) Cas9 nickase.

75. The method of claim 63 or 74, wherein the first genomic editor or the base editor comprises a D10A SpyCas9 nickase.

76. The method of any one of claims 63, 74, and 75, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising the nucleotide sequence of any one of SEQ ID NOs: 42, 44, and 46 or a nucleotide sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NOs: 42, 44, and 46.

77. The method of any one of claims 63 and 74-76, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising the nucleotide sequence of any one of SEQ ID NOs: 42, 44, and 46-58.

78. The method of any one of claims 63 and 74-77, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 1.

79. The method of any one of claims 63 and 74-77, wherein the first genomic editor or the base editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 4.

80. The method of claim 68, wherein the second genomic editor or the RNA-guided cleavase comprises an N. meningitidis (Nme) Cas9 cleavase.

81. The method of claim 68 or 80, wherein the second genomic editor or the RNA-guided cleavase comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 157-167, 191, 198, 212, and 219.

82. The method of any one of claims 68, 80, and 81, wherein the second genomic editor or the RNA-guided cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 157-167, 191, 198, 212, and 219.

83. The method of any one of claims 68 and 80-82, wherein the second genomic editor or the RNA-guided cleavase is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 168-190, 192-197, 199- 204, 206-211, 213- 218, and 220-225.

84. The method of any one of claims 68 and 80-83, wherein the second genomic editor or the RNA-guided cleavase is delivered to the population of cells as a nucleic acid comprising a nucleotide sequence of any one of SEQ ID NOs: 168-190, 192-197, 199-204, 206-211, 213-218, and 220-225.

85. The method of any one of claims 10-84, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor is non-cognate to the second genomic editor or the RNA-guided cleavase.

86. The method of any one of claims 10-85, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase is non-cognate to the first genomic editor or the base editor.

87. The method of any one of claims 1-86, wherein the at least one gRNA comprises at least one single guide RNA (sgRNA).

88. The method of any one of claims 1-87, wherein the at least one sgRNA comprises a shortsingle guide RNA (short-sgRNA) comprising a conserved portion of an sgRNA comprising a hairpin region, wherein the hairpin region lacks at least 5-10 nucleotides and wherein the short-sgRNA comprises a 5’ end modification or a 3’ end modification or both.

89. The method of any one of claims 1-88, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least two gRNAs that target at least two different genomic loci.

90. The method of any one of claims 10-89, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least two gRNAs that target at least two different genomic loci.

91. The method of any one of claims 1-90, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least three gRNAs that target at least three different genomic loci.

92. The method of any one of claims 10-91, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least three gRNAs that target at least three different genomic loci.

93. The method of any one of claims 1-92, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least four gRNAs that target at least four different genomic loci.

94. The method of any one of claims 10-93, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least four gRNAs that target at least four different genomic loci.

95. The method of any one of claims 1-94, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises at least five gRNAs that target at least five different genomic loci.

96. The method of any one of claims 10-95, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises at least five gRNAs that target at least five different genomic loci.

97. The method of any one of claims 1-96, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor targets one or more genomic loci chosen fromthe TRBC locus, the HLA-A locus, the HLA-B locus, the CIITA locus, the HLA-DR locus, the HLA-DQ locus, and the HLA-DP locus.

98. The method of any one of claims 10-97, wherein the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase targets one or more genomic loci chosen from the TRAC locus, the AAVS1 locus, and the CIITA locus.

99. The method of any one of claims 10-98, wherein(i) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(ii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(iii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(iv) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(v) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(vi) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(vii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA- guided cleavase comprises a gRNA that targets the TRAC locus;(viii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(ix) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRAC locus, a gRNA that targets the TRBC locus, a gRNA that targets the CIITA locus, and a gRNA that targets the HLA-A locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the TRAC locus;(x) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus;(xi) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, a gRNA that targets the HLA-B locus, and a gRNA that targets the CIITA locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus;(xii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA- guided cleavase comprises a gRNA that targets the AAVS1 locus; or(xiii) the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TRBC locus, a gRNA that targets the HLA-A locus, agRNA that targets the HLA-B locus, and a gRNA that targets the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA that is cognate to the second genomic editor or the RNA-guided cleavase comprises a gRNA that targets the AAVS1 locus.

100. The method of any one of claims 1-99, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus or the at least one gRNA that is cognate to the second genomic editor or the RNA- guided cleavase comprises a gRNA that targets the TRAC locus.

101. The method of claim 100, wherein the gRNA that targets the TRAC locus comprises the guide sequence of SEQ ID NO: 315.

102. The method of any one of claims 1-101, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-A locus.

103. The method of claim 102, wherein the gRNA that targets the HLA-A locus comprises the guide sequence of SEQ ID NO: 366.

104. The method of any one of claims 1-103, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the HLA-B locus.

105. The method of claim 104, wherein the gRNA that targets the HLA-B locus comprises the guide sequence of SEQ ID NO: 388.

106. The method of any one of claims 1-105, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the CIITA locus.

107. The method of claim 106, wherein the gRNA that targets the CIITA locus comprises the guide sequence of SEQ ID NO: 384.

108. The method of any one of claims 1-107, wherein the at least one gRNA that is cognate to the first genomic editor or the base editor comprises a gRNA that targets the TGFBR2 locus.

109. The method of claim 108, wherein the gRNA that targets the TGFBR2 locus comprises the guide sequence of SEQ ID NO: 455.

110. The method of any one of claims 17-109, wherein the at least one exogenous gene comprises a T cell receptor (TCR) or a chimeric antigen receptor (CAR).

111. The method of any one of claims 40-110, wherein the LNP comprises an ionizable lipid.

112. The method or composition of claim 111, wherein the ionizable lipid comprises a biodegradable ionizable lipid.

113. The method of any one of claims any one of claims 40-112, wherein the LNP comprises a lipid component and the lipid component comprises: about 50-60 mol % amine lipid such as Lipid A; about 8-10 mol % neutral lipid; and about 2.5-4 mol % stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N / P ratio of the lipid LNP is about 3-7.

114. The method of any one of claims 40-112, wherein the LNP comprises a lipid component and the lipid component comprises: about 25-45 mol % amine lipid, such as Lipid A; about 10-30 mol % neutral lipid; about 25-65 mol % helper lipid; and about 1.5- 3.5 mol % stealth lipid (e.g., PEG lipid), and wherein the N / P ratio of the LNP is about 3- 7.

115. The method of any one of claims 1-114, wherein the population of cells is a population of cells isolated from human donor PBMCs or leukopaks.

116. The method of any one of claims 1-115, wherein the population of cells is a population of immune cells.

117. The method of any one of claims 1-116, wherein the population of cells is a population of T cells.

118. The method of claim 117, wherein in the population of T cells, a ratio of CD4+ T cells to CD8+ T cells is 1 : 1.

119. A population of edited cells, prepared ex vivo using the method of any one of claims 1-118.

120. The population of edited cells of claim 119, wherein on the day step (c) is performed, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of the cells in the population of edited cells express the at least one exogenous gene.

121. The population of edited cells of claim 119 or 120, wherein on the day step (c) is performed, no more than 20%, no more than 18%, no more than 16%, no more than 14%, no more than 12%, no more than 10%, no more than 8%, no more than 6%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, no more than 0.4%, no more than 0.3%, no more than 0.2%, or no more than 0.1% of the cells in the population of edited cells express an endogenous T cell receptor (TCR).

122. The population of edited cells of any one of claims 119-121, wherein on the day step (c) is performed, at least 60%, at least 62%, at least 64%, at least 66%, at least 68%, atleast 70%, at least 72%, at least 74%, at least 76%, at least 78%, at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, or at least 98% of the cells in the population of edited cells are naive T cells (Tn cells), stem cell like memory T cells (Tscm cells), or central memory T cells (Tcm cells), optionally wherein the Tn cells or the Tscm cells are CD45RO- and CCR7+, and optionally wherein the Tcm cells are CD45RO+ and CCR7+.

123. The population of edited cells of any one of claims 119-122, wherein on the day step (c) is performed, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, or at least 20% of the cells in the population of edited cells are naive T cells (Tn cells) or stem cell like memory T cells (Tscm cells), optionally wherein the Tn cells or the Tscm cells are CD45RO- and CCR7+.

124. The population of edited cells of any one of claims 119-123, wherein on the day step (c) is performed, at least 44%, at least 46%, at least 48%, at least 50%, at least 52%, at least 54%, at least 56%, at least 58%, at least 60%, at least 62%, at least 64%, at least 66%, at least 68%, at least 70%, at least 72%, at least 74%, at least 76%, at least 78%, at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, or at least 90% of the cells in the population of edited cells are central memory T cells (Tcm cells), optionally wherein the Tcm cells are CD45RO+ and CCR7+.

125. The population of edited cells of any one of claims 119-124, wherein on the day step(c) is performed, the population of edited cells has expanded no more than 9-fold, no more than 8.5-fold, no more than 8-fold, no more than 7.5-fold, no more than 7-fold, no more than 6.5-fold, no more than 6-fold, no more than 5.5-fold, no more than 5-fold, no more than 4.5-fold, no more than 4-fold, no more than 3.5-fold, no more than 3-fold, no more than 2.5-fold, or no more than 2-fold, compared to the population of cells on the day step (a) is performed.

126. The population of edited cells of any one of claims 119-125, wherein when contacted with tumor cells, the population of edited cells is capable of releasing at least 8-fold, at least 12-fold, at least 16-fold, at least 20-fold, at least 24-fold, at least 28-fold, at least 32- fold, at least 36-fold, at least 40-fold, at least 44-fold, at least 48-fold, at least 52-fold, or at least 56-fold higher TNF-a compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), andstep (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.

127. The population of edited cells of any one of claims 119-126, wherein when contacted with tumor cells, the population of edited cells is capable of releasing at least 10-fold, at least 12-fold, at least 14-fold, at least 16-fold, at least 18-fold, at least 20-fold, at least 22- fold, at least 24-fold, at least 26-fold, or at least 28-fold higher GM-CSF compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.

128. The population of edited cells of any one of claims 119-127, wherein when contacted with tumor cells, the population of edited cells is capable of releasing at least 4-fold, at least 6-fold, at least 8-fold, at least 10-fold, at least 12-fold, at least 14-fold, at least 16- fold, at least 18-fold, at least 20-fold, , at least 22-fold or at least 24-fold higher IL-2 compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.

129. The population of edited cells of any one of claims 119-128, wherein when contacted with tumor cells, the population of edited cells is capable of releasing at least 4-fold, at least 8-fold, at least 12-fold, at least 16-fold, at least 20-fold, at least 24-fold, at least 28- fold, or at least 32-fold higher IFN-y compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.

130. The population of edited cells of any one of claims 119-129, wherein when contacted with tumor cells, the population of edited cells is capable of proliferating at a rate at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, or at least 8-fold higher compared to another population of edited cells, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed more than 7 days after the day on which step (a) is performed.

131. The population of edited cells of any one of claims 126-130, wherein the other population of edited cells is modified using step (a), step (b-1) and / or step (b-2), and step (c), except that step (c) is performed 10 days after the day on which step (a) is performed.

132. An edited cell comprised in the population of edited cells of any one of claims 119- 131, wherein the edited cell comprises the at least two genomic edits.

133. The edited cell of claim 132, wherein the at least two genomic edits comprises at least three genomic edits.

134. The edited cell of claim 133, wherein the at least three genomic edits comprises at least four genomic edits.

135. The edited cell of any one of claims 132-134, wherein the at least two genomic edits comprises an edit located at the HLA-A locus, an edit located at the CIITA locus, an edit located at the TRAC locus, and an edit located at the TRBC locus.

136. The edited cell of any one of claims 132-135, wherein the at least two genomic edits comprises an edit located at the HLA-A locus, an edit located at the HLA-B locus, an edit located at the CIITA locus, and an edit located at the TRAC locus.

137. The edited cell of any one of claims 132-136, wherein the edited cell comprises the at least one exogenous gene.

138. The edited cell of claim 137, wherein the least one exogenous gene comprises a CAR.

139. A method for treating a disease in a subject, comprising administering the population of edited cells or the edited cell of any one of claims 119-138 to the subject.

140. The population of edited cells or the edited cell of any one of claims 119-138, for use in treating a disease in a subject.

141. Use of the population of edited cells or the edited cell of any one of claims 119-138, in the manufacture of a medicament for treating a disease in a subject.

142. The method, edited population or cell for use, or use of any one of claims 139-141, wherein the disease is cancer or an autoimmune disease.

143. The method, edited population or cell for use, or use of any one of claims 139-141, wherein the population of edited cells or the edited cell is allogeneic to the subject.

Citation Information

Patent Citations

  • Engineered CRISPR-CAS9 NUCLEASES WITH ALTERED PAM SPECIFICITY

    US20160312198A1

  • Engineered CRISPR-CAS9 Nucleases with Altered PAM Specificity

    US20160312199A1

  • RNA Modification to Engineer Cas9 Activity

    US20170114334A1

  • Method of reducing turbine wheel high cycle fatigue in sector-divided dual volute turbochargers

    US20230068498A1

  • Methods and compositions for modulating splicing

    US20230068499A1