Modified aminoacyl-trna synthetase, nucleic acid construct and genetically engineered strain

By designing tags and enzyme cleavage sites in the MaPylRS genome and integrating them into the Kluvier genome with CRISPR/Cas9, the problems of low efficiency of non-natural amino acid introduction and complexity of exogenous addition are solved, and efficient and stable non-natural amino acid introduction and target protein production are achieved.

WO2025140227A1PCT designated stage expired Publication Date: 2025-07-03KANGMA (SHANGHAI) BIOTECH LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/142051
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-25
Filing Date
2024-12-25
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

In the existing cell-free in vitro protein translation system, the introduction efficiency of non-natural amino acids is low, and traditional methods require the exogenous addition of aminoacyl-tRNA synthetase, resulting in increased experimental results complexity and cost.

Method used

By designing histidine tags and thrombin cleavage sites at the N-terminal and C-terminal of the MaPylRS gene, and integrating the MaPylRS gene into the Kluvier genome using the CRISPR/Cas9 system, stable and efficient expression is achieved, simplifying the experimental steps and improving the catalytic activity of the enzyme and the introduction efficiency of non-natural amino acids.

Benefits of technology

The stable and efficient expression of MaPylRS in Kluvieria simplifies the preparation steps, reduces costs, and significantly improves the introduction efficiency of non-natural amino acids and the production stability of the target protein.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024142051_03072025_PF_FP_ABST
    Figure CN2024142051_03072025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a modified aminoacyl-tRNA synthetase, a nucleic acid construct and a genetically engineered strain. The provided recombinant aminoacyl-tRNA synthetase can significantly improve the introduction efficiency of non-natural amino acids in IVTT regardless of exogenous addition or integration into cells.
Need to check novelty before this filing date? Find Prior Art

Description

A modified aminoacyl-tRNA synthetase, nucleic acid construct and genetically engineered strain Technical Field The present invention relates to the field of biotechnology, and preferably to an aminoacyl-tRNA synthetase and a nucleic acid construct thereof, a genetically engineered strain, and applications thereof in the cell-free synthesis of non-natural amino acid proteins. Background Art Whether studying protein structure and function or producing antibody-drug conjugates, the need to introduce new functional groups into protein polypeptide chains is increasing. This can be achieved by utilizing orthogonal protein translation systems, incorporating unnatural amino acids with specialized chemical functional groups into peptide chains according to pre-defined genetic codes. While unnatural amino acid incorporation can be achieved intracellularly, competition with classical protein translation systems and the inability of unnatural amino acids to freely cross cell membranes due to their chemically active side chains often prevent them from freely crossing cell membranes. Therefore, cell-free in vitro protein translation systems offer irreplaceable advantages for the large-scale production of proteins containing unnatural amino acids. Because cell-free in vitro protein translation systems are free from the constraints of cell membranes, it is theoretically possible to boost the reaction by increasing the concentrations of the main components in the reaction system. Unnatural amino acids are transported to the ribosome by aminoacyl-tRNAs, which are formed by specific aminoacyl-tRNA synthetases. These aminoacyl-tRNAs pair with codons and are then assembled into peptide chains under the ribosome's catalysis. However, unnatural aminoacyl-tRNAs have weaker binding to transport proteins and a poorer fit with the ribosome than canonical aminoacyl-tRNAs, hindering the reaction's progress. This requires increasing the substrate concentration to promote the reaction. The orthogonal aminoacyl-tRNA synthetases used to introduce unnatural amino acids are typically derived by mutating the substrate binding site of natural aminoacyl-tRNA synthetases. This change in substrate specificity often comes at the cost of decreased catalytic activity. To compensate for this decreased activity, high concentrations of enzyme, tRNA, or unnatural amino acid are used to shift the reaction in a direction favorable for peptide chain synthesis. Commonly used orthogonal translation system pylrs-tRNA CUA pyl PylRS (MmPylRS, MbPylRS) from the archaea Methanosarcina mazei and Methanosarcina barkeri. Due to its special structure, pylrs recognize tRNA independently of the anticodon loop and have substrate recognition plasticity. Through directed evolution, pylrs–tRNA CUA pyl The introduction of more than 200 unnatural amino acids has been achieved. However, both MmPylRS and MbPylRS possess a low-solubility N-terminal domain, resulting in poor solubility. Even after codon optimization, the expression levels of MmPylRS and MbPylRS in E. coli are difficult to increase, and protein concentrations after enrichment still fail to exceed 8 mg / ml. This system fails to fully exploit the advantages of cell-free in vitro protein translation, and the incorporation efficiency of unnatural amino acids is extremely low, making it unsuitable for practical production applications. Methanomethylophilus alvus PylRS (PylRS) is an aminoacyl-tRNA synthetase. This synthetase belongs to the nucleotide class and its full name is pyrrolysyl-tRNA synthetase, commonly referred to as PylRS. The main function of PylRS is to help prokaryotes synthesize a special amino acid, pyrrolysine (Pyl), which is not found in any known eukaryotes. [1] . Methanomethylophilus alvus is a methanogenic archaeon originally isolated from the stomach of bovine ruminants. PylRS, discovered through sequence analysis of the M. alvus genome, can be used to engineer foreign proteins and express novel biological activities, thus possessing significant application value in synthetic biology. Recently, Chin et al. discovered a pylrs (MaPylRS) from Methanomethylophilus alvus, which has similar catalytic domains and tRNA-binding domains to MmPylRS, MbPylRS, and mapylrs, but lacks the N-terminal domain. In current scientific research, MaPylRS is mainly used to modify exogenous proteins in prokaryotes such as Escherichia coli. [2] , and has also been successfully applied in eukaryotes [3] According to the latest research results, MaPylRS in Saccharomyces cerevisiae [4] When expressed in E. coli, the target non-natural amino acid can be efficiently inserted into the target protein. However, whether in E. coli or yeast, MaPylRS exists in the cell as an exogenous plasmid, and there is no eukaryotic cell system that can directly recombinantly express MaPylRS stably and efficiently. [5] . Protein Expression Systems in vitro refers to protein synthesis under non-in vivo conditions such as cell lysates. It is only necessary to add DNA or RNA templates, RNA polymerase and necessary amino acids, ATP, and auxiliary factors to the reaction system to complete the synthesis of the target protein. Since the complex metabolic steps of the entire cell are not required, the system can achieve rapid and efficient large-scale protein production. Due to its high flexibility and simplified process, it has become one of the widely used tools in the biomedical field and scientific research. [6] Currently, commercial in vitro protein expression systems that are frequently used include the E. coli extract (ECE) system. [7] , Rabbit reticulocyte Lysate (RRL) [8] , Wheat germ extract (WGE) [9] 、Insects (Insect cell extract, ICE)

[0010] and human-derived systems

[0011] . Because it lacks the low-solubility N-terminal domain, mapylrs is easier to express in E. coli, and the final expression product can be concentrated to 40 mg / ml without precipitation. It is suitable for cell-free unnatural amino acid delivery systems. CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated) is an immune system widely found in bacteria and archaea. As part of the organism's defense mechanism, it can identify and eliminate foreign DNA or RNA that invades host cells and has been developed into an efficient and accurate gene editing tool.

[0012] The technique can precisely cut DNA, allowing researchers to increase or decrease specific parts of genes to study their function and potentially treat certain genetic diseases.

[0013] . When using the CRISPR / Cas9 system for gene editing, a specific gRNA sequence needs to be paired with the Cas9 nuclease protein and delivered to the target cell. When the gRNA binds to Cas9, it will be carried to the target genome. During the formation of the double-stranded DNA cut, the gRNA regulates the Cas9 enzyme to find the PAM sequence (ie "protospacer adjacent motif") on the genome and recognize the sequence 20bp upstream of it. The Cas9 enzyme then produces a double-stranded cut 3 bases upstream of the PAM. At the same time, if donor DNA is provided, the broken DNA chains can be connected through the mechanism of homologous recombination (HDR), thereby achieving the purpose of genetic modification.

[0014] There are many examples of using the CRISPR / Cas9 system to modify the genome of S. cerevisiae, including gene point mutation, gene knockout and gene insertion. [15,16] For example, the pCAS plasmid widely used in the prior art has both the Cas9 gene sequence and the gRNA element.

[0017] , enabling genome modification of Saccharomyces cerevisiae through a single transformation. Kluyveromyces is a yeast fungus belonging to the genus Saccharomyces cerevisiae. It has extensive industrial applications, particularly in the food and beverage industry. Kluyveromyces is widely used in the fermentation of foods and beverages such as dairy products, wine, and beer. It can break down sugars and produce a variety of enzymes, facilitating the fermentation process and imparting a pleasant taste and flavor to foods. Compared to other brewer's yeasts, Kluyveromyces possesses unique properties, such as high temperature adaptability and acid tolerance. This makes it more suitable for certain industrial applications under specific conditions, such as high-temperature fermentation and acidic environments. Furthermore, Kluyveromyces offers many advantages as a host system for expressing pharmaceutical proteins. First, through the design of appropriate gene expression vectors and promoter sequences, Kluyveromyces can achieve high-level expression of exogenous genes. Second, Kluyveromyces possesses a comprehensive protein folding and modification system, enabling the correct folding of complex pharmaceutical proteins and the necessary glycosylation modifications. Third, Kluyveromyces is easy to culture and can be expressed intracellularly in a soluble form, facilitating the extraction and purification of target proteins and reducing the cost of engineered production. Overall, Kluyveromyces is a host system with great potential for efficient expression of pharmaceutical proteins. References 1.Yanagisawa T,Seki E,Tanabe H,Fujii Y,Sakamoto K,Yokoyama S.Crystal Structure of Pyrrolysyl-tRNA Synthetase from a Methanogenic Archaeon ISO4-G1 and Its Structure-Based Engineering for Highly-Productive Cell-Free Genetic Code Expansion with Non-Canonical Amino Acids.Int J Mol Sci.2023Mar 26;24(7):6256.doi:10.3390 / ijms24076256.PMID:37047230;PMCID:PMC10094482. 2.Kobayashi T,Yanagisawa T,Sakamoto K,Yokoyama S.Recognition of non-alpha-amino substrates by pyrrolysyl-tRNA synthetase.J Mol Biol.2009Feb 6;385(5):1352-60.doi:10.1016 / j.jmb.2008.11.059.Epub 2008Dec 11.PMID:19100747. 3.Beránek V,Willis JCW,Chin JW.An Evolved Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetase / tRNA Pair Is Highly Active and Orthogonal in Mammalian Cells.Biochemistry.2019 Feb 5;58(5):387-390.doi:10.1021 / acs.biochem.8b00808.Epub 2018 Sep 27.PMID:30260626;PMCID:PMC6365905. 4.Stieglitz JT,Lahiri P,Stout MI,Van Deventer JA.Exploration of Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetase Activity in Yeast.ACS Synth Biol.2022 May 20;11(5):1824-1834.doi:10.1021 / acssynbio.2c00001.Epub 2022 Apr 13.PMID:35417129;PMCID:PMC10112046. 5.Avila-Crump S,Hemshorn ML,Jones CM,Mbengi L,Meyer K,Griffis JA,Jana S,Petrina GE,Pagar VV,Karplus PA,Petersson EJ,Perona JJ,Mehl RA,Cooley RB.Generating Efficient Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetases for Structurally Diverse Non-Canonical Amino Acids.ACS Chem Biol.2022 Dec 16;17(12):3458-3469.doi:10.1021 / acschembio.2c00639.Epub 2022 Nov 16.PMID:36383641;PMCID:PMC9833845. 6.Craig D,Howell MT,Gibbs CL,Hunt T,Jackson RJ.Plasmid cDNA-directed protein synthesis in a coupled eukaryotic in vitro transcription-translation system.Nucleic Acids Res.1992 Oct 11;20(19):4987-95.doi:10.1093 / nar / 20.19.4987.PMID:1383935;PMCID:PMC334274. 7.Kim DM,Kigawa T,Choi CY,Yokoyama S.A highly efficient cell-free protein synthesis system from Escherichia coli.Eur J Biochem.1996 Aug 1;239(3):881-6.doi:10.1111 / j.1432-1033.1996.0881u.x.PMID:8774739. 8.Jackson RJ,Hunt T.Preparation and use of nuclease-treated rabbit reticulocyte lysates for the translation of eukaryotic messenger RNA.Methods Enzymol.1983;96:50-74.doi:10.1016 / s0076-6879(83)96008-1.PMID:6656641. 9.Erickson AH,Blobel G.Cell-free translation of messenger RNA in a wheat germ system.Methods Enzymol.1983;96:38-50.doi:10.1016 / s0076-6879(83)96007-x.PMID:6656637. 10.Ezure T,Suzuki T,Higashide S,Shintani E,Endo K,Kobayashi S,Shikata M,Ito M,Tanimizu K,Nishimura O.Cell-free protein synthesis system prepared from insect cells by freeze-thawing.Biotechnol Prog.2006 Nov-Dec;22(6):1570-7.doi:10.1021 / bp060110v.PMID:17137303. 11.Mikami S,Kobayashi T,Masutani M,Yokoyama S,Imataka H.A human cell-derived in vitro coupled transcription / translation system optimized for production of recombinant proteins.Protein Expr Purif.2008Dec;62(2):190-8.doi:10.1016 / j.pep.2008.09.002.Epub 2008Sep 11.PMID:18814849. 12.Sander JD,Joung JK.CRISPR-Cas systems for editing,regulating and targeting genomes.Nat Biotechnol.2014Apr;32(4):347-55.doi:10.1038 / nbt.2842.Epub 2014Mar 2.PMID:24584096;PMCID:PMC4022601. 13.Jinek M,Chylinski K,Fonfara I,Hauer M,Doudna JA,Charpentier E.A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.Science.2012Aug 17;337(6096):816-21.doi:10.1126 / science.1225829.Epub 2012Jun 28.PMID:22745249;PMCID:PMC6286148. 14.Bibikova M,Carroll D,Segal DJ,Trautman JK,Smith J,Kim YG,Chandrasegaran S.Stimulation of homologous recombination through targeted cleavage by chimeric nucleases.Mol Cell Biol.2001Jan;21(1):289-97.doi:10.1128 / MCB.21.1.289-297.2001.PMID:11113203;PMCID:PMC88802. 15.DiCarlo JE,Norville JE,Mali P,Rios X,Aach J,Church GM.Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.Nucleic Acids Res.2013Apr;41(7):4336-43.doi:10.1093 / nar / gkt135.Epub 2013Mar 4.PMID:23460208;PMCID:PMC3627607. 16.Bao Z,Xiao H,Liang J,Zhang L,Xiong X,Sun N,Si T,Zhao H.Homology-integrated CRISPR-Cas(HI-CRISPR)system for one-step multigene disruption in Saccharomyces cerevisiae.ACS Synth Biol.2015May 15;4(5):585-94.doi:10.1021 / sb500255k.Epub 2014Sep 19.PMID:25207793. 17.Ryan OW,Skerker JM,Maurer MJ,Li X,Tsai JC,Poddar S,Lee ME,DeLoache W,Dueber JE,Arkin AP,Cate JH.Selection of chromosomal DNA libraries using a multiplex CRISPR system.Elife.2014Aug 19;3:e03703.doi:10.7554 / eLife.03703.PMID:25139909; PMCID:PMC4161972. Summary of the Invention To overcome the shortcomings of the prior art, the present invention incorporates a histidine tag at the N-terminus and C-terminus of the MaPylRS gene, along with a thrombin cleavage site to facilitate tag removal. The results show that adding these sequences to the N-terminus or C-terminus not only improves enzyme stability and facilitates purification, but also further enhances the enzyme's catalytic activity. In addition, existing literature reports and commercial kits all involve manually adding the MaPylRS protein exogenously or introducing a plasmid containing its expression construct through transformation / transfection. This has adverse effects on the interpretation of experimental results, the complexity and stability of experimental results, and the production cost of the target protein. The present invention integrates the MaPylRS gene into the Kluyveromyces genome through the efficient CRISPR / Cas9 gene editing system, achieving stable and efficient expression of the MaPylRS gene in yeast without the need for antibiotic screening and maintenance, and on this basis, achieving the insertion of unnatural amino acids into the target protein. The first invention of the present invention provides a recombinant aminoacyl-tRNA synthetase having the structure described in Formula I: A1-A2-A3-A4(I): In Formula I, A1 is absent or a histidine tag; A2 is absent or is a thrombin cleavage site; A3 is absent or a tagged protein; A4 is an aminoacyl-tRNA synthetase; "-" is independently a bond or an amino acid linking sequence, And at least one of A1~A3 exists, The connection between A1 to A4 can be from the N-terminus to the C-terminus or from the C-terminus to the N-terminus. Further preferably, the aminoacyl-tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS) or TrP-tRNA synthetase (TrpRS). Further preferably, the aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS or BsTrpRS. Further preferably, the aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS. Further preferably, the sequence of the aminoacyl-tRNA synthetase is SEQ ID NO: 60. Further preferably, the aminoacyl-tRNA synthetase comprises the sequence shown in SEQ ID NO: 60 or an active fragment thereof, or is a polypeptide having ≥85% homology (preferably ≥90% homology; more preferably ≥95% homology; most preferably ≥97% homology, such as 98% or more, 99% or more) with the amino acid sequence shown in SEQ ID NO: 60 and having the same activity as the sequence of SEQ ID NO: 60. More preferably, the structure of the histidine tag is n×His, wherein 1≦n≦50; preferably 2≦n≦30; further preferably, 5≦n≦20; more preferably, 6≦n≦10. Further preferably, the tag protein is selected from T7 tag, CBP tag, CMyc tag, FLAG tag, Spot tag, C tag, Avi tag, Streg tag, SUMO tag, GST tag, MBP tag or a combination thereof; preferably T7 tag. Further preferably, the N-terminus or C-terminus of A4 is connected to A1-A2-A3: More preferably, a his tag is linked to the N-terminus or C-terminus of the aminoacyl-tRNA synthetase. More preferably, a thrombin cleavage site and a tag protein are linked to the N-terminus of the aminoacyl-tRNA synthetase in order from the N-terminus to the C-terminus. More preferably, a his tag, a thrombin cleavage site, and a tag protein are connected to the N-terminus of the aminoacyl-tRNA synthetase in order from the N-terminus to the C-terminus. Further preferably, the amino acid sequence of the recombinant aminoacyl-tRNA synthetase is selected from any one or more of the following: SEQ ID NO: 1 to SEQ ID NO: 3 or SEQ ID NO: 64. Further preferably, the recombinant aminoacyl-tRNA synthetase comprises the sequence of any one of SEQ ID NOs: 1 to 3, SEQ ID NO: 64, or an active fragment thereof, or is a polypeptide having ≥85% homology (preferably, ≥90% homology; more preferably ≥95% homology; most preferably, ≥97% homology, such as 98% or more, 99% or more) with the amino acid sequence of any one of SEQ ID NOs: 1 to 3, SEQ ID NO: 64, and having the same activity as any one of the sequences described in SEQ ID NOs: 1 to 3, SEQ ID NO: 64. Further preferably, the coding sequence of the recombinant aminoacyl-tRNA synthetase is selected from any one or more of the following: SEQ ID NO: 4, SEQ ID NO: 61, SEQ ID NO: 62 or SEQ ID NO: 63. Further preferably, the coding sequence of the recombinant aminoacyl-tRNA synthetase comprises any one of SEQ ID NO: 4, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63 or an active fragment thereof, or each of which has ≥85% homology (preferably ≥90% homology; preferably ≥95% homology; most preferably ≥97% homology, such as 98% or more, 99% or more) with the nucleotide sequence shown above and each has the same activity as any one of SEQ ID NO: 4, SEQ ID NO: 61, SEQ ID NO: 62 or SEQ ID NO: 63. The second aspect of the present invention provides a nucleic acid construct encoding the recombinant aminoacyl-tRNA synthetase described in the first aspect of the present invention. Further preferably, the nucleic acid construct contains at least a nucleic acid sequence as described in Formula II: Z1-Z2-Z3-Z4, wherein Z1 to Z4 are respectively elements used to constitute the construct; "-" is independently a bond or a nucleotide linker sequence; Z1 is absent or is a coding sequence for a histidine tag, Z2 is absent or is a coding sequence for a thrombin cleavage site, Z3 is absent or is a coding sequence for a tag protein, and Z4 is a coding sequence for an aminoacyl-tRNA synthetase; wherein at least one of Z1 to Z3 is present. The structure of formula II can be from 5' to 3' or from 3' to 5': That is, the encoding product of Z1-Z2-Z3 is connected to the N-terminus or C-terminus of the encoding product of Z4. More preferably, the encoding product of Z1-Z2-Z3 is connected to the N-terminus of the encoding product of Z4. Further preferably, the amino acid sequence encoded by Z1 is HHHHHH; more preferably, Z1 encodes a sequence comprising HHHHHH or an active fragment thereof, or a nucleotide having ≥85% homology (preferably ≥90% homology; more preferably ≥95% homology; most preferably ≥97% homology, such as 98% or more, 99% or more) with the nucleotide sequence shown above and having the same activity as the above sequence. Further preferably, the amino acid sequence encoded by Z2 is LVPRGS; more preferably, the Z2 encodes a sequence containing LVPRGS or an active fragment thereof, or a nucleotide having ≥85% homology with the nucleotide sequence shown above (preferably, ≥90% homology; more preferably ≥95% homology; most preferably, ≥97% homology, such as above 98%, above 99%) and having the same activity as the above sequence. Further preferably, the amino acid sequence encoded by Z3 is SEQ ID NO: 59; more preferably, the Z code comprises the sequence shown in SEQ ID NO: 59 or an active fragment thereof, or is a nucleotide sequence having ≥85% homology (preferably, ≥90% homology; preferably ≥95% homology; most preferably, ≥97% homology, such as 98% or more, 99% or more) with the above-mentioned nucleotide sequence and having the same activity as the above-mentioned sequence. More preferably, the nucleic acid construct further comprises a promoter. Further preferably, the nucleic acid structure comprises the structure described in Formula III: Z5-Z1-Z2-Z3-Z4. Further preferably, the promoter is selected from PGK1, GAP1, ADH1, HXK1, GAPDH1, TEF1 or TIF11. The third aspect of the present invention provides a vector, wherein the vector contains the nucleic acid construct provided by the second aspect of the present invention. The fourth aspect of the present invention provides a genetically engineered strain, wherein the nucleic acid construct according to the second aspect of the present invention is integrated into one or more sites of the genome of the genetically engineered strain. Further preferably, the site is selected from Lys1-5, glpA or UPF1. More preferably, the nucleic acid construct further comprises a promoter and a terminator. Further preferably, the promoter is selected from PGK1, GAP1, ADH1, HXK1, GAPDH1, TEF1, TIF11, GAL1, GAL7 or GAL10. Further preferably, the terminator is selected from CYC1, GPM1, TDH2 or ACT1. Further preferably, the genetically engineered strain contains the recombinant aminoacyl-tRNA synthetase provided by the first aspect of the present invention. Further preferably, the genetically engineered strain contains the vector provided in the third aspect of the present invention. Further preferably, the strain is derived from one of mammalian cells, plant cells, yeast cells, insect cells, prokaryotic cells or any combination thereof. The fifth aspect of the present invention provides a method for synthesizing proteins incorporating non-natural amino acids, using the recombinant aminoacyl-tRNA synthetase described in the first aspect of the present invention, or using the genetically engineered strain described in the fourth aspect of the present invention to provide the recombinant aminoacyl-tRNA synthetase. In a sixth aspect, the present invention provides a cell-free system for synthesizing proteins containing unnatural amino acids, characterized in that the cell-free system comprises at least: (a) a cell extract, and (b) one or more of the recombinant aminoacyl-tRNA synthetase provided by the first aspect of the present invention, the nucleic acid construct provided by the second aspect of the present invention, or the vector provided by the third aspect of the present invention; the cell extract is derived from one of mammalian cells, plant cells, yeast cells, insect cells, prokaryotic cells, or any combination thereof. The seventh aspect of the present invention provides a cell-free system for synthesizing proteins containing unnatural amino acids, characterized in that the cell-free system at least includes a cell extract, and the cell extract is derived from the genetically engineered strain provided by the fourth aspect of the present invention. Further preferably, the cell extract is selected from any one of the following sources or combinations: Escherichia coli, Kluyveromyces lactis, wheat germ cells, insect cells, rabbit reticulocytes, CHO cells, COS cells, VERO cells, BHK cells, human fibrosarcoma HT1080 cells, or a combination thereof. Further preferably, the cell extract is derived from yeast cells. Further, the yeast cell is selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugarcane molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof. Further, more preferably, the Kluyveromyces further includes: Kluyveromyces lactis (Kluyveromyces, K.lactis), Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces syringae, Kluyveromyces truncatum ... yarrowii) or one or a combination thereof; preferably, the yeast cell is a Kluyveromyces cell, more preferably a Kluyveromyces lactis cell. Further preferably, the cell-free system further comprises: a non-natural amino acid, an orthogonal tRNA and a template comprising a target protein gene sequence, wherein the codons encoding amino acids in the target protein gene sequence are mutated. More preferably, the structural formula of the non-natural amino acid is a compound of formula (2) or a salt thereof. wherein n is selected from a natural number of 1-20, R1 is selected from a substituted or unsubstituted C5-C60 aryl or heteroaryl group, a substituted or unsubstituted C1-C20 alkyl group, a substituted or unsubstituted C2-C20 alkenyl group or a substituted or unsubstituted C2-C20 alkynyl group, and A is selected from O or -CH2-. In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. In another preferred embodiment, n is a natural number selected from 1-10. In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In another preferred embodiment, n is a natural number selected from 1-6. In another preferred embodiment, n is selected from 1, 2, 3, 4, 5 or 6. In another preferred embodiment, the R1 is selected from substituted or unsubstituted C5-C30 aryl or heteroaryl. In another preferred embodiment, the R1 is selected from substituted or unsubstituted phenyl. In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C20 alkenyl. In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C10 alkenyl. In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C6 alkenyl. In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C20 alkynyl. In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C10 alkynyl. In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C6 alkynyl. In another preferred embodiment, the A is selected from O. In another preferred embodiment, the A is selected from -CH2-. In another preferred embodiment, the substituents are substituents commonly used in the art, such as aryl, heteroaryl, alkyl, cycloalkyl, aryloxy, heteroaryloxy, alkyloxy, cycloalkyloxy, hydroxyl, thiol, ester, carboxyl, cyano, halogen, nitro, sulfonic acid, azide, alkenyl, alkynyl, phosphate, etc. In another preferred embodiment, the structural formula of the non-natural amino acid is selected from one or a combination of the following, or a salt form thereof: Further preferably, the target protein is selected from the group consisting of: luciferin, luciferase (such as firefly luciferase), fluorescent protein (such as green fluorescent protein, yellow fluorescent protein), aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of an antibody, luciferase mutation, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, cytokine, interferon α2b, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase, or a combination thereof. Further preferably, the target protein includes a wild-type protein, a mutant protein or a recombinant protein. The eighth aspect of the present invention provides a method for preparing the genetically engineered strain described in the fourth aspect of the present invention, characterized in that the nucleic acid construct described in the second aspect of the present invention is transferred or integrated into a cell through transformation, transfection or gene editing technology. Further preferably, the nucleic acid construct described in the second aspect of the present invention is integrated into the genome of the cell by gene editing technology. Further preferably, the nucleic acid construct is integrated into the genome of the cell through the active site. More preferably, the nucleic acid construct further comprises a promoter and a terminator. Further preferably, the promoter is selected from PGK1, GAP1, ADH1, HXK1, GAPDH1, TEF1 or TIF11. Further preferably, the terminator is selected from CYC1, GPM1, TDH2 or ACT1. Further preferably, the site is selected from Lys1-5, glpA or UPF1. The ninth aspect of the present invention provides a kit, characterized in that the kit contains the reaction system described in the sixth aspect or the seventh aspect of the present invention. The tenth aspect of the present invention provides a method for in vitro synthesis of proteins containing non-natural amino acids, characterized in that the method is prepared using the cell-free system described in the sixth or seventh aspect of the present invention or the kit described in the ninth aspect of the present invention. The advantages of the present invention are: (1) Designing His-tag structures at the N-terminus and C-terminus of natural or modified MaPylRS synthetase further improves enzyme stability, facilitates purification, and enhances the catalytic activity of the enzyme, which is beneficial for improving the efficiency of non-natural amino acid introduction; (2) Connecting a His tag, T7 tag, and thrombin cleavage site to the N-terminus of natural or modified MaPylRS synthetase will further promote enzyme stability, make purification easier, and increase the catalytic activity of the enzyme, which is beneficial to improving the efficiency of the introduction of unnatural amino acids; (3) The N-terminal T7 tag and thrombin cleavage site of the natural or modified MaPylRS synthase will further promote the stability of the enzyme, make it easier to purify, and improve the catalytic activity of the enzyme, which is beneficial to improve the efficiency of the introduction of non-natural amino acids. (4) The present invention integrates the aforementioned designed MaPylRS recombinant expression structure into the cell genome through CRISPR / Cas9 combined with efficient transformation technology, thereby achieving the stable existence of MaPylRS in the cell genome and the continuous expression of MaPylRS protein. (5) The Kluyveromyces yeast strain with recombinant MaPylRS inserted was prepared into an in vitro expression system, which achieved the site-specific insertion of non-natural amino acids into the exogenous target protein, greatly simplified the preparation steps, saved costs, and increased the stability of the synthesized protein with non-natural amino acids inserted. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the construction diagram of long N-terminal mapylrs Figure 2 shows the construction diagram of N-his mapylrs Figure 3 shows the construction diagram of C-his mapylrs Figure 4 shows the electrophoresis of the supernatants from the lysis of three proteins after induction. Figure 1 represents long N-terminal mapylrs, 2 represents N-his mapylrs, and 3 represents C-his mapylrs. Mapylrs with longer N-termini exhibit higher expression levels and greater solubility. The highest protein concentration reached 120 mg / mL (3.4 mM). Figure 5 compares the activity of three constructed proteins expressed at the same concentrations when unnatural amino acids were introduced. All three MAPylrs catalyzed the expression of proteins containing unnatural amino acids. Inverted triangles represent the absence of unnatural amino acids, while circles represent the addition of unnatural amino acids. nhis represents N-his MAPylrs, chis represents C-his MAPylrs, and N-terminal represents long N-terminal MAPylrs. Figure 6 shows a comparison of the activities of native MAPylrs (referring to unrecombinant MAPylrs) and recombinant MAPylrs (long N-terminal MAPylrs and N-his MAPylrs) in the introduction of unnatural amino acids. In the figure, nhis represents N-his MAPylrs, and long terminal represents long N-terminal MAPylrs. The left part of each comparison bar represents the addition of unnatural amino acids, and the right part represents the addition of unnatural amino acids. Figure 7 shows the comparison of RFP / GFP between native MAPylrs and recombinant MAPylrs (long N-terminal MAPylrs and N-his MAPylrs) with the introduction of non-natural amino acids. In the figure, nhis represents N-his MAPylrs, long terminal represents long N-terminal MAPylrs, and no tag represents native MAPylrs. FIG8 shows a schematic diagram of the structure of the pKM-CAS1.0-K1Lys1-5 plasmid. FIG9 shows a schematic diagram of the structure of the pKM-MaPylRS plasmid. FIG10 shows a schematic diagram of the structure of the pKM-CAS1.0-KlglpA plasmid. FIG11 shows a schematic diagram of the structure of the pKM-CAS1.0-K1UPF1 plasmid. FIG. 12 is a graph showing the RFP activity measured in Example 9. FIG13 is a graph showing the GFP activity measured in Example 9. FIG. 14 is a graph showing the RFP / GFP activity measured in Example 9. FIG. FIG15 is a graph showing the GFP activity measured in Example 10. FIG. 16 is a graph showing the RFP activity measured in Example 10. FIG. 17 is a graph showing the RFP / GFP activity measured in Example 10. In the figures herein, the words "non" or "control" refer to reactions in which non-natural amino acids are added. DETAILED DESCRIPTION It should be noted that, unless there is any conflict, the embodiments and features in the embodiments of this application can be combined with each other. The present invention will be further described below in conjunction with the specific embodiments and examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Experimental methods in the following examples where specific conditions are not specified are preferably performed in accordance with or with reference to the conditions indicated in the specific embodiments described above, and may then be performed under conventional conditions or as recommended by the manufacturer. Unless otherwise specified, percentages and parts mentioned in the present invention are percentages and parts by weight. Unless otherwise specified, the materials and reagents used in the examples of the present invention are all commercially available products. Unless otherwise specified, the temperature units in this application are degrees Celsius (°C). Nouns and terms The following is an explanation or description of the meaning of some of the relevant "nouns" and "terms" used in the present invention, so as to better understand the present invention. The corresponding explanation or description applies to the full text of the present invention, both below and above. When the present invention involves references, the definitions of relevant terms, nouns, and phrases in the references are also quoted, but when they conflict with the definitions in the present invention, the definitions in the present invention shall prevail. When the definitions in the references conflict with the definitions in the present invention, it does not affect the cited components, substances, compositions, materials, systems, formulations, types, methods, equipment, etc., which are subject to the contents determined in the references. In the present invention, preferred embodiments such as “preferred”, “better”, “more preferred”, “better”, “most preferred”, and “further preferred” do not constitute any limitation on the scope of the invention and the scope of protection, and are not used to limit the scope and embodiments of the present invention, but are only used to provide some embodiments as examples. In the description of the present invention, preferred modes such as “one of the preferred ones”, “one of the preferred modes”, “one of the preferred embodiments”, “one of the preferred examples”, “preferred example”, “in a preferred embodiment”, “some preferred examples”, “in some preferred modes”, “preferably”, “preferably”, “preferably”, “more preferably”, “more preferably”, “further preferably”, “most preferably”, and illustrative enumeration modes such as “one of the embodiments”, “one of the modes”, “example”, “specific example”, “for example”, “as an example”, “for example”, “such as”, etc., do not constitute any limitation on the scope of the invention and the scope of protection, and the specific features described in each mode are included in at least one specific embodiment of the present invention. In the present invention, the specific features described in each mode can be combined in a suitable manner in any one or more specific embodiments. In the present invention, the technical features or technical solutions corresponding to each preferred mode can also be combined in any suitable manner. In the present invention, “any combination thereof” means “greater than 1” in terms of quantity, and means a group consisting of the following situations in terms of coverage: “any one of them, or a group consisting of at least two of them”. In the present invention, the descriptions of "one or more", "one or more" and "one or more" have the same meaning as "at least one", "at least one", "a combination thereof", "or a combination thereof", "and a combination thereof", "or any combination thereof", "and any combination thereof", etc., and can be used interchangeably to indicate that the quantity is equal to "1" or "greater than 1". In the present invention, "or / and" and "and / or" are used to represent "optionally one of them or optional combination thereof", and also represent at least one of them. The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.). Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art. The prior art means described in the present invention in terms of “usually”, “conventional”, “general”, “frequently”, “often”, etc. are also cited as references to the content of the present invention. Unless otherwise specified, they can be regarded as one of the preferred ways of some technical features of the present invention. It should be noted that they do not constitute any limitation on the scope of coverage and protection scope of the invention. All documents mentioned in the present invention and documents directly or indirectly cited by these documents are incorporated by reference in this application as if each document was individually incorporated by reference. It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (including but not limited to the embodiments) can be combined with each other to form new or preferred technical solutions, as long as they can be used to implement the present invention. Due to space limitations, they will not be listed one by one. In vitro protein synthesis reaction refers to the reaction of synthesizing protein in an in vitro cell-free synthesis system, which at least includes the translation process. It includes but is not limited to IVT reaction (in vitro translation reaction), IVTT reaction (in vitro transcription and translation reaction), and IVDTT reaction (in vitro replication transcription and translation reaction). In the present invention, IVTT reaction is preferred. IVTT reaction, corresponding to IVTT system, is the process of transcribing and translating DNA into protein (Protein) in vitro. Therefore, we also refer to this type of in vitro protein synthesis system as D2P system, D-to-P system, D_to_P system, DNA-to-Protein system; the corresponding in vitro protein synthesis method is also called D2P method, D-to-P method, D_to_P method, DNA-to-Protein method. "Cell-free system" refers to a method of in vitro protein synthesis that is not secretory expression through intact cells. It should be noted that in the in vitro cell-free protein synthesis system of the present invention, it is also allowed to add cell components to promote the reaction, but the added cells are not primarily intended to secrete and express exogenous target proteins. In addition, in the D2P system without intact cells constructed under the guidance of the present invention, a small amount of intact cells are intentionally added (for example, the protein content provided by them is not more than 30wt% compared to the protein content provided by the cell extract). Such a "circumvention" method is also included in the scope of protection of the present invention. Target protein: The target expression product of the in vitro protein synthesis system of the present invention is not synthesized by host cell secretion, but is synthesized in vitro based on an exogenous nucleic acid template, and can also be called an exogenous protein. The exogenous protein can be a protein, a fusion protein, a mixture of protein molecules or fusion protein molecules; it also broadly includes polypeptides. The product obtained after the in vitro protein synthesis reaction based on the nucleic acid template encoding the target protein can be a single substance or a combination of two or more substances. "Exogenous protein", "target protein", "target protein", "target translation product" have the same meaning and can be translated as "objective protein", "interested protein", "objective translated product", "interested protein product", etc., and can be used interchangeably in the present invention. D2P, DNA-to-Protein, refers to the process from DNA template to protein product. For example, D2P technology, D2P system, D2P method, D2P kit, etc. "The expression system of the present invention", "the in vitro expression system of the present invention", "the in vitro cell-free expression system", and "the in vitro cell-free expression system" are used interchangeably and all refer to the in vitro protein expression system of the present invention. Other descriptions may also be used, such as: in vitro protein synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), etc. According to the reaction mechanism, it may include an in vitro translation system (which may be abbreviated as an IVT system, a mR2P system), an in vitro transcription-translation system (which may be abbreviated as an IVTT system, a D2P system), an in vitro replication-transcription-translation system (which may be abbreviated as an IVDTT system, a D2P system), etc. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as a "protein synthesis factory" ("Protein Factory" or "proteinfactory" or "Proteinfactory"). The in vitro protein synthesis system provided by the present invention adopts an open description method for its components. The cell-free protein synthesis system of the present invention uses exogenous DNA, mRNA or a combination thereof as the nucleic acid template for protein synthesis, and achieves in vitro synthesis of the target protein by artificially controlling the addition of substrates and transcription- and translation-related protein factors required for protein synthesis. In the present invention, "protein" and "protein" have the same meaning and can be used interchangeably. In the present invention, “system” and “system” are both translated as system and can be used interchangeably. In the present invention, "protein synthesis amount", "protein expression amount" and "protein expression yield" have the same meaning and can be used interchangeably. In the present invention, cell extract, cell extract, cell lysate, cell disrupted product and cell lysate have the same meaning and can be used interchangeably. In English, cell extract, cell lysate and the like can be used as descriptions. In the present invention, energy system, energy system, and energy supply system have the same meaning and can be used interchangeably. Energy regeneration system and energy regeneration system have the same meaning and can be used interchangeably. The energy regeneration system is a preferred embodiment or component of the energy system. Furthermore, the present invention provides a cell-free protein synthesis system, which at least includes a cell extract or a cell lysate. Further preferably, the cell-free protein synthesis system further comprises one or more components selected from the following group: a substrate for RNA synthesis, a substrate for protein synthesis, polyethylene glycol or its analogues, magnesium ions, potassium ions, a buffer, RNA polymerase, an energy regeneration system, dithiothreitol, and an optional aqueous solvent. Further preferably, the substrate for synthesizing RNA includes: nucleoside monophosphate, nucleoside triphosphate or a combination thereof. More preferably, the substrate for synthesizing protein includes 20 natural amino acids and unnatural amino acids. Further preferably, the magnesium ions are derived from a magnesium ion source, and the magnesium ion source is selected from the following group: magnesium acetate, magnesium glutamate, or a combination thereof. Further preferably, the potassium ions are derived from a potassium ion source, and the potassium ion source is selected from the following group: potassium acetate, potassium glutamate, or a combination thereof. Further preferably, the energy regeneration system is selected from the group consisting of: a creatine phosphate / creatine phosphate enzyme system, a glycolysis pathway and an intermediate energy system thereof, or a combination thereof. Further preferably, the energy regeneration system comprises a glucose / phosphate system, and the phosphate is selected from the following group: tripotassium phosphate, triammonium phosphate, trisodium phosphate, dipotassium hydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, potassium dihydrogen phosphate, ammonium dihydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof. Further preferably, the buffer is selected from the group consisting of 4-hydroxyethylpiperazineethanesulfonic acid, tris(hydroxymethyl)aminomethane, or a combination thereof. Further preferably, the in vitro protein synthesis system contains polyethylene glycol (PEG) or an analog thereof. The concentration of the PEG or its analog is not particularly limited. Typically, the concentration (w / v) of the PEG or its analogue is 0.1-8%, preferably 0.5-4%, and more preferably 1-2%, based on the total weight of the protein synthesis system. Representative PEGs are selected from the group consisting of PEG 3000, PEG 3350, PEG 6000, and PEG 8000, or a combination thereof. Further preferably, the polyethylene glycol includes polyethylene glycol with a molecular weight (Da) of 200-10000, such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc., preferably, polyethylene glycol with a molecular weight of 3000-10000. In the present invention, the RNA polymerase is not particularly limited and can be selected from one or more RNA polymerases. A typical RNA polymerase is T7 RNA polymerase. An optional scheme is that the in vitro protein synthesis system provided by the present invention includes: cell extract, 4-hydroxyethylpiperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytosine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphate kinase, and RNA polymerase. In the present invention, the cell extract does not contain intact cells. A typical cell extract includes ribosomes, aminoacyl-tRNA synthetases, initiation factors and elongation factors required for protein synthesis, and termination and release factors. In addition, the cell extract also contains some other proteins derived from the cytoplasm of the cell, especially soluble proteins. In the present invention, the proportion of the cell extract in the in vitro cell-free protein synthesis system is not particularly limited. Usually, the cell extract accounts for 20-70% of the in vitro cell-free protein synthesis system, preferably 30-60%, and more preferably 40-50%. In the present invention, the protein content of the cell extract is 20-100 mg / mL, preferably 50-100 mg / mL. The protein content is determined by Coomassie Brilliant Blue assay. The present invention also provides a vector or vector combination containing the nucleic acid construct of the present invention. Preferably, the vector is selected from the group consisting of bacterial plasmids, bacteriophages, yeast plasmids, animal cell vectors, and shuttle vectors; the vector is a transposon vector. Methods for preparing recombinant vectors are well known to those skilled in the art. Any plasmid or vector may be used as long as it is replicable and stable in the host. Those skilled in the art can construct expression vectors containing the promoter and / or target gene sequence of the present invention using well-known methods, including in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc. Template DNA The template DNA is a nucleotide sequence encoding any target protein to be synthesized, which can be an original sequence, an artificially synthesized sequence, or an artificially modified sequence. The corresponding RNA and / or protein can be synthesized using the template DNA. In the present invention, the preparation method of the cell extract is not limited. A preferred preparation method is The following steps are involved: (i) providing cells; (ii) washing the cells to obtain washed cells; (iii) disrupting the washed cells to obtain a crude cell extract; (iv) performing solid-liquid separation on the crude cell extract to obtain a liquid portion, which is the cell extract. In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation. In a preferred embodiment, the centrifugation is performed in a liquid state. In the present invention, the centrifugation conditions are not particularly limited. A preferred centrifugation condition is 5000-100000 g, preferably 8000-30000 g. In the present invention, the centrifugation time is not particularly limited. A preferred centrifugation time is 0.5 min-2 h, preferably 20 min-50 min. In the present invention, the centrifugation temperature is not particularly limited. Preferably, the centrifugation is performed at 1-10°C, more preferably, at 2-6°C. In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to use a washing liquid at a pH of 7-8 (preferably 7.4). The washing liquid is not particularly limited. Typically, the washing liquid is selected from the following group: potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof. In the present invention, the cell disruption treatment method is not particularly limited. A preferred cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen low-temperature) disruption. The nucleoside triphosphate mixture in the in vitro cell-free protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytosine triphosphate, and uridine triphosphate. In the present invention, the concentration of each mononucleotide is not particularly limited, and the concentration of each mononucleotide is generally 0.5-5 mM, preferably 1.0-2.0 mM. The amino acid mixture in the in vitro cell-free protein synthesis system may include natural or unnatural amino acids, including D- or L-amino acids. Representative amino acids include (but are not limited to) the 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine. The concentration of each amino acid is typically 0.01-0.5 mM, preferably 0.02-0.2 mM, such as 0.05, 0.06, 0.07, or 0.08 mM. In a preferred embodiment, the in vitro cell-free protein synthesis system further comprises polyethylene glycol or its analogues. The concentration of polyethylene glycol or its analogues is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogues is 0.1-8%, preferably 0.5-4%, and more preferably 1-2%, based on the total weight of the biosynthesis system. Representative examples of PEG include (but are not limited to): PEG3000, PEG8000, PEG6000, and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of various other molecular weights (e.g., PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.). In a preferred embodiment, the in vitro cell-free protein synthesis system further contains sucrose. The concentration of sucrose is not particularly limited. Generally, the concentration of sucrose is 0.03-40 wt %, preferably 0.08-10 wt %, and more preferably 0.1-5 wt %, based on the total weight of the protein synthesis system. A particularly preferred in vitro cell-free protein synthesis system contains the following components in addition to yeast cell extract: 22 mM 4-hydroxyethylpiperazineethanesulfonic acid at pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM creatine phosphate, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphokinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, and 0.027-0.054 mg / mL T7 RNA polymerase. The present invention will be further described below with reference to specific examples, which should be understood to be merely illustrative of the present invention. The present invention is not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, generally follow conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The present invention uses Kluyveromyces lactis (abbreviated as K. lactis or KL) as an example, but the same design, analysis, and experimental methods are also applicable to other eukaryotic cells such as yeast and animal cells, as well as prokaryotic cells. This invention uses Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis, and experimental methods are applicable to other lower eukaryotic cells, such as yeast, as well as higher animal cells. The genetic modification method used in this invention is CRISPR-Cas9 technology, but is not limited to this technique and can be any known, existing genetic modification method. An in vitro protein synthesis reaction mixture system, also described as an in vitro protein synthesis reaction mixture, a reaction mixture system, or a reaction mixture, refers to a mixed system comprising an in vitro protein synthesis system and a nucleic acid template encoding a target protein; it may be homogeneous or heterogeneous, and may be a liquid system such as a solution, an emulsion, or a suspension. Protein of the present invention The final concentrations of the components in the Factory are as follows: 80% (v / v) Kluyveromyces lactis extract, 15 mM glucose, 320 mM maltodextrin (measured as glucose monomers), 24 mM tripotassium phosphate, 1.8 mM nucleoside triphosphate mixture (a mixture of adenosine triphosphate, guanosine triphosphate, cytosine triphosphate, and uridine triphosphate, with a final concentration of each nucleoside triphosphate of 1.8 mM), 0.7 mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine, with a final concentration of each amino acid of 0.7 mM), magnesium L-aspartate, 80 mM potassium acetate, 2% (w / v) polyethylene glycol 8000, 9.78 mM NaCl, pH 8.0 Tris·HCl buffer, 6% (w / v) trehalose. The preparation process of Kluyveromyces lactis cell extract adopts conventional technical means, and is prepared by referring to the method described in CN109593656A. In summary, the preparation steps include: providing an appropriate amount of raw materials of Kluyveromyces lactis cells that have been fermented and cultured, quickly freezing the cells with liquid nitrogen, breaking the cells, and collecting the supernatant by centrifugation to obtain a cell extract. The protein concentration in the obtained Kluyveromyces lactis cell extract is 20-40 mg / mL. In the following examples, (i.e., prock, N-E-propargyloxycarbonyl-L-lysine hydrochloride) is a representative of non-natural amino acids (abbreviated as NCAA), but the NCAA in this application is not limited to only referring to prock. Example 1: Three methods for constructing Mapylrs proteins: The first type, Long N-terminal mapylrs: The N-terminus of the Mapylrs protein contains a 31-amino acid leader peptide, which contains a 6*His affinity purification tag, a T7 tag, and a thrombin restriction site (Figure 1): Long N-terminal mapylrs amino acid sequence: Theoretical molecular weight: 34349.98Da The second type, N-his mapylrs: The Mapylrs protein has only a 6*His affinity purification tag at the N-terminus, as well as a flexible interface (Figure 2): Theoretical molecular weight of N-his MAPYRS: 32091.35Da The third type, C-his mapylrs: The Mapylrs protein has an additional Gly at the N-terminus compared to the reported sequence, and an affinity purification tag 6*His at the C-terminus (Figure 3): C-his MAPYRS theoretical molecular weight: 31685.98 The fourth type, compared to the Long N-terminal mapylrs, removes the his tag: Example 2: Construction of expression plasmid Long-N-terminal mapylrs expression plasmid: We commissioned Sangon Biotech to synthesize the full mapylrs gene (WP_015505008), with codons optimized for E. coli expression. The resulting gene sequence is: Nde I Xho I Inserted into pET28a vector through NdeI / XhoI restriction sites. The N-his maplys and C-his maplys expression vectors were modified based on pET28a-long-terminal maplys by PCR. The primers used were: N-his mapylrs C-his mapylrs: C-his vector R: The amplified product was digested with DnpI, ligated and transformed into DH5α competent cells, and the plasmid was extracted and sequenced. Example 3 1) Pick a single bacterial colony and inoculate 100 ml of LB (containing 100 mg / L kanamycin) at 37°C overnight. 2) The next day, the cells were inoculated into fresh LB medium (containing 100 mg / L kanamycin) at a ratio of 1:100 and cultured at 37°C until OD600 ≈ 0.6. IPTG was added to a final concentration of 0.1 mM and expression was induced at 16°C for 20 hr. 3) Collect the cells by centrifugation at 5000 rpm for 20 min at 4°C. Resuspend 20 g of wet cells in 100 ml of lysis buffer (25 mM Tris-HCl, 500 mM NaCl, 25 mM imidazole, 5 mM β-mercaptoethanol, 1 mM PMSF, 0.1% Triton X-100). Lyse the cells using a high-pressure homogenizer. 4) Centrifuge twice at 20,000 rpm for 20 min at 4°C to remove bacterial debris. Isolate and purify the target protein using a HisTrap affinity column. Buffer A: 25 mM TrisHCl pH 7.8, 500 mM NaCl, 25 mM imidazole; Buffer B: 25 mM TrisHCl pH 7.8, 150 mM NaCl, 500 mM imidazole. 5) After the cell lysis supernatant flows through the affinity chromatography column, the affinity column is repeatedly washed with 10 cv of buffer A, and then the target protein is eluted with 10 cv of buffer B in a gradient from 0% to 100%. 6) Collect and combine the fractions containing the target protein and concentrate the sample using an ultrafiltration centrifuge tube; 7) After thorough dialyzing of the concentrated sample against dialysis buffer (50% glycerol, 25 mM Hepes, pH 7.5), determine the protein concentration and aliquot. The sample can be stored at -80°C for at least one year. Figure 4 shows that the supernatant of the first three recombinant MAPYRS proteins was lysed after induction of expression. MAPYRS with a longer N-terminus showed higher protein expression and improved solubility. The highest protein concentration reached 120 mg / mL (3.4 mM). Example 4 Comparison of the activity of proteins purified by three construction methods The concentrations of the three proteins were measured using nanodrop and adjusted to the same level using ddH2O that did not contain DNAase and RNase. Establishment of expression system containing unnatural amino acids: Protein Factory 100ul Prock (unnatural amino acid) 500mM 1ul matRNA CUA pyl In vitro transcription product (unpurified) 10ul GFP-TAG-RFP dual fluorescence reporter gene PCR product 3ul The final concentration of purified proteins of different forms of Mapylrs was 5uM The fluorescence intensity of GFP was detected by Ex485nm / Em535, and the fluorescence intensity of RFP was detected by Ex535nm / Em595nm. The efficiency of the introduction of unnatural amino acids was determined based on the fluorescence intensity of RFP and the ratio of RFP / GFP (see Figure 5 for details). As shown in Figure 5, all three forms of Mapylrs can achieve efficient incorporation of unnatural amino acids, as seen with RFP / GFP, and all exhibit high activity. Among them, the N-terminal tag stabilizes the protein structure (Long-N-terminal Mapylrs), resulting in better activity. Example 5 examined the effects of the original Mapylrs (ie, non-recombinant Mapylrs) and the purified products of N-terminally tagged Mapylrs on the activity of introducing unnatural amino acids. The activities of the original Mapylrs were compared with those of Long-N-terminal Mapylrs and N-his Maplys. The activity was measured using the same method as in Example 4, using the dual fluorescent protein expression method. As shown in Figures 6 and 7 , the Long-N-terminal Mapylrs and N-his Maplys have improved activity in introducing unnatural amino acids compared to the original Mapylrs (no tag in the figures), indicating that the recombinant Mapylrs obtained through the modification of the present invention have significant improvements in the introduction of unnatural amino acids compared to the original Mapylrs. To overcome the drawbacks of existing non-natural amino acid insertion systems, which require manual exogenous addition of MaPylRS protein or the introduction of a plasmid containing its expression structure through transformation / transfection, the present invention further discloses the integration of MaPylRS protein into the cell genome through gene editing technology, creating a strain capable of stably expressing MaPylRS protein in appropriate amounts, thereby forming a simple and efficient non-natural amino acid insertion system that does not require exogenous addition of MaPylRS. The following only uses the Long-N-terminal maplyrs with the his tag removed as an example (ie, the fourth structure) to verify the integration of the MaPylRS protein into the cell genome, which does not limit other MaPylRS of the present invention. Example 6: The MaPylRS expression cassette (i.e., the expression cassette of the fourth structure, the same below) was inserted near KlLs1-5 by CRISPR-Cas9 technology. (1) KlLys1-5 sequence retrieval and CRISPR gRNA sequence determination In order not to affect the normal expression of other genes in Kluyveromyces lactis, the present invention inserts the MaPylRS expression structure near KlLs1-5 of Kluyveromyces lactis tDNA, and after expression, it is combined with the non-natural amino acid to perform site-directed insertion. i. tRNA-Lys-CTT-1-5 was retrieved from http: / / gtrnadb.ucsc.edu / GtRNAdb2 / genomes / eukaryota / Kluy_lact_NRRL_Y_1140 / Kluy_lact_NRRL_Y_1140-gene-list.html to obtain the Lys1-5 gene sequence from K. lactis yeast. This sequence is designated K1Lys1-5 (located at 856274-856346 on chromosome E) in the present invention. ii. The PAM sequence (NGG) was searched within 500 bp upstream and downstream of KlLs1-5, and the PAM located downstream of the gene (sites 856876 ... 856878 of chromosome E) was finally selected. The KlLs1-5 gRNA sequence (GTTCCCATTGATCCCATATC (SEQ ID NO: 11), located at sites 856856 ... 856875 of chromosome E) was determined. (2) Construction of KlLs1-5 CRISPR-Cas9 plasmid Based on the designed gRNA sequence, design two 24nt primers required for vector construction. gRNA-F1: AATCGTTCCCATTGATCCCATATC (SEQ ID NO: 12); gRNA-R1: AAACGATATGGGATCAATGGGAAC (SEQ ID NO: 13). Dilute the primers to 10 μM and add 10 μL each of gRNA-F1 and gRNA-R2 to a PCR tube. Mix and centrifuge to the bottom of the tube. Anneal according to the following procedure: 95℃, 3min; 72℃, 30s; 65℃, 2min; 60℃, 2min; 55℃, 2min; 50℃, 2min; 16℃, 2min, then proceed with ligation reaction A. Reaction system: 1 μL 10× Buffer, 20-50 ng plasmid, 1 μL annealed product, 0.2 μL enzyme, add water to 10 μL. B. Reaction procedure: 16°C, 60 min. Take 50 μL of commercially available E. coli DH5α competent cells, add all ligation products, mix thoroughly, and complete the transformation process according to the instructions. Select on LB plates containing 50 mg / L kanamycin and culture overnight. Pick five single clones and culture them in LB liquid medium with shaking. After sequencing confirmation, extract the plasmid and save it, naming it pKM-CAS1.0-KlLys1-5 (Figure 8). (3) Donor DNA construction and amplification First, construct the donor DNA, which includes the homologous recombination sequence at the KlLys1-5 sites and the MaPylRS expression construct. The MaPylRS promoter is the KlPGK1 promoter, and the terminator is the ScCYC1 terminator. The donor DNA construction and transformation procedures are as follows: iii. Gene synthesis A plasmid containing the MaPylRS expression cassette (named pKM-MaPylRS, see Figure 9) was used as a template to amplify the MaPylRS expression cassette fragment by PCR using primers PF1: AATGTTCCATTGATCCCATATCCTTCGAGCGTCCCAAAACC (SEQ ID NO: 14) and primer PR1: TTCAGTTCAAAAACGCCCCGTTCCTCATCACTAGAAG (SEQ ID NO: 15). iv. Using Kluyveromyces lactis free plasmid as a template, primers PF2: GTTATTAATGTCGTGTGCCATAGGT (SEQ ID NO: 16) and primers PR2: AGGTTTTGGGACGCTCGAAGGATATGGGATCAATGGGAA (SEQ ID NO: 17) were used for PCR amplification to obtain the homology arm 1 fragment of the KlLs1-5 site; using Kluyveromyces lactis free plasmid as a template, primers PF3: TTCTAGTGATGAGGAACGGGGCGTTTTTGAACTGAATTTCG (SEQ ID NO: 18) and primers PR3: CAGCATAGCATTTGAGTATTGTG (SEQ ID NO: 19) were used for PCR amplification to obtain the homology arm 2 fragment of the KlLs1-5 site. v. The three PCR product fragments obtained above were mixed and diluted 100-fold as templates. PCR amplification was performed again using primers PF4: ATAGGTCAATTAATAATATGCCAGCAAT (SEQ ID NO: 20) and PR4: GGGGAGCATAGCATTCAAAAACTTC (SEQ ID NO: 21). The three fragments were then connected by overlap extension PCR to form a linear donor DNA. After sequencing confirmation, the DNA was stored at -20°C. (4) Preparation and transformation of efficient Kluyveromyces lactis competent cells Preparation of competent yeast Streak the Kluyveromyces lactis culture onto YPD solid medium and pick a single colony. Culture overnight with shaking in 25 mL of 2×YPD liquid medium. Transfer 2 mL of the culture to 50 mL of 2×YPD liquid medium and continue to culture with shaking for 2-8 hours. Collect the yeast cells by centrifugation at 3000g for 5 minutes at 20°C, resuspend in 500 μL of sterile water, and collect the cells by centrifugation under the same conditions. Prepare a competent cell solution (5% v / v glycerol, 10% v / v DMSO) and dissolve the yeast cells in 500 μL of this solution. Aliquot 50 μL into 1.5 mL centrifuge tubes and store at -80°C. Yeast DNA transformation Thaw competent cells on ice for 30 seconds, then add 200 ng of the pKM-CAS1.0-KlLys1-5 plasmid and 2000 ng of donor DNA. Immediately add 1 mL of liquid YPD medium and incubate for 2-3 hours. Then, spread 200 μL of the aliquot onto solid YPD medium (200 μg / mL G418) and incubate for 2-3 days until single colonies appear. (5) Positive identification of gene editing 50-60 single colonies were picked from the transformed Kluyveromyces lactis plate, and each single colony was placed in 5 μL yeast lysate (Takara Mighty Prep Reagent for DNA). The bacterial lysate was used as a template and the following primers were used: Ma R1 (primer within the MaPylRS sequence): ATCTCTTACTTGAACGGTGCTA (SEQ ID NO: 22); 1-5F1 (primer outside the 5' end of the KlLys1-5 donor DNA): GGTTATCCATTCAGGCAATGAAG (SEQ ID NO: 23) and Ma F1 (primer within the MaPylRS sequence): CCATGTGAGAACCTCTTGG (SEQ ID NO: 24); 1-5R1 (primer outside the 5' end of the KlLys1-5 donor DNA): CAGCATAGCATTTGAGTATTGTG (SEQ ID NO: 25). NO: 25) was amplified by PCR to detect the CRISPR insertion at the KlLys1-5 site. The presence of a positive band indicated that the MaPylRS sequence was successfully inserted into the target site. Example 7 Insertion of the MaPylRS expression cassette near KlglpA using CRISPR-Cas9 technology (1) KlglpA sequence retrieval and CRISPR gRNA sequence determination In order not to affect the normal expression of other genes in Kluyveromyces lactis, the present invention inserts the MaPylRS expression structure near the Kluyveromyces lactis tDNA KlglpA, and after expression, it is combined with the non-natural amino acid to perform site-directed insertion. i. Search for glycerol-3-phosphate dehydrogenase at https: / / www.genome.jp / kegg / kegg2.html to obtain the glpA gene sequence from K. lactis yeast. This sequence is designated KlglpA (located at 33084-35012 on chromosome A) in this paper. ii. Search for the PAM sequence (NGG) within the range of 1000-2000 bp upstream of KlglpA, and finally select the PAM located downstream of the gene (sites 31956...31958 of chromosome A), and determine the KlglpA gRNA sequence (GAAGTAACTCTAGCCATCGG (SEQ ID NO: 26), located at sites 31936...31955 of chromosome A). (2) Construction of KlglpA CRISPR-Cas9 plasmid Based on the designed gRNA sequence, two 24nt primers were designed for vector construction. gRNA-F2: AATCGAAGTAACTCTAGCCATCGG (SEQ ID NO: 27); gRNA-R2: AAACCCGATGGCTAGAGTTACTTC (SEQ ID NO: 28). The primers were diluted to 10 μM, and 10 μL each of gRNA-F2 and gRNA-R2 were added to a PCR tube. After mixing, centrifuge to the bottom of the tube and anneal according to the following procedure: 95℃, 3min; 72℃, 30s; 65℃, 2min; 60℃, 2min; 55℃, 2min; 50℃, 2min; 16℃, 2min Then carry out the ligation reaction A. Reaction system: 1 μL 10× Buffer, 20-50 ng plasmid, 1 μL annealed product, 0.2 μL enzyme, add water to 10 μL. B. Reaction procedure: 16°C, 60 min. Take 50 μL of commercially available E. coli DH5α competent cells, add all ligation products, mix thoroughly, and complete the transformation process according to the instructions. Select on LB plates containing 50 mg / L kanamycin and culture overnight. Pick five single clones and culture them in LB liquid medium with shaking. After sequencing confirmation, extract the plasmid and save it, naming it pKM-CAS1.0-KlglpA (Figure 10). (3) Donor DNA construction and amplification First, the donor DNA was constructed, which consisted of the homologous recombination sequence at the KlglpA site and the MaPylRS expression construct. The MaPylRS promoter was the KlPGK1 promoter, and the terminator was the ScCYC1 terminator. The donor DNA construction and transformation methods were as follows: iii. Gene synthesis A plasmid containing the MaPylRS expression cassette was used as a template to amplify the MaPylRS expression cassette fragment by PCR using primers PF5: CCATCAGTTACGGTAGATTCTCCAGTGCCTACGTTCCTCATCACTAGAAG (SEQ ID NO: 29) and primer PR5: TGTTTTGCGCTTGGTTTTCTTTGTGGAGAAATTTCTTCGAGCGTCCCAAA (SEQ ID NO: 30). iv. Using Kluyveromyces lactis free plasmid as a template, primers PF6: AAATTAAGGCAAACATACAGG (SEQ ID NO: 31) and primers PR6: CAACAGTTCGGCTTCTAGTGATGAGGAACGTAGGCACTGGAGAATCTACC (SEQ ID NO: 32) were used for PCR amplification to obtain the homology arm 1 fragment of the KlglpA site; using Kluyveromyces lactis free plasmid as a template, primers PF7: GCTTGAGAAGGTTTTGGGACGCTCGAAGAAATTTCTCCACAAAGAAAACC (SEQ ID NO: 33) and primers PR7: GACCTTTTATTTTGTCACCG (SEQ ID NO: 34) were used for PCR amplification to obtain the homology arm 2 fragment of the KlglpA site. v. The three PCR product fragments obtained above were mixed and diluted 100-fold as templates. PCR amplification was performed again using primers PF8: ATATCGGATGACATGCAGCAA (SEQ ID NO: 35) and PR8: TTGTGTACCAAAACTTTCACGG (SEQ ID NO: 36). The three fragments were then connected by overlap extension PCR to form a linear donor DNA. After sequencing confirmation, the donor DNA was stored at -20 degrees Celsius. (4) Preparation and transformation of efficient Kluyveromyces lactis competent cells Preparation of competent yeast Streak the Kluyveromyces lactis culture onto YPD solid medium and pick a single colony. Culture overnight with shaking in 25 mL of 2×YPD liquid medium. Transfer 2 mL of the culture to 50 mL of 2×YPD liquid medium and continue to culture with shaking for 2-8 hours. Collect the yeast cells by centrifugation at 3000g for 5 minutes at 20°C, resuspend in 500 μL of sterile water, and collect the cells by centrifugation under the same conditions. Prepare a competent cell solution (5% v / v glycerol, 10% v / v DMSO) and dissolve the yeast cells in 500 μL of this solution. Aliquot 50 μL into 1.5 mL centrifuge tubes and store at -80°C. Yeast DNA transformation Thaw competent cells on ice for 30 seconds, add 200 ng of pKM-CAS1.0-KlglpA plasmid and 2000 ng of donor DNA. Immediately add 1 mL of YPD liquid medium after electroporation at 1.5 kV for 5 mS, incubate for 2-3 hours, then spread 200 μL of the aliquot onto solid YPD medium (200 μg / mL G418) and culture for 2-3 days until single colonies appear. (5) Positive identification of gene editing Fifty to sixty single colonies were picked from the transformed Kluyveromyces lactis plate and each colony was placed in 5 μL yeast lysate (Takara Mighty Prep Reagent for DNA). Using the bacterial lysate as a template, PCR amplification was performed with primers Ma R2 (primer within the MaPylRS sequence): CCATGTGAGAACCTCTTGG (SEQ ID NO: 37); glpA F1 (primer outside the 5' side of the KlglpA donor DNA): AAATTAAGGCAAACATACAGG (SEQ ID NO: 38) and primers Ma F2 (primer within the MaPylRS sequence): ATCTCTTACTTGAACGGTGCTA (SEQ ID NO: 39); glpA R1 (primer outside the 5' side of the KlglpA donor DNA): GACCTTTTATTTTGTCACCG (SEQ ID NO: 40). CRISPR insertion at the KlglpA locus was detected. The presence of a positive band indicated that the MaPylRS sequence was successfully inserted into the target site. Example 8 KlUPF1 was knocked out and replaced with MaPylRS expression cassette by CRISPR-Cas9 technology (1) KlUPF1 sequence retrieval and CRISPR gRNA sequence determination Literature has shown that the yeast UPF1 protein is involved in mRNA degradation, and deleting this gene can slow the degradation of immature mRNA transcripts. Therefore, the present invention completely deleted the K1UPF1 gene and replaced it with the MaPylRS sequence, allowing the unnatural amino acid transcripts to aggregate, thereby improving the efficiency of unnatural amino acid insertion. i. Search "UPF1" at http: / / www.yeastgenome.org / to obtain the ScUPF1 gene sequence in Saccharomyces cerevisiae. Perform BLAST analysis of the UPF1 gene in the NCBI database to identify the UPF1 homologous gene sequence K1UPF1 in Kluyveromyces lactis (located at positions 567908-570817 on chromosome B). ii. Search for PAM sequences (NGG) at both ends of the KlUPF1 gene and determine the gRNA sequence. The gRNA selection criteria were: moderate GC content (the standard in this invention is 40%-60%); and avoidance of poly T structures. Ultimately, the KlUPF1 gRNA1 sequence determined by this invention was TTGGCAAACGCATCGTCATA (SEQ ID NO: 41) and the gRNA2 sequence was CTTAAGGAAGTACAATGGAG (SEQ ID NO: 42). (2) Construction of KlUPF1 CRISPR-Cas9 plasmid Based on the designed gRNA1 and gRNA2 sequences, two 24nt primers required for vector construction were designed. gRNA-F3: AATCTTGGCAAACGCATCGTCATA (SEQ ID NO: 43); gRNA-R3: AAACTATGACGATGCGTTTGCCAA (SEQ ID NO: 44); gRNA-F4: AATCCTTAAGGAAGTACAATGGAG (SEQ ID NO: 45); gRNA-R4: AAACCTCCATTGTACTTCCTTAAG (SEQ ID NO: 46) Dilute the primers to 10 μM, add 10 μL each of gRNA-F and gRNA-R to a PCR tube, mix, and centrifuge to the bottom of the tube. Anneal according to the following procedure: 95℃, 3min; 72℃, 30s; 65℃, 2min; 60℃, 2min; 55℃, 2min; 50℃, 2min; 16℃, 2min Then the ligation reaction is carried out. A. Reaction system: 1 μL 10× Buffer, 20-50 ng plasmid, 1 μL annealed product, 0.2 μL enzyme, add water to 10 μL. B. Reaction procedure: 16°C, 60 min. Take 50 μL of commercially available E. coli DH5α competent cells, add all ligation products, mix thoroughly, and complete the transformation process according to the instructions. Select on LB plates containing 50 mg / L kanamycin and culture overnight. Select five single clones and culture them in LB liquid medium with shaking. After sequencing confirmation, extract the plasmid and save it, naming it pKM-CAS1.0-KlUPF1 (Figure 11). (3) Donor DNA construction and amplification The present invention first constructs the donor Donor, and replaces the UPF1 coding sequence with the MaPylRS coding sequence. That is, the inserted MaPylRS uses the UPF1 promoter and terminator. The donor DNA construction and transformation method are as follows: iii. Gene synthesis A plasmid containing the MaPylRS expression cassette was used as a template to amplify the coding sequence of MaPylRS using primers PF9: AGTACAATTAGAATCAAGTTTCCTTATGGGTTCTTCTTCTTCTGG (SEQ ID NO: 47) and PR9: TAATATTATTTAATTAATGGATTGATACGCGTTCATGTTTAGTTGATCTTAGCACCGTTC (SEQ ID NO: 48). iv. Using Kluyveromyces lactis free plasmid as a template, primers PF10: CAATGGATACAGTTTCTCGCTA (SEQ ID NO: 49) and primers PR10: ACCAGAAGAAGAAGAACCCATAAGGAAACTTGATTCTAATTGT (SEQ ID NO: 50) were used for PCR amplification to obtain the homology arm 1 fragment of the KlUPF1 site; using Kluyveromyces lactis free plasmid as a template, primers PF11: TTGAACGGTGCTAAGATCAACTAAACATGAACGCGTATCAATC (SEQ ID NO: 51) and primers PR11: CTTCGAGACTTCCAATGATCTC (SEQ ID NO: 52) were used for PCR amplification to obtain the homology arm 2 fragment of the KlUPF1 site. v. The three PCR product fragments obtained above were mixed and diluted 100-fold as templates. PCR amplification was performed again using primers PF12: GATCGTCCATTAGCTTATCTACAAATGCC (SEQ ID NO: 53) and PR12: GTGAGAATGCCAGACGAT (SEQ ID NO: 54). The three fragments were then connected by overlap extension PCR to form a linear donor DNA. After sequencing confirmation, the donor DNA was stored at -20°C. (4) Transformation and positive identification of Kluyveromyces lactis Preparation of competent yeast Streak the Kluyveromyces lactis culture onto YPD solid medium and pick a single colony. Culture overnight with shaking in 25 mL of 2×YPD liquid medium. Transfer 2 mL of the culture to 50 mL of 2×YPD liquid medium and continue to culture with shaking for 2-8 hours. Collect the yeast cells by centrifugation at 3000g for 5 minutes at 20°C, resuspend in 500 μL of sterile water, and collect the cells by centrifugation under the same conditions. Prepare a competent cell solution (5% v / v glycerol, 10% v / v DMSO) and dissolve the yeast cells in 500 μL of this solution. Aliquot 50 μL into 1.5 mL centrifuge tubes and store at -80°C. Yeast DNA transformation Thaw competent cells on ice for 30 seconds, add 200 ng of the pKM-CAS1.0-KlUPF1 plasmid and 2000 ng of donor DNA. Electroporate at 1.5 kV for 5 mS. Immediately add 1 mL of liquid YPD medium and incubate for 2-3 hours. Pipette 200 μL onto solid YPD medium (200 μg / mL G418) and incubate for 2-3 days until single colonies appear. (5) Positive identification of gene editing Fifty to sixty single colonies were picked from the transformed Kluyveromyces lactis plate and each colony was placed in 5 μL yeast lysate (Takara Mighty Prep Reagent for DNA). Using the yeast lysate as a template, PCR amplification was performed with primers Ma R3 (primer within the MaPylRS sequence): GTCTCTAGAAGCCAAGTCTTC (SEQ ID NO: 55); UPF1 F1 (primer outside the 5' side of the KlUPF1 donor DNA): GAACTGCCACGGGCT (SEQ ID NO: 56) and primers Ma F3 (primer within the MaPylRS sequence): GCTGCTCACGACGTTCA (SEQ ID NO: 57); UPF1 R1 (primer outside the 5' side of the KlUPF1 donor DNA): GCACTGTAATCAGGCAACT (SEQ ID NO: 58). CRISPR insertion at the KlUPF1 locus was detected. The presence of a positive band indicated that the MaPylRS sequence was successfully inserted into the target site. Example 9 Activity Determination A genetically modified Kluyveromyces lactis strain was constructed into an in vitro protein synthesis system (IVTT) and loaded with a plasmid containing dual reporter genes for green fluorescent protein (GFP) and red fluorescent protein (RFP) to assess the ability of the modified strain to insert unnatural amino acids into specific sites within a specific protein. GFP was used to monitor overall protein expression, while RFP was used to detect successful insertion of the unnatural amino acid at a specific site, namely the GFP stop codon (TAG). The presence of a red fluorescent signal indicates that the protein involved in translation reads through the TAG stop codon, indicating successful insertion of the unnatural amino acid. The absence of a red fluorescent signal indicates that translation of the protein stopped at the TAG stop codon, indicating unsuccessful insertion of the unnatural amino acid. Taking the Kluyveromyces lactis strain obtained in Example 6 as an example, the promoter in the MaPylRS expression cassette was adjusted to obtain different Kluyveromyces lactis strains, which were prepared into Protein Factories. Establishment of expression system containing unnatural amino acids: Protein Factory 100ul Prock (unnatural amino acid) 500mM 1ul matRNA CUA pyl In vitro transcription product (unpurified) 10ul GFP-TAG-RFP dual fluorescence reporter gene PCR product 3ul The efficiency of the introduction of unnatural amino acids was determined by measuring the RFP fluorescence intensity and the RFP / GFP ratio (see Figures 12 to 14 for details). In Figures 12 to 14, DW14-1 and DW14-2 are two sets of parallel experiments, and the promoter is TIF11; the promoter of DW14-3 is TEF1; DW14-4 and DW14-5 are two sets of parallel experiments, and the promoter is ADH1; DW14-6 and DW14-7 are two sets of parallel experiments, and the promoter is GAP1; DW14-8 and DW14-9 are two sets of parallel experiments, and the promoter is HXK4; the promoter of DW14-10 is PGK1. As shown in Figure 12 , all modified strains achieve readthrough of the stop codon TAG, demonstrating that the modified strains of the present invention are capable of incorporating unnatural amino acids. As shown in Figure 14 , the modified strains of the present invention all exhibit high unnatural amino acid incorporation efficiencies, particularly DW14-4 to DW14-7 and DW14-10, which exhibit high RFP / GFP values, demonstrating exceptionally high unnatural amino acid incorporation efficiencies. Example 10 The reaction systems obtained after the modified MaPylRS in Example 6 and the original MaPylRS (Example 5) were integrated into yeast to compare the effects on the activity of ncaa introduction. For specific measurement conditions, see Example 9, and for specific results, see Figures 15 to 17. Among them, sl-3 represents the reaction system of yeast integrated with the original MaPylRS, and sl-9 represents the reaction system of yeast integrated with the modified MaPylRS of the present application. Orthogonal tRNA and Prock were added to both systems, and a system without adding ncaa (i.e., non) was used as a control. As can be seen from Figures 15 to 17, the reaction systems obtained by integrating the wild-type and modified MaPylRS into yeast cells can both achieve ncaa introduction, but the reaction system obtained after integrating the modified MaPylRS of the present invention into yeast cells can significantly improve the efficiency of ncaa introduction. The sequences used in the present invention are shown in Table 1 below Table 1 Based on the above ideal embodiment of this application, and through the above description, relevant staff can make various changes and modifications without deviating from the technical concept of this application. The technical scope of this application is not limited to the content in the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A recombinant aminoacyl-tRNA synthetase having the structure as shown in Formula I: A1-A2-A3-A4 (I): In Formula I, "-" is independently a bond or an amino acid linking sequence, A1 is absent or is a histidine tag, A2 is absent or is a thrombin cleavage site, A3 is absent or is a tag protein, A4 is an aminoacyl-tRNA synthetase, and at least one of A1 to A3 is present; the connection between A1 to A4 can be either from the N-terminus to the C-terminus or from the C-terminus to the N-terminus.

2. The recombinant aminoacyl-tRNA synthetase according to claim 1, wherein: The aminoacyl-tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS) or TrP-tRNA synthetase (TrpRS).

3. The recombinant aminoacyl-tRNA synthetase according to claim 1 or 2, characterized in that: The aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS or BsTrpRS; preferably, the aminoacyl-tRNA synthetase comprises the sequence shown in SEQ ID NO: 60 or an active fragment thereof, and more preferably, the sequence of the aminoacyl-tRNA synthetase is SEQ ID NO: 62; or is a polypeptide having a homology of ≥85%, ≥90%, ≥95%, ≥97%, ≥98% or ≥99% or more with the amino acid sequence shown in SEQ ID NO: 60 and having the same activity as the SEQ ID NO: 60 sequence.

4. The recombinant aminoacyl-tRNA synthetase according to any one of claims 1-3, characterized in that: The structure of the histidine tag is n×His, where 1≦n≦50; preferably 2≦n≦30; more preferably, 5≦n≦20; even more preferably 6≦n≦10.

5. The recombinant aminoacyl-tRNA synthetase according to any one of claims 1-4, characterized in that: A his tag is connected to the N-terminus or C-terminus of the aminoacyl-tRNA synthetase; or a thrombin cleavage site and a tag protein are connected to the N-terminus of the aminoacyl-tRNA synthetase in the order from the N-terminus to the C-terminus; or a his tag, a thrombin cleavage site and a tag protein are connected to the N-terminus of the aminoacyl-tRNA synthetase in the order from the N-terminus to the C-terminus.

6. The recombinant aminoacyl-tRNA synthetase according to any one of claims 1-5, characterized in that: The recombinant aminoacyl-tRNA synthetase described above comprises any one of the sequences of SEQ ID NO:1-3, SEQ ID NO:64 or an active fragment thereof. Further preferably, the amino acid sequence of the recombinant aminoacyl-tRNA synthetase is selected from any one or more of the following: SEQ ID NO:1-SEQ ID NO:3 and SEQ ID NO:64; or is a polypeptide having a homology of ≥85%, ≥90%, ≥95%, ≥97%, ≥98% or ≥99% with any one of the amino acid sequences of SEQ ID NO:1-3, SEQ ID NO:64 and having the same activity as any one of the sequences corresponding to the homology of SEQ ID NO:1-3, SEQ ID NO:64; or the coding sequence of the recombinant aminoacyl-tRNA synthetase is selected from any one or more of the following: SEQ ID NO:4, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63; or comprises any one of the sequences of SEQ ID NO:4, SEQ ID NO:61, SEQ ID NO:62 or SEQ ID NO:63 or an active fragment thereof, or is a nucleotide having a homology of ≥85%, ≥90%, ≥95%, ≥97%, ≥98% or ≥99% with any one of the sequences of SEQ ID NO:4, SEQ ID NO:61, SEQ ID NO:62 or SEQ ID NO:63 and having the same activity as any one of the sequences corresponding to the homology of SEQ ID NO:4, SEQ ID NO:61, SEQ ID NO:62 or SEQ ID NO:

63.

7. A nucleic acid construct encoding the recombinant aminoacyl-tRNA synthetase according to any one of claims 1-6.

8. The nucleic acid construct according to claim 7, wherein: The nucleic acid construct contains at least a structure as described in Formula II: Z1-Z2-Z3-Z4, wherein Z1-Z4 are elements for constructing the construct respectively; "-" is independently a bond or a nucleotide linking sequence; Z1 is absent or is a coding sequence of a histidine tag, Z2 is absent or is a coding sequence of a thrombin cleavage site, Z3 is absent or is a coding sequence of a tag protein, and Z4 is a coding sequence of an aminoacyl-tRNA synthetase; wherein at least one of Z1-Z3 is present.

9. The nucleic acid construct according to claim 8, characterized in that: The amino acid sequence encoded by Z1 is HHHHHH; the amino acid sequence encoded by Z2 is LVPRGS; the amino acid sequence encoded by Z3 is SEQ ID NO:59; or Z1, Z2, and Z3 each separately encode a sequence containing the sequences of HHHHHH, LVPRGS, and SEQ ID NO:59 or an active fragment thereof, or each separately has a nucleotide sequence with ≥85%, ≥90%, ≥95%, ≥97%, ≥98%, or ≥99% homology with the nucleotide sequences corresponding to the encoding of HHHHHH, LVPRGS, and SEQ ID NO:59 and each separately has the same activity as the nucleotide sequences encoding HHHHHH, LVPRGS, and SEQ ID NO:

59.

10. The nucleic acid construct according to claim 8 or 9, characterized in that, It further includes a promoter element. Preferably, the nucleic acid construct contains the structure of Formula III: Z5-Z1-Z2-Z3-Z4, wherein Z5 is a promoter element. More preferably, the promoter is selected from PGK1, GAP1, ADH1, HXK1, GAPDH1, TEF1, or TIF11.

11. A carrier, characterized in that, The vector contains the nucleic acid construct according to any one of claims 7-10.

12. A genetically engineered strain, characterized in that, One or more sites in the genome of the genetically engineered strain are integrated with the nucleic acid construct according to any one of claims 7-10, or the genetically engineered strain contains the recombinant aminoacyl-tRNA synthetase according to any one of claims 1-6, or the genetically engineered strain contains the vector according to claim 11.

13. The genetically engineered strain according to claim 12, characterized in that, The strain is derived from one of mammalian cells, plant cells, yeast cells, insect cells, prokaryotic cells or any combination thereof.

14. The genetically engineered strain according to claim 12 or 13, characterized in that: The site is selected from Lys1-5, glpA, or UPF1.

15. The genetically engineered strain according to any one of claims 12-14, characterized in that: The nucleic acid construct further includes a terminator; preferably, the terminator is selected from CYC1, GPM1, TDH2, or ACT1.

16. A method for synthesizing a protein incorporating non-natural amino acids, characterized in that: The recombinant aminoacyl-tRNA synthetase is provided by using the recombinant aminoacyl-tRNA synthetase according to any one of claims 1-6 or by using the genetically engineered strain according to any one of claims 12-15.

17. A cell-free system for synthesizing proteins containing non-natural amino acids, characterized in that, The cell-free system at least includes: (a) a cell extract, and (b) one or more of the recombinant aminoacyl-tRNA synthetase according to any one of claims 1-6, the nucleic acid construct according to any one of claims 7-10, or the vector according to claim 11; the cell extract is derived from one of mammalian cells, plant cells, yeast cells, insect cells, prokaryotic cells or any combination thereof.

18. A cell-free system for synthesizing proteins containing non-natural amino acids, characterized in that, The cell-free system at least includes a cell extract, and the cell extract is from the genetically engineered strain according to any one of claims 12-15.

19. A cell-free system for synthesizing a protein containing a non-natural amino acid according to claim 17 or 18, characterized in that, The cell-free system further includes: unnatural amino acids, orthogonal tRNA, and a template containing the gene sequence of the target protein, and the codons encoding amino acids in the gene sequence of the target protein are mutated.

20. A method for preparing a genetically engineered strain according to any one of claims 12-15, characterized in that, The nucleic acid construct according to any one of claims 7-10 is transferred or integrated into cells by transformation, transfection, or gene editing technology.

21. The preparation method of a genetically engineered strain according to claim 20, wherein, Integrate the nucleic acid construct according to any one of claims 7-10 into the genome of a cell through an active site.

22. The preparation method of a genetically engineered strain according to claim 20 or 21, characterized in that, The nucleic acid construct further comprises a terminator; preferably, the terminator is selected from CYC1, GPM1, TDH2 or ACT1.

23. The preparation method of a genetically engineered strain according to claim 21 or 22, characterized in that, The site is selected from Lys1-5, glpA or UPF1.

24. A kit, characterized in that The kit contains the reaction system according to any one of claims 17-19.

25. A method for in vitro synthesizing a protein containing unnatural amino acids, characterized in that, It is prepared using the cell-free system according to any one of claims 17-19 or the kit according to claim 24.

Citation Information

Patent Citations

  • Method for preparing novel cell extract

    CN109593656A

  • Method for regulating in-vitro biosynthetic activity by knocking out nuclease system

    CN108949801A

  • Pyrrolysyl-trna synthetase

    CN112739823A

  • Nucleic acid construct for endogenous expression of RNA polymerase in cell

    CN117165620A

  • Incorporation of unnatural amino acids into proteins

    WO2016066995A1