Method for constructing cell which produces defucosylated protein and use of cell

Through the targeted binding of the FUT8 gene by zinc finger nuclease (ZFN), the problem of defucosylated protein production cells in the prior art is solved, and defucosylation of the antibody Fc region is achieved, which enhances the ADCC effect of the antibody and improves the biological activity and production efficiency of the antibody.

WO2025140609A1PCT designated stage expired Publication Date: 2025-07-03WUXI BIOLOGICS (SHANGHAI) CO LTD +1
View PDF 13 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/143321
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-28
Filing Date
2024-12-27
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently construct defucosylated protein production cells, especially in the antibody Fc region to remove fucosylation modifications to enhance the binding between NK cells FcγRIIIa and IgG antibody Fc fragments, thereby enhancing the ADCC effect of the antibody.

Method used

Zinc finger nuclease (ZFN) is used to target the FUT8 gene and inactivate it, thereby producing defucosylated proteins, including antibodies, in cells. ZFN consists of zinc finger protein (ZFP) and DNA cleavage domain or cleavage half domain, and inactivates FUT8 genes in cells through gene editing technology.

Benefits of technology

It has achieved efficient removal of fucosylation modifications, enhanced the ADCC effect function of the antibody, and improved the biological activity and production efficiency of the antibody.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2024143321-FTAPPB-I100001
    Figure PCTCN2024143321-FTAPPB-I100001
  • Figure PCTCN2024143321-FTAPPB-I100002
    Figure PCTCN2024143321-FTAPPB-I100002
  • Figure PCTCN2024143321-FTAPPB-I100003
    Figure PCTCN2024143321-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a method for constructing a cell which produces defucosylated protein using a zinc finger nuclease which contains a zinc finger protein capable of binding to the FUT8 gene in a targeted manner and a DNA cleavage domain or cleavage half-domain. Also provided are a polynucleotide which encodes the zinc finger protein and the zinc finger nuclease, and a cell containing the polynucleotide and the zinc finger nuclease.
Need to check novelty before this filing date? Find Prior Art

Description

A method for constructing a cell for producing defucosylated protein and its application Technical Field

[0001] The present disclosure relates to the fields of molecular biology and biopharmaceuticals; in particular, to cells for producing defucosylated proteins constructed by gene editing using zinc finger nuclease technology and their applications. Background Art

[0002] In recent years, with the successful preparation and widespread application of genetically engineered antibodies and the significant improvement in antibody production levels, the research and development of antibody drugs has entered a new stage of rapid development. According to literature reports, as of December 2019, there were 79 therapeutic antibodies on the market, mainly used for tumors, autoimmune diseases, metabolic and infectious diseases (Lu RM et al. (2020) J Biomed Sci. 27(1): 1-30). In 2022, the world's top ten best-selling anti-cancer drugs included four antibody drugs, with a total sales of nearly US$42.492 billion.

[0003] Antibodies activate the immune system to destroy attacking cells through two mechanisms: complement-dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC). ADCC is an immune response primarily generated by natural killer (NK) cells against antibody-coated targets. In ADCC, NK cells recognize the constant (Fc) region of antibodies primarily through interaction with the NK cell FcγRIII receptor. NK cells then deposit perforins and granzymes on the target cell surface, inducing cell lysis and apoptosis, respectively.

[0004] Most mammalian immunoglobulins are fucosylated, including those produced by Chinese hamster ovary cells (CHO cells). α-1,6-fucosyltransferase (FUT8) catalyzes the transfer of fucose residues from guanosine diphosphate-fucose (GDP-Fuc) to the end of the innermost acetylglucosamine (GlcNAc) on the N-glycan core to form fucose attached to the antibody Fc core region. Studies have shown that removing fucose from the glycan structure at position Asn297 in the CH2 domain of the IgG antibody Fc fragment enhances the binding between NK cell FcγRIIIa and the IgG antibody Fc fragment, thereby enhancing the antibody's ADCC effect (Shinkawa T et al. (2003) J Biol Chem. 278(5):3466-73).

[0005] Currently, there are three common methods for industrial production of defucosylated antibodies: (1) adding fucosylation inhibitors such as 2-fluorofucose (2FF) to the culture medium (Rillahan CD et al. (2012) Nat Chem Biol. 8(7): 661-8); (2) stably overexpressing bacterial RMD protein (GDP-6-deoxy-D-lyso-4-hexulose reductase) in engineered cells (von Horsten HH et al. (2010) Glycobiology. 20(12): 1607-18) to block the fucosylation modification of the Fc region by interfering with the formation of substrate GDP-fucose; (3) interfering with key genes in the fucose production pathway, such as introducing the expression of β(1,4)-N-acetylglucosamine transferase III (GnTIII) (Popp O et al. (2018) MAbs. 10(2): 290-303), knocking out the GDP-fucose transporter (GFT) (Omasa et al. (2014) MAbs. 10(2): 290-303), and knocking out the GDP-fucose transporter (GFT) (Omasa et al. (2014) MAbs. 10(2): 290-303). T et al. (2008) J Biosci Bioeng. 106(2): 168-73), or knockout of α-1,6-fucosyltransferase (FUT8) (Yamane-Ohnuki N et al. (2004) Biotechnol Bioeng. 87(5): 614-22), etc.

[0006] There is still a need in the art for new methods to construct defucosylated protein-producing cells. Summary of the Invention

[0007] To address these needs, after extensive and intensive research, the inventors have developed a novel method for constructing defucosylated protein-producing cells. This method utilizes zinc finger nucleases to inactivate the FUT8 gene in cells. The resulting cells produce defucosylated proteins (e.g., antibodies) with potent effector functions, promising broad industrial applications.

[0008] In one aspect, the present invention provides a zinc finger protein capable of targeting and binding to the FUT8 gene, which comprises, from N-terminus to C-terminus, the zinc finger recognition region amino acid sequences of zinc fingers F1 to F5 or to F6 shown in the same row in the following table:

[0009] In another aspect, provided herein is a zinc finger nuclease (ZFN) targeting the FUT8 gene, which is a fusion protein comprising the ZFP described herein and at least one DNA cleavage domain or cleavage half-domain.

[0010] Yet another aspect herein provides a polynucleotide encoding a ZFP or ZFN as described herein.

[0011] Another aspect herein provides a vector comprising the polynucleotide as described above.

[0012] Another aspect herein provides an isolated cell (eg, a host cell) comprising a ZFP, ZFN, polynucleotide, or vector described herein.

[0013] Another aspect herein provides a cell line in which the FUT8 gene is inactivated or partially inactivated, comprising a ZFP, ZFN, polynucleotide or vector described herein.

[0014] Another aspect herein provides a method of generating a FUT8-deficient cell, the method comprising:

[0015] (a) introducing a polynucleotide encoding one or more ZFNs into a cell, wherein the ZFN comprises: (i) a ZFP as described herein that binds to a target site in a FUT8 gene in the cell; and (ii) a DNA cleavage domain or cleavage half-domain;

[0016] (b) expressing the ZFN in the cell, so that the ZFN binds to the target site and cleaves the FUT8 gene.

[0017] Another aspect herein provides a method of generating a FUT8-deficient cell line, the method comprising:

[0018] (a) inactivating the endogenous FUT8 gene in the cell by the method for generating FUT8-deficient cells as described herein; and

[0019] (b) culturing the cells under conditions suitable for generating a FUT8-deficient cell line.

[0020] Another aspect of the present invention provides a method for producing a target recombinant protein in a host cell, the method comprising:

[0021] (a) providing a FUT8-deficient cell as described herein,

[0022] (b) introducing an expression vector comprising a nucleic acid encoding the target recombinant protein into the cell, thereby producing the target recombinant protein.

[0023] Another aspect of the present invention provides a method for producing a recombinant protein of interest in a host cell, the method comprising:

[0024] (a) providing a cell comprising an endogenous FUT8 gene;

[0025] (b) inactivating the endogenous FUT8 gene in the cell by the method for generating FUT8-deficient cells as described herein; and

[0026] (c) introducing an expression vector comprising a nucleic acid encoding the target recombinant protein into the cell, thereby producing the target recombinant protein.

[0027] Another aspect herein provides the use of the ZFPs, ZFNs, polynucleotides, and vectors described herein for generating FUT8-deficient cells.

[0028] Another aspect herein provides use of a ZFP, ZFN, polynucleotide, vector, cell, or cell line described herein for producing a defucosylated Fc-containing recombinant protein.

[0029] Another aspect provided herein is the use of a ZFP, ZFN, polynucleotide, vector, cell, or cell line described herein for producing an antibody (eg, a monoclonal antibody) capable of eliciting an enhanced ADCC effect.

[0030] Another aspect herein provides a FUT8-deficient cell line prepared according to the method for generating a FUT8-deficient cell line described herein.

[0031] Another aspect herein provides a FUT8-deficient cell line comprising a nucleotide sequence as set forth in one or more of SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, and SEQ ID NO: 59 at the FUT8 locus.

[0032] Another aspect of the present invention provides a FUT8-deficient cell line comprising an engineered FUT8 locus, wherein the engineered FUT8 locus can be detected by the following primers:

[0033] Primer pair (i):

[0034] Forward primer: AGCCTGAAGTACATAGCCGA (SEQ ID NO: 46); and

[0035] Reverse primer: TGCCACTGCTTCTATATACTGATTC (SEQ ID NO: 47);

[0036] and / or

[0037] Primer pair (ii):

[0038] Forward primer: GACGCACTGACAAAGTGGGA (SEQ ID NO: 48); and

[0039] Reverse primer: GGTCTGTTCCATCCCCAGAATG (SEQ ID NO: 49);

[0040] and / or

[0041] Primer pair (iii):

[0042] Forward primer: CTGTTGATTCCAGGTTCCCA (SEQ ID NO: 50); and

[0043] Reverse primer: TGTTACTTAAGCCCCAGGC (SEQ ID NO: 51).

[0044] Another aspect of the present invention provides a method for cultivating a FUT8-deficient cell line, comprising:

[0045] (a) providing a FUT8-deficient cell line according to any one of claims 15 to 17; and

[0046] (b) culturing or expanding cells of the cell line. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The present invention will be further described below with reference to the accompanying drawings, wherein these drawings are only for illustrating the embodiments of the present invention and are not intended to limit the scope of the present invention.

[0048] FIG1 shows the binding site, cleavage site, and PCR primer sites of zinc finger nuclease targeting FUT8 exon 3 and exon 10 and their adjacent regions according to one exemplary embodiment of the present invention.

[0049] Figure 2A shows a schematic diagram of an expression plasmid for a zinc finger nuclease according to one exemplary embodiment of the present invention. The zinc finger protein and the FokI cleavage half-domain of the restriction endonuclease are fused and cloned into a plasmid. The fusion protein is under the control of a CMV promoter. Figure 2B shows a schematic diagram of the specific structure of a zinc finger nuclease according to one exemplary embodiment of the present invention, wherein each zinc finger binding domain is sequentially inserted between the framework sequences of a native zinc finger protein and connected to the FokI cleavage half-domain at the C-terminus.

[0050] Figure 3 shows a T7E1 digestion assay to verify the effective excision of the target gene sequence by the ZFN plasmid. Lane 1: S2-L and S4-R transfections, with an editing efficiency of 4.7% calculated based on band intensity measured by ImageJ; Lane 2: L3 and R3 transfections, with an editing efficiency of 6.2%. NC: Negative control, i.e., genomic DNA from cells without FUT8 knockout; PC: Positive control, i.e., genomic DNA from cells with 50% FUT8 knockout.

[0051] Figure 4 shows the results of flow cytometric analysis of cell pools stained with green fluorescent lentil agglutinin (LCA-FITC). (A) Quantitative analysis of different subpopulations, where the circled cell population with lower green fluorescence is FUT8. - / - The cell population accounts for 27.44% of the cell pool. (B) Peak shifts of different subpopulations.

[0052] Figure 5 shows the flow cytometry analysis results of clone 154-F8ZFN-09-08 and negative control after LCA-FITC staining. Solid line: 154-F8ZFN-09-08 cells; dotted line: negative control without FUT8 gene knockout.

[0053] Figure 6 shows the NGS validation results, demonstrating that a pair of alleles in clones 154-F8ZFN-09-08 and 154-F8ZFN-10-02 were knocked out.

[0054] Figure 7 shows FUT8 - / - Application of cell lines (i.e., 154-F8ZFN-09-08 and 154-F8ZFN-10-02) in monoclonal antibody expression screening. NC: Negative control with non-FUT8 knockout. (A) Changes in viability during FB culture after cell pool recovery; (B) Changes in viable cell density (VCD) during FB culture of the cell pool; (C) Protein expression level and titer on day 14 of fed-batch culture; (D) Harvested supernatant after one-step ProA purification and size exclusion chromatography-HPLC analysis; (E) One-step purified samples were analyzed using SDS Caliper NR and SDS Caliper R; (F) Glycoform analysis results of the one-step purified samples.

[0055] Figure 8 shows the performance evaluation results of the FUT8- / - cell line (154-F8ZFN-09-08) in antibody production. (A) Cell viability of the 154-F8ZFN-09-08 group during FB culture; (B) Changes in viable cell density (VCD); (C) Protein expression titer; (D) SEC-HPLC and SDS Caliper NR analysis results; (E) Glycoform analysis results.

[0056] Figure 9 shows the results of gene editing efficiency testing. Lane 1: 31-L1 / 31-R1 knockout sample, editing efficiency 9.4%; Lane 2: 32-L1 / 32-R1 knockout sample, editing efficiency 10.9%; NC: wild-type CHO-K1.

[0057] Figure 10 shows the results of SCP monoclonal sorting. The unstained sample is CHO K1; Fut8 - / -Clone C6 was selected after single clone sorting and LCA-FITC staining; Fut8 wt was obtained by LCA-FITC staining of CHO K1.

[0058] Figure 11 shows the results of SCP monoclonal sorting. The unstained sample is CHO K1-N079; Fut8 - / - Clone F2 is a single clone selected after sorting and LCA-FITC staining; Fut8 wt is CHO K1 stained with LCA-FITC.

[0059] FIG12 shows the NGS verification results, demonstrating that a pair of alleles in clones C6 and F2 were knocked out.

[0060] FIG13 shows that the ADCC effect of adalimumab produced by host cells after Fut8 gene knockout is significantly enhanced compared with the wild-type control. DETAILED DESCRIPTION

[0061] The meaning of scientific and technological terms in this application is consistent with the general understanding of those skilled in the art, unless otherwise specified. In this application, "one" or its combination with various quantifiers includes both singular and plural meanings, unless otherwise specified. In this application, for the same parameter or variable, when multiple numerical values, numerical ranges, or combinations thereof are given for description, it is equivalent to specifically revealing these numerical values, range end values, and numerical ranges formed by any combination thereof. In this application, any numerical value, whether or not it is accompanied by a modifier such as "about", covers an approximate range that can be understood by those skilled in the art, such as plus or minus 10%, 5%, etc. In this article, each "embodiment" refers equally to and covers the implementation methods of various methods and systems of this application. In this application, one or more technical features in any implementation method can be freely combined with one or more technical features in any one or more other implementation methods, and the implementation methods thus obtained also belong to the content disclosed in this application.

[0062] In mammalian cells, Fut8 attaches core fucose to oligosaccharides present on the Fc region of antibodies, which is generally considered to be important for the effector function of antibody-dependent cellular cytotoxicity. Three-dimensional analysis of the structure of human Fut8 revealed three α2 / α6 fucosyltransferase motifs forming the catalytic core of the enzyme. See, Ihara et al. (2007) Glycobiology 17:455-66. Point mutations of many single residues in this region to alanine result in complete inactivation of the enzyme. See, Ihara et al. (2007) Glycobiology 17:455-66; Takahashi et al. (2000) Glycobiology 10:503-10. Studies have shown that cells in which FUT8 expression is reduced or eliminated (e.g., knockout cell lines or using siRNA) can produce non-fucosylated antibodies with enhanced effector function. See, for example, Kanada et al. (2007) Biotechnol. 130(3):300-310; Kanada et al. (2007) Glycobiology 18:104-118; Mori et al. (2004) Biotechnol. Bioeng. 88:901-908.

[0063] Provided herein is a method for constructing a defucosylated protein-producing cell, which utilizes a zinc finger nuclease targeting the FUT8 gene to inactivate the FUT8 gene in the cell. The zinc finger nuclease (ZFN) comprises a zinc finger protein (ZFP) and a nuclease cleavage domain or a cleavage partner domain. The inventors surprisingly discovered that using the specifically designed zinc finger nuclease described herein, the FUT8 gene can be highly efficiently knocked out in cells, resulting in cells producing defucosylated proteins (e.g., antibodies) with enhanced effector function.

[0064] A. Zinc finger proteins

[0065] In one aspect, the present invention provides a zinc finger protein (ZFP) capable of targeting and binding to the FUT8 gene.

[0066] As used herein, the term "zinc finger protein" or "ZFP" refers to a protein that binds DNA in a sequence-specific manner through one or more zinc fingers (or zinc finger recognition regions). The zinc fingers are amino acid sequence regions within the protein whose structure is stabilized by the coordination of zinc ions.

[0067] The ZFPs described herein are non-naturally occurring ZFPs. The ZFPs may have 1, 2, 3, 4, 5, 6 or more zinc fingers, each of which has a zinc finger recognition region capable of binding to a target site in the FUT8 gene. In some embodiments, the ZFP comprises five or six zinc fingers.

[0068] Herein, the term "target site" refers to the nucleotide sequence of a portion of the DNA of a target gene (eg, FUT8 gene) to which the ZFP or ZFN described herein will bind.

[0069] In some embodiments, the target site may include exon 3 of the FUT8 gene (the relevant sequence is shown in SEQ ID NO: 1). In some embodiments, the target site may include exon 10 of the FUT8 gene and its surrounding region (the relevant sequence is shown in SEQ ID NO: 2).

[0070] Herein, the zinc fingers in a ZFP are named using the format of "F + sequential numbers from the N-terminus to the C-terminus". For example, for a ZFP, the first zinc finger is named "F1", the second zinc finger is named "F2", and so on, in the order from the N-terminus to the C-terminus.

[0071] In some embodiments, one or more zinc fingers of the ZFP have an engineered zinc finger recognition region. In some embodiments, the ZFP has the amino acid sequence of the recognition region of the zinc finger (F1 to F5 or to F6) shown in the same row in Table 1:

[0072] Table 1. Zinc finger proteins targeting the FUT8 gene

[0073] In Table 1, each row describes a single ZFP. The name and DNA target sequence (in 5'-3' order) of each ZFP are shown in column 1, and the amino acid sequence of the recognition region of the zinc finger (F1 to F5 or to F6) in each ZFP is shown in columns 2 to 6 or 7.

[0074] In some embodiments, the multiple zinc fingers of the ZFP can be connected by a suitable linker sequence. In some embodiments, the linker sequence can include a linker that is 1, 2, 3, 4, 5 or more amino acids in length.

[0075] Further, the present invention also provides a ZFP pair, which includes a left ZFP and a right ZFP. The target site of the left ZFP in the ZFP pair is located on the opposite chain of the target gene DNA sequence at a nearby position (e.g., 5 to 10 nucleotide base pairs). For example, the left ZFP in the ZFP pair can bind to the target site on one strand (e.g., template strand or coding strand) of the target gene DNA sequence, while the right ZFP can bind to the target site on the opposite strand (e.g., coding strand or template strand) of the target gene DNA sequence that is located near the left ZFP target site (e.g., 5 to 20 nucleotide base pairs). In some embodiments, the target site of the left ZFP and the target site of the right ZFP are separated by 5 to 20 nucleotide base pairs, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotide base pairs.

[0076] In some embodiments, the left ZFP can have the following recognition region amino acid sequence (ZFP 32-L1):

[0077] F1: QLATLNR (SEQ ID NO: 13);

[0078] F2: TRWNLRA (SEQ ID NO: 14);

[0079] F3: SRRDLRR (SEQ ID NO: 15);

[0080] F4: WRRRRLS (SEQ ID NO: 16);

[0081] F5:RSDYLTN (SEQ ID NO: 17), and

[0082] F6: FHSNLLA (SEQ ID NO: 18).

[0083] In some embodiments, the left ZFP can have the following recognition region amino acid sequence (ZFP L3):

[0084] F1: SKWNLRS (SEQ ID NO: 24);

[0085] F2: AQSNLLS (SEQ ID NO: 25);

[0086] F3: LRHQLRR (SEQ ID NO: 26);

[0087] F4: RSDYLTN (SEQ ID NO: 17);

[0088] F5: RSDYLTN (SEQ ID NO: 17).

[0089] In some embodiments, the left ZFP can have the following recognition region amino acid sequence (ZFP S2-L):

[0090] F1: RADNLTE (SEQ ID NO: 30);

[0091] F2: TSGNLTE (SEQ ID NO: 31);

[0092] F3: TSGHLVR (SEQ ID NO: 32);

[0093] F4: RKDNLKN (SEQ ID NO: 33); and

[0094] F5: RKDNLKN (SEQ ID NO: 33).

[0095] In some embodiments, the left ZFP can have the following recognition region amino acid sequence (ZFP 31-L1):

[0096] F1: DRSNLLS (SEQ ID NO: 39);

[0097] F2: NQSNLLR (SEQ ID NO: 40);

[0098] F3: FHSNLLA (SEQ ID NO: 18);

[0099] F4: QLSTLNY (SEQ ID NO: 41); and

[0100] F5: QSGNLSR (SEQ ID NO: 42).

[0101] In some embodiments, the right ZFP can have the following recognition region amino acid sequence (ZFP 32-R1):

[0102] F1: RKSHLTM (SEQ ID NO: 19);

[0103] F2: FHSGLLA (SEQ ID NO: 20);

[0104] F3: WRRRRLS (SEQ ID NO: 16);

[0105] F4: RKYVLLR (SEQ ID NO: 21);

[0106] F5: RKDYLVL (SEQ ID NO: 22); and

[0107] F6: QQAGLIN (SEQ ID NO: 23).

[0108] In some embodiments, the right ZFP can have the following recognition region amino acid sequence (ZFP R3):

[0109] RSDYLTN (SEQ ID NO: 17);

[0110] QKITLVR (SEQ ID NO: 27);

[0111] RSDYLTN (SEQ ID NO: 17);

[0112] QLATLNR (SEQ ID NO: 13);

[0113] SRFNLTR (SEQ ID NO: 28); and

[0114] TKYILTN (SEQ ID NO: 29).

[0115] In some embodiments, the right ZFP can have the following recognition region amino acid sequence (ZFP S4-R):

[0116] RSDNLSV (SEQ ID NO: 34);

[0117] SPADLTR (SEQ ID NO: 35);

[0118] RSDHLSQ (SEQ ID NO: 36);

[0119] QSGDLRR (SEQ ID NO: 37);

[0120] RSDNLVR (SEQ ID NO: 38); and

[0121] RKDNLKN (SEQ ID NO: 33).

[0122] In some embodiments, the right ZFP can have the following recognition region amino acid sequence (ZFP 31-R1):

[0123] FHSGLLA (SEQ ID NO: 20);

[0124] HPSTLSK (SEQ ID NO: 43);

[0125] ARWTLDC (SEQ ID NO: 44);

[0126] HPSTLSK (SEQ ID NO: 43);

[0127] HPSTLSK (SEQ ID NO: 43); and

[0128] RKFTLTN (SEQ ID NO: 45).

[0129] In some embodiments, a ZFP pair can consist of ZFP 32-L1 and ZFP 32-R1. In some embodiments, a ZFP pair can consist of ZFP L3 and ZFP R3. In some embodiments, a ZFP pair can consist of ZFP S2-L and S4-R. In some embodiments, a ZFP pair can consist of ZFP 31-L1 and ZFP 31-R1.

[0130] B. Zinc finger nuclease

[0131] In another aspect, provided herein is a zinc finger nuclease (ZFN) targeting the FUT8 gene, which is a fusion protein comprising the ZFP described herein and at least one DNA cleavage domain or cleavage half-domain.

[0132] As used herein, the term "fusion protein" refers to a protein molecule in which two or more subunit molecules (eg, a ZFP and a DNA cleavage domain or cleavage half-domain as described herein) are linked to each other (preferably covalently).

[0133] As used herein, the term "cleavage" refers to the breaking of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods, including but not limited to enzymatic or chemical hydrolysis of phosphodiester bonds. In some embodiments, cleavage can be single-stranded or double-stranded. In some embodiments, double-stranded cleavage can be caused by two different single-stranded cleavage events. DNA cleavage can result in the generation of blunt ends or staggered ends. In certain embodiments, the ZFN is used to target double-stranded DNA cleavage.

[0134] As used herein, the term "cleavage half-domain" refers to a polypeptide sequence that can be conjugated with another polypeptide (the same or different) to form a complex with cleavage activity (preferably double-strand cleavage activity). In some embodiments, two cleavage half-domains typically dimerize (form a pair) to exert cleavage activity.

[0135] In some embodiments, the ZFP and at least one DNA cleavage domain or cleavage half-domain are operably linked.

[0136] As used herein, the term "operably linked" may refer to a component being linked to another component in a functional manner. For example, with respect to a fusion protein in which a ZFP is fused to a cleavage domain, the ZFP and cleavage domain are in an operably linked relationship if the ZFP in the fusion protein can bind to its target site and / or its binding site, and the cleavage domain can cleave DNA near the target site.

[0137] The zinc finger nucleases described herein can be used as tools for targeted cleavage and inactivation of target genes (such as the FUT8 gene) by introducing double-stranded DNA breaks (DSBs) at the target site of the target gene and utilizing non-homologous end joining (NHEJ)-mediated DSB repair to achieve the purpose of targeted knockout of the target gene.

[0138] Furthermore, the present invention also provides a ZFN pair comprising a left ZFN and a right ZFN. The left ZFN and the right ZFN are each formed by fusion of a ZFP described herein with at least one DNA cleavage domain or cleavage half-domain. For example, ZFN 32-L1 is a fusion protein comprising ZFP 32-L1 and at least one DNA cleavage domain or cleavage half-domain.

[0139] The target site of the left ZFN in the ZFN pair and the target site of the right ZFN are located on opposite strands of the target gene DNA sequence at similar positions (e.g., 5 to 10 nucleotide base pairs apart). For example, the left ZFN in the ZFN pair can bind to a target site on one strand (e.g., the template strand or the coding strand) of the target gene DNA sequence, while the right ZFN can bind to a target site on the opposite strand (e.g., the coding strand or the template strand) of the target gene DNA sequence that is located near the left ZFN target site (e.g., 5 to 20 nucleotide base pairs apart). In some embodiments, the target sites of the left ZFN and the right ZFN are separated by 5 to 20 nucleotide base pairs, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotide base pairs.

[0140] In some embodiments, the ZFN pair may consist of ZFN 32-L1 and ZFN 32-R1. In some embodiments, the ZFN pair may consist of ZFN L3 and ZFN R3. In some embodiments, the ZFN pair may consist of ZFN S2-L and S4-R. In some embodiments, the ZFN pair may consist of ZFN 31-L1 and ZFN 31-R1.

[0141] The cleavage domain portion of the fusion proteins disclosed herein can be obtained from any endonuclease or exonuclease. Exemplary endonucleases from which the cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, New England Biolabs 2002-2003 catalog, Beverly, MA; and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Other enzymes capable of cleaving DNA are known (e.g., S1 nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease; see also Linn et al. (eds.), Nucleases, Cold Spring Harbor Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains and cleavage half-domains.

[0142] Similarly, the cleavage half-domains can be derived from any nuclease or fragment thereof whose cleavage activity requires dimerization, as mentioned above. In general, if a fusion protein comprises a cleavage half-domain, two fusion proteins are required to perform cleavage. Optionally, a single protein comprising two cleavage half-domains can be used. The two cleavage half-domains can be derived from the same endonuclease (or a functional fragment thereof), or each cleavage half-domain can be derived from a different endonuclease (or a functional fragment thereof). In addition, the target sites of the two fusion proteins are configured such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation relative to each other that allows the cleavage half-domains to form a functional cleavage domain (e.g., by dimerization). Thus, in certain embodiments, the target sites can be separated by 5-20 or more nucleotide base pairs. In general, the cleavage site is located between the target sites.

[0143] Restriction endonucleases (restriction enzymes) are found in many species and can sequence-specifically bind to DNA (at a recognition site) and cleave the DNA at or near the binding site. Certain restriction enzymes (e.g., Type IIS) cleave DNA at a site distal to the recognition site and have separable binding and cleavage domains. Exemplary Type IIS restriction enzymes are described in International Publication No. WO 07 / 014275, which is incorporated herein by reference in its entirety. Thus, in one embodiment, the fusion protein comprises the zinc finger protein and the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme.

[0144] A cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity or retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.

[0145] In some embodiments, the Type IIS restriction enzyme is FokI. This enzyme is active as a dimer. Accordingly, in some embodiments, a portion of the FokI enzyme used in the fusion protein is considered a cleavage half-domain. Thus, for targeted double-stranded cleavage and / or targeted replacement of cellular sequences using zinc finger protein-FokI fusions, two fusion proteins, each comprising a FokI cleavage half-domain, can be used to reconstitute the catalytically active cleavage domain. Optionally, a single polypeptide molecule containing a zinc finger protein and two FokI cleavage half-domains can also be used. In some embodiments, the cleavage half-domain is a FokI cleavage half-domain. In some embodiments, the cleavage half-domain is a wild-type FokI cleavage half-domain. In other embodiments, the cleavage half-domain is a modified FokI cleavage half-domain.

[0146] In some exemplary embodiments, the cleavage half-domain is derived from Sharkey FokI nuclease by amino acid mutation based on wild-type FokI, and an exemplary amino acid sequence thereof is shown in SEQ ID NO:3.

[0147] The engineered cleavage half-domains described herein can be prepared using any suitable method, for example, by site-directed mutagenesis.

[0148] Other restriction enzymes comprising separable binding and cleavage domains are also contemplated herein. See, e.g., Roberts et al. (2003) Nucleic Acids Res. 31: 418-420.

[0149] In some embodiments, the cleavage domain can comprise one or more engineered cleavage half-domains (also referred to as dimerization domain mutants) that minimize or prevent homodimerization, such as described in U.S. Patent Publication Nos. 20050064474; 20060188987; and 20080131962, the disclosures of which are incorporated herein by reference in their entireties. Amino acid residues at positions 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 of FokI are targets for influencing dimerization of the FokI cleavage half-domain.

[0150] In some embodiments, exemplary engineered cleavage half-domains of FokI that form obligate heterodimers include pairs wherein a first cleavage half-domain includes mutations in amino acid residues at positions 490 and 538 of FokI, and a second cleavage half-domain includes mutations in amino acid residues 486 and 499.

[0151] In one embodiment, the mutation at position 490 replaces Glu (E) with Lys (K); the mutation at position 538 replaces Iso (I) with Lys (K); the mutation at position 486 replaces Gln (Q) with Glu (E); and the mutation at position 499 replaces Iso (I) with Lys (K). Specifically, the engineered cleavage half-domains described herein were prepared by mutating positions 490 (E→K) and 538 (I→K) in one cleavage half-domain to generate an engineered cleavage half-domain designated "E490K:I538K" and by mutating positions 486 (Q→E) and 499 (I→L) in the other cleavage half-domain to generate an engineered cleavage half-domain designated "Q486E:I499L." The engineered cleavage half-domains described herein are obligate heterodimer mutants in which aberrant cleavage is minimized or eliminated when one or more pairs of nucleases containing these cleavage half-domains are used for cleavage. See, for example, US Patent Publication No. 20080131962, the disclosure of which is incorporated by reference in its entirety for all purposes.

[0152] C. Delivery

[0153] The ZFNs described herein can be delivered to cells to inactivate the FUT8 gene in the cells. Delivery of the ZFNs to cells can be achieved by introducing a polynucleotide encoding the ZFN into the cells, wherein the polynucleotide is transcribed in the cells and the transcript is translated to produce the ZFN fusion protein. Protein expression in the cells can also involve trans-splicing, polypeptide cleavage, and polypeptide ligation.

[0154] Another aspect of the present invention provides a polynucleotide encoding a ZFP or ZFN as described herein. In some embodiments, the polynucleotide may be mRNA.

[0155] The ZFNs described herein can be delivered to target cells by a variety of suitable methods.

[0156] In some embodiments, a vector (or vector system) can be used to deliver the ZFN to target cells.

[0157] Another aspect of the present invention provides a vector comprising the polynucleotide as described above. Available vectors include, but are not limited to, one or more of the following: plasmid vectors, retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, poxvirus vectors, herpesvirus vectors, and the like.

[0158] In some embodiments, the vector may comprise a polynucleotide encoding one or more ZFNs. In some embodiments, the polynucleotide encoding one or more ZFNs may be located on one (the same) or multiple (different) vectors. In embodiments utilizing multiple vectors, each vector may comprise a polynucleotide encoding one or more ZFNs. In embodiments utilizing multiple vectors, each vector may be delivered to the target cell simultaneously or sequentially.

[0159] In some embodiments, the ZFNs can be delivered to target cells using non-vector delivery methods. Available non-vector delivery methods include, but are not limited to, electroporation, lipofection, microinjection, gene guns, liposomes, immunoliposomes, polycationic or lipid:nucleic acid conjugates, naked DNA, and agents that enhance DNA uptake. Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used to deliver polynucleotides encoding the ZFNs.

[0160] Another aspect herein provides an isolated cell (eg, a host cell) comprising a ZFP, ZFN, polynucleotide, or vector described herein.

[0161] Suitable cells include, but are not limited to, eukaryotic and prokaryotic cells and / or cell lines. Non-limiting examples of such cells or cell lines include: COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2 / 0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T) and perC6 cells and insect cells such as fall armyworm (Sf) or fungal cells such as saccharomyces cerevisiae, pichia pastoris and fission yeast. In some embodiments, the cell is a mammalian cell. In a specific embodiment, the cell is a Chinese hamster ovary cell (CHO cell). Progeny, variants and derivatives of these cell lines can also be used.

[0162] Another aspect herein provides a cell line in which the FUT8 gene is inactivated or partially inactivated, comprising a ZFP, ZFN, polynucleotide or vector described herein.

[0163] Also provided herein is a cell line in which the FUT8 gene is inactivated or partially inactivated, generated by using the ZFPs, ZFNs, polynucleotides and / or vectors described herein.

[0164] Also provided herein is a FUT8-deficient cell line comprising a nucleotide sequence at the FUT8 locus as set forth in one or more of SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, and SEQ ID NO: 59.

[0165] In some embodiments, the FUT8-deficient cell line comprises the nucleotide sequences set forth in SEQ ID NO: 52 and SEQ ID NO: 53 at the FUT8 locus. In some embodiments, the FUT8-deficient cell line comprises the nucleotide sequences set forth in SEQ ID NO: 54 and SEQ ID NO: 55 at the FUT8 locus. In some embodiments, the FUT8-deficient cell line comprises the nucleotide sequences set forth in SEQ ID NO: 56 and SEQ ID NO: 57 at the FUT8 locus. In some embodiments, the FUT8-deficient cell line comprises the nucleotide sequences set forth in SEQ ID NO: 58 and SEQ ID NO: 59 at the FUT8 locus.

[0166] Also provided herein is a FUT8-deficient cell line comprising an engineered FUT8 locus, wherein the engineered FUT8 locus can be detected by the following primer pair:

[0167] Primer pair (i):

[0168] Forward primer: AGCCTGAAGTACATAGCCGA (SEQ ID NO: 46); and

[0169] Reverse primer: TGCCACTGCTTCTATATACTGATTC (SEQ ID NO: 47);

[0170] and / or

[0171] Primer pair (ii):

[0172] Forward primer: GACGCACTGACAAAGTGGGA (SEQ ID NO: 48); and

[0173] Reverse primer: GGTCTGTTCCATCCCCAGAATG (SEQ ID NO: 49);

[0174] and / or

[0175] Primer pair (iii):

[0176] Forward primer: CTGTTGATTCCAGGTTCCCA (SEQ ID NO: 50); and

[0177] Reverse primer: TGTTACTTAAGCCCCAGGC (SEQ ID NO: 51).

[0178] In some embodiments, the assay uses an equivalent cell line with normal (non-deficient) FUT8 as a control cell line. In some embodiments, the assay shows differences in results (e.g., differences in molecular size and band brightness measured by electrophoresis) between the FUT8-deficient cell line and the control cell line.

[0179] D. Application

[0180] The ZFNs described herein can be used to inactivate the FUT8 gene in a cell. In some embodiments, inactivation comprises partial or complete inhibition of the expression of the FUT8 gene in the cell. The inactivation of the FUT8 gene can be achieved, for example, by a single cleavage event, by cleavage followed by non-homologous end joining, by cleavage at two sites followed by joining to delete the sequence between the two cleavage sites, by targeted recombination of missense or nonsense codons into the coding region, by targeted recombination of an unrelated sequence (i.e., a "stuffer" sequence) into the gene or its regulatory region to destroy the gene or regulatory region, or by targeted recombination of a splice acceptor sequence into an intron to cause mis-splicing of the transcript.

[0181] The ZFN-mediated inactivation (knockout or inhibition) described herein has a variety of applications.

[0182] Another aspect herein provides a method of generating a FUT8-deficient cell, the method comprising:

[0183] (a) introducing a polynucleotide encoding one or more ZFNs into a cell, wherein the ZFN comprises: (i) a ZFP as described herein that binds to a target site in a FUT8 gene in the cell; and (ii) a DNA cleavage domain or cleavage half-domain;

[0184] (b) expressing the ZFN in the cell, so that the ZFN binds to the target site and cleaves the FUT8 gene.

[0185] In some embodiments, the one or more ZFNs include a ZFN pair described herein.

[0186] In some embodiments, the method may further comprise introducing into the cell an additional nuclease having a target site in the FUT8 gene. Examples of the additional nuclease may include, for example, homing endonucleases and meganucleases.

[0187] Another aspect herein provides a method of generating a FUT8-deficient cell line, the method comprising:

[0188] (a) inactivating the endogenous FUT8 gene in the cell by the method for generating FUT8-deficient cells as described herein; and

[0189] (b) culturing the cells under conditions suitable for generating a FUT8-deficient cell line.

[0190] Exemplary homing endonucleases include I-Scel, I-Ceul, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-ScelI, I-PpoI, I-ScelIII, I-Crel, I-TevI, I-TevII, and I-TevIII, for which the recognition sequences are known. See also U.S. Pat. No. 5,420,032; U.S. Pat. No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene 82:115-118; Perler et al. (1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al. (1996) J Mol. Biol. 263:163-180; Argast et al. (1998) J. Mol. Biol. 280:345-353 and the New England Biolabs catalog.

[0191] Although the cleavage specificity of most homing endonucleases is not absolute with respect to their recognition sites, these sites are of sufficient length to allow a single cleavage event per mammalian-sized genome to be obtained by expressing the homing endonuclease in cells containing a single copy of its recognition site. It has also been reported that the specificity of homing endonucleases and meganucleases can be engineered to bind to non-natural target sites. See, e.g., Chevalier et al. (2002) Molec. Cell 10:895-905; Epinat et al. (2003) Nucleic Acids Res. 31:2952-2962; Ashworth et al. (2006) Nature 441:656-659; Paques et al. (2007) Current Gene Therapy 7:49-66.

[0192] Also provided herein are FUT8-deficient cell lines produced by the methods described herein for generating FUT8-deficient cell lines.

[0193] Another aspect of the present invention provides a method for cultivating a FUT8-deficient cell line, comprising:

[0194] (a) providing a FUT8-deficient cell line obtained as described herein; and

[0195] (b) culturing or expanding cells of the cell line.

[0196] Another aspect of the present invention provides a method for producing a target recombinant protein in a host cell, the method comprising:

[0197] (a) providing a FUT8-deficient cell as described herein,

[0198] (b) introducing an expression vector comprising a nucleic acid encoding the target recombinant protein into the cell, thereby producing the target recombinant protein.

[0199] Another aspect of the present invention provides a method for producing a recombinant protein of interest in a host cell, the method comprising:

[0200] (a) providing a cell comprising an endogenous FUT8 gene;

[0201] (b) inactivating the endogenous FUT8 gene in the cell by the method for generating FUT8-deficient cells as described herein; and

[0202] (c) introducing an expression vector comprising a nucleic acid encoding the target recombinant protein into the cell, thereby producing the target recombinant protein.

[0203] In some embodiments, the step of inactivating the endogenous FUT8 gene in the cell as described herein and the step of introducing an expression vector comprising a nucleic acid encoding the target recombinant protein into the cell can be performed in reverse order or simultaneously.

[0204] Suitable cells include, but are not limited to, eukaryotic and prokaryotic cells and / or cell lines. Non-limiting examples of such cells or cell lines include: COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2 / 0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T) and perC6 cells and insect cells such as fall armyworm (Sf) or fungal cells such as saccharomyces cerevisiae, pichia pastoris and fission yeast. In some embodiments, the cell is a mammalian cell. In a specific embodiment, the cell is a Chinese hamster ovary cell (CHO cell). Progeny, variants and derivatives of these cell lines can also be used. In some embodiments, the cell is a mammalian cell. In one embodiment, the cells are Chinese hamster ovary cells (CHO cells).

[0205] In some embodiments, the target recombinant protein comprises an Fc-containing recombinant protein. In some embodiments, the target recombinant protein is a defucosylated Fc-containing recombinant protein.

[0206] Another aspect herein provides the use of the ZFPs, ZFNs, polynucleotides, and vectors described herein for generating FUT8-deficient cells.

[0207] Another aspect herein provides use of a ZFP, ZFN, polynucleotide, vector, cell, or cell line described herein for producing a defucosylated Fc-containing recombinant protein.

[0208] Another aspect provided herein is the use of a ZFP, ZFN, polynucleotide, vector, cell, or cell line described herein for producing an antibody (eg, a monoclonal antibody) capable of eliciting an enhanced ADCC effect.

[0209] In some embodiments, the Fc-containing recombinant protein can be an antibody (eg, monoclonal antibody, polyclonal antibody) or an Fc fusion protein. The defucosylated Fc-containing recombinant protein provided by the method described herein exhibits enhanced effector function, particularly in the induction of ADCC.

[0210] Example

[0211] The technical solutions of the present invention will be described in more detail below with reference to specific embodiments. The following embodiments are merely illustrative and do not constitute any limitation or restriction on the technical solutions of the present invention. The specific materials, steps, conditions, values, or numerical ranges and other technical parameters in the following embodiments are merely examples and are not exhaustive or limiting.

[0212] In addition to the specific methods, equipment, and materials used in the embodiments, based on the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials in the prior art that are similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0213] The equipment and reagents used in the examples are listed in Table 2 and Table 3, respectively.

[0214] Table 2: List of experimental equipment

[0215] Table 3: List of experimental reagents

[0216] Example 1 FUT8 - / - Application of cell lines in the development of stable expression of adalimumab monoclonal antibody molecules

[0217] 1. Expression vector construction

[0218] 1.1 As exemplified in Figure 2A, the ZFP proteins L3 / R3 and S2-L / S4-R were constructed into separate groups on expression vectors. Transcription was initiated by a CMV promoter. The ZFP protein, acting as a DNA binding domain, was linked to the downstream FokI cleavage half-domain to form a complete protein, expressed from a single ORF. This expression vector failed resistance selection after transfection into CHO cells, so no eukaryotic selection marker was inserted into the plasmid construction. Figure 2B shows an exemplary sequence structure, in which five to six zinc finger recognition regions are sequentially inserted into a native zinc finger protein framework sequence (e.g., ZIF268 or SP1C) and linked to the FokI cleavage half-domain at the C-terminus. The full-length sequences of S2-L-FokI and S4-R-FokI used in this example are exemplified in SEQ ID NO: 60 and SEQ ID NO: 61. For other ZFP proteins, the corresponding zinc finger recognition regions were constructed in a similar manner within the same framework sequence and linked to FokI.

[0219] 1.2 The adalimumab HC sequence (SEQ ID NO: 4) was constructed into the expression vector pWX039-HC-Z-105 and linked to the zeocin resistance gene via the EMCV IRES. The adalimumab LC sequence (SEQ ID NO: 5) was constructed into the expression vector pWX040-LC-B-105 and placed upstream of the blasticidin resistance gene. The LC and resistance gene elements were in two independent reading frames, and the blasticidin resistance gene was driven by the SV40 promoter.

[0220] 2. Cell transfection and cell pool screening

[0221] 2.1 Take 1E7 CHO-K1 host cell suspension, add 30 μg of plasmid to 250 μL of DPBS solution and mix thoroughly. Thoroughly mix the plasmid solution and cell suspension before adding the mixture to an electroporation cuvette. Place the cuvette in the slot of a Biorad electroporator and perform electroporation according to the protocol for the host cells. After transfection, aspirate the cell suspension from the cuvette and transfer it to a T25 cell culture flask containing 7.5 mL of preheated unstressed culture medium. Incubate in a CO2 incubator at 36.5°C, 5% CO2, and 85% humidity.

[0222] 2.2 Forty-eight hours after transfection, the T25 culture flask was transferred to a CO2 incubator at 36.5°C. After 24 hours of static culture, a sample of 1E6 cells was collected for genomic DNA extraction and quantified using a micro-UV spectrophotometer. 100-200 ng of genomic DNA was used to amplify the target gene sequence using a high-fidelity DNA polymerase and appropriate primers (primer 2F: CTGTTGATTCCAGGTTCCCA (SEQ ID NO 50); primer R: TGTTACTTAAGCCCCAGGC (SEQ ID NO 51)). The system was then denatured and reannealed. After annealing, 1 μL of T7E1 enzyme (10 U / μL) was added to the system and incubated at 37°C for 15 minutes. After enzyme digestion, the digestion bands and editing efficiency were detected by 2% agarose gel electrophoresis.

[0223] 3. Clone Screening

[0224] Cell pools with viability restored to over 90% were isolated by limiting dilution for single clones. After approximately two weeks of static culture in 96-well plates, clones were transferred to 24-well plates and cultured for approximately two to three days before expansion in shake tubes. Sequencing of the FUT8 gene knockout in the cell lines was performed using NGS. Passaging was performed every two to four days in shake tubes at 36.5°C, 6% CO2, 85% humidity, and 225 rpm.

[0225] 4. Application of target cell lines in expressing monoclonal antibody molecules

[0226] 4.1 After the target cell lines (monoclones 154-F8ZFN-09-08 and 154-F8ZFN-10-02) were screened and recovered, the target cell lines and a cell line without FUT8 knockout (negative control group) were used as host cells. 1E7 cells and 20 μg of adalimumab HC and LC plasmids were taken. The cells and plasmid solution were mixed and transferred to an electroporation cuvette. Electroporation was performed using a Biorad electroporator with appropriate electroporation parameters selected according to the cell type. After electroporation, all cells were transferred to a shake tube containing preheated culture medium and cultured on a shaker at 36.5°C, 6% CO2, 85% humidity, and a rotation speed of 225 rpm.

[0227] 4.2 24 hours after transfection, add screening stress medium and continue culturing, subculturing every 2-4 days.

[0228] 4.3 After 3-4 weeks of continuous passage, when the viability of the cell pool recovered to more than 95%, the cells were inoculated into the production medium at a cell density of 4E5 / mL for fed-batch culture. Samples were taken on the 3rd, 5th, 7th, 9th and 11th days of culture to detect the viable cell density and viability, and feed and sugar were added. After 14 days of culture, the supernatant was harvested by centrifugation, and the titer level of the monoclonal antibody in the supernatant was detected by ProA-HPLC method. In addition, the harvested supernatant sample was further proA purified and then subjected to SEC-HPLC high polymer content detection, SDS Caliper and N-glycan-LC glycoform analysis. In this example, the negative control group was transfected with the monoclonal antibody vector in host cells in which the FUT8 gene was not knocked out.

[0229] 5 Experimental results

[0230] The results of the enzyme digestion experiment successfully verified that the ZFN plasmid can effectively remove the target gene sequence (Figure 3). The cell pool was analyzed by flow cytometry (Figure 4), and a certain proportion of FUT8 - / -Cell population. Through the clone screening process, clones 154-F8ZFN-09-08 and 154-F8ZFN-10-02 were successfully verified to have a pair of alleles knocked out (Figures 5 and 6). As can be seen from Figures 7A and 7B, the viable cell density and peak VCD of 154-F8ZFN-09-08 and 154-F8ZFN-10-02 during FB culture were comparable to those of the control group; Figure 7C showed that the monoclonal antibody expression titer of the 154-F8ZFN-09-08 group was not significantly different from that of the control group. In addition, SEC-HPLC and Caliper R / NR results showed that the high aggregation level of the one-step purified samples of the cell pools of the 154-F8ZFN-09-08 and 154-F8ZFN-10-02 groups was not significantly different from that of the control group (Figures 7D and 7E). Finally, the glycoform results ( Figure 7F ) show that the fucose levels in the 154-F8ZFN-09-08 and 154-F8ZFN-10-02 groups were much lower than that in the negative control group in which the FUT8 gene was not knocked out, and dropped to a level close to zero.

[0231] Example 2 FUT8 - / - Application of cell lines in the development of stable expression of fusion protein molecules Dulaglutide

[0232] 1. Expression vector construction

[0233] Dulaglutide is a glucagon-like peptide 1 (GLP-1) Fc fusion protein.

[0234] The sequence of dulaglutide (SEQ ID NO 6) was constructed into the expression vectors pWX039-Pr-Z-126A3 and pWX040-Pr-B-126A3. In the pWX039-Pr-Z-126A3 vector, the sequence of dulaglutide was connected to the Zeocin resistance gene via the EMCV IRES. In pWX040-Pr-B-126A3, the sequence of dulaglutide was placed upstream of the blasticidin resistance gene, with the target gene and resistance gene elements belonging to two independent reading frames, and the blasticidin resistance gene was driven by the SV40 promoter.

[0235] 2. Cell transfection and fed-batch culture

[0236] 2.1 154-F8ZFN-09-08, selected in Example 1, was used as the host cell. 1E7 cells were mixed with 20 μg of the expression vector and transferred to a cuvette for electroporation. Electroporation was performed using a Biorad electroporator using appropriate parameters for the cell type. After electroporation, all cells were transferred to a shake tube containing preheated culture medium and cultured on a shaker at 36.5°C, 6% CO2, 85% humidity, and 225 rpm.

[0237] 2.2 24 hours after transfection, add an equal volume of screening pressure medium and continue culturing, subculturing every 2-4 days.

[0238] 2.3 After 3-4 weeks of continuous passage, the cell pool was seeded into production medium at a cell density of 4E5 / mL for fed-batch culture. Samples were taken on days 3, 5, 7, 9, and 11 to determine viable cell density and viability, and feed and sugar supplementation were performed. After 14 days of culture, the supernatant was harvested by centrifugation and the monoclonal antibody titer in the supernatant was determined using ProA-HPLC. In addition, the harvested supernatant sample was further purified by ProA and then subjected to SEC HPLC for high polymer content, SDS Caliper NR for purity, and N-glycan glycoform analysis. In this example, the positive control group consisted of host cells in which the FUT8 gene was knocked out and transfected with the fusion protein vector.

[0239] 3 Experimental results

[0240] Figure 8A shows that the viable cell density and viability of the 154-F8ZFN-09-08 group during FB culture were within acceptable ranges. Figures 8C, D, and E demonstrate that the protein expression titer, main SEC-HPLC peak, and SDS CaliperNR main peak of the 154-F8ZFN-09-08 group were not significantly different from those of the control group. Finally, glycoformulation results (Figure 8E) revealed that the fucose level in the 154-F8ZFN-09-08 group was significantly lower than that of the negative control group in which the FUT8 gene was not knocked out, reaching near-zero levels.

[0241] Example 3 ZFN editing at exon 3

[0242] 1. Expression vector construction

[0243] 1.1 As shown in FIG2A , similarly to Example 1, the ZFP proteins 31-L1 / 31-R1 and 32-L1 / 32-R1 were constructed as a group on expression vectors.

[0244] 2. Cell transfection and cell population (library) screening

[0245] 2.2 1×10 7 Mix 100 CHO-K1 cells with the 32-L1 / 32-R1 and 31-L1 / 31-R1 plasmids and transfect them using the WE program in a Bio-rad electroporator. After transfection, recover the cells in 5 mL of CD CHO medium and culture them in a static incubator at 30°C.

[0246] 2.3 On the second day after transfection, cells were harvested and genomic DNA was prepared. The targeted region of the FUT8 gene was amplified using primers Fut8-EX3-F1 (SEQ ID NO: 46) and Fut8-EX3-R1 (SEQ ID NO: 47). Finally, the gene editing efficiency was assessed using the T7E1 kit. As shown in lane 2 of Figure 9, based on the calculation of band intensities using ImageJ, modification of the FUT8 exon 3 region by 32-L1 / 32-R1 resulted in 10.9% DNA mutations. As shown in lane 1, modification of the FUT8 exon 3 region by 31-L1 / 31-R1 resulted in 9.4% DNA mutations.

[0247] 3 Monoclonal screening

[0248] On the 34th day after transfection, SCP monoclonal sorting was performed. All grown monoclonal clones were stained with LCA-FITC, and finally 2 FUT8 - / - The phenotypic single clones C6 and F2 (Figures 10 and 11) were sequenced and the sequencing results of these two clones are shown in Figure 12, indicating that both alleles were knocked out.

[0249] Example 4 FUT8 knockout by ZFN - / - The ADCC activity of the cloned antibody was significantly improved

[0250] 1. Protein Expression

[0251] The FUT8 obtained according to the method described herein - / - The double knockout clone (154-F8ZFN-09-08) was used as the host cell, and wild-type CHO cells without mutation were used as the control. Adalimumab was expressed and purified according to the aforementioned method.

[0252] 2. Target Cell Labeling

[0253] TNFα-expressing HT1080 cells were first labeled with DELFIA BATDA (Cat# C136-100, Perkin Elmer, China) in a 37°C, 5% CO2 humidified incubator for 30-40 minutes. After incubation, the HT1080 cells were centrifuged and washed with assay medium and then resuspended in assay medium (RPMI 1640 + 10% HI-FBS).

[0254] 3. Co-incubation of target cells and effector cells

[0255] Peripheral blood mononuclear cells (PBMC) were resuspended in assay medium. 6 PBMCs and 1×10 4HT1080 cells expressing TNFα were fully mixed, 0 to 50 ng / mL anti-TNFα therapeutic antibody samples were added, and the cells were co-cultured in a 96-well plate at 200 μL / well in a 37° C., 5% CO 2 incubator for 1 to 2 hours.

[0256] 4. Supernatant Reaction

[0257] After centrifugation at 500 × g for 3–5 minutes, 20 μL of supernatant was removed from each well and transferred to the corresponding well in a 96-well white microplate (3912, Corning, USA). Subsequently, 200 μL of DELFIA europium solution (Cat# C135-100, Perkin Elmer, China) was added to each well, and the plate was incubated for 20–30 minutes.

[0258] 5. Data Processing

[0259] Data were collected on a microplate reader M5e (Molecular Devices, California, USA). Relative fluorescence units (RFU) were plotted against antibody concentration to generate a 4-parameter logistic response curve. When all system and sample suitability conditions were met, the relative efficacy of the samples was calculated using the EC50 ratio. As shown in Figure 13, FUT8 - / - The ADCC activity of adalimumab produced by the double knockout host was significantly higher than that of the same protein produced by the control wild-type CHO host.

Claims

1. A zinc finger protein capable of targeting and binding to the FUT8 gene, comprising, from N-terminus to C-terminus, the amino acid sequences of the zinc finger recognition regions of zinc fingers F1 to F5 or F6 as shown in the following table:

2. A zinc finger nuclease comprising the zinc finger protein according to claim 1 and at least one DNA cleavage domain or cleavage half-domain. A polynucleotide encoding the zinc finger protein according to claim 1 . A polynucleotide encoding the zinc finger nuclease according to claim 2 . A vector comprising the polynucleotide according to claim 3 or 4. 6 . An isolated cell comprising the zinc finger protein according to claim 1 , the zinc finger nuclease according to claim 2 , the polynucleotide according to claim 3 or 4 , or the vector according to claim 5 .

7. A method for generating FUT8-deficient cells, the method comprising: (a) introducing a polynucleotide encoding one or more zinc finger nucleases according to claim 2 into a cell; (b) expressing the zinc finger nuclease in the cell, so that the zinc finger nuclease binds to the target site and cleaves the FUT8 gene.

8. The method according to claim 7, wherein: In step (a), a zinc finger nuclease pair comprising a left zinc finger nuclease and a right zinc finger nuclease is introduced into the cell, wherein the zinc finger nuclease pair comprises: Zinc finger nuclease pair (a): Left zinc finger nuclease with the following zinc finger recognition region amino acid sequence: F1: QLATLNR (SEQ ID NO: 13); F2: TRWNLRA (SEQ ID NO: 14); F3: SRRDLRR (SEQ ID NO: 15); F4: WRRRRLS (SEQ ID NO: 16); F5:RSDYLTN (SEQ ID NO: 17); and F6: FHSNLLA (SEQ ID NO: 18); and Right zinc finger nuclease having the following zinc finger recognition region amino acid sequence: F1: RKSHLTM (SEQ ID NO: 19); F2: FHSGLLA (SEQ ID NO: 20); F3: WRRRRLS (SEQ ID NO: 16); F4: RKYVLLR (SEQ ID NO: 21); F5: RKDYLVL (SEQ ID NO: 22); and F6: QQAGLIN (SEQ ID NO: 23); and / or Zinc finger nuclease pair (b): Left zinc finger nuclease with the following zinc finger recognition region amino acid sequence: F1: SKWNLRS (SEQ ID NO: 24); F2: AQSNLLS (SEQ ID NO: 25); F3: LRHQLRR (SEQ ID NO: 26); F4:RSDYLTN (SEQ ID NO: 17); and F5: RSDYLTN (SEQ ID NO: 17); and Right zinc finger nuclease having the following zinc finger recognition region amino acid sequence: RSDYLTN (SEQ ID NO: 17); QKITLVR (SEQ ID NO: 27); RSDYLTN (SEQ ID NO: 17); QLATLNR (SEQ ID NO: 13); SRFNLTR (SEQ ID NO: 28); and TKYILTN (SEQ ID NO: 29); and / or Zinc finger nuclease pair (c): Left zinc finger nuclease with the following zinc finger recognition region amino acid sequence: F1: RADNLTE (SEQ ID NO: 30); F2: TSGNLTE (SEQ ID NO: 31); F3: TSGHLVR (SEQ ID NO: 32); F4: RKDNLKN (SEQ ID NO: 33); and F5: RKDNLKN (SEQ ID NO: 33); and Right zinc finger nuclease having the following zinc finger recognition region amino acid sequence: RSDNLSV (SEQ ID NO: 34); SPADLTR (SEQ ID NO: 35); RSDHLSQ (SEQ ID NO: 36); QSGDLRR (SEQ ID NO: 37); RSDNLVR (SEQ ID NO: 38); and RKDNLKN (SEQ ID NO: 33); and / or Zinc finger nuclease pair (d): Left zinc finger nuclease with the following zinc finger recognition region amino acid sequence: F1: DRSNLLS (SEQ ID NO: 39); F2: NQSNLLR (SEQ ID NO: 40); F3: FHSNLLA (SEQ ID NO: 18); F4: QLSTLNY (SEQ ID NO: 41); and F5: QSGNLSR (SEQ ID NO: 42); or Right zinc finger nuclease having the following zinc finger recognition region amino acid sequence: FHSGLLA (SEQ ID NO: 20); HPSTLSK (SEQ ID NO: 43); ARWTLDC (SEQ ID NO: 44); HPSTLSK (SEQ ID NO: 43); HPSTLSK (SEQ ID NO: 43); and RKFTLTN (SEQ ID NO: 45).

9. A method for generating a FUT8-deficient cell line, the method comprising: (a) inactivating the FUT8 gene in a cell by the method according to claim 7; and (b) culturing the cells under conditions suitable for generating a FUT8-deficient cell line; Specifically, the cell is a mammalian cell; more specifically, the cell is a CHO cell.

10. A method for producing a target recombinant protein in a host cell, the method comprising: (a) providing the cell according to claim 6, wherein the cell is a FUT8-deficient cell, (b) introducing an expression vector comprising a nucleic acid encoding the target recombinant protein into the cell, thereby producing the target recombinant protein; Specifically, the cell is a mammalian cell; more specifically, the cell is a CHO cell.

11. A method for producing a target recombinant protein in a host cell, the method comprising: (a) providing a cell comprising an endogenous FUT8 gene; (b) inactivating the endogenous FUT8 gene in the cell by the method according to claim 7; and (c) introducing an expression vector comprising a nucleic acid encoding the target recombinant protein into the cell, thereby producing the target recombinant protein; More specifically, step (b) is performed before, simultaneously with or after step (c). 12 . Use of the zinc finger protein according to claim 1 , the zinc finger nuclease according to claim 2 , the polynucleotide according to claim 3 or 4 , or the vector according to claim 5 for generating FUT8-deficient cells.

13. Use of the zinc finger protein according to claim 1, the zinc finger nuclease according to claim 2, the polynucleotide according to claim 3 or 4, the vector according to claim 5 or the cell according to claim 6 for producing a defucosylated Fc-containing recombinant protein.

14. Use of the zinc finger protein according to claim 1, the zinc finger nuclease according to claim 2, the polynucleotide according to claim 3 or 4, the vector according to claim 5 or the cell according to claim 6 for producing an antibody (such as a monoclonal antibody) capable of eliciting an enhanced ADCC effect. 15 . A FUT8-deficient cell line prepared according to the method of claim 9 .

16. A FUT8-deficient cell line comprising the nucleotide sequence shown in one or more of SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58 and SEQ ID NO: 59 at the FUT8 locus.

17. A FUT8-deficient cell line comprising an engineered FUT8 locus, wherein the engineered FUT8 locus can be detected by the following primer pair: Primer pair (i): Forward primer: AGCCTGAAGTACATAGCCGA (SEQ ID NO: 46); and Reverse primer: TGCCACTGCTTCTATATACTGATTC (SEQ ID NO: 47); and / or Primer pair (ii): Forward primer: GACGCACTGACAAAGTGGGA (SEQ ID NO: 48); and Reverse primer: GGTCTGTTCCATCCCCAGAATG (SEQ ID NO: 49); and / or Primer pair (iii): Forward primer: CTGTTGATTCCAGGTTCCCA (SEQ ID NO: 50); and Reverse primer: TGTTACTTAAGCCCCAGGC (SEQ ID NO: 51).

18. A method for cultivating a FUT8-deficient cell line, comprising: (a) providing a FUT8-deficient cell line according to any one of claims 15 to 17; and (b) culturing or expanding cells of the cell line.

Citation Information

Patent Citations

  • Methods and compositions for targeted cleavage and recombination

    US20050064474A1

  • Targeted deletion of cellular DNA sequences

    US20060188987A1

  • Engineered cleavage half-domains

    US20080131962A1

  • Homing endonuclease which originates from chlamydomonas eugametos and recognizes and cleaves a 15, 17 or 19 degenerate double stranded nucleotide sequence

    US5420032A

  • Nucleotide sequence encoding the enzyme I-SCEI and the uses thereof

    US6833252B1