Wheat dwarf india virus plant gene engineering system

Abstract

Wheat Dwarf India Virus (WDIV) nucleic acid constructs and WDIV-associated satellite nucleic acid constructs that can be used for gene editing of both monocotyledonous and dicotyledonous plants are provided herein, as are methods for using the constructs for targeted modification of plant DNA.

Description

[0001]Attorney Docket No.09531-0544WO1 2023-287 WHEAT DWARF INDIA VIRUS PLANT GENE ENGINEERING SYSTEM CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from U.S. Provisional Application Serial No. 63 / 612,985, filed December 20, 2023. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application. STATEMENT AS TO FEDERALLY SPONSORED RESEARCH This invention was made with government support under 58-5062-9-006 awarded by the Agricultural Research Service. The government has certain rights in the invention. TECHNICAL FIELD This document relates to a virus vector and system that can be used for gene editing of both monocotyledonous and dicotyledonous plants. BACKGROUND The family Geminiviridae represents a major class of single-stranded DNAviruses that can cause devastating diseases in crops around the world (Yang et al., J.Integr. Agric., 16:2761-2771, 2017; Varsani et al., Arch. Virol., 159:2193-203, 2014;Varsani et al., Arch. Virol., 162:1819-1831, 2017; and Roumagnac et al., Arch. Virol.,167:695-710, 2022). The family is divided into 14 genera – Begomovirus, Becurtovirus,Capulavirus, Citlodavirus, Curtovirus, Eragrovirus, Grablovirus, Maldovirus,Mastrevirus, Mulcrilevirus, Opunvirus, Topilevirus, Topocuvirus, and Turncurtovirus.Begomoviruses represent the largest genus in the family Geminiviridae, and often areassociated with DNA satellites that are about half the size (about 1.3 kb) of the virusgenome and play important roles in virus infection (Briddon et al., Virology 312:106-121,2003; Nawaz-ul-Rehman and Fauquet, FEBS Letters 583:1825-1832, 2009;Gnanasekaran et al., Mol. Plant Pathol., 20:1019-1033, 2019; Kumar et al., J. Virol.,88:7093-7104, 2014; Cui et al., J Virol., 78:13966-13974, 2004; Eini et al., Virus Res.,167:97-101, 2010; Saunders et al., Virology, 324:37-47, 2004; Patil et al., J. Gen. Virol., Attorney Docket No.09531-0544WO1 2023-28791:1871-1882, 2010; and Saeed et al., J. Gen. Virol., 88:2881-2889, 2007). Viruses ofgenera other than the begomoviruses have not been reported to be associated withsatellites, except for two mastreviruses – Wheat Dwarf India Virus (WDIV) andChickpea Chlorotic Dwarf Virus (CpCDV) (Kumar et al., supra; Kumar et al., PlantHealth Prog., 21:119-122, 2020a; Kumar et al., Austral. Plant Dis. Notes, 15:16, 2020b;and Hamza et al., Virus Res., 256:174-182, 2018). For example, WDIV is associated withsatellites that include an Ageratum yellow leaf curl betasatellite (AYLCB), a Cotton leaf curl Multan alphasatellite (CLCuMA), and a Guar leaf curl alphasatellite (GLCuA)(Kumar et al. 2014, supra; and Kumar et al., J. Adv. Res. 61:35-45, 2024). The virus isnot dependent on the satellite for replication, and satellites can be associated with more than one virus. For example, AYLCB also is associated with Avian encephalomyelitis virus and other geminiviruses. Geminiviruses typically are easy to manipulate and use. For example, geminiviruses can multiply without integrating into the plant genome, can deliver DNA repair templates, and can replicate in high copy numbers leading to higher expression ofgRNA and high editing efficiency (Yang et al., supra; and Lozano-Durán, New Phytol.,210:58-64, 2016). However, their use in genetic engineering is limited due to theircarrying capacity and restricted host range, as members of the family Geminiviridae areknown to infect either monocot plants or dicot plants, but not both. Viruses of the genus Mastrevirus have single-stranded DNA genomes and aretransmitted by leafhopper vectors (Boulton, Physiol. Mol. Plant Pathol., 60:243-255,2002; Liu et al., Virology, 256:270–279, 1999; Halley-Stott et al., Arch. Virol., 152:1237-1240, 2007; and Nahid et al., Arch. Virol., 153:1441-1451, 2008). The mastrevirusgenome expresses four proteins: two replication-associated proteins from the complementary strand, and a movement protein and the capsid protein from the virionstrand (Boulton, supra; Liu et al., supra; Hefferon, J. Gen. Virol., 84:3465-3472, 2003;Schalk et al., EMBO J, 8:359-364, 1989; Wright et al., Plant J., 12:1285-1297, 1997;Boulton et al., J. Gen. Virol., 70:2309-2323, 1989; Liu et al., J. Gen. Virol., 82:35-44,2001; and Liu et al., J. Gen. Virol., 80:501-506, 1999). The ORFs on the virion andcomplementary strands are separated by a small intergenic region and a large intergenic Attorney Docket No.09531-0544WO1 2023-287region (Boulton 2002, supra). While some mastreviruses infect dicots, most infectmonocot plant species. No monocot-infecting mastrevirus has been reported to infect a dicot plant species, nor has any dicot-infecting mastrevirus been reported to infect a monocot plant species. SUMMARY This document is based, at least in part, on the discovery that a geminivirus (WDIV) and accessory nucleic acid molecule (AYLCB) can infect both monocot and dicot plants. As demonstrated herein, the virus, which does not cause symptoms in plants, has a broad host range and infects plants including wheat, oat, barley, corn, soybean, sugarcane, grape, apple, tobacco, citrus trees, and coffee plants. This document also is based, at least in part, on engineering of the genome of WDIV and the sequence of the AYLCB accessory molecule to develop a system for high-throughput and tissue culture- free genome editing in plants. The wide host range of the virus system described herein renders it useful as a vector system that can be used for tissue culture-free genome and epigenomic editing in a multitude of plant species. This document provides methods and materials that can be used to edit plant nucleic acid (including genomic and epigenomic nucleic acid) in cells of monocotyledonous and dicotyledonous plants. For example, this document provides WDIV-based nucleic acid constructs and WDIV-associated satellite nucleic acids (also referred to as accessory nucleic acid molecules) containing nucleic acid modifying agents (e.g., site-specific endonucleases) that can introduce modifications into the nucleic acid of plant cells. This document also provides methods for using the nucleic acid constructs described herein to introduce modifications into plant nucleic acid. In a first aspect, this document features a WDIV nucleic acid construct. The WDIV nucleic acid construct can include: (a) one or more nucleotide sequences that, when the nucleic acid construct is within a plant cell and the one or more nucleotide sequences are expressed, cause the WDIV and a WDIV-associated satellite nucleic acid, if the satellite nucleic acid is present, to replicate within the plant cell, and (b) one or more nucleotide sequences encoding one or more nucleic acid modifying agents, where Attorney Docket No.09531-0544WO1 2023-287 the one or more nucleic acid modifying agents include one or more polypeptides, RNAs, or a combination thereof that, when expressed within the plant cell, edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications, wherein the one or more nucleotide sequences encoding one or more nucleic acid modifying agents are flanked on one or both sides by a plant tRNA sequence rather than by promoter and / or terminator sequences. The nucleic acid construct can be agro-infectious. The agro- infectious WDIV nucleic acid construct can be a vector comprising a T-DNA sequence. In some cases, except for the one or more nucleotide sequences encoding one or more nucleic acid modifying agents, the WDIV nucleic acid construct can include the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166. The one or more nucleic acid modifying agents can include a guide RNA (gRNA) and a Cas endonuclease. The Cas endonuclease can include an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:541. The one or more nucleotide sequences encoding one or more nucleic acid modifying agents can include a nucleotide sequence encoding a Cas endonuclease and a nucleotide sequence encoding a gRNA. The one or more nucleic acid modifying agents can include a gRNA and a TnpB endonuclease. The one or more nucleic acid modifying agents can include a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease. The plant tRNA sequence can include a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185. In another aspect this document features a system that includes: (a) a WDIV nucleic acid construct containing one or more nucleotide sequences that, when the nucleic acid construct is within a plant cell and the one or more nucleotide sequences are expressed, cause the WDIV and a WDIV-associated satellite nucleic acid to replicate within the plant cell, and (b) a WDIV-associated satellite nucleic acid construct containing the WDIV-associated satellite nucleic acid, where the WDIV-associated satellite nucleic acid includes one or more nucleotide sequences encoding one or more nucleic acid modifying agents, and wherein the one or more nucleic acid modifying Attorney Docket No.09531-0544WO1 2023-287 agents include one or more polypeptides, RNAs, or a combination thereof that, when expressed within the plant cell, edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications. The WDIV nucleic acid construct can be agro- infectious. The agro-infectious WDIV nucleic acid construct can be a vector containing a T-DNA sequence. The WDIV-associated satellite nucleic acid construct can be agro- infectious. The agro-infectious WDIV-associated satellite nucleic acid construct can be a vector containing a T-DNA sequence. The WDIV nucleic acid construct can include the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166. In some cases, except for the one or more nucleotide sequences encoding one or more nucleic acid modifying agents, the WDIV- associated satellite nucleic acid can contain the nucleotide sequence set forth in SEQ ID NO:165, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:165. The one or more nucleic acid modifying agents can include a gRNA and a Cas endonuclease. The Cas endonuclease can include an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:541. The one or more nucleic acid modifying agents can include a gRNA and a TnpB endonuclease. The one or more nucleic acid modifying agents can include a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease. The one or more nucleotide sequences encoding one or more nucleic acid modifying agents can be flanked on one or both sides by a plant tRNA sequence rather than by promoter and / or terminator sequences. The plant tRNA sequence can include a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185. In another aspect, this document features a method for targeted modification of a plant nucleic acid. The method can include, or consist essentially of, introducing, into a plant cell, an agro-infectious WDIV nucleic acid construct having the ability to infect monocotyledonous and dicotyledonous plants, where the agro-infectious WDIV nucleic acid construct includes: (a) one or more nucleotide sequences that, when expressed, cause the WDIV and a WDIV-associated satellite nucleic acid, if the WDIV-associated satellite nucleic acid is present, to replicate within the plant cell, and (b) one or more nucleotide Attorney Docket No.09531-0544WO1 2023-287 sequences encoding one or more nucleic acid modifying agents, where the one or more nucleic acid modifying agents include one or more polypeptides, RNAs, or a combination thereof that, when expressed within the plant cell, edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications, where the one or more nucleotide sequence encoding one or more nucleic acid modifying agents are flanked on one or both sides by a plant tRNA sequence rather than by promoter and / or terminator sequences. The agro-infectious WDIV nucleic acid construct can be a vector comprising a T-DNA sequence. In some cases, except for the one or more nucleotide sequences encoding the one or more nucleic acid modifying agents, the agro-infectious WDIV can include the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166. The one or more nucleic acid modifying agents can include a Cas endonuclease and a gRNA targeted to a selected nucleotide sequence of the plant, wherein, when the gRNA and the Cas endonuclease are expressed, the gRNA targets the Cas endonuclease to the selected sequence such that the Cas endonuclease introduces the one or more genetic or epigenetic modifications. The nucleotide sequence encoding the Cas endonuclease can include a sequence having at least 95% identity to the sequence set forth in SEQ ID NO:168, SEQ ID NO:183, SEQ ID NO:181, SEQ ID NO:538, SEQ ID NO:540, SEQ ID NO:542, or SEQ ID NO:543. The one or more nucleic acid modifying agents can include a gRNA and a TnpB endonuclease. The one or more nucleic acid modifying agents can include a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease. The plant tRNA sequence can include a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185. In another aspect, this document features a method for targeted modification of a plant nucleic acid, where the method includes, or consists essentially of, introducing, into a plant cell: (a) an agro-infectious WDIV nucleic acid construct having the ability to infect monocotyledonous and dicotyledonous plants, where the agro-infectious WDIV nucleic acid construct includes one or more nucleotide sequences that, when expressed, cause the WDIV and a WDIV-associated satellite nucleic acid to replicate within the plant cell, and (b) an agro-infectious satellite nucleic acid construct containing the WDIV- Attorney Docket No.09531-0544WO1 2023-287 associated satellite nucleic acid, where the WDIV-associated satellite nucleic acid includes one or more nucleotide sequences encoding one or more nucleic acid modifying agents, and where the one or more nucleic acid modifying agents include one or more polypeptides, RNAs, or a combination thereof that, when expressed within the plant cell, edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications. The agro-infectious WDIV nucleic acid construct and the agro-infectious satellite nucleic acid constructs can be vectors containing T-DNA sequences. The agro- infectious WDIV nucleic acid construct can include the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166. In some cases, except for the one or more nucleotide sequences encoding one or more nucleic acid modifying agents, the WDIV-associated satellite nucleic acid can include the nucleotide sequence set forth in SEQ ID NO:165, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:165. The one or more nucleic acid modifying agents can include a gRNA and a Cas endonuclease, wherein when the gRNA and the Cas endonuclease are expressed, the gRNA targets the Cas endonuclease to the selected sequence such that the Cas endonuclease introduces the one or more genetic or epigenetic modifications. The Cas endonuclease can include an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:541. The one or more nucleic acid modifying agents can include a gRNA and a TnpB endonuclease. The one or more nucleic acid modifying agents can include comprise a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease. The one or more nucleotide sequence encoding one or more nucleic acid modifying agents can be flanked on one or both side by a plant tRNA sequence rather than by promoter and / or terminator sequences. The plant tRNA sequence can include a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185. In another aspect, this document features a WDIV nucleic acid construct, where the WDIV nucleic acid construct includes, consists of, or consists essentially of (a) one or more nucleotide sequences that, when the nucleic acid construct is within a plant cell and Attorney Docket No.09531-0544WO1 2023-287 the one or more nucleotide sequences are expressed, cause the WDIV and a WDIV- associated satellite nucleic acid, if the satellite nucleic acid is present, to replicate within the plant cell, and (b) one or more nucleotide sequences encoding one or more nucleic acid modifying agents, where the one or more nucleic acid modifying agents include one or more polypeptides or RNAs that, when expressed within the plant cell, edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications. The WDIV nucleic acid construct can be agro-infectious. The agro-infectious WDIV nucleic acid construct can be a vector containing a T-DNA sequence. Except for the one or more nucleotide sequences encoding one or more nucleic acid modifying agents, the WDIV nucleic acid construct can include the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166. The one or more nucleic acid modifying agents can include a guide RNA (gRNA) and a Cas endonuclease. The Cas endonuclease can include an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:541. The one or more nucleotide sequences encoding one or more nucleic acid modifying agents can include a nucleotide sequence encoding a Cas endonuclease and a nucleotide sequence encoding a gRNA, where the nucleotide sequence encoding the Cas endonuclease is flanked on one or both sides by a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185, and where the nucleotide sequence encoding the gRNA is flanked on one or both sides by a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185. The one or more nucleic acid modifying agents can include a gRNA and a TnpB endonuclease. The one or more nucleic acid modifying agents can include a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease. In another aspect, this document features a system that includes, consists of, or consists essentially of (a) a WDIV nucleic acid construct containing one or more nucleotide sequences that, when the nucleic acid construct is within a plant cell and the one or more nucleotide sequences are expressed, cause the WDIV and a WDIV- associated satellite nucleic acid to replicate within the plant cell, and (b) a WDIV- Attorney Docket No.09531-0544WO1 2023-287 associated satellite nucleic acid construct that includes the WDIV-associated satellite nucleic acid, where the WDIV nucleic acid construct and / or the WDIV-associated satellite nucleic acid include one or more nucleotide sequences encoding one or more nucleic acid modifying agents, and where the one or more nucleic acid modifying agents include one or more polypeptides or RNAs that, when expressed within the plant cell, edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications. The WDIV nucleic acid construct can be agro-infectious. The agro- infectious WDIV nucleic acid construct can be a vector containing a T-DNA sequence. The WDIV-associated satellite nucleic acid construct can be agro-infectious. The agro- infectious WDIV-associated satellite nucleic acid construct can be a vector containing a T-DNA sequence. Except for the one or more nucleotide sequences encoding one or more nucleic acid modifying agents, the WDIV nucleic acid construct can include the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166. Except for the one or more nucleotide sequences encoding one or more nucleic acid modifying agents, the WDIV-associated satellite nucleic acid can include the nucleotide sequence set forth in SEQ ID NO:165, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:165. The one or more nucleic acid modifying agents can include a gRNA and a Cas endonuclease. The Cas endonuclease can include an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:541. The one or more nucleotide sequences encoding one or more nucleic acid modifying agents can include a nucleotide sequence encoding a Cas endonuclease and a nucleotide sequence encoding a gRNA, where the nucleotide sequence encoding the Cas endonuclease is flanked on one or both sides by a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185, and where the nucleotide sequence encoding the gRNA is flanked on one or more both sides by a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185. The one or more nucleic acid modifying agents can include a gRNA and a TnpB endonuclease. The one or more Attorney Docket No.09531-0544WO1 2023-287 nucleic acid modifying agents can include a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease. In another aspect, this document features a method for targeted modification of a plant nucleic acid. The method can include, or consist essentially of, introducing, into a plant cell, an agro-infectious WDIV nucleic acid construct having the ability to infect monocotyledonous and dicotyledonous plants, where the agro-infectious WDIV nucleic acid construct includes, consists of, or consists essentially of (a) one or more nucleotide sequences that, when expressed, cause the WDIV and a WDIV-associated satellite nucleic acid, if the WDIV-associated satellite nucleic acid is present, to replicate within the plant cell, and (b) one or more nucleotide sequences encoding one or more nucleic acid modifying agents, where the one or more nucleic acid modifying agents include one or more polypeptides or RNAs that, when expressed within the plant cell, edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications. The agro- infectious WDIV nucleic acid construct can be a vector containing a T-DNA sequence. Except for the one or more nucleotide sequences encoding the one or more nucleic acid modifying agents, the agro-infectious WDIV can include the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166. The one or more nucleic acid modifying agents can include a Cas endonuclease and a gRNA targeted to a selected nucleotide sequence of the plant, wherein, when the gRNA and the Cas endonuclease are expressed, the gRNA targets the Cas endonuclease to the selected sequence such that the Cas endonuclease introduces the one or more genetic or epigenetic modifications (e.g., by introducing one or more single- or double-strand DNA breaks in the plant nucleic acid). The nucleotide sequence encoding the Cas endonuclease can include a sequence having at least 95% identity to the sequence set forth in SEQ ID NO:168, SEQ ID NO:183, SEQ ID NO:543, SEQ ID NO:181, SEQ ID NO:538, SEQ ID NO:540, SEQ ID NO:542, or SEQ ID NO:543. The one or more nucleotide sequences encoding one or more nucleic acid modifying agents can include a nucleotide sequence encoding a Cas endonuclease and a nucleotide sequence encoding a gRNA, where the nucleotide sequence encoding the Cas endonuclease is flanked on one or both sides by a nucleotide sequence having at least Attorney Docket No.09531-0544WO1 2023-287 95% sequence identity to the sequence set forth in SEQ ID NO:185, and where the nucleotide sequence encoding the gRNA is flanked on one or both sides by a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185. The one or more nucleic acid modifying agents can include a gRNA and a TnpB endonuclease. The one or more nucleic acid modifying agents can include a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease. In another aspect, this document features a method for targeted modification of a plant nucleic acid, where the method includes, consists of, or consists essentially of introducing, into a plant cell, (a) an agro-infectious WDIV nucleic acid construct having the ability to infect monocotyledonous and dicotyledonous plants, where the agro- infectious WDIV nucleic acid construct includes or consists essentially of one or more nucleotide sequences that, when expressed, cause the WDIV and a WDIV-associated satellite nucleic acid to replicate within the plant cell, and (b) an agro-infectious satellite nucleic acid construct containing the WDIV-associated satellite nucleic acid, where the WDIV nucleic acid construct and / or the WDIV-associated satellite nucleic acid include one or more nucleotide sequences encoding one or more nucleic acid modifying agents, and where the one or more nucleic acid modifying agents include one or more polypeptides or RNAs that, when expressed within the plant cell, edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications. The agro- infectious WDIV nucleic acid construct and the agro-infectious satellite nucleic acid constructs can be vectors containing T-DNA sequences. Except for the one or more nucleotide sequences encoding one or more nucleic acid modifying agents, the agro- infectious WDIV nucleic acid construct can include the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166. Except for the one or more nucleotide sequences encoding one or more nucleic acid modifying agents, the WDIV-associated satellite nucleic acid can include the nucleotide sequence set forth in SEQ ID NO:165, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:165. The one or more nucleic acid modifying agents can include a gRNA and a Cas endonuclease, wherein, when the gRNA and the Cas endonuclease are expressed, the gRNA targets the Cas endonuclease to the selected Attorney Docket No.09531-0544WO1 2023-287 sequence such that the Cas endonuclease introduces the one or more genetic or epigenetic modifications (e.g., by introducing one or more single- or double-strand DNA breaks in the plant nucleic acid). The Cas endonuclease can include an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:541. The one or more nucleotide sequences encoding one or more nucleic acid modifying agents can include a nucleotide sequence encoding a Cas endonuclease and a nucleotide sequence encoding a gRNA, where the nucleotide sequence encoding the Cas endonuclease is flanked on one or both sides by a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185, and where the nucleotide sequence encoding the gRNA is flanked on one or both sides by a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185. The one or more nucleic acid modifying agents can include a gRNA and a TnpB endonuclease. The one or more nucleic acid modifying agents can include a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. Attorney Docket No.09531-0544WO1 2023-287 DESCRIPTION OF DRAWINGS FIG. 1A is a schematic representation of a method for developing an infectiousclone of WDIV. Primer details are provided in TABLE 1. FIG. 1B shows the WDIVclone 88(1) complete genome sequence as set forth in GenBank Accession No.MN240329.1 (SEQ ID NO:186). FIG. 1C is a map of the pCAMBIA vector. FIG. 1Dshows a DNA sequence for the ligated WDIV PCR products (SEQ ID NO:164).Underlining indicates the SacI, KpnI, and XbaI restriction sites. The WDIV sequence setforth in SEQ ID NO:164 includes a nucleotide sequence encoding a Rep polypeptide (nucleotides 1688 to 2850 of SEQ ID NO:164, which include an intron), a nucleotide sequence encoding a RepA polypeptide (nucleotides 1981 to 2850 of SEQ ID NO:164), a nucleotide sequence encoding a coat protein (CP; nucleotides 793 to 1536 of SEQ ID NO:164), and a nucleotide sequence encoding a movement protein (MP; nucleotides 428 to 748 of SEQ ID NO:164), as well as long intergenic region (LIR) sequences (nucleotides 77 to 427 and 2851 to 3209 of SEQ ID NO:164) and a short intergenic region (SIR) sequence (nucleotides 1537 to 1687 of SEQ ID NO:164). FIG. 2A is a schematic representation of a method for developing an infectiousclone of AYLCB. Primer details are provided in TABLE 1. FIG. 2B shows the AYLCBclone 72beta1F complete sequence as set forth in GenBank Accession No. MN240347.1(SEQ ID NO:187). FIG. 2C shows a DNA sequence for the ligated AYLCB PCRproducts (SEQ ID NO:165). Underlining indicates the XbaI, PacI, and PstI restrictionsites. The AYLCB sequence set forth in SEQ ID NO:165 includes two A-rich regions (nucleotides 349 to 612 and 1723 to 1986 of SEQ ID NO:165), two nucleotide sequences encoding a C1 polypeptide (nucleotides 710 to 1126 and 2084 to 2500 of SEQ ID NO:165), and a satellite conserved region (SCR; nucleotides 1280 to 1557 of SEQ ID NO:165). FIG. 3A is a schematic representation of a method for developing a WDIV-basedvector for gene silencing and genome editing. Primer details are provided in TABLE 1. FIG.3B shows a DNA sequence for the ligated P1 / P2 and P5 / P6 products (SEQ IDNO:166). Underlining indicates the MluI / SpeI / AscI cloning site. The WDIV sequence setforth in SEQ ID NO:166 includes a nucleotide sequence encoding a Rep polypeptide Attorney Docket No.09531-0544WO1 2023-287 (nucleotides 360 to 1522 of SEQ ID NO:166, which include an intron), a nucleotide sequence encoding a RepA polypeptide (nucleotides 360 to 1229 of SEQ ID NO:166), a nucleotide sequence encoding a coat protein (CP; nucleotides 1694 to 2437 of SEQ ID NO:166), and a nucleotide sequence encoding a movement protein (MP; nucleotides 2482 to 2802 of SEQ ID NO:166), as well as long intergenic region (LIR) sequences (nucleotides 1 to 359 and 2803 to 3153 of SEQ ID NO:166) and a short intergenic region(SIR) sequence (nucleotides 1523 to 1673 of SEQ ID NO:166). FIG. 3C shows a DNAsequence for the WDIV construct in pCAMBIA1300 (SEQ ID NO:167). Underlining indicates the WDIV sequence. FIG. 4 is a nucleotide sequence alignment of wheat (SEQ ID NO:116) andsolanum (SEQ ID NO:117) isolates of WDIV. The sequences showed a high degree of similarity. FIG. 5 is a nucleotide sequence alignment of wheat (SEQ ID NO:118) andsolanum (SEQ ID NO:119) isolates of AYLCB. The sequences showed a high degree of similarity. FIG. 6 shows an amino acid sequence alignment of the WDIV Rep protein (SEQID NO:120) with the Rep proteins of monocot infecting mastreviruses (MIMs) includingSugarcane chlorotic streak virus (SCSV; SEQ ID NO:121), Maize streak virus (MSV;SEQ ID NO:122), Panicum streak virus (PanSV; SEQ ID NO:123), and Urochloa streakvirus (USV SEQ ID NO:124), and dicot infecting mastreviruses (DIMs) including Sweetpotato symptomless virus 1 (SPSMV-1; SEQ ID NO:125), Chickpea chlorosis virus(CpCV SEQ ID NO:126), Tobacco yellow dwarf virus (TYDV; SEQ ID NO:127),Chickpea chlorotic dwarf virus (CpCDV; SEQ ID NO:128), and Bean yellow dwarf virus(BeYDV; SEQ ID NO:129). Motifs in the Rep protein that are required for its function are indicated by the dotted boxes. FIG. 7 shows an amino acid sequence alignment of the WDIV RepA protein(SEQ ID NO: 130) with the RepA proteins of MIMs including MSV (SEQ ID NO:131), PanSV (SEQ ID NO:132), USV (SEQ ID NO:133), SCSV (SEQ ID NO:134), and Sugarcane streak Reunion virus (SSRV; SEQ ID NO:135) and DIMs including SPSMV-1 (SEQ ID NO:136), CpCV (SEQ ID NO:137), TYDV (SEQ ID NO:138), CpCDV (SEQ Attorney Docket No.09531-0544WO1 2023-287 ID NO:139), and BeYDV (SEQ ID NO:140). Important motifs in the RepA protein are shown by dotted boxes. FIG. 8 shows an amino acid sequence alignment of the WDIV CP (SEQ IDNO:141) with the CPs of MIMs including Maize streak Reunion virus (MSRV SEQ IDNO:142), MSV (SEQ ID NO:143), PanSV (SEQ ID NO:144), USV (SEQ ID NO:145),and Sugarcane streak Egypt virus (SSEV; SEQ ID NO:146) and DIMs includingChickpea redleaf virus 2 (CpRLV2; SEQ ID NO:147), CpCV (SEQ ID NO:148), TYDV (SEQ ID NO:149), CpCDV (SEQ ID NO:150), and BeYDV (SEQ ID NO:151). Important motifs in the CPs are shown by dotted boxes. FIG. 9 shows an amino acid sequence alignment of the WDIV MP (SEQ IDNO:152) with the MPs of MIMs including MSRV (SEQ ID NO:153), MSV (SEQ IDNO:154), Sugarcane white streak virus (SWSV; SEQ ID NO:155), Wheat dwarf virus(WDV; SEQ ID NO:156), and Sugarcane striate virus (SStrV; SEQ ID NO:157) andDIMs including SPSMV-1 (SEQ ID NO:158), CpCV (SEQ ID NO:159), TYDV (SEQ ID NO:160), CpCDV (SEQ ID NO:161), and BeYDV (SEQ ID NO:162). Important motifs in the MP are shown by dotted boxes. FIG. 10 includes representative images showing barley, wheat, oat, corn,soybean, and tobacco plants after systemic infection by WDIV and AYLCB. Mock (C), WDIV (V), and WDIV and AYLCB (VB) inoculated plants are shown at 3 to 5 weeks post inoculation. FIGS. 11A-11F are images showing plants after systemic infection of barley(FIG.11A), wheat (FIG.11B), oat (FIG.11C), corn (FIG.11D), soybean (FIG.11E), and tobacco (FIG.11F) by WDIV and AYLCB. Uninoculated control (C), WDIV (V), and WDIV and AYLCB (VB) inoculated barley, wheat, oat, corn, soybean, and tobacco plants are shown at 3 to 5 weeks post-inoculation. The WDIV and AYLCB inoculated (VB) barley and wheat plants showed a significant difference in growth and development as compared to V and C. The virus-only (V) inoculated wheat and barley also exhibited symptoms and appeared different from control (C) plants. Plants from other species did not show such differences in growth and development. Attorney Docket No.09531-0544WO1 2023-287 FIG. 12 includes representative images showing the results of PCR-basedamplification of the WDIV coat protein gene from 24 randomly selected samples ofwheat, barley, oat, corn, soybean, and tobacco. “M” indicates DNA digested byEcoRI / HindIII. DNA bands of about 750 bp represent amplicons from the WDIV CP gene. FIG. 13 includes representative images showing the results of PCR-basedamplification of the AYLCB C1 gene from 12 samples of wheat, barley, oat, corn, soybean, and tobacco inoculated with WDIV and AYLCB. “L” indicates a 100 bp DNA ladder, and DNA bands of about 400 bp represent amplicons from the AYLCB C1 gene. FIGS. 14A-14D show detection and quantification of WDIV and AYLCB inbarley, wheat, oat, corn, soybean, and tobacco. FIG. 14A includes images showing theresults of PCR using three random biological replicates for WDIV (“V”) or WDIV and AYLCB betasatellite (“VB”) inoculated plants showing the presence of WDIV andAYLCB. Amplification products of the WDIV CP gene (CP) and the AYLCB C1 gene(BC1) are shown. Amplification products of the actin gene are shown below the BC1 gel. FIG.14B shows representative DNA sequences from CP and BC1 PCR products (SEQID NOS:1-24) to confirm their identity. FIG. 14C includes a pair of graphs plotting theresults of real-time PCR using the same three biological replicates used for PCR in FIG.14A, showing accumulation of WDIV (upper graph), and AYLCB (lower graph) in systemically infected plants. The Y-axes indicate the relative concentration of virus and satellite, and the X-axes indicate the samples (V = virus, VB = virus and betasatellite, Bar = barley, Wh = wheat, Soy = soybean, Tob = tobacco, Oat = oat, and Corn = corn). The actin gene was used as an internal control for normalization. Each bar represents the mean value of three biological replicates. Error bars refer to standard errors of the means. FIG.14D includes images showing the results of Southern hybridization to detect the presence of WDIV and AYLCB in the inoculated plants. Accumulation of the virus washigher in the presence of AYLCB. The CP gene was used as a probe for WDIV, and C1was used as a probe for AYLCB. Different replicative forms of the viral DNA were observed in the blots. Attorney Docket No.09531-0544WO1 2023-287 FIGS. 15A-15C include representative images and graphs show virus-inducedsilencing of the PDS gene in wheat. The left image in each panel is representative of an empty vector-inoculated wheat leaf (FIG.15A), spike (FIG.15B), and seed (FIG.15C). The right image in each panel is representative of wheat leaf (FIG.15A), spike (FIG. 15B), and seed (FIG.15C) after PDS gene silencing. The arrows indicate white sectors of the representative leaf, spike, and seed due to PDS silencing. The graphs below the images show the level of PDS transcripts in the white sectors of the silenced leaf (FIG. 15A), spike (FIG.15B), and seed (FIG.15C) and in a corresponding control leaf, spike, and seed, respectively. The actin gene was used as an internal control for normalization. Each bar represents the mean value of three technical replicates. Error bars indicate standard error of the mean. FIGS. 16A-16D show virus-induced silencing of PDS gene in tobacco. FIG. 16Ais a representative image showing a tobacco plant inoculated with empty vector ascontrol. FIG. 16B is a representative image showing a tobacco plant inoculated with aviral vector containing a PDS gene fragment. The white sectors on the leaves were anoutcome of PDS gene silencing. FIG. 16C includes representative images showing a leaffrom the control plant (top) and a leaf from the PDS-silenced tobacco plant (bottom) thatwas used for real-time PCR analysis. FIG. 16D is a graph plotting the quantification ofPDS transcripts in the control leaf and in the white sectors of the PDS-silenced leaf. The actin gene was used as the internal control for normalization. Each bar represents the mean value of three technical replicates. Error bars indicate standard error of the mean. FIGS. 17A-17C demonstrate gene editing in tobacco. FIG. 17A includesschematic representations of a WDIV-based vector (top) and a WDIV-based vector witha gRNA construct (bottom). FIG. 17B includes representative images showing Nicotianabenthamiana leaves inoculated in the circled regions with the empty viral vector (left) or the viral vector carrying gRNA construct (right). The inoculated portions of the leaves shown in the circles were later collected for sequencing the PDS gene to look formutations. FIG. 17C shows a wild type PDS sequence (SEQ ID NO:25) andrepresentative sequences showing deletion mutations (SEQ ID NOS:26-39) in the N. Attorney Docket No.09531-0544WO1 2023-287 benthamiana PDS gene. The gRNA target sequence is underlined and labeled as the target sequence, and the PAM sequence is italicized. FIGS. 18A-18C demonstrate gene editing in tobacco leaves by the systemicspread of WDIV. FIG. 18A is a representative image of a tobacco plant, showing thepoint of inoculation and the point of sample collection for testing. FIG. 18B is an imageshowing representative leaves from an inoculated tobacco plant. While most of the leavesin the inoculated N. benthamiana plant were green, some leaves had white sectors aswell. Amplicon sequencing was done by isolating DNA from both types of samples,followed by bulking them as one sample. FIG. 18C shows a wild type PDS sequence(SEQ ID NO:40) and representative sequences showing deletion mutations (SEQ IDNOS:41-61) in the N. benthamiana PDS gene. The gRNA target sequence is underlinedand labeled as the target sequence, and the PAM sequence is italicized. FIGS. 19A-19B demonstrate gene editing in tobacco fruits by the systemic spreadof WDIV. FIG. 19A includes representative images showing N. benthamiana fruit thatwas collected for DNA isolation and amplicon sequencing. Both green and white patches from the tobacco fruits were collected and analyzed. Amplicon sequencing was done byisolating DNA from both types of samples followed by bulking them as one sample. FIG.19B shows a wild type PDS sequence (SEQ ID NO:62) and representative sequencesshowing deletion mutations (SEQ ID NOS:63-77) in the N. benthamiana PDS gene. ThegRNA target sequence is underlined and labeled as the target sequence, and the PAM sequence is italicized. FIG. 20A shows a representative Cas12j (Cas 1) amino acid sequence (SEQ IDNO:184), a nucleotide sequence (SEQ ID NO:168) encoding the Cas12j endonuclease polypeptide, where the Cas12j coding sequence is flanked by tRNA sequences (underlined in SEQ ID NO:168), as well as gRNA sequences (SEQ ID NOS:169-172) that were tested with the Cas12j endonuclease (underlining indicates differences betweenthe four sequences), the full gRNA sequence (SEQ ID NO:173) that was used in planta,and the tRNA sequence (SEQ ID NO:185) that flanked the 5 and 3 ends of the Cas12jcoding sequence and the gRNA coding sequence (and is included within SEQ ID NOS:168 and 173). The underlining in SEQ ID NO:173 indicates the gRNA sequence Attorney Docket No.09531-0544WO1 2023-287 itself, and the bold in SEQ ID NO:173 indicates the sequence targeted to the tobacco PDSgene. FIG. 20B includes representative images showing transgenic tobacco expressingCas12j and a gRNA targeting a locus in the PDS gene. The image at right provides a closer view of next generation seedlings, with arrows indicating seedlings that were albino due to the mutations in the PDS gene. FIG.21A is a schematic representation of a redesigned CRISPR-Cas editing system that was generated by replacing the external promoter and terminator sequences with plant tRNA sequences, leading to processing of the Cas mRNA and the gRNA. This reduced the cargo size of the CRISPR / Cas components in the viral vector by about 800- 1000 base pairs, and enabled tissue culture-free delivery upon systemic infection byvirus. FIG. 21B includes alignments of wild type and edited PDS sequences,demonstrating successful editing by the Cas12j endonuclease. The bold sequence (SEQ ID NO:179) above each alignment indicates the sequence targeted by the gRNA. FIG. 22A is a schematic illustrating three versions of vectors derived fromWDIV, one containing coat protein (CP) and movement protein (MP) coding sequences (top), one lacking a CP coding sequence (middle), and one lacking both CP and MP (bottom). The top vector can spread systemically, while the middle vector can move locally and has no upper cargo capacity. The bottom vector has no cargo limit but also nospread. FIG. 22B is a schematic illustrating two versions of AYLCB-based vectors. Thebottom vector (version 2) is thought to have a higher cargo capacity than the top vector (version 1). FIG. 23A shows a Cas9 amino acid sequence (SEQ ID NO:180) fromStreptococcus pyogenes. FIG. 23B shows a nucleotide sequence (SEQ ID NO:181)encoding the S. pyogenes Cas9 polypeptide. FIG. 23C shows a Cas12f amino acidsequence (SEQ ID NO:182). FIG. 23D shows a nucleotide sequence (SEQ ID NO:183)encoding a Cas12f polypeptide, where the Cas12f coding sequence is flanked by tRNA sequences, and also shows a nucleotide sequence (SEQ ID NO:543) encoding the Cas12fpolypeptide shown in FIG. 23C. FIG. 23E shows a Cas 2 amino acid sequence (SEQID NO:537) and a nucleotide sequence (SEQ ID NO:538) encoding a Cas 2endonuclease. FIG. 23F shows a Cas 3 amino acid sequence (SEQ ID NO:539) and a Attorney Docket No.09531-0544WO1 2023-287nucleotide sequence (SEQ ID NO:540) encoding a Cas 3 endonuclease. FIG. 23Gshows a RiceMINI amino acid sequence (SEQ ID NO:541) and a nucleotide sequence(SEQ ID NO:542) encoding a RiceMINI endonuclease. FIG. 23H shows representativeTnpB amino acid sequences (SEQ ID NOS:544 and 545). FIGS. 24A-24G show results from testing promoter strength using GUSexpression. FIG. 24A includes tDNA maps of pCAMBIA1305 constructs expressingGUS under the control of AYLCB-C1, WDIV-VF, WDIV-CF, and CaMV35s promoters. The regulatory elements and genes between left border (LB) and right border (RB) areshown. FIGS. 24B-24F include representative images showing histochemicallocalization of GUS activity in different organs of transgenic T0 tobacco seedlings. Leaf and stem showing GUS activity in non-transgenic control (FIG.24B), AYLCB-C1 GUS (FIG.24C), WDIV-VF GUS (FIG.24D), WDIV-CF GUS (FIG.24E), and CaMV35SGUS (FIG. 24F) plants. FIG. 24G is a graph plotting expression levels of GUStranscripts and hygromycin (hpt) in T0 tobacco seedlings. The relative expression of GUS transcripts in control and transgenic seedlings was quantified by qRT-PCR. The relative expression of hpt was quantified to see the copy number of integrated T-DNA. The actin gene was used as an internal control to calculate relative expression values. All experiments were performed with three biological replicates. Error bars indicate standard error. FIGS. 25A-25O show results from testing promoter strength and deliverycapability using AmCyan expression. FIG. 25A is a diagram showing the position andorientation of the virion and complementary promoter of WDIV (right ) and also showing a schematic representation of four AmCyan expressing constructs (AN, 35AN, VFAN, and CFAN) and their cloning strategy in the AYLCB vector (left). AN = AmCyan + NOS, 35AN = 35s + AmCyan + NOS, VFAN = WDIV virion promoter + AmCyan +NOS and CFAN = WDIV complementary promoter + AmCyan + NOS. FIGS. 25B-25Finclude representative images showing AN, VFAN, CFAN, 35AN, and empty vectorinoculated tobacco leaves at five days post inoculation. FIG. 25G is a representativeimage of a gel showing amplification of AmCyan from the inoculated leaves. FIGS.25H-25L include representative images showing systemically infected leaves from AN, Attorney Docket No.09531-0544WO1 2023-287 VFAN, CFAN, 35AN, and empty vector inoculated tobacco at three weeks postinoculation. FIG. 25M is a representative image of a gel showing amplification ofAmCyan from the systemically infected leaves. FIG. 25N is a graph plotting the resultsof real-time PCR based quantification of the viral vector (AYLCB) and the AmCyan DNA from the AN, VFAN, CFAN, 35AN, and empty vector inoculated and systemicallyinfected leaves. FIG. 25O is a graph plotting the results of real-time PCR basedquantification of the AmCyan transcripts from the inoculated and systemically infected leaves. The actin gene was used as an internal control to calculate the relative expression values. All experiments were performed with three biological replicates. Error bars indicate standard error. FIGS. 26A-26E show comparison of gRNA delivery capability and editingfrequency in Cas9 transgenic tobacco. FIG. 26A is a representative image showing aCas9 transgenic tobacco plant, with arrows indicating the points of gRNA inoculationand areas of sample collection (inoculated, systemically infected, and top leaves). FIG.26B is a graph plotting indel frequency in inoculated, systemically infected, and topleaves. FIGS. 26C-26E show representative examples of deletion mutations in the PDSgene of N. benthamiana subjected to leaf inoculation or systemic infection. The gRNAtarget sequence is boxed and the PAM sequence is underlined in each panel. Sequenceidentifiers are assigned to sequences in FIGS. 26C-26E that contain ten or morenucleotides. FIGS. 27A-27F show delivery of Cas9 and gRNA in tobacco leaves using anAYLCB vector, and demonstrate gene editing. FIG. 27A is a schematic representation ofan AYLCB vector encoding Cas9 and gRNA. FIG. 27B includes a representative imageshowing an inoculated leaf and a next leaf (left) and an image showing a scheme forsample collection from inoculated leaves (right). FIG. 27C is a graph plotting indelfrequency from the inoculated side of leaves, the other side of leaves, and the next leaves. FIGS.27D-27F show representative examples of deletion mutations from the inoculated side of the leaf (FIG.27D), the other side of the leaf (FIG.27E), and the next leaf (FIG. 27F). The gRNA target sequence is boxed and the PAM region is underlined in each Attorney Docket No.09531-0544WO1 2023-287panel. Sequence identifiers are assigned to sequences in FIGS. 27D-27F that contain tenor more nucleotides. FIGS. 28A-28E demonstrate gene editing by delivering Cas 1, Cas 2, andgRNA. FIG. 28A is a schematic representation showing Cas 1, Cas 2, and gRNA inAYLCB vectors. FIG. 28B includes a representative image showing inoculated andsystemically infected leaves (left) and a scheme of sample collection from the inoculatedleaves (right). FIG. 28C includes graphs plotting the number of indels (left) and indelfrequency (right) from the other side of the leaves (CP14, CP15, CP22 and CP23) and thesystemically infected leaves (CP19, CP112, CP212 and CP214) from Cas 1 and Cas 2inoculated plants. FIGS. 28D-28E show representative examples of deletion mutationsfrom the other side of the leaf and the systemically infected leaves for Cas 1 (FIG. 28D)and Cas 2 (FIG. 28E) inoculated plants. The gRNA target sequence is boxed and thePAM region is underlined in each panel. Sequence identifiers are assigned to sequencesin FIGS. 28D-28E that contain ten or more nucleotides.FIGS. 29A-29E demonstrate gene editing by delivering CasMINI, RiceMINI, andgRNA. FIG. 29A is a schematic representation showing CasMINI, RiceMINI, and gRNAin AYLCB vectors. FIG. 29B includes a representative image showing inoculated andsystemically infected leaves (left) and a scheme of sample collection from the inoculatedleaves (right). FIG. 29C includes graphs plotting the number of indels (left) and indelfrequency (right) from the other side of the leaves (CM8, CM9, RM8 and RM9) and the systemically infected leaves (CM10, CM11, RM3 and RM7) for CasMINI and RiceMINIinoculated plants. FIGS. 29D-29E show representative examples of deletion mutationsfrom the other side of the leaf and the systemically infected leaves for CasMINI (FIG. 29D) and RiceMINI (FIG.29E) inoculated plants. The gRNA target sequence is boxed and the PAM region is underlined in each panel. Sequence identifiers are assigned tosequences in FIGS. 29D-29E that contain ten or more nucleotides.FIGS. 30A-30E demonstrate gene editing by regulating expression of Cas 1,Cas 2, RiceMINI, and gRNA using a WDIV-CF promoter. FIG. 30A is a schematicrepresentation showing Cas 1, Cas 2, RiceMINI, and its gRNA under the control of a Attorney Docket No.09531-0544WO1 2023-287WDIV-CF promoter in AYLCB vectors. FIG. 30B includes graphs plotting the numberof indels (top) and indel frequency (bottom) from the other side of the leaves and thesystemically infected leaves of Cas 1, Cas 2, and RiceMINI inoculated plants. FIGS.30C-30E show representative examples of deletion mutations from the other side of the leaf. The gRNA target sequence is boxed and the PAM region is underlined in eachpanel. Sequence identifiers are assigned to sequences in FIGS. 30C-30E that contain tenor more nucleotides. FIGS. 31A-31B are schematics showing the genome organization of AYLCB(FIG.31A) and WDIV (FIG.31B), indicating the location of the C1 promoter on AYLCB and the bidirectional promoter on WDIV. The nucleotide sequences of both strands of the C1 promoter (FIG.31A; SEQ ID NOS:412 and 413) and the bidirectional promoter (FIG.31B; SEQ ID NOS:414 and 415) also are shown, with boxes indicating putative cis-acting element, TATA box, CAAT-box, G-box, GATA-motif, AAAG motif, Box 4, and AE-Box sequences. The putative translation start sites are indicated by the arrows at the beginning of the promoter sequences. FIGS.32A-32C show comparison of editing analysis by CRISPResso2 and Cas-Analyzer. FIG. 32A is a graph plotting indel frequencies predicted by CRISPResso2 andCas-Analyzer, compared side by side for samples having Cas9-induced indels. In spite ofdifferences in number of indels, both tools predicted same indel frequencies. FIGS. 32B-32C show representative deletion mutations from inoculated leaves (FIG.32B) and systemically infected leaves (FIG.32C). The gRNA target sequence is boxed and the PAM region is underlined in each panel. Representative deletions detected by Cas-Analyzer for NBSP3 are shown in FIG. 26C. Both Cas-Analyzer and CRISPResso2detected similar deletions, but CRISPResso2 predicted a higher count for some of themost prevalent deletions. Sequence identifiers are assigned to sequences in FIGS. 32B-32C that contain ten or more nucleotides. FIGS.33A-33D show comparison of editing analysis by CRISPResso2 and Cas-Analyzer. FIG. 33A is a graph plotting indel frequencies predicted by CRISPResso2 andCas-Analyzer, compared side by side for samples having miniature Cas (RiceMINI,Cas 1, Cas 2, and CasMINI) induced indels. CRISPResso2 predicted a higher indel Attorney Docket No.09531-0544WO1 2023-287frequency as compared to Cas-Analyzer. FIGS. 33B-33D show representative deletionmutations from the other side of the leaf induced by RiceMINI (FIG. 33B), Cas 1 (FIG.33C), and Cas 2 (FIG. 33D). The gRNA target sequence is boxed and the PAM regionis underlined in each panel. Representative deletions detected by Cas-Analyzer for RM5are shown in FIG. 30E. Representative deletions detected by Cas-Analyzer for CP11 areshown in FIG. 30C. Representative deletions detected by Cas-Analyzer for CP21 areshown in FIG. 30D. Cas-Analyzer and CRISPResso2 detected similar deletions, butCRISPResso2 predicted a higher count for some of the most prevalent deletions. FIGS. 34A-34B are schematic representations of Cas9 gRNA constructs. FIG.34A shows the nucleotide sequence of AtU6:gRNA (SEQ ID NO:535; left) and depicts its cloning into a WDIV based vector (top right) and an AYLCB based vector (bottomright). FIG. 34B shows the nucleotide sequence of spacer:gRNA:spacer (SEQ IDNO:536; left) and depicts its cloning into a WDIV based vector (top right) and an AYLCB based vector (bottom right). FIG.35 is a schematic representation of the protocol for developing an AYLCB- based vector for tissue culture free genome editing. Primer details are provided in TABLE 4. DETAILED DESCRIPTION Provided herein are methods and materials that can be used to edit nucleic acids within both monocot and dicot plants. For example, this document provides nucleic acid constructs containing WDIV nucleotide sequences and satellite nucleotide sequences, where the WDIV construct or the satellite construct has been engineered to encode one or more nucleic acid modifying agents that can introduce modifications into the nucleic acid of plant cells. This document also provides methods for using the nucleic acid constructs described herein to introduce modifications into plant nucleic acid. In some embodiments, this document provides agro-infectious WDIV nucleic acid constructs. The terms “nucleic acid” and “polynucleotide” are used interchangeably and refer to both RNA and DNA, including cDNA, genomic DNA, synthetic (e.g., chemically synthesized) DNA, and DNA (or RNA) containing nucleic acid analogs. Nucleic acids Attorney Docket No.09531-0544WO1 2023-287 can have any three-dimensional structure. A nucleic acid can be double-stranded or single-stranded (i.e., a sense strand or an antisense single strand). Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers, as well as nucleic acid analogs. As used herein, “isolated,” when in reference to a nucleic acid, refers to a nucleic acid that is separated from other nucleic acids that are present in a genome, e.g., a plant genome, including nucleic acids that normally flank one or both sides of the nucleic acid in the genome. The term “isolated” as used herein with respect to nucleic acids also includes any non-naturally-occurring sequence, since such non-naturally-occurring sequences are not found in nature and do not have immediately contiguous sequences in a naturally-occurring genome. In some cases, a nucleic acid can be made by, for example, chemical synthesis or polymerase chain reaction (PCR) amplification from a template sequence or sequences. PCR refers to a procedure or technique in which target nucleic acids are amplified. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Various PCR methods are described, for example, in PCR Primer: A Laboratory Manual, Dieffenbach and Dveksler, eds., Cold Spring Harbor Laboratory Press, 1995. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified. Various PCR strategies also are available by which site-specific nucleotide sequence modifications can be introduced into a template nucleic acid. As used herein, the term “agro-infectious” refers to a nucleic acid that can infect plant cells. Thus, the WDIV constructs and satellite constructs described herein can enter plant cells. Once an agro-infectious nucleic acid provided herein has infected a plant cell, however, it cannot be transmitted from that cell to another plant cell, nor can the agro- Attorney Docket No.09531-0544WO1 2023-287 infectious nucleic acid be transmitted from an infected plant to another plant. This is due, at least in part, to the fact that WDIV cannot transmit in nature. The WDIV sequences in the constructs provided herein can be rendered agro- infectious in any appropriate manner. In some cases, the WDIV constructs provided herein can include transfer DNA (T-DNA) sequences that can deliver the WDIV sequences into plant cells. For example, the pCAMBIA destination T-DNA plasmid (FIG. 1C) used in the Examples described herein includes T-DNA sequences that can mediate transfer of inserted sequences (e.g., the WDIV sequences) into a plant cell. Any other appropriate binary vector containing T-DNA sequences can be used. Representative examples of WDIV sequences are set forth in SEQ ID NOS:116 and 117 (FIG.4), which are WDIV sequences from wheat and potato (Solanum nigrum), respectively. Other representative examples of WDIV sequences are set forth in SEQ ID NO:164 (FIG.1D) and SEQ ID NO:166 (FIG.3B). In general, the WDIV nucleic acid constructs provided herein include sequences encoding polypeptides that, when expressed in a plant cell, cause the WDIV nucleic acid to replicate within the plant cell. In addition, if a satellite nucleic acid as described herein is present within the plant cell, the encoded polypeptide can, when expressed, cause the satellite nucleic acid to replicate. Non- limiting examples of polypeptides that can cause a WDIV nucleic acid and / or a satellite nucleic acid to replicate in a plant cell include the Rep polypeptide encoded by nucleotides 1688 to 2850 of SEQ ID NO:164 (which include an intron), and the RepA polypeptide encoded by nucleotides 1981 to 2850 of SEQ ID NO:164. Without being bound by a particular mechanism of action, the Rep polypeptide can nick the WDIV nucleic acid and, if present, the satellite nucleic acid, and the plant’s cellular machinery can then replicate the WDIV and satellite DNA. In some cases, a WDIV nucleic acid construct provided herein can include a nucleotide sequence encoding a movement protein (e.g., nucleotides 428 to 748 of SEQ ID NO:164). In some cases, a WDIV nucleic acid construct provided herein can lack a nucleotide sequence encoding a movement protein. In some cases, a WDIV nucleic acid construct provided herein can include a nucleotide sequence encoding a coat protein (e.g., nucleotides 793 to 1536 of SEQ ID NO:164). In some cases, a WDIV nucleic acid Attorney Docket No.09531-0544WO1 2023-287 construct provided herein can lack a nucleotide sequence encoding a coat protein. In some cases, a WDIV nucleic acid construct provided herein can include a nucleotide sequence encoding a movement protein (e.g., nucleotides 428 to 748 of SEQ ID NO:164) and a nucleotide sequence encoding a coat protein (e.g., nucleotides 793 to 1536 of SEQ ID NO:164). In some cases, a WDIV nucleic acid construct provided herein can lack nucleotide sequences encoding a movement protein and a coat protein. In some cases, a WDIV nucleic acid can be engineered to include a multicloning site (e.g., a sequence that includes recognition sites for two or more (e.g., three, four, five, or more than five) restriction endonucleases. As an example, SEQ ID NO:166 includes a multicloning site atnucleotides 1674 to 1693 (underlined in FIG. 3B).In some cases, a WDIV nucleic acid construct provided herein can include one or more LIR sequences and / or one or more SIR sequences. For example, a WDIV nucleic acid construct can include a LIR having the sequence set forth in nucleotides 77 to 427 of SEQ ID NO:164 and / or a LIR having the sequence set forth in nucleotides 2851 to 3209 of SEQ ID NO:164. For example, in some cases a WDIV nucleic acid construct can include a SIR having the sequence set forth in nucleotides 1537 to 1687 of SEQ ID NO:164. In some embodiments, this document provides agro-infectious WDIV-associated satellite nucleic acid constructs. In some cases, the presence of a satellite nucleic acid construct provided herein in a plant cell can enhance the effectiveness of a WDIV construct for modifying nucleic acid within the plant cell. Without being bound by a particular mechanism of action, satellites encode proteins (e.g., C1) that can silence suppressors, leading to a higher accumulation of virus particles. An agro-infectious satellite nucleic acid can include one or more A-rich sequences (which typically serve as stuffer sequences and have varying lengths between different species of satellites) and / or one or more nucleotide sequences encoding C1 polypeptides. The satellite nucleic acid can be any appropriate satellite nucleic acid. For example, the satellite nucleic acid can be an AYLCB nucleic acid. Representative AYLCB sequences are set forth in SEQ ID NO:165 (FIG.2C) and SEQ ID NOS:118 and 119 (FIG.5), which are wheat and solanum-infective sequences, respectively. The AYLCB sequence set forth in SEQ ID Attorney Docket No.09531-0544WO1 2023-287 NO:165 includes A-rich regions (nucleotides 349 to 612 and 1723 to 1986 of SEQ ID NO:165), two nucleotide sequences encoding a C1 polypeptide (nucleotides 710 to 1126 and 2084 to 2500 of SEQ ID NO:165), and a SCR (nucleotides 1280 to 1557 of SEQ ID NO:165). Other WDIV-associated satellite nucleic acids also can be used in the systemsprovided herein, including Cotton leaf curl Multan alphasatellite (see, e.g., GenBankAccession No.: KC305093) and Guar leaf curl alphasatellite (see, e.g., GenBankAccession No. KC305095). In some cases, the WDIV nucleic acid constructs and the satellite nucleic acid constructs provided herein also can contain a cloning site into which one or more nucleotide sequences encoding one or more nucleic acid modifying agents can be inserted. The one or more encoded nucleic acid modifying agents can include a polypeptide and / or an RNA that, when expressed within a plant cell, can edit nucleic acid of the plant cell to introduce one or more genetic or epigenetic modifications. The inserted sequence(s) containing the one or more nucleic acid modifying agents can have any appropriate length. For example, the inserted sequence(s) can have a total length form about 20 nucleotides to about 3000 nucleotides (e.g., about 20 to about 50 nucleotides, about 50 to about 100 nucleotides, about 100 to about 250 nucleotides, about 250 to about 500 nucleotides, about 500 to about 1000 nucleotides, about 1000 to about 1500 nucleotides, about 1500 to about 2000 nucleotides, about 2000 to about 2500 nucleotides, or about 2500 to about 3000 nucleotides). In some cases, a nucleic acid modifying agent can be selected to introduce a break (e.g., a single-strand break or a double-strand break) into a plant’s DNA (e.g., genomic DNA or epigenomic DNA). In general, a double-strand break at a target sequence to be modified can be repaired by one of two primary pathways: non-homologous end joining (NHEJ) or homologous recombination (HR). In NHEJ, the ends of the broken chromosome are rejoined, sometimes imprecisely, which can introduce small insertionsor deletions (indels) at the break site (Gorbunova and Levy, Nucleic Acids Res 1997,25:4650-4657). When indels occur in coding sequences, they may create frame shift mutations that disrupt gene function. In HR, or gene targeting (GT), the DNA break is repaired using a template with homology to the break site. The repair template can be the Attorney Docket No.09531-0544WO1 2023-287 sister chromatid, a homologous or homeologous chromosome (in the case of polyploid species), or an exogenous template containing one or more specific sequence modifications to be incorporated into the break site. Any appropriate nucleic acid modifying agent can be encoded by a WDIV nucleic acid construct or satellite nucleic acid construct provided herein. Examples of nucleic acid modifying agents include, without limitation, targeted rare-cutting endonucleasessuch as meganucleases (Puchta et al., Nucleic Acids Res 1993, 21:5034-5040; Salomonand Puchta, EMBO J 1998, 17:6086-6095; and Jacoby et al., Nucl. Acids Res.,10.1093 / nar / gkr1303, 2012), zinc-finger nucleases (ZFNs) (Kim et al., Proc Natl AcadSci USA 1996, 93:1156-1160; Townsend et al., Nature 2009, 459:442-445; and Sander etal., Nature Methods, 8:67-69, 2011), transcription activator-like effector (TALE)endonucleases (Christian et al., Genetics 2010, 186:757-761; Bogdanove and Voytas,Science 2011, 333:1843-1846; and U.S. Publication No.2011 / 0145940), and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems, such as aCRISPR / Cas9 system (Hwang et al., Nat Biotechnol 2013, 31:227-229; Shan et al., NatBiotechnol 2013, 31:686-688; Cong et al., Science 339:819-823, 2013; and Mali et al.,Science 339:823-826, 2013). CRISPR / Cas systems use RNA base pairing to direct DNAor RNA cleavage by a Cas endonuclease. CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) sequences direct the Cas enzyme to a specific target DNA sequence(Makarova et al., Nat Rev Microbiol, 9(6):467-477, 2011). The modification of a singletargeting RNA can be sufficient to target of a Cas protein. In some cases, crRNA and tracrRNA can be engineered as a single cr / tracrRNA hybrid to directCas9 cleavage activity (Jinek et al., Science, 337(6096):816-821, 2012).In some cases, a WDIV nucleic acid construct or a satellite nucleic acid construct can contain sequences encoding a Cas endonuclease and a gRNA. The Cas-encoding sequence and the gRNA-encoding sequence can be independently and operably linked to any appropriate promoter(s) within the WDIV or satellite nucleic acid construct. The promoter(s) can be, for example, inducible, constitutive, cell specific, or tissue specific. Exemplary constitutive promoters include, without limitation, constitutive RNA pol II promoters such as the 35S, Nos-P, and ubiquitin promoters, and constitutive RNA pol III Attorney Docket No.09531-0544WO1 2023-287 promoters such as the U6 promoter. Examples of inducible promoters include, without limitation, the virion-sense promoter from geminivirus, and the XVE promoter. In some embodiments, for example, a Cas coding sequence can be operably linked to an inducible XVE promoter, which can be activated by estradiol. Any appropriate Cas endonuclease can be encoded by a WDIV nucleic acid construct or a satellite nucleic acid construct provided herein. In some cases, the Cas endonuclease can be a Cas9 endonuclease. A Cas9 amino acid sequence fromStreptococcus pyogenes is set forth in SEQ ID NO:180 (FIG. 23A), and a nucleotidesequence encoding an S. pyogenes Cas9 endonuclease is set forth in SEQ ID NO:181(FIG.23B). Other suitable Cas polypeptides include, without limitation, Cas12j (alsoreferred to as Cas , including Cas 1, Cas 2, and Cas 3) and Cas12f (also referred to asCasMINI). A representative Cas 1 amino acid sequence is set forth in SEQ ID NO:184and a representative nucleotide sequence encoding Cas 1 endonuclease is set forth inSEQ ID NO:168 (both in FIG. 20A). A representative Cas12f endonuclease amino acidsequence is set forth in SEQ ID NO:182 (FIG.23C), and a representative nucleotide sequence encoding a Cas12f endonuclease is set forth in SEQ ID NO:183 (FIG.23D). Arepresentative Cas 2 amino acid sequence is set forth in SEQ ID NO:537 and arepresentative nucleotide sequence encoding Cas 2 endonuclease is set forth in SEQ IDNO:538 (both in FIG. 23E). A representative Cas 3 amino acid sequence is set forth inSEQ ID NO:539 and a representative nucleotide sequence encoding Cas 3 endonucleaseis set forth in SEQ ID NO:540 (both in FIG. 23F). In some cases, a Cas endonucleasesequence can be adjusted or optimized for expression in a particular type of plant. For example, a representative amino acid sequence for a rice codon optimized Cas12f endonuclease (referred to herein as “RiceMINI”) is set forth in SEQ ID NO:541 and a representative nucleotide sequence encoding a RiceMINI endonuclease is set forth inSEQ ID NO:542 (both in FIG. 23G). respectively.Other examples of nucleic acid modifying agents that can be encoded by a WDIV nucleic acid construct or satellite nucleic acid provided herein include, without limitation, TnpB polypeptides, cytosine base editors (CBEs), adenine base editors (ABEs), and prime editing agents. TnpBs are Cas-related polypeptides that work with guide RNAs to Attorney Docket No.09531-0544WO1 2023-287 modify DNA. TnpBs are relatively small in size – often less than about 500 amino acids. Representative examples of TnpB amino acid sequences are set forth in SEQ ID NOS:544 and 545 (FIG.23H). Base editing and prime editing technology can avoid the creation of double-stranded DNA breaks, and may provide enhanced editing efficiency and product purity. These technologies are described elsewhere (see, e.g., Kaya (2024), “Base Editing and Prime Editing” in: A Roadmap for Plant Genome Editing. Ricroch,Eriksson, Miladinovi , Sweet, Van Laere, and Wo niak-Gientka (eds), Springer, Cham.;https: / / doi.org / 10.1007 / 978-3-031-46150-7_2). In some cases, a WDIV or satellite vector provided herein can include gRNA and Cas coding sequences that are flanked on one or both sides with a plant tRNA sequence, rather than by an external promoter and / or a terminator. Such an arrangement can reduce the size of the nucleic acid sequences inserted into the vector (e.g., by at least about 500 to about 2000 base pairs). After mRNA expression, the tRNA sequence(s) can be removed from the RNA by the plant’s machinery. Any appropriate plant tRNA sequence can be used. In some cases, when a sequence encoding a gRNA or a Cas endonuclease is flanked on both sides by tRNA sequences, the tRNA sequences on either side of the gRNA coding sequence or the sequence encoding the Cas endonuclease sequence can be the same. In some cases, when a sequence encoding a gRNA or a Cas endonuclease is flanked on both sides by tRNA sequences, the tRNA sequences on either side of the gRNA coding sequence or the sequence encoding the Cas endonuclease sequence can be different. A non-limiting example of a plant tRNA sequence that can be used as described herein is set forth in SEQ ID NO:185. In some cases, a WDIV or satellite nucleic acid can be designed to express, as a chimeric RNA, a nucleotide sequence encoding a Cas polypeptide and a gRNA nucleotide sequence, where the Cas encoding sequence and the gRNA sequence are separated by a tRNA sequence. After expression, the transcript can be processed into Cas mRNA and gRNA by removal of the tRNA sequence by the plant’s machinery. In such arrangements, the gRNA can be flanked by tRNA sequences on both sides for processing. The Cas encoding sequence also can be flanked on both sides by tRNA sequences.Alternatively, the Cas encoding sequence may have a tRNA sequence only at its 3 end Attorney Docket No.09531-0544WO1 2023-287 (i.e., the tRNA sequence separating the Cas sequence from the gRNA sequence). Thus, in some cases a WDIV or satellite nucleic acid provided herein can include a cassette having a general structure of viral vector promoter : Cas : tRNA : gRNA : tRNA. In some cases, a nucleic acid modifying agent can be a TALE endonuclease. TALeffectors of plant pathogenic bacteria in the genus Xanthomonas play important roles indisease and trigger defense by binding to host DNA and activating effector-specific hostgenes (see, e.g., Gu et al., Nature 435:1122, 2005; Yang et al., Proc Natl Acad Sci USA103:10503, 2006; Kay et al., Science 318:648, 2007; Sugio et al., Proc Natl Acad SciUSA 104:10720, 2007; and Römer et al., Science 318:645, 2007). Specificity depends onan effector-variable number of imperfect, typically 34 amino acid repeats (Schornack etal., J Plant Physiol 163:256, 2006). Polymorphisms are present primarily at repeatpositions 12 and 13, which are referred to herein as the repeat variable-diresidue (RVD). TALE nucleases contain (1) a DNA binding domain derived from a TAL effector, where the domain can be engineered to bind to a specific sequence based on the RVDs included in the repeats, and (2) an endonuclease domain, typically from a type II restrictionendonuclease such as FokI (Kim et al., Proc Natl Acad Sci USA 93:1156-1160, 1996).Other useful endonucleases include, for example, HhaI, HindIII, NotI, BbvCI, EcoRI,BglI, and AlwI. The fact that some endonucleases (e.g., FokI) only function as dimers canbe capitalized upon to enhance the target specificity of the TALE nuclease. For example,in some cases each FokI monomer can be fused to a TAL effector sequence thatrecognizes a different DNA target sequence, and only when the two recognition sites are in close proximity do the inactive monomers come together to create a functional enzyme. By requiring DNA binding to activate the nuclease, a highly site-specific restriction enzyme can be created. Thus, TALE nucleases can function as heterodimers, where each monomer of the pair is targeted to a selected target sequence, and when the monomers are bound to their targets, the nuclease dimerizes and cleaves the DNA at thetarget sequence between the monomer binding sites. See, e.g., U.S. Patent No. 8,586,363.The WDIV nucleic acid constructs provided herein can, in some cases, include nucleotide sequences as set forth in the representative WDIV sequences disclosed herein (e.g., SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:164 or SEQ ID NO:166), or Attorney Docket No.09531-0544WO1 2023-287 portions thereof. For example, a WDIV nucleic acid construct containing a sequence that encodes a nucleic acid modifying agent can include (a) a portion of SEQ ID NO:166from the 5 end of SEQ ID NO:166 to the multicloning site at the 3 end of the coatprotein coding sequence within SEQ ID NO:166, followed by (b) the sequence encoding the nucleic acid modifying agent, and (c) a portion of SEQ ID NO:166 from themulticloning site at the 5 end of the SIR to the 3 end of SEQ ID NO:166. In some cases,a WDIV nucleic acid construct provided herein can contain a sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to a representative WDIV sequence disclosed herein (e.g., SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:164 or SEQ ID NO:166), or portions thereof. In some cases, a WDIV nucleic acid construct provided herein can contain a Rep-encoding sequence with at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the Rep-encoding sequence set forth in nucleotides 360 to 1522 of SEQ ID NO:166. In some cases, a WDIV nucleic acid construct provided herein can contain a RepA-encoding sequence with at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the RepA-encoding sequence set forth in nucleotides 360 to 1229 of SEQ ID NO:166. The satellite nucleic acid constructs provided herein can, in some cases, include nucleotide sequences as set forth in the representative satellite sequences disclosed herein (e.g., SEQ ID NO:118, SEQ ID NO:119, or SEQ ID NO:165), or portions thereof. For example, a WDIV nucleic acid construct containing a sequence that encodes a nucleicacid modifying agent can include (a) a portion of SEQ ID NO:165 from the 5 end ofSEQ ID NO:166 to the 5 end of an inserted sequence encoding a nucleic acid modifyingagent, followed by (b) the sequence encoding the nucleic acid modifying agent, and (c) aportion of SEQ ID NO:165 from the 3 end of the sequence encoding the nucleic acidmodifying agent to the 3 end of SEQ ID NO:165. In some cases, a satellite nucleic acidconstruct provided herein can contain a sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least Attorney Docket No.09531-0544WO1 2023-287 98%, or at least 99%) sequence identity to a representative satellite sequence disclosed herein (e.g., SEQ ID NO:118, SEQ ID NO:119, or SEQ ID NO:165), or portions thereof. In some cases, when the nucleic acid modifying agent includes a sequence encoding a Cas endonuclease, the Cas endonuclease coding sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:168. In some cases, when the nucleic acid modifying agent includes a sequence encoding a Cas endonuclease, the Cas endonuclease coding sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:181. In some cases, when the nucleic acid modifying agent includes a sequence encoding a Cas endonuclease, the Cas endonuclease coding sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:183. In some cases, when the nucleic acid modifying agent includes a sequence encoding a Cas endonuclease, the Cas endonuclease coding sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:538. In some cases, when the nucleic acid modifying agent includes a sequence encoding a Cas endonuclease, the Cas endonuclease coding sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:540. In some cases, when the nucleic acid modifying agent includes a sequence encoding a Cas endonuclease, the Cas endonuclease coding sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:542. In some cases, when the nucleic acid modifying agent is a Cas endonuclease, the amino acid sequence of the Cas endonuclease sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at Attorney Docket No.09531-0544WO1 2023-287 least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:184. In some cases, when the nucleic acid modifying agent is a Cas endonuclease, the amino acid sequence of the Cas endonuclease sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:182. In some cases, when the nucleic acid modifying agent is a Cas endonuclease, the amino acid sequence of the Cas endonuclease sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:180. In some cases, when the nucleic acid modifying agent is a Cas endonuclease, the amino acid sequence of the Cas endonuclease sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:537. In some cases, when the nucleic acid modifying agent is a Cas endonuclease, the amino acid sequence of the Cas endonuclease sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:539. In some cases, when the nucleic acid modifying agent is a Cas endonuclease, the amino acid sequence of the Cas endonuclease sequence can be at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:541. In some cases, a sequence encoding a nucleic acid modifying agent (e.g., a Cas endonuclease, a TnpB polypeptide, a gRNA, or any combination thereof) can be flanked on one or both sides by a plant tRNA sequence having a nucleotide sequence that is at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence set forth in SEQ ID NO:185. The percent sequence identity between a particular nucleic acid or amino acid sequence and a nucleic acid or amino acid sequence referenced by a particular sequence identification number is determined as follows. First, a nucleic acid or amino acid Attorney Docket No.09531-0544WO1 2023-287 sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (Bl2seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand- alone version of BLASTZ can be obtained from Fish & Richardson’s web site (e.g., www.fr.com / blast / ) or the U.S. government’s National Center for Biotechnology Information web site (www.ncbi.nlm.nih.gov). Instructions explaining how to use the Bl2seq program can be found in the readme file accompanying BLASTZ. Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\Bl2seq -i c:\seq1.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of Bl2seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq -i c:\seq1.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences. Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. A matched position refers to a position in which an identical nucleotide or Attorney Docket No.09531-0544WO1 2023-287 amino acid residue occurs at the same position in aligned sequences. The percent sequence identity is determined by dividing the number of matches by the length of the sequence set forth in the identified sequence (e.g., SEQ ID NO:166), followed by multiplying the resulting value by 100. For example, an amino acid sequence that has 3100 matches when aligned with the sequence set forth in SEQ ID NO:166 is 96.2 percent identical to the sequence set forth in SEQ ID NO:166 (i.e., 3100 ÷ 3224 x 100 = 96.2). It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. It also is noted that the length value will always be an integer. Also provided herein are systems that include a WDIV nucleic acid construct provided herein and a satellite nucleic acid construct provided herein. In addition, this document provides methods for modifying nucleic acid within a plant cell. The methods can include introducing, into a plant, plant part, plant tissue, or plant cell, a WDIV nucleic acid construct provided herein, either alone or with a satellite nucleic acid construct provided herein. When introduced alone, the WDIV nucleic acid construct includes one or more nucleotide sequences encoding one or more nucleic acid modifying agents as described herein. When a WDIV nucleic acid construct is introduced into a plant, plant part, plant tissue, or plant cell in combination with a satellite nucleic acid construct, either construct can include the one or more nucleotide sequences encoding the one or more nucleic acid modifying agents. The methods provided herein can be used with monocots and with dicots, given the broad host range of WDIV. Thus, the methods described herein can be utilized withdicotyledonous plants belonging, for example, to the orders Magniolales, Illiciales,Laurales, Piperales, Aristochiales, Nymphaeales, Ranunculales, Papeverales,Sarraceniaceae, Trochodendrales, Hamamelidales, Eucomiales, Leitneriales, Myricales, Fagales, Casuarinales, Caryophyllales, Batales, Polygonales, Plumbaginales, Dilleniales, Theales, Malvales, Urticales, Lecythidales, Violales, Salicales, Capparales, Ericales, Diapensales, Ebenales, Primulales, Rosales, Fabales, Podostemales, Haloragales, Myrtales, Cornales, Proteales, Santales, Rafflesiales, Celastrales, Attorney Docket No.09531-0544WO1 2023-287 Euphorbiales, Rhamnales, Sapindales, Juglandales, Geraniales, Polygalales, Umbellales, Gentianales, Polemoniales, Lamiales, Plantaginales, Scrophulariales,Campanulales, Rubiales, Dipsacales, and Asterales. The methods described herein alsocan be utilized with monocotyledonous plants such as those belonging to the orders Alismatales, Hydrocharitales, Najadales, Triuridales, Commelinales, Eriocaulales, Restionales, Poales, Juncales, Cyperales, Typhales, Bromeliales, Zingiberales, Arecales,Cyclanthales, Pandanales, Arales, Lilliales, and Orchidales, or with plants belonging toGymnospermae, e.g., Pinales, Ginkgoales, Cycadales and Gnetales.The methods can be used over a broad range of plant species, including speciesfrom the dicot genera Atropa, Alseodaphne, Anacardium, Arachis, Beilschmiedia,Brassica, Carthamus, Cocculus, Croton, Cucumis, Citrus, Citrullus, Capsicum,Catharanthus, Cocos, Coffea, Cucurbita, Daucus, Duguetia, Eschscholzia, Ficus,Fragaria, Glaucium, Glycine, Gossypium, Helianthus, Hevea, Hyoscyamus, Lactuca,Landolphia, Linum, Litsea, Lycopersicon, Lupinus, Manihot, Majorana, Malus,Medicago, Nicotiana, Olea, Parthenium, Papaver, Persea, Phaseolus, Pistacia, Pisum,Pyrus, Prunus, Raphanus, Ricinus, Senecio, Sinomenium, Stephania, Sinapis, Solanum,Theobroma, Trifolium, Trigonella, Vicia, Vinca, Vitis, and Vigna; and the monocotgenera Allium, Andropogon, Aragrostis, Asparagus, Avena, Cynodon, Elaeis, Festuca,Festulolium, Heterocallis, Hordeum, Lemna, Lolium, Musa, Oryza, Panicum,Pannesetum, Phleum, Poa, Secale, Sorghum, Triticum, and Zea; or the gymnospermgenera Abies, Cunninghamia, Picea, Pinus, and Pseudotsuga.The methods provided herein can include introducing, into a plant, plant part, plant tissue, or plant cell, a WDIV nucleic acid construct provided herein, either alone or in combination with a satellite nucleic acid construct provided herein. Any appropriate technique can be used to introduce the nucleic acid construct(s) into the plant, plant part, plant tissue, or plant cell. In some cases, the nucleic acid construct(s) can be introducedby Agrobacterium mediated transformation (e.g., agroinoculation). Alternatively, thenucleic acid construct(s) can be delivered to a plant, plant part, plant tissue, or plant cell using particle bombardment, electroporation, polyethylene glycol (PEG) transformation, insect vectors, grafting, or DNA abrasion. Attorney Docket No.09531-0544WO1 2023-287 After a nucleic acid construct (e.g., a WDIV nucleic acid construct or a satellite nucleic acid construct) encoding a nucleic acid modifying agent has been delivered to a plant, plant part, plant tissue, or plant cell as described herein, any appropriate method can be used to determine whether the plant, plant part, plant tissue, or plant cell contains the WDIV and / or satellite DNA. For example, PCR can be carried out using total DNA isolated from the plant, plant part, plant tissue, or plant cell as a template for WDIV or satellite primers. In some cases, Southern hybridization can be used to detect WDIV and / or satellite DNA. In some cases, real time PCR can be used to quantify the amount of WDIV and / or satellite DNA within the plant, plant part, plant tissue, or plant cell. In addition, any appropriate method can be used to determine whether nucleic acid within the plant, plant part, plant tissue, or plant cell has been modified by the encoded nucleic acid modifying agent. For example, PCR (e.g., real time PCR) can be used with primers on either side of the targeted sequence to determine whether a deletion, insertion, or other mutation has been introduced, and to characterize the location and sequence of the deletion, insertion, or other mutation. In some cases, restriction digestion of PCR products can be used, if the target site in the plant DNA contains a cleavage site for a restriction endonuclease. The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES Example 1 – A geminivirus that crosses the monocot-dicot boundary and acts as a viral vector for gene silencing and genome editing MATERIALS AND METHODS WDIV and AYLCB clones and sequence analysis: A wheat-infecting isolate ofWDIV (clone number 88(1); GenBank accession number MN240329) (SEQ ID NO:186,FIG. 1B) and AYLCB (clone number 72( 1); GenBank accession number MN240347)(SEQ ID NO:187; FIG. 2B) from a study described elsewhere (Kumar et al. 2020b,supra) were selected for the construction of infectious clones and viral vector development. Sequence analysis was conducted by aligning the nucleotide sequences of a Attorney Docket No.09531-0544WO1 2023-287 wheat-infecting isolate of WDIV (MN240329) and AYLCB (MN240347) with a Solanum nigrum-infecting isolate of WDIV (KJ028209) and AYLCB (KJ028213). In addition, the movement protein (MP), coat protein (CP), and replication-associated protein (Rep and RepA) sequences of WDIV and other mastreviruses that infect monocot and dicot plant species were compared by multiple sequence alignment using Clustal Omega (available at www.ebi.ac.uk / Tools / msa / clustalo / ). Construction of infectious clones of WDIV and AYLCB: An infectious clone ofWDIV was prepared by combining a full-length and a partial fragment of the virus genome to create a head-to-tail tandem repeat of the viral genome in pCAMBIA1300 (FIG.1A). Two separate PCR amplifications were performed using the primersWDVRF1 / WDVRR1 and WDVRF2 / WDVRR2 (TABLE 1; FIG. 1A) and clone 88(1) asa template. The PCR product generated with the WDVRF1 / WDVRR1 primers wasdigested with SacI and KpnI, and the WDVRF2 / WDVRR2 PCR product was digestedwith KpnI and XbaI. At the same time, pCAMBIA1300 (FIG. 1C) was digested withSacI and XbaI. The two PCR products and the pCAMBIA1300 vector were ligatedtogether as illustrated in FIG. 1A. A DNA sequence for the ligated WDIV PCR productsis provided in FIG. 1D (SEQ ID NO:164). The SacI, KpnI, and XbaI restriction sites areunderlined. An infectious clone of AYLCB was prepared by cloning head-to-tail tandemrepeats of the full-length betasatellite genome in pCAMBIA1300 as illustrated in FIG. 2.PCR amplifications were performed using the primers Beta1FN / Beta1RN andBeta2FN / Beta2RN (TABLE 1; FIG. 2) and clone number 72( 1) as a template.Phire hot start II DNA polymerase (ThermoFisher Scientific) was used in all the PCR performed in these studies. The PCR product amplified with the Beta1FN / Beta1RNprimers was digested with XbaI and PacI, and the PCR products generated with theBeta2FN / Beta2RN primers were digested by PacI and PstI. The binary vectorpCAMBIA1300 was digested with XbaI and PstI, and the two PCR products andpCAMBIA1300 were ligated together to generate head-to-tail tandem repeats of thebetasatellite DNA as illustrated in FIG. 2A. A DNA sequence for the ligated AYLCB Attorney Docket No.09531-0544WO1 2023-287PCR products is provided in FIG. 2C (SEQ ID NO:165). The XbaI, PacI, and PstIrestriction sites are underlined. TABLE 1: List of primersPrimer name Nucleotide sequence (5 to 3 ) SEQ IDNO: Attorney Docket No.09531-0544WO1 2023-287 Development of a WDIV-based viral vector: A WDIV-based vector was preparedby introducing cloning sites after the stop codon of the coat protein gene as illustrated in FIG.3. Clone 88(1), representing a full-length WDIV genome, was used as a template for virus-based vector development. The first set of primers, P1 and P3, were used to amplify the portion of the viral genome containing the large intergenic region (LIR), MP, and CP, while the second set of primers, P2 and P4, were used to amplify Rep and the small intergenic region (FIG.3). The third set of primers, P5 and P6, were used to amplify the LIR of the viral genome. The PCR products generated using the first andsecond sets of primers were digested with SpeI and ligated together. The ligation productwas used as a template in PCR with the P1 and P2 primers (FIG.3). The PCR products generated with P1 and P2 and with P5 and P6 were cloned into the pJET1.2 cloning vector (ThermoFisher Scientific). One positive clone of each type was selected for thenext step. The clone containing the P1 and P2 primer pair product was digested with SacIand KpnI, the P5 and P6 primer product was digested with KpnI and XbaI, andpCAMBIA1300 was digested with SacI and XbaI restriction enzymes. The two inserts(generated with P1 and P2 and with P5 and P6) and the pCAMBIA1300 vector wereligated together as shown in FIG. 3A. The resulting viral vector is available throughAddgene (207657 pCMV_146). A DNA sequence for the ligated P1 / P2 and P5 / P6products is shown in FIG. 3B (SEQ ID NO:166). The cloning sites (MluI, SpeI, and AscI)are underlined. A DNA sequence for WDIV vector in pCAMBIA is shown in FIG. 3C(SEQ ID NO:167). The WDIV sequence are underlined. Silencing of the phytoene desaturase gene: A 185 bp long DNA fragment of thephytoene desaturase (PDS) gene was amplified using cDNA of Triticum aestivum as atemplate and the WhPDSF and WhPDSR primers (TABLE 1). Similarly, a 185 bp DNAfragment of the PDS gene was amplified from Nicotiana benthamiana using cDNA as atemplate and the TobPDSF and TobPDSR primers (TABLE 1). The PCR products were cloned into the pJET1.2 cloning vector and sequenced to confirm identity with sequences reported elsewhere (GenBank accession numbers EU165355 and FJ517553). Onepositive clone each from wheat and tobacco was selected and digested using AscI andMluI to release the PDS gene fragments. The WDIV vector (FIG.3) also was digested Attorney Docket No.09531-0544WO1 2023-287with AscI and MluI, and the PDS fragments from tobacco and wheat were separatelycloned into the WDIV vector. One positive clone from each was selected for virus- induced gene silencing (VIGS) of the PDS gene in wheat and tobacco. Development of gRNA construct: The gRNA sequence 5'-TTGGTAGTAGCGACTCCATG-3' (SEQ ID NO:163) was selected for targeting thePDS gene in tobacco (Maher et al., Nat. Biotechnol., 38:84-89, 2020). A 4 bp overhangcompatible with the pDIRECT_23A vector was added to the sense gRNA (NbgRNA1_For) and antisense gRNA (NbgRNA1_Rev) primers (TABLE 1). The gRNA duplex was prepared using the NbgRNA1_For and NbgRNA1_Rev in a PCR reaction.The 20 bp duplex was then cloned into an AarI digested pDIRECT_23A vector(www.addgene.org / 91138 / ). One positive clone was selected and the AtU6:gRNA cassette was amplified using modified pDIRECT_23A as a template and AtU6_For and gRNA_Rev primers. The PCR product was cloned into the pJET1.2 vector and sequencedfor verification. The AtU6:gRNA cassette was released from pJET1.2 using AscI andMluI restriction enzymes. The AtU6:gRNA cassette was then cloned into the WDIV vector (FIGS.3 and 17A). Agroinoculation: A pCAMBIA1300 vector carrying WDIV, AYLCB, or WDIVwith the PDS gene or gRNA was transformed into Agrobacterium tumefaciens GV3101.One positive clone from each type was selected and was grown separately in 5 mL ofLuria Bertani (LB) medium for 24 hours at 28 C and 200 rpm in a rotary shaker. A 100L primary culture was inoculated in 100 mL fresh LB medium and incubated overnight (optical density at 550 nm = 1), pelleted, and re-suspended in 100 mL infiltration buffer(10 mM MES, 10 mM MgCl2, and 200 M acetosyringone). For testing host range,young (3-6 leaf stage) barley, wheat, oat, corn, and soybean plants were agroinoculated by punching holes and then dipping the wounded leaves in the infiltration buffer, and tobacco leaves were inoculated using a needleless syringe. For WDIV and AYLCB inoculation, Agrobacterium containing WDIV and AYLCB were mixed in a 1:1 ratio before plant inoculations. For VIGS in wheat spikes and seeds, the flag leaf of each wheat plant was inoculated by punching holes. For genome editing, the Cas9 expressing transgenic tobacco lines were first tested using SpCas9For / Rev primers and then Attorney Docket No.09531-0544WO1 2023-287 inoculated with WDIV-carrying gRNA. The inoculated plants were observed and testedfor virus infection at 2 to 3 weeks post-inoculation (WPI). The inoculated plants weremaintained in the same growth chamber at 22 C during the day and 20 C at night(Conviron, Canada). Detection of virus and satellite DNA: Total DNA was isolated from the newly emerged systemically infected leaves of agroinoculated plants. WDIV was detected using the WDCPF / R primers, and AYLCB was detected using the BC1F / R primers, respectively (TABLE 1). The presence of the gRNA construct in systemically infected leaves was detected using the VIGSMCSF / R primers (TABLE 1). Detection of viral and satellite DNA also was performed using Southern hybridization. DNA from three biological replicates of each combination was pooled together. The pooled genomic DNAwas fractionated in 1 agarose gel and transferred to a positively charged nylonmembrane (Sigma-Aldrich). Capsid protein genes were used as probes for detection of WDIV, and the C1 gene was used as a probe for the detection of AYLCB in the inoculated plants. Hybridization and detection were performed as described elsewhere(Kumar et al. 2014, supra).Quantification of virus and satellite DNA: Three biological replicates wererandomly selected from each plant species and the DNA concentration was adjusted to 20ng / L. The primers WDIV RTF / RTR (TABLE 1) for the virus and AYLCB RTF / RTR(TABLE 1) for the betasatellite were used to perform real-time PCR. A universal primerpair targeting the actin gene (UniActF / R; TABLE 1) was modified and adopted from astudy described elsewhere (Pandey et al., Sci. Rep., 6:31361, 2016). Prior to their use inreal-time PCR assays, the UniActF / R primers were tested by PCR using control plant DNA samples from barley, wheat, oat, corn, soybean, and tobacco. Real-time PCR was performed in a Roche light cycler with SYBR green chemistry (Roche Diagnostics International AG). Validation of gene silencing, and genome editing: Virus-induced silencing of thePDS gene in wheat and tobacco was verified using real-time PCR analysis. Total RNA was isolated from PDS silenced and control leaves and converted into cDNA for use as a template. The primer pair WhPDS RTF / RTR (TABLE 1) was used for wheat, and Attorney Docket No.09531-0544WO1 2023-287 TobPDS RTF / RTR (TABLE 1) was used for tobacco. The actin genes in both wheat and tobacco were used as housekeeping controls. The universal primers, UniActF / R (TABLE 1) were used for amplifying the actin genes from wheat and tobacco. Amplicon sequencing was conducted to detect mutations in the tobacco PDS gene. The presence of the virus in the inoculated and systemically infected samples was confirmed using the WDCPF and WDCPR primers, and the presence of the gRNA cassette in the samples was confirmed using the VIGSMCSF and VIGSMCSR primers (TABLE 1). Samples showing the presence of virus and gRNA were used as templates for amplification of a partial fragment (384 bp) of the NbPDS gene containing the gRNA target region usingNbPDS(MutDet)_F1 and NbPDS(MutDet)_R1 (TABLE 1). All PCR amplifications wereperformed using the Phire hot start II DNA polymerase (ThermoFisher Scientific). The single PCR band was purified, quantified, and outsourced for amplicon sequencing (Azenta Life Sciences). Sequencing data were analyzed using Cas-analyzer (Park et al., Bioinformatics, 33:286-288, 2017). Development of new Cas protein for tissue culture-free genome editing: A Cas encoding construct (designated as “Cas12j” or “CasPhi1”) was selected for use with the system described herein, as the Cas12j polypeptide is encoded by a nucleotide sequencethat is 2247 bp in length (SEQ ID NO:168; FIG. 20A). Four different gRNAs (SEQ IDNOS:169-172; FIG. 20A) were selected and tested for efficiency in a plant protoplastsystem. The gRNA with a TTA protospacer-adjacent motif (PAM) showed higher editing efficiency in the protoplast system and was selected for virus-based testing. The Cas12j and the gRNA were delivered to plants using an approach in which the external promoter and terminators for the Cas12j and gRNA were replaced with plant tRNA sequences(SEQ ID NO:185; FIG. 20A) in order to minimize the construct size within the viralvector; after mRNA expression, the tRNA sequences can be removed from the RNA by the plant’s machinery. RESULTS Sequence analyses: Similarity analysis showed that nucleotide sequence of thewheat isolate of WDIV (MN240329) was 99% identical to sequence of the S. nigrumisolate of WDIV (KJ028209). The nucleotide sequence differences in the WDIV genome Attorney Docket No.09531-0544WO1 2023-287 were distributed randomly and were not located at specific loci (FIG.4). The nucleotide sequence of the wheat isolate of AYLCB (MN240347) was 99% identical to thenucleotide sequence of the S. nigrum isolate of AYLCB (KJ028213). Variations in theAYLCB nucleotide sequence were found to be close to A-rich regions (FIG.5). The amino acid sequences of the WDIV Rep, RepA, CP, and MP proteins were compared to those of mastreviruses infecting monocots (referred to as MIMs) and dicots (referred to as DIMs) showing the highest similarity. The analysis revealed the presence of conserved regions in the Rep, RepA, CP, and MP of MIMs and DIMs (FIGS.6-9). Viral symptoms across plant species: Inoculated plants were observed for viralsymptoms at three to five weeks post-inoculation. Except for wheat and barley, most of the tested plant species did not show significant growth retardation between the control and virus or virus and satellite-infected plants. About 10 to 15% of the wheat, barley, and oat plants showed extreme dwarfing (FIG.10), while 85 to 90% of the infected plants showed a mild effect on growth and development (FIGS.11A-11C). Corn plants did not show a significant difference in growth and development in the control vs. virus or virus and satellite inoculated plants (FIG.11D), while 5% of the soybean plants exhibited growth retardation and leaf deformity (FIGS.10 and 11E). About 50% of tobacco plants infected with the virus alone or virus with satellite showed no difference in growth and development (FIG.1F). However, about 30% of the tobacco plants showed mild symptoms such as growth retardation and leaf deformity, and about 20% showed moderate to severe symptoms such as stunted growth and small leaves (FIG.10). Detection and quantification of WDIV and AYLCB: The infectious clones ofWDIV or WDIV together with AYLCB were inoculated on wheat, barley, oat, corn, soybean, and tobacco plants. Twenty-four plants of each species were randomly selected for DNA isolation and tested for the presence of WDIV and AYLCB in the systemically infected leaves. About 90% of the inoculated barley and wheat plants, about 70% of the inoculated oat plants, about 55% of the inoculated corn plants, about 60% of the inoculated soybean plants, and about 95% of the inoculated tobacco plants became systemically infected with WDIV and yielded the expected PCR amplicons (FIG.12). WDIV and AYLCB inoculated plants were also tested for the presence of AYLCB in the Attorney Docket No.09531-0544WO1 2023-287 systemically infected leaves. About 80% of the inoculated wheat plants, about 70% of the inoculated barley plants, about 55% of the inoculated oat and corn plants, about 60% of the inoculated soybean plants, and about 80% of the inoculated tobacco plants showed the presence of AYLCB (FIG.13). AYLCB was detected in the WDIV-positive plants and was absent in the plants that tested negative for WDIV. Three biological replicates from each of the plant species (barley, wheat, oat, corn, soybean, and tobacco) were randomly selected, and PCR was carried out with CP,BC1, and actin gene primers and equal amounts of templates (20 ng / L). The presence ofamplicons for the CP, BC1, and actin genes was observed across the inoculated plant species (FIG.14A). The CP and BC1 PCR products were sequenced to confirm their identity (FIG.14B). All CP and BC1 PCR products had identities of 98% to 100% to WDIV and AYLCB, respectively. The accumulation of WDIV in all plant species was measured using real-time PCR, which showed that the accumulation of WDIV was higher in all plant species in the presence of AYLCB as compared to plants that were only inoculated with WDIV (FIG. 14C). The level of accumulation of WDIV and AYLCB varied among plant species. Wheat had the highest accumulation of virus in virus and betasatellite (VB) inoculated plants, whereas corn and soybean had the lowest accumulation with the VB combination. The abundance of betasatellite was lower in soybean (FIG.14C). Accumulation of the virus was similar in barley, oat, wheat, and soybean, slightly lower in corn, and higher in tobacco (FIG.14C). Southern hybridization from all six plant species further confirmed the presence of WDIV and AYLCB in the systemically infected plant leaves. All plant species were positive for the presence of WDIV and AYLCB in the samples that tested positive using PCR (FIG.14D). As observed by Southern hybridization (and generally consistent with the real time PCR results), the accumulation of WDIV was slightly higher in WDIV and AYLCB inoculated plant species. Moreover, the presence of multiple bands in the blots shows different replicative forms of the virus (FIG.14D). Virus-induced gene silencing in wheat and tobacco: Silencing of the PDS gene inwheat and tobacco was performed to further examine the capability of WDIV to work as Attorney Docket No.09531-0544WO1 2023-287 a vector in both monocot and dicot plant species. The WDIV vector carrying a partial PDS fragment was used for inoculation, and plants were examined three weeks later for the phenotype, which resulted from generation of small interfering RNAs against the PDS gene, leading to silencing. Silencing of the PDS gene in wheat resulted in white sectors on leaves, spikes, and seeds (FIGS.15A, 15B, and 15C, respectively). White sectors also were observed on tobacco leaves upon PDS silencing (FIGS.16A-16C). The bleaching phenotype in the leaves started at three weeks and was observed up to eight weeks post-inoculation. Spikes had bleaching phenotypes until the seeds started to senesce. Real-time PCR-based comparison of PDS transcripts in silenced vs. control plants further confirmed a lower abundance of PDS transcripts in the silenced wheat and tobacco plants (FIGS.15A-15C and 16D). Genome editing verification: Amplicon sequence files (fastq.gz) were analyzedusing a JavaScript-based online tool Cas-Analyzer (Park et al., supra). Detailed analysisresults for all the samples are provided in TABLE 2. The inoculated tobacco leaves(FIG.17B) had the highest number insertion and deletion events, followed by systemically infected tobacco leaves (FIGS.18A and 18B). Systemically infected tobacco fruits (FIG.19A) had the lowest number of insertion or deletion events. Single nucleotide insertions were documented in all insertion events found in these studies, but deletion lengths ranged from one nucleotide to several nucleotides in the inoculated leaves (FIG.17C) and in the systemically infected leaves and fruits of tobacco (FIGS. 18C and 19B). Some of the systemically infected leaves and fruits also showed white sectors (FIGS.18A, 18B, and 19A), but no difference in editing efficiency in the plant tissues was observed between green sectors and white sectors. TABLE 2: Summary of insertions and deletions in edited cells.Sample Total With both indicatorInsertions Deletions Indely Attorney Docket No.09531-0544WO1 2023-287 S3 340839 132867 1342 1230 2.0%S4 375092 135038 1862 1520 2.6% Modified Cas protein and its use in tissue culture-free genome editing: The Cas12j protein, which is encoded by a nucleotide sequence that is 2247 basepairs in length (nucleotides 78 to 2324 of SEQ ID NO:168; FIG. 20A), was used for geneediting in tobacco. In initial studies, four different gRNAs (SEQ ID NOS:169-172; FIG.20A) targeted to the tobacco PDS gene were tested for efficiency in tobacco protoplasts. Examination the resulting seedlings (FIG.20B) revealed that the gRNA containing a TTA PAM (SEQ ID NO:170) showed higher efficiency than the other three gRNAs, and therefore that gRNA was selected for virus-based testing. Nucleotide sequences encodingthe selected gRNA flanked by plant tRNA sequences (SEQ ID NO:173; FIG. 20A) andencoding the Cas12j polypeptide flanked by plant tRNA sequences (SEQ ID NO:168; FIG.20A), were delivered to tobacco plants in a WDIV / AYLCB construct system as described herein, yielding a variety of edited PDS sequences (FIG.21B). Taken together, the studies described herein demonstrated that WDIV can infect both monocot and dicot plants, including barley, wheat, oat, corn, soybean, and tobacco. WDIV was able to infect all of these inoculated plant species, and plants infected with WDIV and AYLCB showed more severe symptoms than plants infected with WDIV alone. WDIV was capable of acting as a viral vector for gene silencing when the WDIV genome was modified to include a fragment of the PDS gene from wheat and tobacco, with PDS gene silencing observed in both wheat and tobacco. Silencing of the PDS gene was observed in the spikes and seeds of the wheat, demonstrating the vector’s usefulness in targeting a gene present in reproductive tissues. Another WDIV-derived vector was successfully used to deliver a gRNA cassette of about 1 kb in length that targeted the PDS genes of a Cas9-expressing tobacco line, resulting in mutations (insertions and deletions) in the targeted region of the PDS gene in inoculated and systemically infected Attorney Docket No.09531-0544WO1 2023-287 leaves and fruits. The findings of these studies therefore confirmed that WDIV is not only able to infect a wide host range, but also works as a vector for gene silencing and genome editing. Example 2 - Tissue culture-free and high throughput genome editing in plants WDIV-associated AYLCB was engineered and used as a vector for delivering CRISPR gRNA along with a Cas molecule. The delivery potential of AYLCB was first demonstrated by expressing AmCyan. In addition, the size of the CRISPR gRNA and Cas constructs was minimized by replacing the external promoter and terminator with atransfer RNA (tRNA) spacer. N. benthamiana leaves were co-infiltrated with WDIV andAYLCB encoding gRNAs along with Cas9, Cas12f, and / or Cas12j. MATERIALS AND METHODS Vector development: To develop an AYLCB-based vector, a wheat-infectingisolate of AYLCB (clone number 72( 1); GenBank accession number MN240347)described elsewhere (Kumar et al. 2020b, supra) was selected and used as a template inPCR reactions. The AYLCB-based vector was developed by removing the C1 gene fromAYLCB and inserting a multiple cloning site after the C1 promoter as shown in FIG. 35.The first set of primers (P1 and P2) amplified the portion of the AYLCB genome containing the satellite conserved region (SCR), A-rich region, and C1 promoter, whereas the second set of primers (P3 and P4) amplified part of SCR and remaining backbone of the AYLCB. The PCR products generated using the first and second sets of primers weredigested by EcoRI and ligated together. The ligation product was used as a template inPCR using third (P1 and P4), and fourth sets (P5 and P6) of primers. Both PCR products - generated by P1 and P4 and P5 and P6 primers - were cloned in the pJET1.2 cloning vector (ThermoFisher Scientific). One positive clone of each type was selected for thenext step. The clone containing the P1 and P4 primer pair product was digested with XbaIand AscI, and the P5 and P6 primer product was digested with AscI and PstI.pCAMBIA1300 was digested with XbaI and PstI, and the P1 and P4 and P5 and P6inserts were ligated into the pCAMBIA1300 vector as shown. Primer details are provided Attorney Docket No.09531-0544WO1 2023-287in TABLE 3. BetaMCSF / R primers were used for confirmation of the insert in theAYLCB vector (TABLE 3). To support replication and systemic infection of the AYLCB-based vector, aninfectious clone of WDIV from a study described elsewhere (Kumar et al. 2024, supra)used for co-inoculation. Further, a WDIV-based vector described elsewhere (Kumar et al.2024, supra) was used for comparison of gRNA delivery efficiency with the AYLCBvector. Phire hot start II DNA polymerase (ThermoFisher Scientific) was used in all the PCR reactions performed in these studies. Testing promoters of AYLCB and WDIV: The presence of cis-regulatory elementsin the AYLCB C1 promoter and the WDIV bidirectional promoter was analyzed using thePlant Cis-Acting Regulatory Element (PlantCARE) database (Lescot et al., Nucleic AcidsRes.30:325-327, 2002). In addition, the regulatory elements were compared bycomparing with other betasatellite and virus sequences (Zhang et al., Virol J. 9:234, 2012;Shukla et al., Arch. Phytopathol. Pflanzenschutz, 46:1015-1029, 2013; Xie et al., PlantMol Biol. 53:1-14, 2003; Khan et al., PLoS One, 10:e0121656, 2015; Alok et al., Physiol.Mol. Plant Pathol.108:0885-5765, 2019). The AYLCB C1 promoter and the WDIV bidirectional promoter were then cloned into in pCAMBIA1305 by replacing the CaMV35s promoter, which resulted in a total of four constructs: AYLCB-C1, WDIV-VF, WDIV-CF, and CaMV35s (FIG.24A). All the four constructs were transformed into Agrobacterium. One positive clone for each construct was used for transformation into tobacco asdescribed elsewhere (Jogam et al., Mol Biol Rep. 50:5165-5176, 2023). Tobacco leaveswere surface sterilized with bleach and 70% ethanol followed by washing 3 times. All explants were used for regeneration on media containing 6-benzylaminopurine (BAP; 1.0 mg / L) and 1-naphthaleneacetic acid (NAA; 0.1 mg / L) along with 10 mg / L hygromycin for selection. The selected transgenic shoots were separated and transferred to MS medium with 1.0 mg / L indole-3-acetic acid (IAA). All media were solidified with 0.8% agar, and pH was adjusted to 5.7-5.8 before autoclaving. The transformants wereincubated at 26 ± 2ºC with a 16 / 8 hour photoperiod, with 50 µmol m 2 s 1 light intensitywhite fluorescent and 50–60% relative humidity. Attorney Docket No.09531-0544WO1 2023-287 At the 4 to 5 leaf stage, plantlets were selected for GUS histochemical assay to analyze the expression of the GUS in transformed and control tobacco plants. The GUS solution was prepared from a stock solution of 1 GUS KIT (Sigma-Aldrich) following the manufacturer’s instructions. T0 regenerated plants (transformed and wild type) were soaked in GUS solution and kept at 37°C overnight, and then 70% ethanol was used to eliminate chlorophyll from the plantlets and visualize GUS expression. Development of AmCyan expression constructs: To test the delivery andexpression capabilities the of AYLCB-based vectors, four different constructs weredeveloped with a visual marker gene (AmCyan; Wenck et al., Plant Cell Rep. 22:244-251, 2003). The first was developed by cloning AmCyan and a Nos terminator (AN) into the AYLCB based vector under the control of a C1 promoter of AYLCB (FIG.25A). The AmCyanKpnFor and AmCyanEcoRev primers (TABLE 3) were used to amplify the AmCyan gene. The NosEcorFor and NosAscRev primers (TABLE 3) were used for amplifying the NOS terminator. The AmCyan and NOS PCR products were digested withEcoRI and ligated together. The ligation product was then used as a PCR template withthe AmCyanKpnFor and NosAscRev primers (TABLE 3). The resulting PCR productwas digested with KpnI and AscI and ligated into the AYLCB vector. For anotherconstruct, AmCyan was amplified using the AmCyanBamFor and AmCyanEcoRevprimers (TABLE 3) and digested using EcoRI. The EcoRI digested AmCyan was ligatedwith EcoRI digested NOS and used as a template in PCR with the AmCyanBamFor andNosAscRev primers (TABLE 3). The AmCyan and Nos (AN) PCR product was digestedwith BamHI and used for the next step. Next, two constructs were developed using– complementary (CF) and virion (VF; FIG. 25A). CF was amplifiedusing the WDfullComBamFor and WDfullComKpnRev primers, and VF was amplified using the WDfullVirKpnFor and WDfullVirBamRev primers. In addition, the CaMV35s (35s) promoter was amplified using the 35sKpnFor and 35sBamRev primers, for comparing promoter strengths. All three PCR products (CF, VF and 35s) were digestedwith BamHI and ligated separately to BamHI-digested AN. The three ligation productsused as templates for primer pairs 35sKpnFor and NosAscRev, WDfullComKpnRev and NosAscRev, and WDfullVirKpnFor and NosAscRev, resulting Attorney Docket No.09531-0544WO1 2023-287 into 35AN, CFAN, and VFAN, respectively (FIG.25A). The three PCR products (35AN,CFAN, and VFAN) were cloned into the AYLCB vector at the KpnI and AscI restrictionsites as shown in FIG. 25A.Expression analysis using real-time PCR: Leaf samples from T0 transgenictobacco plants that were AYLCB-inoculated with the AmCyan constructs were collected separately. DNA and RNA were extracted using the DNeasy® and RNeasy® Plant Mini kits (QIAGEN GmbH, Germany). Total RNA was isolated and converted into cDNA and used as templates. DNA and cDNA concentrations were adjusted before their use as templates. Quantitative real-time (qRT) PCR reactions were carried out using AmCyan, GUS, hpt, and AYLCB specific primers (AmCyanRTFor / Rev, GUSRTFor / Rev,HptRTFor / Rev and AYLCBRTF / R; TABLE 3). Real-time PCR was performed in aRoche light cycler using SYBR green chemistry (Roche Diagnostics International AG, Switzerland). The tobacco actin gene was used as an internal control to normalize theexpression data (TobActFor / Rev; TABLE 3). Three biological replicates were amplifiedseparately in real-time PCR assays. Development of gRNA constructs for use in Cas9-expressing tobacco: A gRNAconstruct with an AtU6 promoter was generated using the sequence 5'-TTGGTAGTAGCGACTCCATG-3' (SEQ ID NO:188) as a gRNA for targeting the PDS gene in tobacco, as it had been demonstrated to work efficiently in studies describedelsewhere (Maher et al., supra; Kumar et al. 2024, supra). The AtU6:gRNA cassettedescribed in Kumar et al.2024 (supra) was used as a template for PCR amplification using the AtU6AYLCBKpnFor and gRNAterAYLCBAscRev primers (TABLE 3). The PCR product was cloned into the pJET1.2 vector and sequenced for verification. TheAtU6:gRNA cassette was released from pJET1.2 using KpnI and AscI and cloned into theAYLCB vector (FIG.34A). A WDIV vector carrying the AtU6:gRNA cassette (Kumar etal. 2024, supra) was also used for inoculation and comparison.Another set of gRNA constructs in WDIV and AYLCB vectors was developed using tRNA spacers on both sides of the gRNA (FIGS.34A-34B). PCR was performed using the TobPDSspaAscFor and TobPDSspaMluRev primers for cloning in the WDIV vector, and using the TobPDSspaKpnFor and TobPDSspaAscRev primers for cloning in Attorney Docket No.09531-0544WO1 2023-287 the AYLCB based vector (TABLE 3). The AtU6:gRNA cassette was used as a template in separate PCRs. The PCR product generated using the TobPDSspaAscFor andTobPDSspaMluRev primers was digested with AscI and MluI and the PCR productgenerated using the TobPDSspaKpnFor and TobPDSspaAscRev primers was digestedwith KpnI and AscI. The AscI and MluI digested product was cloned into the WDIVvector, and the KpnI and AscI digested product was cloned into AYLCB vector (FIGS.34A-34B). Clones were confirmed by Sanger sequencing. Development of tissue culture free gRNA and Cas expressing cassette in AYLCBvector: Five constructs – a Cas9 along with its gRNA, two Cas12j (Cas 1 and Cas 2;Pausch et al., Science, 369:333-337, 2020) and their gRNAs, and two Cas12f (CasMINIand Rice codon optimized Cas12f; Xu et al., Nat Chem Biol. 17:1132-1138, 2021;Sukegawa et al., Frontiers Genome Edit. 5:1138843, 2023) and their gRNAs – weredeveloped by cloning in an AYLCB based vector under the control of the C1 promoter (FIGS.27A, 28A, and 29A). Three additional constructs were developed by inserting the WDIV-CF promoter between the C1 promoter of AYLCB and the Cas coding sequences (FIG.30A). The sequences encoding the Cas molecules and their respective gRNAs were separated by a tRNA spacer in each construct. The tRNA spacer sequenceswere same those shown in FIG. 34B. Each construct was amplified in two sets of PCRreactions, one to amplify the gRNA and tRNA spacer on both sides and the other to amplify the Cas sequence and tRNA spacer. CRISPR-Cas constructs with C1 promoter: A first CRISPR-Cas construct wasdeveloped using Cas9 and its gRNA (FIG.27A). The Cas9KpnFor and Cas9SpeRevprimers were used for amplification of Cas9 using pDIRECT_23A (Cermak et al., PlantCell, 29:1196-1217, 2017) as a template, and the Cas9gRSpeFor and Cas9gRAscRev primers were used for amplifying the gRNA (TABLE 3), with the AtU6:gRNA cassette(Kumar et al. 2024, supra) as a template. Following PCR amplification, the Cas9 PCRproduct was digested with KpnI and SpeI and the gRNA PCR product was digested with Attorney Docket No.09531-0544WO1 2023-287AscI and SpeI, and the restriction fragments were cloned into a KpnI and AscI digestedAYLCB vector (FIG.27A). Another set of constructs was developed by cloning sequences encoding Cas 1and Cas 2 along with their gRNA into an AYLCB vector (FIG. 28A). TheCasPhi1SPKpnF and CasPhi1SPSpeR primers were used to amplify Cas 1, and theTbPDSCasPhi1SPSpeF and TbPDSCasPhi1SPAscR primers were used for gRNA amplification (TABLE 3). Similarly, the CasPhi2SPAKpnFor and CasPhi2SPAMluRevprimers were used to amplify Cas 2 and the TobPDSCasPhi2spaMluFor andTobPDSCasPhi2spaAscRev primers were used for gRNA amplification (TABLE 3).Template DNAs for Cas 1, Cas 2 and gRNAs were as described elsewhere (Pausch etal., supra). The Cas 1 PCR product was digested using KpnI and SpeI and its gRNA wasdigested with AscI and SpeI, and the restriction fragments were cloned into a KpnI andAscI digested AYLCB vector (FIG. 28A). The Cas 2 PCR product was digested usingKpnI and MluI and its gRNA was digested with AscI and MluI, and the restrictionfragments were cloned into a KpnI and AscI digested AYLCB vector (FIG. 28A).A third set of constructs was developed by cloning CasMINI and RiceMINI along with their gRNA into an AYLCB vector (FIG.29A). For amplification of CasMINI and its gRNA, the CasMiniSPAKpnFor and CasMiniSPAMluRev primers and the TobPDSMiniSPAMluFor and TobPDSMiniSPAAscRev primers were used (TABLE 3).The DNA templates were as described elsewhere (Xu et al., supra). The CasMINI PCRproduct was digested with KpnI and MluI and the gRNA PCR product was digested withAscI and MluI, and the restriction fragments were cloned into a KpnI and AscI digestedAYLCB vector (FIG.29A). RiceMINI and its gRNA nucleotide sequences describedelsewhere (Sukegawa et al., supra) were selected for synthesis as a gene fragment.Synthesis was carried out at Integrated DNA Technologies (IDT; Coralville, Iowa) andthe gene fragment was used as a DNA template in PCR for addition of a tRNA spacer and desired restriction sites. The RiceMiniSPcrKpnFor and RiceMiniSPcrSpeRev primer pair was used for RiceMINI, and the RiceMINIgRNASpeFor and RiceMINIgRNAAscRev primer pair was used for gRNA (TABLE 3). The RiceMINI PCR product was digested Attorney Docket No.09531-0544WO1 2023-287with KpnI and SpeI and the gRNA PCR product was digested with AscI and SpeI, and therestriction fragments were cloned into a KpnI and AscI digested AYLCB vector (FIG.29A). Two clones from each cassette were sequenced to confirm identity and orientation.In addition, AYLCB cassettes expressing only CasMINI, RiceMINI, Cas 1, or Cas 2were developed as negative controls for mutational analysis. A Cas9 transgenic line was used as a negative control for Cas9 mutational analysis. CRISPR-Cas constructs with a WDIV-CF promoter: Three constructs wereprepared by cloning RiceMINI, Cas 1, and Cas 2 under the control of the WDIV-CFpromoter as illustrated in FIG. 30A. WDIV-CF was amplified using theWDfullComKpnFor and WDfullComKpnRev primers, and the PCR product was digestedwith KpnI. RiceMINI, Cas 1, and Cas 2 clones (shown in FIGS. 28A and 29A) werealso digested with KpnI, and the KpnI digested WDIV-CF was ligated into the KpnIdigested RiceMINI, Cas 1, and Cas 2 clones. The ligated products were then separatelytransformed into E. coli. Five positive clones for each construct were sequenced toconfirm identity and orientation of the WDIV-CF promoter. One positive clone from each construct representing the desired orientation was selected for next step. Agroinoculation: pCAMBIA1300 vectors carrying an infectious clone of WDIV, aWDIV vector with insert, or an AYLCB vector with insert were transformed into Agrobacterium tumefaciens GV3101. One positive clone was selected for each constructand grown separately in 5 ml Luria Bertani (LB) medium for 24 hours at 28 C and 200rpm in an incubator shaker. A 50 L primary culture was inoculated in 50 mL fresh LBmedium and incubated overnight (optical density at 550 nm = 1), pelleted, and re-suspended in 50 mL infiltration buffer (10 mM MES, 10 mM MgCl2, and 100 Macetosyringone). In a first set of experiments, wild type Nicotiana benthamiana plants at the five orsix leaf stage were co-inoculated with the infectious clone of WDIV and an AYLCB vector carrying an AmCyan expression cassette (FIG.25A). The inoculated combinations were (1) WDIV and AYLCB with AN, (2) WDIV and AYLCB with 35AN, (3) WDIV and Attorney Docket No.09531-0544WO1 2023-287 AYLCB with CFAN, (4) WDIV and AYLCB with VFAN, and (5) WDIV and empty AYLCB. In a second set of experiments, Cas9 expressing transgenic tobacco lines were inoculated in four different combinations. In the first and second combinations, the AtU6:gRNA cassette was delivered using the WDIV vector or the AYLCB vector (FIG. 34A). In the third and fourth sets, gRNA with tRNA spacers was delivered using the WDIV vector or the AYLCB vector (FIG.34B). WDIV was co-inoculated to support replication of the AYLCB-based vector. Co-inoculation was done in by mixing equal amounts of agrobacterium culture having unmodified WDIV and an AYLCB vector carrying the gene of interest. Cas9 transgenic plants were tested for Cas9 expression using the SpCas9For / Rev primers before moving forward with mutational analysis. In a third set of experiments, wild type tobacco plants were co-inoculated withunmodified WDIV and AYLCB vectors carrying the cassettes shown in FIGS. 27A, 28A,28A and 29A. In addition, AYLCB expressing only CasMINI, RiceMINI, Cas 1, orCas 2 was co-inoculated as a negative control for mutational analysis. The inoculatedplants were moved to a growth chamber at 25 C during the day and 22 C at night(Conviron, Canada). The plants were observed and tested at 2 to 3 weeks post-inoculation (WPI). Detection of WDIV and AYLCB vectors and CRISPR-Cas reagents in theinoculated plants: Total DNA was isolated from the systemically infected leaves ofagroinoculated plants. WDIV was detected using WDCPF / R primers, whereas AYLCB was detected using the BetaC1(-)F / R primers, respectively (TABLE 3). The delivery of gRNA by WDIV in systemically infected leaves were tested using VIGSMCSF / R primers, whereas the delivery of gRNA and AmCyan by AYLCB was tested using BCMMCSF / R primers (TABLE 3). Delivery of CRISPR-Cas reagents were tested using specific primers. CasMinDet871F / R was used for CasMINI, RiceMINdetFor / Rev forRiceMINI, CasPhi1Det1.2kbF / R for Cas 1, CasPhi2Det1kbF / R for Cas 2 andSpCas9For / Rev was used for Cas9 (TABLE 3). Attorney Docket No.09531-0544WO1 2023-287 Detection of edits: Plants showing the presence of WDIV or AYLCB vectorsdepending on the inoculation combinations and the editing reagents were selected for amplicon sequencing. DNA from positive samples was used as templates for amplification of a partial fragment (384 bp) of the NbPDS gene containing the gRNA target region. The NbPDS(MutDet)_F1 and NbPDS(MutDet)_R1 primers (TABLE 3)were used for amplification. PCR was also done from the CasMINI, RiceMINI, Cas 1,Cas 2, and Cas9 only plants as negative controls. All PCR was performed using Phirehot start II DNA polymerase (ThermoFisher Scientific). The PCR band showing the desired size was cut from the agarose gel, purified, quantified, and outsourced for amplicon sequencing (Azenta Life Sciences). Sequencing data were analyzed using web-based tools, Cas-Analyzer (Park et al., supra) and CRISPResso2 (Clement et al., Nat.Biotechnol.37:224-226, 2019). To detect Cas9-induced indels, SpCas9 was selected asthe nuclease, while for detecting miniature Cas (Cas 1, Cas 2, CasMINI andRiceMINI) induced indels, FnCpf1 was selected as the nuclease in Cas-Analyzer. The default parameters of Cas-Analyzer were used for both, Cas9 and miniature Cas molecules, but with a minor modification to change the minimum frequency to one (1). For CRISPResso2, a default Cas9 setting was used to detect Cas9-induced indels. Substitutions were ignored in order to only detect and quantify indels. However, for detecting indels induced by miniature Cas molecules, a custom protocol from a studydescribed elsewhere (Gong et al., Plant Cell Rep. 43:71, 2024) was used. In this protocol,the center of quantification window was set as 0 nucleotides from the 3 end of the targetsequence, and the quantification window was set to 10 nucleotides with a window size of 30 nucleotides. The reads were mapped to the reference and analyzed for edits with an average read quality of Phred33 scale >20 and single bp quality >10. TABLE 3: List of primersPrimer name Nucleotide sequence 5 to 3 SEQID9012 Attorney Docket No.09531-0544WO1 2023-287 BC(-)3For AGGCGCGCCGGTACCGATTTATGGACATAATTCATATAC 193BC(-)3Rev GCTGCAGGTGTATATTTATGATATCAATAAA 1945678901234567890 1 2 3 4 5 6 7 Attorney Docket No.09531-0544WO1 2023-287 AGACCACTGGTGCTTTGTTGCACCGACTCGGTGC CACTTTTTCA GGGTACCAACAAAGCACCAGTGGTCTAGTGGTA 8 9 0 1 2 3 4 5 6 7 8 9 0 12 Attorney Docket No.09531-0544WO1 2023-287 CGATTCCCGGCTGGTGCAGTCGGAACGCTCAAC GATTGCCCCTCACGAGGGGAC AGGCGCGCCTGCACCAGCCGGGAATCGAACCCG 3 4567890123456789012345678901234567890 Attorney Docket No.09531-0544WO1 2023-287 RESULTS WDIV and AYLCB promoters have a typical genomic organization A 455 nt long region (FIG.31A) upstream to the C1 gene on the complementary strand of AYLCB (GenBank accession number MN240347) was selected as a candidate promoter. Analysis of the sequence using the Plant Cis-Acting Regulatory Element(PlantCARE) database (Lescot et al., supra) showed the presence of regulatory elementssuch as a TATA-box, CAAT-box, G-box, AE-box, TCA-element, and TC-rich repeats(FIG. 31A) as reported elsewhere (Zhang et al., supra; Shukla et al., supra). The longintergenic region (LIR) of WDIV (GenBank accession number MN240329) was also selected as a candidate promoter (FIG.31B). Analysis of the LIR sequence using the PlantCARE database showed the presence of regulatory elements such as a TATA-box, CAAT-box, GATA-motif, AAAG-motif, and G-box (FIG.31B) as reported elsewhere(Xie et al., supra; Khan et al., supra; Alok et al., supra).WDIV has a strong bidirectional promoter Transgenic tobacco plants were generated using four different constructs containing an AYLCB C1 promoter (AYLCB-C1), a WDIV virion promoter (WDIV-VF), a WDIV complementary promoter (WDIV-CF), and a CaMV35s promoter to drive expression of GUS (FIG.24A). T0 tobacco plants were harvested and analyzed for expression potential using GUS staining and real-time PCR analysis. GUS staining of the transgenic tobacco plants expressing GUS under the control of WDIV-CF showed the strongest GUS staining, followed by CaMV35s and WDIV-VF (FIGS.24D-24F). AYLCB-C1 had the lowest level of GUS staining (FIG.24C). qRT- PCR analysis from transgenic T0 tobacco leaves showed differential expression of GUS (FIG.24G). The transgenic T0 tobacco plants expressing GUS under the control of WDIV-CF showed the highest expression level (FIG.24G). Transcript levels of GUS under the control of AYLCB-C1 were the lowest out of all constructs tested (FIG.24G). Further, analysis of the accumulation of hpt transcripts indicated fairly equal copy numbers of integrated T-DNA in T0 tobacco plants (FIG.24G). Attorney Docket No.09531-0544WO1 2023-287 AYLCB based vector is an efficient delivery and expression vector The delivery and expression efficiency of the AYLCB-based vectors was tested by cloning AmCyan under the control of the AYLCB-C1 (AN), CaMV35s (35AN), WDIV- VF (VFAN), and WDIV-CF (CFAN) promoters (FIG.25A). Tobacco plants inoculated with AYLCB based expression constructs and WDIV were analyzed for expression at 5 days post inoculation (DPI) in the inoculated leaves (FIGS.25B-25G) and 21 DPI in newly emerged leaves (FIGS.25H-25M). The highest AmCyan signal was observed in leaves inoculated with the CFAN construct (FIG.25D), followed by 35AN, VFAN, and AN (FIGS.25E, 25C, and 25B, respectively). The vector-only control leaf showed a very weak signal due to autofluorescence (FIG.25F). The presence of AmCyan DNA in the AmCyan expressing leaves was also confirmed by PCR amplification, while the control showed the absence of a PCR product (FIGS.25G and 25M, respectively). qRT- PCR analysis using total DNA and primers specific to AYLCB and AmCyan showed similar accumulation of AYLCB in inoculated vs. infected leaves. However, the level of AmCyan was lower in the infected leaves as compared to inoculated leaves (FIG.25N). qRT-PCR based expression analysis using cDNA as template and AmCyan specific primers revealed lower accumulation of AmCyan in systemically infected leaves as compared to inoculated leaves (FIG.2O). The expression of AmCyan was higher with CFAN, followed by 35AN, VFAN, and AN in both inoculated and systemically infected leaves (FIG.2O). Genome editing verification PCR products were outsourced to Genewiz (Azenta Life Sciences) for amplicon sequencing. Data were received as amplicon sequence files (fastq.gz), which were thenanalyzed using Cas-Analyzer (Park et al., supra) and CRISPResso2 (Clement et al.,supra). CRISPResso2 predicts percentage of modified reads, whereas Cas-Analyzer predicts Indel frequencies. Analysis of the two types of nucleases, Cas9 and miniature Cas proteins, was done using different programs as described above. Both Cas-Analyzer and CRISPResso2 predicted similar indel frequencies for Cas9 edited samples (FIGS. 32A-32C). However, analysis of the indels induced by the miniature Cas proteins showed higher indel frequencies using CRISPResso2 as compared to Cas-Analyzer (FIG.33A). Attorney Docket No.09531-0544WO1 2023-287 The lowest and highest indel frequencies predicted by Cas-Analyzer were 0.1 and 0.8, while the CRISPResso2 predicted 0.16 as the lowest and 1.2 as the highest for the miniature Cas nucleases (FIG.33A). Deletion lengths ranged from one nucleotide to several nucleotides (FIGS.33B-33D). The analysis outcomes using the Cas-Analyzer tool are given in more detail below for each combination. Viral vector promoter is as efficient as AtU6 promoter Cas9-expressing tobacco lines were inoculated in four combinations as shown in FIGS.34A-34B. In the first two combinations, AtU6:gRNA (FIG.34A) was delivered, and in the third and fourth combinations, spacer:gRNA:spacer was delivered (FIG.34B). Both types of gRNA cassettes were delivered using WDIV and AYLCB vectors separately. The AYLCB and WDIV vectors with spacer:gRNA:spacer constructs are referred to as NBCM spacer and WDIV spacer, and the vectors with AtU6:gRNA constructs are referred to as NBCM AtU6 and WDIV AtU6 (TABLE 4). Exemplary locations of a top leaf, a systemically infected leaf, and an inoculated leaf are shown in FIG.26A. Amplicon analysis showed that inoculated leaves had the highest indels,followed by systemically infected leaves (TABLE 4 and FIGS. 26B). Systemicallyinfected top leaves had the lowest insertion or deletion events (TABLE 4 and FIGS.26B). Deletion lengths ranged from one nucleotide to several nucleotides, and examplesof deletions are shown in FIGS. 26C-26E). The editing efficiency was similar whethergRNA expression was driven by AtU6 in the AtU6:gRNA construct, by the WDIV virion promoter in the spacer construct, or by the AYLCB C1 promoter in the NBCM spacer construct. Interestingly, the top leaves of plants systemically infected with the NBCM spacer construct (sample numbers NBSP1 and NBSP2) had 8 to 10 times higher indel frequency as compared to other combinations (TABLE 4). The most prevalent deletion in all cases was a single nucleotide deletion, followed by three nucleotide deletions (FIGS. 26C-26E). There was more than one sequence ID with the same length of deletion, butdue to their differing locations they were assigned different sequence IDs. FIGS. 26C-26E illustrate the count for each sequence ID deletion. Attorney Docket No.09531-0544WO1 2023-287 AYLCB vector can deliver Cas9 and its gRNA Further work was conducted to express Cas9 and its gRNA using the spacer (i.e., viral promoter) strategy. This was achieved using a construct containing spacer:Cas9:spacer:gRNA:spacer in an AYLCB vector under the control of the C1 promoter (FIG.27A). The AYLCB vector was inoculated with WDIV to support replication and movement. Samples were collected and tested at 12 DPI from the inoculated side and the opposite side of the leaf, and also at 15 DPI from the next leaf (FIG.27B). Samples showing the presence of viral vector and Cas9 were analyzed by amplicon sequencing. This analysis showed the highest indel frequency on the inoculated side of the leaf (FIG.27C), and the opposite side of the leaf had a lower indel frequency (FIG.27C). The next leaf had the lowest indel frequency (FIG.27C). A typical indel pattern was observed in all three sampled areas. Single nucleotide deletions were most prevalent, followed by three, six, four, seven, and nine nucleotide deletions (FIGS.27D-27F). Each type of deletion was divided into multiple sequence IDs. FIGS. 27D-27Fshow the count for only one sequence ID for each type of deletion. AYLCB vector can efficiently deliver Cas12j (Cas 1 and Cas 2) and its gRNAStudies were conducted to deliver a smaller Cas molecule and its gRNA using thespacer strategy. Two Cas12j polypeptides (Cas 1 and Cas 2) and their gRNA wereselected based on a study described elsewhere (Pausch et al., Science, 369:333-337,2020) and constructs were generated by cloning spacer:Cas :spacer:gRNA:spacer into anAYLCB vector under the control of the C1 promoter (FIG.28A). The AYLCB vectorcarrying spacer:Cas :spacer:gRNA:spacer was inoculated along with WDIV to facilitatesystemic infection. Samples were collected and tested from the other side of the leaf and also the systemically infected leaf (FIG.28B). Samples showing the presence of viralvector and Cas were analyzed by amplicon sequencing. The analysis revealed a higherindel frequency on the opposite side of the inoculated leaf as compared to thesystemically infected leaf (TABLE 4 and FIG. 28C). A typical indel pattern wasobserved in all samples. Various sizes of deletions were observed and were divided into Attorney Docket No.09531-0544WO1 2023-287multiple sequence IDs. FIGS. 28D-28E show counts for only one sequence ID for eachtype of deletions. Delivery of Cas12f (CasMINI & RiceMINI) and its gRNA To deliver Cas12f and its gRNA and test its editing efficiency, two Cas12f (CasMINIv3.1 and rice codon optimized Cas12f, referred to herein as RiceMINI) wereselected based on studies described elsewhere (Xu et al., supra; Sukegawa et al., supra).Amino acid and nucleotide sequences for CasMINIv3.1 are provided in SEQ ID NOS:182 and 183, respectively (FIGS.23C-23D). Amino acid and nucleotide sequences for RiceMINI are provided in SEQ ID NOS:541 and 542, respectively (FIG.23G). The constructs were generated by cloning spacer:CasMINI / RiceMINI:spacer: gRNA:spacer into an AYLCB vector under the control of the C1 promoter (FIG.29A). The AYLCB vector was inoculated along with an infectious WDIV clone. Samples were collected and tested from the other side of the leaf and also the systemically infected leaf (FIG.29B). Samples showing the presence of viral vector and CasMINI or RiceMINI were analyzed by amplicon sequencing. The analysis showed a higher indel frequency on the opposite side of the inoculated leaf as compared to the systemically infected leaf in the RiceMINIinoculated plants (TABLE 4 and FIG. 29C). A typical indel pattern was observed forRiceMINI and its gRNA inoculated samples. Various sizes of deletions were observedand were divided into multiple sequence IDs. FIG. 29E shows counts for only onesequence ID for each type of deletion. The plants inoculated with CasMINI had very low indel numbers and indel frequency (FIG.29C). It was observed that the opposite side of the inoculated leaf had a single nucleotide deletion in most cases, while the systemically infected leaf had, in addition, some larger deletions (FIG.29D). Complementary promoter of WDIV increased indel frequency Transgenic expression of GUS (FIGS.24A-24G) and AYLCB based expression of AmCyan (FIGS.25A-25O) indicated that the WDIV complementary promoter (WDIV-CF) is a strong promoter and could serve as a promoter for expression of miniature Cas molecules, Cas12j, and Cas12f. Based on the editing outcomes, threeAYLCB-Cas constructs (AYLCB-Cas 1, AYLCB-Cas 2, and AYLCB-RiceMINI) wereselected and WDIV-CF promoter was inserted after the C1 promoter (FIG.30A). The Attorney Docket No.09531-0544WO1 2023-287 AYLCB vectors containing the three constructs were inoculated separately along with the infectious WDIV clone. Samples were collected and tested at 12 DPI from the opposite side of the leaf and also the systemically infected leaf. Samples showing the presence of viral vector and Cas 1 or Cas 2 or RiceMINI were analyzed by amplicon sequencing.The analysis showed a higher indel frequency on the opposite side of the inoculated leaf as compared to the systemically infected leaf (FIG. 30B and TABLE 4). A typical indelpattern with various sizes of deletions was observed (FIGS.30C-30E). As for the other studies, each size of deletion was divided into multiple sequence IDs; only one sequenceID for each type of deletion is shown in FIGS. 30C-30E. The addition of WDIV-CF (astrong promoter) resulted in higher indel numbers and indel frequencies as compared to the AYLCB C1 promoter (TABLE 4). Taken together, the studies described herein successfully demonstrated tissue culture-free editing by coupling a viral promoter with a tRNA spacer, and demonstrated that an AYLCB vector was able to deliver and express both Cas and gRNA in systemically infected plant organs. This was the first study to develop a geminivirus based vector and deliver both Cas and its gRNA for gene editing in systemically infected plant organs. Since WDIV and AYLCB have a wide host range, these findings provide a new avenue for genome editing in a wide variety of plant species without the requirement for tissue culture. TABLE 4: Summary of indels (insertion and deletion) predicted by Cas-Analyzer Total Reads Experiment Construct Sample# Tissue typereads with Indel Indel% Attorney Docket No.09531-0544WO1 2023-287 NBCM993739 46243Spacer NBSP8 7 15255 3.3NBPR9 971862 474905 17504 37 Attorney Docket No.09531-0544WO1 2023-287 and gRNACM10 220268 100229 116 0.1in wild typeSystemically122244 59172t bCM11infected leaf68 0.1 C1 promoter is the AYLCB promoter, and Comp promoter is the complementary promoter from WDIV. OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.09531-0544WO1 2023-287 WHAT IS CLAIMED IS:

1. A Wheat Dwarf India Virus (WDIV) nucleic acid construct, wherein said WDIVnucleic acid construct comprises: (a) one or more nucleotide sequences that, when said nucleic acid construct is within a plant cell and said one or more nucleotide sequences are expressed, cause said WDIV and a WDIV-associated satellite nucleic acid, if said satellite nucleic acid is present, to replicate within said plant cell, and (b) one or more nucleotide sequences encoding one or more nucleic acid modifying agents, wherein said one or more nucleic acid modifying agents comprise one or more polypeptides, RNAs, or a combination thereof that, when expressed within said plant cell, edit nucleic acid of said plant cell to introduce one or more genetic or epigenetic modifications, wherein said one or more nucleotide sequence encoding one or more nucleic acid modifying agents are flanked on one or both sides by a plant tRNA sequence rather than by promoter and / or terminator sequences.

2. The WDIV nucleic acid construct of claim 1, wherein said nucleic acid constructis agro-infectious.

3. The WDIV nucleic acid construct of claim 2, wherein said agro-infectious WDIVnucleic acid construct is a vector comprising a T-DNA sequence.

4. The WDIV nucleic acid construct of any one of claims 1 to 3, wherein except forsaid one or more nucleotide sequences encoding one or more nucleic acid modifying agents, said WDIV nucleic acid construct comprises said nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:166.

5. The WDIV nucleic acid construct of any one of claims 1 to 4, wherein said one ormore nucleic acid modifying agents comprise a guide RNA (gRNA) and a Cas endonuclease.Attorney Docket No.09531-0544WO1 2023-2876. The WDIV nucleic acid construct of claim 5, wherein said Cas endonucleasecomprises an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:541.

7. The WDIV nucleic acid construct of claim 5, wherein said one or more nucleotidesequences encoding one or more nucleic acid modifying agents comprise a nucleotide sequence encoding a Cas endonuclease and a nucleotide sequence encoding a gRNA.

8. The WDIV nucleic acid construct of any one of claims 1 to 4, wherein said one ormore nucleic acid modifying agents comprise a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease.

9. The WDIV nucleic acid construct of any one of claims 1 to 8, wherein said planttRNA sequence comprises a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:

185.

10. A system comprising: (a) a WDIV nucleic acid construct comprising one or more nucleotide sequences that, when said nucleic acid construct is within a plant cell and said one or more nucleotide sequences are expressed, cause said WDIV and a WDIV-associated satellite nucleic acid to replicate within said plant cell, and (b) a WDIV-associated satellite nucleic acid construct comprising said WDIV- associated satellite nucleic acid, wherein said WDIV-associated satellite nucleic acid comprises one or more nucleotide sequences encoding one or more nucleic acid modifying agents, and wherein said one or more nucleic acid modifying agents comprise one or more polypeptides, RNAs, or a combination thereof that, when expressed within said plant cell, edit nucleic acid of said plant cell to introduce one or more genetic or epigenetic modifications.

11. The system of claim 10, wherein said WDIV nucleic acid construct is agro- infectious.Attorney Docket No.09531-0544WO1 2023-287 12. The system of claim 11, wherein said agro-infectious WDIV nucleic acid construct is a vector comprising a T-DNA sequence.

13. The system of any one of claims 10 to 12, wherein said WDIV-associated satellite nucleic acid construct is agro-infectious.

14. The system of claim 13, wherein said agro-infectious WDIV-associated satellite nucleic acid construct is a vector comprising a T-DNA sequence.

15. The system of any one of claims 10 to 14, wherein said WDIV nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

166.

16. The system of any one of claims 10 to 15, wherein except for said one or more nucleotide sequences encoding one or more nucleic acid modifying agents, said WDIV- associated satellite nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:165, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

165.

17. The system of any one of claims 10 to 16, wherein said one or more nucleic acid modifying agents comprise a gRNA and a Cas endonuclease.

18. The system of claim 17, wherein said Cas endonuclease comprises an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:

541.

19. The system of any one of claims 10 to 16, wherein said one or more nucleic acid modifying agents comprise a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease.

20. The system of any one of claims 10 to 19, wherein said one or more nucleotide sequences encoding one or more nucleic acid modifying agents are flanked on one orAttorney Docket No.09531-0544WO1 2023-287 both sides by a plant tRNA sequence rather than by promoter and / or terminator sequences.

21. The system of claim 20, wherein said plant tRNA sequence comprises a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:

185.

22. A method for targeted modification of a plant nucleic acid, said method comprising introducing, into a plant cell, an agro-infectious WDIV nucleic acid construct having the ability to infect monocotyledonous and dicotyledonous plants, wherein said agro-infectious WDIV nucleic acid construct comprises: (a) one or more nucleotide sequences that, when expressed, cause the WDIV nucleic acid construct and a WDIV-associated satellite nucleic acid, if said WDIV- associated satellite nucleic acid is present, to replicate within said plant cell, and (b) one or more nucleotide sequences encoding one or more nucleic acid modifying agents, wherein said one or more nucleic acid modifying agents comprise one or more polypeptides, RNAs, or a combination thereof that, when expressed within said plant cell, edit nucleic acid of said plant cell to introduce one or more genetic or epigenetic modifications, wherein said one or more nucleotide sequence encoding one or more nucleic acid modifying agents are flanked on one or both sides by a plant tRNA sequence rather than by promoter and / or terminator sequences.

23. The method of claim 22, wherein said agro-infectious WDIV nucleic acid construct is a vector comprising a T-DNA sequence.

24. The method of claim 22 or claim 23, wherein except for said one or more nucleotide sequences encoding said one or more nucleic acid modifying agents, said agro-infectious WDIV comprises the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

166.

25. The method of any one of claims 22 to 24, wherein said one or more nucleic acid modifying agents comprise a Cas endonuclease and a gRNA targeted to a selectedAttorney Docket No.09531-0544WO1 2023-287 nucleotide sequence of said plant, and wherein, when said gRNA and said Cas endonuclease are expressed, said gRNA targets said Cas endonuclease to said selected sequence such that said Cas endonuclease introduces said one or more genetic or epigenetic modifications.

26. The method of claim 25, wherein said nucleotide sequence encoding said Cas endonuclease comprises a sequence having at least 95% identity to the sequence set forth in SEQ ID NO:168, SEQ ID NO:183, SEQ ID NO:181, SEQ ID NO:538, SEQ ID NO:540, SEQ ID NO:542, or SEQ ID NO:

543.

27. The method of any one of claims 22 to 24, wherein said one or more nucleic acid modifying agents comprise a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease.

28. The method of any one of claims 22 to 27, wherein said plant tRNA sequence comprises a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:

185.

29. A method for targeted modification of a plant nucleic acid, said method comprising introducing, into a plant cell: (a) an agro-infectious WDIV nucleic acid construct having the ability to infect monocotyledonous and dicotyledonous plants, wherein said agro-infectious WDIV nucleic acid construct comprises one or more nucleotide sequences that, when expressed, cause said WDIV nucleic acid contruct and a WDIV-associated satellite nucleic acid to replicate within said plant cell, and (b) an agro-infectious satellite nucleic acid construct comprising said WDIV- associated satellite nucleic acid, wherein said WDIV-associated satellite nucleic acid comprises one or more nucleotide sequences encoding one or more nucleic acid modifying agents, and wherein said one or more nucleic acid modifying agents comprise one or more polypeptides,Attorney Docket No.09531-0544WO1 2023-287 RNAs, or a combination thereof that, when expressed within said plant cell, edit nucleic acid of said plant cell to introduce one or more genetic or epigenetic modifications.

30. The method of claim 29, wherein said agro-infectious WDIV nucleic acid construct and said agro-infectious satellite nucleic acid constructs are vectors comprising T-DNA sequences.

31. The method of claim 29 or claim 30, wherein said agro-infectious WDIV nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO:166, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

166.

32. The method of any one of claims 29 to 31, wherein except for said one or more nucleotide sequences encoding one or more nucleic acid modifying agents, said WDIV- associated satellite nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:165, or a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:

165.

33. The method of any one of claims 29 to 32, wherein said one or more nucleic acid modifying agents comprise a gRNA and a Cas endonuclease, and wherein, when said gRNA and said Cas endonuclease are expressed, said gRNA targets said Cas endonuclease to said selected sequence such that said Cas endonuclease introduces said one or more genetic or epigenetic modifications.

34. The method of claim 33, wherein said Cas endonuclease comprises an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:184, SEQ ID NO:182, SEQ ID NO:180, SEQ ID NO:537, SEQ ID NO:539, or SEQ ID NO:

541.

35. The method of any one of claims 29 to 32, wherein said one or more nucleic acid modifying agents comprise a transcription activator-like effector endonuclease, a zinc finger nuclease, or a meganuclease.Attorney Docket No.09531-0544WO1 2023-287 36. The method of any one of claims 29 to 35, wherein said one or more nucleotide sequence encoding one or more nucleic acid modifying agents are flanked on one or both side by a plant tRNA sequence rather than by promoter and / or terminator sequences.

37. The method of claim 36, wherein said plant tRNA sequence comprises a nucleotide sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:185.

Images