Isolated polypeptide, preparation method, and use

By developing DNA polymerases with specific amino acid sequences, the problem of insufficient adaptability of existing enzymes in different environments is solved, and efficient end modification and diversified application of PCR products is achieved.

WO2025137876A1PCT designated stage expired Publication Date: 2025-07-03SHENZHEN HUADA GENE INST
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2023/142067
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-12-26
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing DNA terminal A enzymes such as Taq DNA polymerase or Klenow exo(3'-5'exo-) are poorly adaptable in different experimental scenarios and environments, and it is difficult to meet the diverse PCR product modification needs.

Method used

An isolated polypeptide has been developed, with DNA polymerase that has homology to a specific amino acid sequence, with 5'-3' polymerization activity, 5'-3' exoactivity and terminal A-tail activity, suitable for PCR amplification and PCR product modification, and high purity separation by purifying the tag sequence.

Benefits of technology

It provides better adaptability under different experimental conditions, can efficiently modify the end of PCR products, and supports applications such as PCR amplification, TA cloning and sequencing library construction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2023142067_03072025_PF_FP_ABST
    Figure CN2023142067_03072025_PF_FP_ABST
Patent Text Reader

Abstract

Provided in the present application are an isolated polypeptide, a preparation method, and a use. The polypeptide has an amino acid sequence which is at least 91% homologous or 92% homologous or 93% homologous or 94% homologous or 95% homologous or 96% homologous or 97% homologous or 98% homologous or 99% homologous to SEQ ID NO: 1.
Need to check novelty before this filing date? Find Prior Art

Description

Isolated polypeptide, preparation method and application Technical Field

[0001] The present application relates to the field of biotechnology, and in particular, to isolated polypeptides, preparation methods and applications thereof. Background Art

[0002] In molecular biology, PCR (polymerase chain reaction) technology is a key experimental tool, commonly used for DNA amplification and cloning. The success of PCR is closely related to the DNA polymerase used, which is divided into different families based on their polymerization and exotomy activities. Among them, family A and family B DNA polymerases have attracted much attention due to their unique properties.

[0003] Family A DNA polymerases originate from eubacteria, such as Taq (Thermus aquaticus), Tth (Thermus thermophilus), Tca (Thermus caldophilus), and Tfl (Thermus flavus) from Thermus genus, and Bst (Bacillus stearothermophilus) from Bacillus. These polymerases primarily exhibit 5'-3' polymerization and 5'-3' exo-cleavage activities.

[0004] Family B DNA polymerases, on the other hand, originate from archaea. Examples include Tli (Thermococcus litoralis) from the genus Thermococcus, Pfu (Pyrococcus furiosus) and KOD (Thermococcus kodacaraensis) from the genus Pyrococcus, as well as Pwo (Pyrococcus woesei), Tgo (Thermococcus gorgonarius), and Pab (Pyrococcus abyssi). These polymerases possess not only 5'-3' polymerization activity but also exhibit unique 3'-5' exonucleolytic activity, earning them the designation of high-fidelity polymerases. This exonucleolytic activity confers proofreading functionality to B family DNA polymerases, enabling them to maintain high-fidelity PCR amplification.

[0005] In PCR experiments, DNA fragments often need to be tailed to their 3' ends for downstream applications (e.g., TA cloning). Currently, the selection of enzymes for DNA end-addition is relatively limited.

[0006] Therefore, there is a need in the art to find an enzyme with greater adaptability for adding A to DNA ends.

[0007] Summary of the Invention

[0008] This application is completed by the inventor based on the discovery of the following problems and facts:

[0009] Currently, DNA end addition is primarily performed using Taq DNA polymerase or Klenow exo (3'-5'exo-). However, these enzymes have poor adaptability in different experimental scenarios and environments.

[0010] The present application aims to at least partially address at least one of the technical problems existing in the prior art. To this end, the inventors aim to discover new enzymes for DNA end-addition, so as to facilitate the end-modification of PCR products under different conditions, providing more options for a wide range of application scenarios.

[0011] In view of this, in one aspect of the present application, the present application proposes an isolated polypeptide. According to an embodiment of the present application, the polypeptide has an amino acid sequence that is at least 91% homologous, or 92% homologous, or 93% homologous, or 94% homologous, or 95% homologous, or 96% homologous, or 97% homologous, or 98% homologous, or 99% homologous to SEQ ID NO: 1. According to an embodiment of the present application, the polypeptide has stable physicochemical properties, can be applied to PCR amplification and PCR product modification (such as adding A at the end), and has better adaptability to different experimental environments.

[0012] In some examples of the present application, polypeptide sequences with higher homology are preferably selected.

[0013] According to an embodiment of the present application, the isolated polypeptide may further include at least one of the following technical features:

[0014] According to an embodiment of the present application, the polypeptide has the amino acid sequence shown in SEQ ID NO: 1.

[0015] According to an embodiment of the present application, the polypeptide further comprises a purification tag sequence, which is used for affinity chromatography purification to obtain a high-purity polypeptide.

[0016] According to an embodiment of the present application, the polypeptide is a DNA polymerase, and the DNA polymerase has 5'-3' polymerization activity, 5'-3' exo-cleavage activity and terminal A-tailing activity.

[0017] In a second aspect of the present application, the present application provides a nucleic acid molecule. According to embodiments of the present application, the nucleic acid molecule encodes the isolated polypeptide described in the first aspect of the present application. According to embodiments of the present application, the isolated polypeptide encoded by the nucleic acid molecule can be obtained by culture in vivo or in vitro.

[0018] According to an embodiment of the present application, the nucleic acid molecule may further include at least one of the following technical features:

[0019] According to an embodiment of the present application, the nucleic acid molecule has a nucleotide sequence that is at least 73% identical, or 74% identical, or 75% identical, or 76% identical, or 77% identical, or 78% identical, or 79% identical, or 80% identical, or 81% identical, or 82% identical, or 83% identical, or 84% identical, or 85% identical, or 86% identical, or 87% identical, or 88% identical, or 89% identical, or 90% identical, or 91% identical, or 92% identical, or 93% identical, or 94% identical, or 95% identical, or 96% identical, or 97% identical, or 98% identical, or 99% identical to SEQ ID NO: 2.

[0020] In some examples of the present application, nucleic acid sequences with higher identity are preferentially selected.

[0021] According to an embodiment of the present application, the nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO: 2.

[0022] In the third aspect of the present application, the present application provides an expression vector. According to an embodiment of the present application, the expression vector comprises the nucleic acid molecule described in the second aspect of the present application.

[0023] In some examples of the present application, the expression vector may further include a promoter, which is operably linked to the nucleic acid molecule.

[0024] According to an embodiment of the present application, the above-mentioned expression vector may further include at least one of the following technical features:

[0025] According to an embodiment of the present application, the expression vector is a non-pathogenic viral vector.

[0026] According to an embodiment of the present application, the non-pathogenic viral vector includes an adenoviral vector or a retroviral vector.

[0027] In a fourth aspect of the present application, a recombinant cell is provided. According to embodiments of the present application, the recombinant cell expresses the isolated polypeptide described in the first aspect of the present application or carries the nucleic acid molecule described in the second aspect or the expression vector described in the third aspect. According to embodiments of the present application, the recombinant cell is used to express or secrete the isolated polypeptide described in the first aspect of the present application.

[0028] According to an embodiment of the present application, the above-mentioned recombinant cell may further include at least one of the following technical features:

[0029] According to an embodiment of the present application, the recombinant cell is selected from Escherichia coli, yeast or mammalian cells.

[0030] In a fifth aspect of the present application, a recombinant strain is provided. According to embodiments of the present application, the recombinant strain expresses the isolated polypeptide described in the first aspect of the present application or the expression vector described in the third aspect. By culturing the recombinant strain, the polypeptide can be rapidly obtained in large quantities.

[0031] In a sixth aspect, the present application provides a method for obtaining an isolated polypeptide. According to embodiments of the present application, the method comprises culturing the recombinant cell described in the fourth aspect or the recombinant strain described in the fifth aspect under conditions suitable for protein expression, thereby obtaining the isolated polypeptide. This method can be used to rapidly obtain large quantities of polypeptides in a short period of time.

[0032] In the seventh aspect of the present application, the present application proposes the use of the polypeptide described in the first aspect, the polypeptide encoded by the nucleic acid molecule described in the second aspect, the polypeptide expressed by the expression vector described in the third aspect, the polypeptide expressed by the recombinant cell described in the fourth aspect, the polypeptide expressed by the recombinant bacteria described in the fifth aspect, or the polypeptide obtained according to the method described in the sixth aspect as a DNA polymerase, wherein the DNA polymerase has 5'-3' polymerization activity, 5'-3' exo-cleavage activity, and terminal A-tailing activity. According to an embodiment of the present application, the polypeptide can be used as a DNA polymerase for PCR amplification and adds deoxyadenylic acid (A) to the 3' end of the PCR amplification product.

[0033] In the present application, the 5'-3' polymerization activity refers to the activity of the DNA polymerase in synthesizing a new DNA chain, which adds new nucleotide units one by one from the 5' end to the 3' end according to the nucleotide sequence on the template chain.

[0034] In the present application, the 5'-3' exolytic activity refers to the activity of DNA polymerase to hydrolyze downstream nucleic acid fragments along the direction from the 5' end to the 3' end.

[0035] In this application, terminal A-tailing activity refers to the ability of a DNA polymerase to add (append) one or more deoxyadenylic acids (dATP) to the 3' end of a double-stranded DNA molecule. During the A-tailing process, the DNA polymerase adds one or more deoxyadenylic acids to the 3' end of a double-stranded DNA fragment, forming an A-tail. This A-tailed DNA fragment can be conveniently ligated to a vector with a T-tail, forming a stable connection.

[0036] In an eighth aspect of the present application, a method for adding an A-tail to the end of double-stranded DNA is provided. According to an embodiment of the present application, the method comprises: subjecting the double-stranded DNA to a terminal A-tailing reaction in the presence of the polypeptide described in the first aspect of the present application, thereby obtaining a terminal A-tailed product.

[0037] According to an embodiment of the present application, the 3' end of the A-tailed product contains a protruding deoxyadenylic acid. Adding A-tails to the DNA terminals facilitates subsequent ligation reactions.

[0038] In a ninth aspect of the present application, the present application provides a polymerase chain reaction method. According to embodiments of the present application, the method comprises: subjecting the DNA to be amplified to polymerase chain reaction (PCR) in the presence of the polypeptide described in the first aspect of the present application. According to embodiments of the present application, the polypeptide can be used for PCR amplification and sequencing library construction.

[0039] In the tenth aspect of the present application, a kit is provided. According to embodiments of the present application, the kit includes: the polypeptide described in the first aspect of the present application, the polypeptide encoded by the nucleic acid molecule described in the second aspect, the polypeptide expressed by the expression vector described in the third aspect, the polypeptide expressed by the recombinant cell described in the fourth aspect, the polypeptide expressed by the recombinant bacteria described in the fifth aspect, or a polypeptide obtained according to the method described in the sixth aspect. According to embodiments of the present application, the kit can be used for A-tailing reaction, PCR amplification, TA cloning, and sequencing library construction.

[0040] According to an embodiment of the present application, the above-mentioned kit may further include at least one of the following technical features:

[0041] According to an embodiment of the present application, the kit further comprises a DNA polymerase buffer. The kit may also comprise instructions, double-distilled water, etc.

[0042] According to an embodiment of the present application, the DNA polymerase buffer comprises 8-15 mM Tris-HCl, 80-120 mM K + , 0.5-1.5mM DTT, 0.05-0.15mM EDTA, 40-60% glycerol. In some examples of the present application, the Tris-HCl concentration is optionally 8mM, 9mM, 10mM, 11mM, 12mM, 13mM, 14mM or 15mM; the K +The concentration is optionally 90mM, 100mM, 110mM or 120mM; the DTT concentration is optionally 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM, 1.0mM, 1.1mM, 1.2mM, 1.3mM, 1.4mM or 1.5mM; the EDTA concentration is optionally 0.05mM, 0.1mM or 0.15mM; the glycerol is optionally 40%, 50% or 60%.

[0043] In the eleventh aspect of the present application, the present application proposes the use of the polypeptide described in the first aspect, the nucleic acid molecule described in the second aspect, the expression vector described in the third aspect, the recombinant cell described in the fourth aspect or the recombinant strain described in the fifth aspect in the preparation of products related to terminal A-tailing, TA cloning, polymerase chain reaction or sequencing library construction.

[0044] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0046] FIG1 is a schematic diagram of the SDS-PAGE electrophoresis results of the DNA polymerase fusion protein according to one embodiment of the present application;

[0047] FIG2 is a schematic diagram of the polymerization activity detection principle according to one embodiment of the present application;

[0048] FIG3 is a schematic diagram of the exo-activity detection principle according to one embodiment of the present application;

[0049] FIG4 is a schematic diagram of the fluorescent signal detection results of the 5'-3' exo-activation of DNA polymerase according to one embodiment of the present application;

[0050] FIG5 is a schematic diagram of the principle of 3'-5' exo-activation detection according to one embodiment of the present application;

[0051] FIG6 is a schematic diagram of the fluorescent signal detection results of the 3'-5' exo-activation of DNA polymerase according to one embodiment of the present application;

[0052] Figure 7 is a schematic diagram of the test results of DNA blunt-end A-tailing described in one embodiment of the present application; wherein, NC is a blank control group in which water is used instead of A pol_30 polymerase reaction, and Klenow (exo-) is a positive control group in which commercial Klenow fragment (exo-) is used instead of A pol_30 polymerase reaction. DETAILED DESCRIPTION

[0053] The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0054] In this application, unless otherwise specified, the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly indicate the number of the technical features indicated. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include at least one of the features. In the description of the present invention, "plurality" means at least two, for example, two, three, etc., unless otherwise specified.

[0055] Throughout this application, unless otherwise indicated, the term "nucleotide" encompasses both nucleotides and nucleosides. Nucleosides, like nucleotides, contain a purine or pyrimidine base linked to a ribose or deoxyribose glycoside, but lack a phosphate residue. Synthetic and / or naturally occurring nucleotides, prior to modification of the 3' sugar hydroxyl group, are included within the definition.

[0056] In this application, unless otherwise specified, the term "reference genome" refers to the genome sequence of the species corresponding to a known sample, which can be a genome sequence obtained through public channels or obtained through sequencing assembly. It can be the entire sequence of the genome or a partial sequence of interest in the genome. For example, when analyzing human samples, multiple versions of the human genome sequence provided by public databases, such as hg19, can be used.

[0057] The inventors of this application used sequence mining to discover a novel polypeptide from metagenomic sequencing data derived from deep-sea hydrothermal sediment samples. Experimental testing revealed that the polypeptide possesses the typical activities of A family DNA polymerases, including 5'-3' polymerization, 5'-3' exoclease, and terminal A-tailing. Therefore, the polypeptide was named A pol_30, and is sometimes referred to herein as A pol_30 DNA polymerase.

[0058] In one aspect of the present application, the present application provides an isolated polypeptide having an amino acid sequence that is at least 91% homologous, or 92% homologous, or 93% homologous, or 94% homologous, or 95% homologous, or 96% homologous, or 97% homologous, or 98% homologous, or 99% homologous to SEQ ID NO: 1. According to some preferred embodiments of the present application, the polypeptide has the amino acid sequence shown in SEQ ID NO: 1.

[0059] According to the embodiments of the present application, "homology" refers to the similar or identical chemical properties of amino acids at corresponding positions in two or more protein sequences. In protein sequence comparison, homology indicates the presence of identical or similar amino acid residues at specific positions in two proteins.

[0060] In some examples of the present application, the polypeptide also has a purification tag sequence. The purification tag sequence is a tag sequence used when the polypeptide (protein) is purified by affinity chromatography. It is usually divided into large tags and small tags. Large tags are usually tens of KD, such as GST, MBP, etc.; small tags are mostly composed of 6-10 amino acids, such as His (6-10), Strep (II), FLAG, etc. On the premise that it does not substantially affect the spatial structure of the protein, the purification tag sequence can be added to the N-terminus of the polypeptide or to the C-terminus of the polypeptide. Those skilled in the art can select a suitable purification tag sequence as needed to obtain a high-purity polypeptide.

[0061] In some examples of the present application, the polypeptide is a DNA polymerase, and the DNA polymerase has 5'-3' polymerization activity, 5'-3' exo-cutting activity and terminal A-tailing activity. The inventors of the present application have experimentally tested and found that the polypeptide has the conventional activities of DNA polymerases of the A family, such as 5'-3' polymerization activity, 5'-3' exo-cutting activity and terminal A-tailing activity. The polypeptide can be used as a DNA polymerase for A-tailing reaction, PCR amplification, TA cloning and sequencing library construction. In another aspect of the present application, the present application proposes a nucleic acid molecule encoding the above-mentioned isolated polypeptide.

[0062] It should be noted that, for nucleic acid molecules mentioned in the specification and claims of this application, those skilled in the art will understand that they actually include either or both of the complementary double strands. For convenience, although only one strand is provided in most cases in this specification and claims, the other complementary strand is actually also disclosed. In addition, the nucleic acid sequences in this application include either DNA or RNA forms, and disclosure of one implies disclosure of the other.

[0063] In some examples of the present application, the nucleic acid molecule has a nucleotide sequence that is at least 73% identical or 74% identical or 75% identical or 76% identical or 77% identical or 78% identical or 79% identical or 80% identical or 81% identical or 82% identical or 83% identical or 84% identical or 85% identical or 86% identical or 87% identical or 88% identical or 89% identical or 90% identical or 91% identical or 92% identical or 93% identical or 94% identical or 95% identical or 96% identical or 97% identical or 98% identical or 99% identical to SEQ ID NO: 2. In some preferred examples of the present application, the nucleic acid molecule has an amino acid sequence as shown in SEQ ID NO: 2.

[0064] In some examples of the present application, the nucleic acid sequence can be obtained by performing metagenomic sequencing data analysis on deep-sea hydrothermal sediment samples.

[0065] According to the examples of this application, "identity" refers to the presence of identical base sequences at corresponding positions of two or more nucleic acid sequences (adenine, guanine, cytosine, or guanine). Nucleotide identity is typically expressed as a percentage, representing the percentage of identical nucleotides present.

[0066] In another aspect of the present application, the present application proposes an expression vector comprising the aforementioned nucleic acid molecule. The type of expression vector herein is not particularly limited, as long as it can replicate and express the corresponding mutant in a host cell. The expression vector may include optional control sequences that are operably linked to the nucleic acid molecule. The control sequences are one or more control sequences that can direct the expression of the nucleic acid molecule in a host. The expression vectors proposed in some specific embodiments of the present application can efficiently express proteins in suitable host cells, and the obtained proteins have the function of an A family DNA polymerase.

[0067] In another aspect of the present application, the present application provides a recombinant cell carrying the aforementioned nucleic acid molecule, expression vector, or expressing the aforementioned isolated polypeptide. The recombinant cell is obtained by transfecting or transforming the expression vector. According to some specific embodiments of the present application, the recombinant cell can efficiently express the above-mentioned isolated polypeptide under appropriate conditions, and the polypeptide can be directly used for A-tailing reaction, PCR amplification, TA cloning, and sequencing library construction.

[0068] In some examples of the present application, the type of recombinant cells is not particularly limited, and can be, for example, Escherichia coli cells.

[0069] It should be noted that the "suitable conditions" referred to in this specification refer to conditions suitable for the expression of the isolated polypeptide described herein. It will be readily understood by those skilled in the art that conditions suitable for the expression of the isolated polypeptide include, but are not limited to, suitable transformation or transfection methods, suitable transformation or transfection conditions, healthy host cell status, suitable host cell density, suitable cell culture environment, and suitable cell culture time. "Suitable conditions" are not particularly limited, and those skilled in the art can optimize the most suitable conditions for the expression of the isolated polypeptide based on the specific environment of the laboratory.

[0070] In another aspect of the present application, the aforementioned polypeptide is used as a DNA polymerase to perform an A-tailing reaction on the ends of double-stranded DNA fragments, typically at the 3' end. After the reaction, the A-tailed product obtained contains one or more overhanging deoxyadenylic acids at the 3' end. This polypeptide exhibits performance similar to that of wild-type DNA polymerase and exhibits no apparent preference for bases at the ends of DNA fragments.

[0071] In another aspect of the present application, the aforementioned polypeptide is used as a DNA polymerase to perform a polymerase chain reaction. The reaction comprises: subjecting the DNA to be amplified to a polymerase chain reaction (PCR) in the presence of the polypeptide described in the first aspect of the present application. It will be understood by those skilled in the art that the PCR amplification reaction should be performed under conditions suitable for the DNA polymerase, such as a suitable metal ion concentration (such as Mg 2+). 2+ , K + The PCR amplification reaction system also includes primers that bind to the template strand during DNA replication and deoxynucleoside triphosphate substrates (dNTP mix) added to the nascent strand.

[0072] In another aspect of the present application, the present application proposes a kit comprising: the aforementioned polypeptide of the present application, the polypeptide encoded by the aforementioned nucleic acid molecule, the polypeptide expressed by the aforementioned expression vector, the polypeptide expressed by the aforementioned recombinant cell, the polypeptide expressed by the aforementioned recombinant bacterium, or the polypeptide obtained according to the aforementioned method. In some examples of the present application, the kit can be used for A-tailing reaction, PCR amplification, TA cloning, and sequencing library construction, etc. Those skilled in the art will understand that in some cases, the aforementioned kit may further include a DNA polymerase buffer to provide a reaction environment suitable for the reaction. In other cases, the aforementioned kit may further include instructions, double distilled water, etc. to facilitate operation by those skilled in the art.

[0073] The present invention will be described below with reference to examples. It should be noted that these examples are merely illustrative and do not limit the present invention in any way. Where specific techniques or conditions are not specified in the examples, they are performed according to the techniques or conditions described in the literature in this area or according to the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0074] It should be noted that in this application, the isolated polypeptide can be used as a DNA polymerase. For ease of comparison, the following examples will use DNA polymerase instead. The A pol_30 DNA polymerase described in the following examples has the amino acid sequence shown in SEQ ID NO: 1.

[0075] Example 1: Sequence identity comparison

[0076] In this example, the DNA polymerase in this application (SEQ ID NO: 1, A pol_30) was aligned with the commercial Taq polymerase (SEQ ID NO: 3) and Klenow fragment DNA polymerase (SEQ ID NO: 4, Klenow (exo-)) using the Clustal Omega online sequence alignment website. The results showed that the sequence identities of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 4 were respectively.

[0077] Among them, the amino acid sequences of commercial Taq polymerase and Klenow fragment DNA polymerase are shown below 47.18%, 41.99%;

[0078] Example 2: Recombinant plasmid construction, expression and purification

[0079] First, a DNA polymerase with the amino acid sequence shown in SEQ ID NO: 1 was synthesized (Beijing Liuhe BGI Genomics Co., Ltd.). The gene was then cloned into the pET28A expression vector with the Nde I and Xho I cloning sites. The resulting recombinant plasmid was transformed into competent Escherichia coli BL21(DE3) cells and incubated overnight at 37°C for expression and purification. Protein purification was performed using a HisTrap FF×5mL affinity chromatography column.

[0080] The specific purification steps are as follows:

[0081] 1. Cultivation and induction

[0082] A single colony with good growth was selected from the plate and inoculated into a conical flask containing 50 mL of kanamycin-resistant LB liquid medium. The culture was carried out at 37°C for 5-7 hours until the OD 600 Then, transfer the above bacterial solution into 2L kanamycin-resistant LB medium with 1% inoculum and culture at 37℃ for 2-4 hours until OD reaches 0.6-4.0. 600 During this time, cool the shaker to 16°C. Add IPTG to the culture medium to a final concentration of 0.5 mM. Then, induce expression for 12-16 hours in a shaker at 220 rpm and 16°C.

[0083] 2. Bacteria collection and crushing

[0084] The cells were collected by centrifugation at 8000 g for 30 minutes. The cells were then suspended in Ni column affinity solution A at a ratio of 1:20 and disrupted by ultrasonication in an ice bath.

[0085] 3. Sample loading and elution

[0086] The sonicated solution was centrifuged at 12,000 rpm for 60 minutes at 4°C. The supernatant was filtered through a 0.22 μM filter to obtain the sample on the purification column. The sample was loaded at a rate of 3 mL / min and then rinsed with Ni-column affinity solution A for 20 column volumes. Next, linear elution was performed using Ni-column affinity solution B. The target protein was collected when the UV absorbance peak reached 50 mAu and stopped when the UV absorbance peak dropped to 100 mAu.

[0087] 4. Dialysis and storage

[0088] The purified protein samples were dialyzed, the concentration was measured, and they were stored in stock solution for subsequent functional activity analysis.

[0089] In the above purification process, the buffer components used are as follows:

[0090] Ni column-A buffer (Ni column affinity A solution): 20 mM Tris-HCl, 300 mM NaCl, 20 mM imidazole, 5% glycerol, pH 8.5;

[0091] Ni column-B buffer (Ni column affinity B solution): 20 mM Tris-HCl, 300 mM NaCl, 500 mM imidazole, 5% glycerol, pH 8.5;

[0092] Storage solution: 10 mM Tris-HCl, 100 mM KCl, 1 mM DTT, 0.1 mM EDTA, 50% glycerol, pH 8.0 @ 25°C.

[0093] 5. Purification results

[0094] The protein sample (A pol_30 polymerase) obtained in step 4 was subjected to SDS-PAGE electrophoresis detection, and the results are shown in Figure 1.

[0095] Example 3: Polymerization activity assay

[0096] The polymerization activity of A pol_30 polymerase was measured using a primed M13 ssDNA substrate. The specific principle is shown in Figure 2. In the presence of polymerization activity, the primer on the primed M13 ssDNA will extend along the ssDNA (single-stranded DNA) in the 5'-3' direction to produce dsDNA (double-stranded DNA), which can be quantitatively detected using the Qubit dsDNA HS Assay Kits (Manufacturer: Thermo Fisher; Catalog Number: Q32854).

[0097] The primed M13 ssDNA substrate was prepared as follows: the M13 used was M13mp18 single-stranded DNA (brand: NEB, cat. no.: N4040S), and the corresponding M13 annealing primer sequences are shown in Table 1. The single-stranded M13 and the seven primers shown were annealed by gradient cooling to obtain the primed M13 ssDNA substrate.

[0098] Table 1

[0099] The reaction system and components are shown in Table 2.

[0100] Table 2

[0101] The reaction solution was reacted at 37°C, 55°C, and 72°C for 5 min (Table 3), and then 1 μL of 0.5 M EDTA was added to terminate the reaction. The dsDNA concentration was determined using a Qubit kit.

[0102] Table 3

[0103] The results showed that A pol_30 DNA polymerase had significant polymerization activity at both 37℃ and 55℃, and both could synthesize dsDNA.

[0104] Example 4: Exo-activity assay (5'-3' exo-activity)

[0105] To detect the exo-activation of A pol_30 polymerase, this example uses the Taqman probe method. When the 5'-3' exo-activation occurs, the downstream probe chain is degraded by transferring the activity through the nick (the principle is shown in Figure 3). A microplate reader is used to detect the generated fluorescent signal, and the 5'-3' exo-activation is measured based on the change in the signal. The fluorescent probe sequence is as follows:

[0106] 5'-Dabcyl-GCATCTGCTCGAGTCACGCGCTATGGCGATGCTTGATAGTGATGCTGTGTACAGAAAG (SEQ ID NO: 12);

[0107] CCATAGCGCGTGACTCGAGCAGATGC-FAM-3' (SEQ ID NO: 13);

[0108] CTTTCTGTACACAGCATCACTATCAAGCATCG(SEQ ID NO:14);

[0109] The three single-stranded DNA fragments were mixed in equal proportions and reacted at 90°C for 2 minutes. The power was then turned off and the temperature was allowed to cool naturally. The reaction system is shown in Table 4.

[0110] Table 4

[0111] Detection and fluorescence signal collection were performed using a microplate reader, with excitation at 492 nm and emission at 520 nm. Specifically, the reaction was allowed to proceed at 37°C for 1 hour, with fluorescence signals collected every minute. The results, shown in Figure 4, demonstrate that poly-30 polymerase A exhibits 5'-3' exo-cleavage activity.

[0112] Example 5: Exo-activity assay (3'-5' exo-activity)

[0113] In this example, the exo-activation assay of A pol_30 polymerase was performed using a terminal mismatched substrate probe method (the principle is shown in FIG5 ).

[0114] The fluorescent probe sequences used are:

[0115] A primer with a quencher group at the 3' end: ATCAGCAGGCCACACGTTAAACTGT 3'-BHQ2 (SEQ ID NO: 15); and a primer with a fluorescent group at the 5' end: TAGTCGTCCGGTGTGCAATTTCTGT 5'-Rox (SEQ ID NO: 16);

[0116] After annealing, the complementary pairs form a double-stranded substrate with four mismatches at the ends.

[0117] The reaction system for detecting 3'-5' exo-cleavage activity is as follows, wherein the blank control is a reaction system without enzyme. The reaction is carried out at 30°C for 1 hour, and the fluorescence signal (FAM fluorescence, excitation peak at 492 nm, emission peak at 520 nm) is collected every 30 seconds. The reaction system is shown in Table 5.

[0118] Table 5

[0119] The detection results are shown in FIG6 . A pol_30 polymerase did not generate obvious fluorescent signals, indicating that the enzyme did not have 3'-5' exo-cleavage activity.

[0120] Example 6: DNA blunt end plus A tail test

[0121] In this example, the functional activity of A pol-30 polymerase in DNA blunt-end A addition was evaluated by detecting changes in band position before and after A addition to DNA fragments using denaturing gel electrophoresis. Two fluorescent probes (sequences shown in Table 6, with fluorescent labels at the 5' end) were designed. When A addition activity was activated, the length of each probe was increased by one nucleotide (nt). The A-tailing activity was measured by the size of the Urea-PAGE band.

[0122] Table 6

[0123] Annealing of the fluorescent probe substrate: Incubate at 90°C for 2 minutes, then turn off the power and allow the reaction to cool naturally. The reaction system is shown in Table 7. A blank control (NC) without enzyme and a positive control with Klenow (exo-) DNA polymerase (NEB, Cat. No. M0212V) were also included.

[0124] Table 7

[0125] The reaction was allowed to proceed at 37°C for 30 min. After the reaction was completed, the mixture was immediately placed on ice and 1 μL of 0.5 M EDTA solution was added to terminate the reaction.

[0126] The preparation method of 20% denaturing gel is shown in Table 8.

[0127] Table 8

[0128] The preparation method of 2X Gel loading solution is shown in Table 9.

[0129] Table 9

[0130] 4 μL of reaction solution was mixed with an equal volume of Gel loading, heated at 80°C for 5 min, and immediately placed on ice for sample loading.

[0131] During electrophoresis, use 1X TBE Buffer as the buffer; preheat the denaturing gel at 180V, 100mA for 30 minutes; blow away the urea in the gel holes with a syringe before loading the sample. Run the gel at 180V, 100mA for about 2 hours, and terminate the electrophoresis when the bromphenol blue indicator is about 2 cm from the bottom of the gel.

[0132] The results are shown in FIG7 , showing that both A pol_30 and Klenow (exo-) of the A family DNA polymerase have A-tailing activity.

[0133] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0134] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. An isolated polypeptide, characterized in that, The polypeptide has an amino acid sequence with at least 91% homology or 92% homology or 93% homology or 94% homology or 95% homology or 96% homology or 97% homology or 98% homology or 99% homology to SEQ ID NO:

1.

2. The isolated polypeptide according to claim 1, wherein, The polypeptide has the amino acid sequence shown in SEQ ID NO:

1.

3. The isolated polypeptide according to claim 2, wherein, The polypeptide further has a purification tag sequence.

4. The isolated polypeptide according to any one of claims 1 to 3, characterized in that, The polypeptide is a DNA polymerase, and the DNA polymerase has 5'-3' polymerase activity, 5'-3' exonuclease activity, and terminal A-tailing activity.

5. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the isolated polypeptide according to any one of claims 1 to 4.

6. The nucleic acid molecule according to claim 5, wherein The nucleic acid molecule has a nucleotide sequence with at least 73% identity or 74% identity or 75% identity or 76% identity or 77% identity or 78% identity or 79% identity or 80% identity or 81% identity or 82% identity or 83% identity or 84% identity or 85% identity or 86% identity or 87% identity or 88% identity or 89% identity or 90% identity or 91% identity or 92% identity or 93% identity or 94% identity or 95% identity or 96% identity or 97% identity or 98% identity or 99% identity to SEQ ID NO:

2.

7. The nucleic acid molecule according to claim 5, wherein, The nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO:

2.

8. An expression vector, characterized in that, Comprises the nucleic acid molecule according to any one of claims 5 to 7.

9. The expression vector according to claim 8, wherein The expression vector is a non-pathogenic viral vector.

10. The expression vector according to claim 9, characterized in that, The non-pathogenic viral vector includes an adenovirus vector or a retrovirus vector.

11. A recombinant cell, characterized in that, Expresses the isolated polypeptide according to any one of claims 1 to 4, or carries the nucleic acid molecule according to any one of claims 5 to 7, or the expression vector according to any one of claims 8 to 10.

12. The recombinant cell according to claim 11, wherein The recombinant cell is selected from Escherichia coli, yeast, or mammalian cells.

13. A recombinant strain, characterized in that, Expresses the isolated polypeptide according to any one of claims 1 to 4, or carries the nucleic acid molecule according to any one of claims 5 to 7, or the expression vector according to any one of claims 8 to 10.

14. A method for obtaining an isolated polypeptide, characterized in that, Comprises: Culturing the recombinant cell according to claim 11 or 12 or the recombinant strain according to claim 13 under conditions suitable for protein expression to obtain the isolated polypeptide.

15. Use of the polypeptide according to any one of claims 1 to 4, the polypeptide encoded by the nucleic acid molecule according to any one of claims 5 to 7, the polypeptide expressed by the expression vector according to any one of claims 8 to 10, the polypeptide expressed by the recombinant cell according to claim 11 or 12, the polypeptide expressed by the recombinant bacterial cell according to claim 13, or the polypeptide obtained by the method according to claim 14 as a DNA polymerase, wherein the DNA polymerase has 5'-3' polymerase activity, 5'-3' exonuclease activity, and terminal A-tailing activity.

16. A method for adding an A tail to the ends of double-stranded DNA, characterized in that, Comprises: Performing a terminal A-tailing reaction on double-stranded DNA in the presence of the polypeptide according to any one of claims 1 to 4 to obtain a terminal A-tailed product.

17. The method according to claim 16, wherein The 3' end of the terminal A-tailed product contains a protruding deoxyadenylic acid.

18. A polymerase chain reaction method, characterized in that, The DNA to be amplified is subjected to polymerase chain reaction under the condition that the polypeptide described in any one of claims 1 to 4 exists.

19. A kit, characterized in that, Including: The polypeptide described in any one of claims 1 to 4, the polypeptide encoded by the nucleic acid molecule described in any one of claims 5 to 7, the polypeptide expressed by the expression vector described in any one of claims 8 to 10, the polypeptide expressed by the recombinant cell described in claim 11 or 12, the polypeptide expressed by the recombinant bacterial cell described in claim 13, or the polypeptide obtained by the method according to claim 14.

20. The kit according to claim 19, wherein It further includes a DNA polymerase buffer.

21. The kit according to claim 20, wherein The DNA polymerase buffer comprises 8 - 15 mM Tris-HCl, 80 - 120 mM K + , 0.5 - 1.5 mM DTT, 0.05 - 0.15 mM EDTA, and 40 - 60% glycerol.

22. Use of the polypeptide described in any one of claims 1 to 4, the nucleic acid molecule described in any one of claims 5 to 7, the expression vector described in any one of claims 8 to 10, the recombinant cell described in claim 11 or 12, or the recombinant strain described in claim 13 in the preparation of products related to A-tailing, TA cloning, polymerase chain reaction, or sequencing library construction.

Citation Information

Patent Citations

  • High fidelity DNA polymerase and preparation and application thereof

    CN104250641A

  • DNA polymerase and application thereof, recombinant vector and preparation method and application thereof, and recombinant engineering bacteria and application thereof

    CN112899255A

  • Chimeric DNA polymerase and application thereof

    CN114829593A