Targeting compound for use in delivery and use thereof

Abstract

Disclosed in the present invention is a compound represented by formula (I) or a stereoisomer, a tautomer, or a pharmaceutically acceptable salt thereof.

Description

Targeted compounds for delivery and uses thereof

[0001] Priority information

[0002] This application claims priority and benefits of patent application 202311834901.6 filed with the State Intellectual Property Office of China on December 27, 2023, patent application 202410695515.1 filed with the State Intellectual Property Office of China on May 30, 2024, and patent application 202411253447.X filed with the State Intellectual Property Office of China on September 6, 2024, and incorporates the entire text of each of them herein by reference. Technical Field

[0003] The present invention relates to the field of biomedicine technology, and in particular to a targeted compound for delivery and uses thereof. Background Art

[0004] Nucleic acid drugs (such as siRNA and ASOs) are playing an increasingly important role in gene therapy. They specifically target pathogenic genes or proteins by binding or cleaving nucleic acid sequences, thereby inhibiting or promoting the expression of certain genes or proteins. Ligand compounds are one of the core technologies in the development of nucleic acid drugs. By conjugating with nucleic acids, they can carry nucleic acids for targeted delivery to target cells. Therefore, there is an urgent need to develop new targeted compounds. Summary of the Invention

[0005] The present invention aims to, to a certain extent, solve one of the technical problems existing in the prior art. To this end, the present invention provides a targeted compound for delivering an active drug, which can carry the active drug and deliver it to a target cell. In particular, the present invention provides a targeted compound for delivering a nucleic acid, which can carry an oligonucleotide (e.g., siRNA) and deliver it to a target cell.

[0006] In the first aspect of the present invention, the present invention provides a compound represented by formula (I) or its stereoisomers, tautomers or pharmaceutically acceptable salts:

[0007] Wherein, L1 is -N(R1)-C(O)-(C 1-10 Alkylene)-, or -N(G4)-L2-;

[0008] L2 is C replaced by R1 1-6 alkylene;

[0009] G1, G2, G3, G4 are

[0010] R2 is a substituted or unsubstituted sugar residue;

[0011] R1 is -(C 0-10 Alkylene)-C(O)-R 10 ;

[0012] R 10 For the leaving group.

[0013] According to an embodiment of the present invention, L2 is C substituted by R1. 2-4 Alkylene.

[0014] According to an embodiment of the present invention, L2 is -CH2-CH(R1)-CH2-.

[0015] According to an embodiment of the present invention, L1 is -N(R1)-C(O)-(C 1-6 alkylene)-.

[0016] According to an embodiment of the present invention, L1 is -N(R1)-C(O)-(C 1-6 Alkylene)-, R1 is -(C 1-6 Alkylene)-C(O)-R 10 .

[0017] According to an embodiment of the present invention, L1 is -N(G4)-CH2-CH(R1)-CH2-.

[0018] According to an embodiment of the present invention, L1 is -N(G4)-CH2-C(R1)H-CH2-, R1 is -C(O)-R 10 .

[0019] According to an embodiment of the present invention, R1 is -(C 0-6 Alkylene)-C(O)-R 10 .

[0020] According to an embodiment of the present invention, R 10 Selected from

[0021] According to an embodiment of the present invention, The group is

[0022] According to an embodiment of the present invention, R1 is

[0023] According to an embodiment of the present invention, The group is

[0024] According to an embodiment of the present invention, The group is

[0025] According to an embodiment of the present invention, the sugar is glucose, lactose, galactose, or fructose.

[0026] According to an embodiment of the present invention, in G1, G2, G3 and G4, each R2 is independently selected from the residues of the following compounds: N-acetylgalactosamine (GalNAc), N-trifluoroacetylgalactosamine, N-formyl-galactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, and N-isobutyrylgalactosamine.

[0027] According to an embodiment of the present invention, in G1, G2, G3 and G4, R2 is the same.

[0028] According to an embodiment of the present invention, G1, G2, G3, and G4 are

[0029] According to an embodiment of the present invention, G1, G2, G3, and G4 are

[0030] According to an embodiment of the present invention, the compound represented by formula (I) has a structure represented by formula (Ia):

[0031] Wherein, R1 is -(C 1-6 Alkylene)-C(O)-R 10 ;

[0032] G1, G2, G3, and G4 are as described above.

[0033] According to an embodiment of the present invention, in the formula (Ia), R1 is

[0034] G1, G2, G3, G4 are

[0035] According to an embodiment of the present invention, in the formula (Ia), R1 is

[0036] G1, G2, G3, G4 are

[0037] According to an embodiment of the present invention, the compound represented by formula (I) has a structure represented by formula (Ib):

[0038] Wherein, R1 is -C(O)-R 10 ;

[0039] G1, G2, G3, and G4 are as described above.

[0040] According to an embodiment of the present invention, in formula (Ib), R1 is

[0041] G1, G2, G3, G4 are

[0042] According to an embodiment of the present invention, in formula (Ib), R1 is

[0043] G1, G2, G3, G4 are

[0044] According to an embodiment of the present invention, the compound represented by formula (I) has the following structure:

[0045] In the second aspect of the present invention, the present invention provides a compound or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof, which has a structure shown in formula (II):

[0046] Wherein, L1' is -N(R1')-C(O)-(C 1-10 Alkylene)-, or -N(G4)-L2'-;

[0047] L2' is C substituted by R1' 1-6 alkylene;

[0048] G1, G2, G3, G4 are

[0049] R2 is a substituted or unsubstituted sugar residue;

[0050] R1' is n is any integer between 0 and 10;

[0051] X is empty or a connector;

[0052] The linker is -NH-(C 1-10 Alkylene)-O-, -NH-(C 1-10 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-, optionally substituted by one or more R a -C 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-O-, or optionally one or more R a -C substituted with a group 4～10 Heterocycloalkylene-(C1-6 Alkylene)-S-, the R a The groups are each independently selected from -OH, -C 1-6 Alkylene.

[0053] According to an embodiment of the present invention, X is a linker.

[0054] The structure represented by formula (II) of the present invention can be used as a ligand targeting liver cells, and in particular can promote the targeting and delivery of nucleic acid drugs, so that the nucleic acid is connected to the desired cells and / or tissues in the body (for example, targeted delivery oligonucleotides to target and silence target genes in target cells and / or tissues), thereby effectively preventing and / or treating related diseases.

[0055] According to an embodiment of the present invention, L2' is C substituted by R1' 2-4 Alkylene.

[0056] According to an embodiment of the present invention, L2' is -CH2-CH(R1')-CH2-.

[0057] According to an embodiment of the present invention, n is any integer between 0 and 6.

[0058] According to an embodiment of the present invention, L1' is -N(R1')-C(O)-(C 1-6 alkylene)-, -N(G4)-CH2-CH(R1')-CH2-.

[0059] According to an embodiment of the present invention, L1' is -N(R1')-C(O)-(C 1-6 alkylene)-.

[0060] According to an embodiment of the present invention, L1' is -N(R1')-C(O)-(C 1-6 alkylene)-, n is any integer between 1 and 6.

[0061] According to an embodiment of the present invention, L1′ is —N(G4)-CH2-CH(R1′)-CH2-.

[0062] According to an embodiment of the present invention, L1′ is —N(G4)-CH2-CH(R1′)-CH2-, and n is 0.

[0063] According to an embodiment of the present invention, the linker is -NH-(C 1-10 Alkylene)-O-, -NH-(C 1-10 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-, -C- optionally substituted with one or more -OH 4～10 Heterocycloalkylene-(C1-6 Alkylene)-O-, or -C 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-S-.

[0064] According to an embodiment of the present invention, the linker is -NH-(C 4-8 Alkylene)-O-, -NH-(C 4-8 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-, -C- optionally substituted with one or more -OH 4～10 Heterocycloalkylene-(C 1-3 Alkylene)-O-, or -C 4～10 Heterocycloalkylene-(C 1-3 Alkylene)-S-.

[0065] According to an embodiment of the present invention, the linker is -NH-(C 1-10 Alkylene)-O-, -NH-(C 1-10 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-.

[0066] According to an embodiment of the present invention, the linker is -NH-C 4-8 Alkylene-O-, -C 4～10 Heterocycloalkylene-O-, optionally substituted by hydroxy-C 4～10 Heterocycloalkylene-(C 1-3 Alkylene)-O-.

[0067] According to an embodiment of the present invention, the linker is -NH-C 4-8 Alkylene-O-, -C 4～8 Heterocycloalkylene-O-, optionally substituted by hydroxy-C 4～8 Heterocycloalkylene-CH2-O-.

[0068] According to an embodiment of the present invention, the connector is

[0069] According to an embodiment of the present invention, the connector is

[0070] According to an embodiment of the present invention, R1' is selected from -(C 0-10 Alkylene)-C(O)-NH-(C 1-10 Alkylene)-O-, -(C 0-10Alkylene)-C(O)-NH-(C 1-10 Alkylene)-S-, -(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-O-, -(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-S-, -(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-O-, -(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-S-, wherein -(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-O-, and -(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-(C 1-6 C in alkylene)-S- 4～10 Heterocycloalkylene groups are optionally substituted with one or more -OH groups.

[0071] According to an embodiment of the present invention, R1' is selected from

[0072] According to an embodiment of the present invention, R1' is selected from

[0073] According to an embodiment of the present invention, the sugar is glucose, lactose, galactose, or fructose.

[0074] According to an embodiment of the present invention, in G1, G2, G3 and G4, each R2 is independently selected from the residues of the following compounds: N-acetylgalactosamine (GalNAc), N-trifluoroacetylgalactosamine, N-formyl-galactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, and N-isobutyrylgalactosamine.

[0075] According to an embodiment of the present invention, in G1, G2, G3 and G4, R2 is the same.

[0076] According to an embodiment of the present invention, G1, G2, G3, and G4 are

[0077] According to an embodiment of the present invention, G1, G2, G3, and G4 are

[0078] According to an embodiment of the present invention, the compound has a structure shown in formula (IIa):

[0079] Among them, R1' is n is any integer between 1 and 6;

[0080] G1, G2, G3, and G4 are as described above.

[0081] According to an embodiment of the present invention, in formula (IIa), R1' is selected from

[0082] G1, G2, G3, G4 are

[0083] According to an embodiment of the present invention, in formula (IIa), R1' is selected from

[0084] G1, G2, G3, G4 are

[0085] According to an embodiment of the present invention, the compound has a structure shown in formula (IIb):

[0086] Among them, R1' is n is 0;

[0087] G1, G2, G3, and G4 are as described above.

[0088] According to an embodiment of the present invention, in formula (IIb), R1' is selected from

[0089] G1, G2, G3, G4 are

[0090] According to an embodiment of the present invention, in formula (IIb), R1' is selected from

[0091] G1, G2, G3, G4 are

[0092] According to an embodiment of the present invention, the compound has the following structure:

[0093] In the third aspect of the present invention, the present invention provides a use of the compound described in the first or second aspect or its stereoisomers, tautomers or pharmaceutically acceptable salts in the preparation of a drug.

[0094] According to an embodiment of the present invention, the drug is used to target liver cells and / or kidney cells.

[0095] According to an embodiment of the present invention, the drug is used for targeted delivery of active drugs to cells.

[0096] According to an embodiment of the present invention, the drug is used to deliver oligonucleotides to cells. The above-mentioned compound of the present invention or its stereoisomers, tautomers or pharmaceutically acceptable salts can be conjugated with drugs such as oligonucleotides as targeting ligands for the targeting and delivery of nucleic acid drugs, so that the nucleic acid is connected to the desired cells and / or tissues in the body (e.g., targeted delivery oligonucleotides to target and silence target genes in target cells and / or tissues), thereby effectively preventing and / or treating related diseases.

[0097] According to an embodiment of the present invention, the cells are preferably liver cells and / or kidney cells.

[0098] According to an embodiment of the present invention, the drug is used to reduce the expression or activity of a target gene.

[0099] In a fourth aspect, the present invention further provides a conjugate. According to an embodiment of the present invention, the conjugate comprises an active drug and a ligand conjugated to the active drug; wherein the ligand is selected from the structure represented by formula (II) defined in the compound described in the second aspect, or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof.

[0100] The present invention provides a conjugate. According to an embodiment of the present invention, the conjugate comprises an oligonucleotide and a ligand conjugated to the oligonucleotide; wherein the ligand is selected from the structure represented by formula (II) defined in the compound described in the second aspect or its stereoisomers, tautomers, or pharmaceutically acceptable salts.

[0101] According to an embodiment of the present invention, the conjugate may further include at least one of the following technical features:

[0102] According to an embodiment of the present invention, the conjugate is obtained by reacting an active drug (such as an oligonucleotide) with the structure shown in formula (I) defined in the compound described in the first aspect or its stereoisomers, tautomers or pharmaceutically acceptable salts, or by connecting it with the structure shown in formula (II) defined in the compound described in the second aspect or its stereoisomers, tautomers or pharmaceutically acceptable salts.

[0103] According to an embodiment of the present invention, the oligonucleotides include siRNA, miRNA, and ASO.

[0104] In an optional embodiment of the present invention, the oligonucleotide is siRNA.

[0105] According to an embodiment of the present invention, the conjugate has one or more of the following characteristics:

[0106] i) the ligand is linked to the sense strand and / or antisense strand in the siRNA;

[0107] ii) the ligand is linked to the sense strand and / or antisense strand via a phosphorothioate bond or a phosphate bond;

[0108] iii) the ligand is linked to the 5' end or the 3' end of the sense strand;

[0109] iv) The ligand is linked to the 5' end or the 3' end of the antisense strand.

[0110] According to an embodiment of the present invention, the ligand is connected to the oligonucleotide via the R1' group in the ligand.

[0111] According to an embodiment of the present invention, the ligand is connected to the oligonucleotide via a linker of the R1' group in the ligand.

[0112] According to an embodiment of the present invention, the conjugate includes a compound represented by formula (III) or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof:

[0113] Wherein, L1" is -N(R1")-C(O)-(C 1-10 Alkylene)-, or -N(G4)-L2"-;

[0114] L2" is C replaced by R1" 1-6 alkylene;

[0115] G1, G2, G3, G4 are

[0116] R2 is a substituted or unsubstituted sugar residue;

[0117] R1" is -(C 0-10 Alkylene)-C(O)-Linker-R 12 ;

[0118] The linker is -NH-(C 1-10 Alkylene)-O-, -NH-(C 1-10 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-, optionally substituted by one or more R a -C substituted with a group 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-O-, or optionally one or more Ra -C substituted with a group 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-S-, the R a The groups are each independently selected from -OH, -C 1-6 alkylene;

[0119] R 12 is an active drug, preferably an oligonucleotide.

[0120] According to an embodiment of the present invention, R 12 For siRNA.

[0121] According to an embodiment of the present invention, L2" is C substituted by R1". 2-4 Alkylene.

[0122] According to an embodiment of the present invention, L2" is -CH2-CH(R1")-CH2-.

[0123] According to an embodiment of the present invention, L1" is -N(R1")-C(O)-(C 1-6 alkylene)-.

[0124] According to an embodiment of the present invention, L1" is -N(R1")-C(O)-(C 1-6 Alkylene)-, R1" is -(C 1-6 Alkylene)-C(O)-Linker-R 12 .

[0125] According to an embodiment of the present invention, L1″ is -N(G4)-CH2-CH(R1″)-CH2-.

[0126] According to an embodiment of the present invention, L1" is -N(G4)-CH2-CH(R1")-CH2-, R1" is -C(O)-linker-R 12 .

[0127] According to an embodiment of the present invention, R1" is -(C 0-6 Alkylene)-C(O)-R 12 .

[0128] According to an embodiment of the present invention, the linker is -NH-(C 1-10 Alkylene)-O-, -NH-(C 1-10 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-, -C- optionally substituted with one or more -OH 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-O-, or -C4～10 Heterocycloalkylene-(C 1-6 Alkylene)-S-.

[0129] According to an embodiment of the present invention, the linker is -NH-(C 4-8 Alkylene)-O-, -NH-(C 4-8 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-, -C- optionally substituted with one or more -OH 4～10 Heterocycloalkylene-(C 1-3 Alkylene)-O-, or -C 4～10 Heterocycloalkylene-(C 1-3 Alkylene)-S-.

[0130] According to an embodiment of the present invention, the linker is -NH-(C 1-10 Alkylene)-O-, -NH-(C 1-10 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-.

[0131] According to an embodiment of the present invention, the linker is -NH-(C 4-8 Alkylene)-O-, -C 4～10 Heterocycloalkylene-O-, optionally substituted by hydroxy-C 4～10 Heterocycloalkylene-CH2-O-.

[0132] According to an embodiment of the present invention, the connector is

[0133] According to an embodiment of the present invention, the connector is

[0134] According to an embodiment of the present invention, R1" is selected from -(C 0-10 Alkylene)-C(O)-NH-(C 1-10 Alkylene)-OR 12 、-(C 0-10 Alkylene)-C(O)-NH-(C 1-10 Alkylene)-SR 12 、-(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-OR 12 、-(C 0-10 Alkylene)-C(O)-C4～10 Heterocycloalkylene-(C 1-6 Alkylene)-SR 12 、-(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-OR 12 、-(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-SR 12 , where -(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-OR 12 、-(C 0-10 Alkylene)-C(O)-C 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-SR 12 C in 4～10 Heterocycloalkylene groups are optionally substituted with one or more -OH groups.

[0135] According to an embodiment of the present invention, R1" is selected from

[0136] According to an embodiment of the present invention, R1" is selected from

[0137] According to an embodiment of the present invention, R 12 ASO, siRNA, and miRNA.

[0138] According to an embodiment of the present invention, the sugar is glucose, lactose, galactose, or fructose.

[0139] According to an embodiment of the present invention, in G1, G2, G3 and G4, each R2 is independently selected from the residues of the following compounds: N-acetylgalactosamine (GalNAc), N-trifluoroacetylgalactosamine, N-formyl-galactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, and N-isobutyrylgalactosamine.

[0140] According to an embodiment of the present invention, in G1, G2, G3 and G4, R2 is the same.

[0141] According to an embodiment of the present invention, G1, G2, G3, and G4 are

[0142] According to an embodiment of the present invention, G1, G2, G3, and G4 are

[0143] According to an embodiment of the present invention, the compound represented by formula (III) has a structure represented by formula (IIIa):

[0144] Wherein, R1" is -(C 1-6 Alkylene)-C(O)-Linker-R 12 ;

[0145] G1, G2, G3, and G4 are as described above.

[0146] According to an embodiment of the present invention, in formula (IIIa), R1" is selected from

[0147] G1, G2, G3, G4 are

[0148] According to an embodiment of the present invention, in formula (IIIa), R1" is selected from

[0149] G1, G2, G3, G4 are

[0150] According to an embodiment of the present invention, the compound represented by formula (III) has a structure represented by formula (IIIb):

[0151] Wherein, R1" is -C(O)-linker-R 12 ;

[0152] G1, G2, G3, and G4 are as described above.

[0153] According to an embodiment of the present invention, in formula (IIIb), R1" is selected from

[0154] G1, G2, G3, G4 are

[0155] According to an embodiment of the present invention, in formula (IIIb), R1" is selected from

[0156] G1, G2, G3, G4 are

[0157] According to an embodiment of the present invention, the conjugate has the following structure:

[0158] Among them, R 12 is an active drug; preferably an oligonucleotide.

[0159] According to an embodiment of the present invention, R 12 ASO, siRNA, and miRNA.

[0160] According to an embodiment of the present invention, R 12 For siRNA.

[0161] In an optional embodiment of the present invention, R 12 It is the sense strand and / or antisense strand defined in siRNA.

[0162] In an optional embodiment of the present invention, R 12 It is the defined positive strand in siRNA.

[0163] According to an embodiment of the present invention, the ligand is connected to the 3' end or the 5' end of the sense strand via a phosphorothioate bond or a phosphate bond.

[0164] In this article, without special explanation, in the sense chain and / or antisense chain used for conjugation with the ligand, the end of the sense chain and / or antisense chain connected to the ligand contains a phosphorothioate bond or a phosphate, that is, the phosphorothioate bond or the phosphate bond is located at the 3' end or the 5' end of the sense chain and / or antisense chain, which is used for conjugation with the ligand.

[0165] According to an embodiment of the present invention, the conjugate has the following structure:

[0166] in, Represents an oligonucleotide (e.g. R 12 ); X represents O or S.

[0167] In a fifth aspect, the present invention provides a pharmaceutical composition. According to an embodiment of the present invention, the pharmaceutical composition comprises: the compound described in the second aspect or its stereoisomer, tautomer or pharmaceutically acceptable salt, or the conjugate described in the fourth aspect.

[0168] According to an embodiment of the present invention, the pharmaceutical composition further includes: a pharmaceutically acceptable carrier or excipient.

[0169] In a sixth aspect, the present invention provides a method for targeting cells. According to an embodiment of the present invention, the method comprises introducing the conjugate of the fourth aspect into cells.

[0170] The above-mentioned compounds of the present invention or their stereoisomers, tautomers or pharmaceutically acceptable salts can be used as targeting ligands to be conjugated with active drugs such as oligonucleotides for targeting and delivery of active drugs, so that the active drugs can enter the required cells and / or tissues in vivo / in vitro (for example, targeted delivery of oligonucleotides to target and silence target genes in target cells and / or tissues).

[0171] According to an embodiment of the present invention, the cells are liver cells and / or kidney cells.

[0172] In the seventh aspect of the present invention, the present invention proposes the use of the conjugate described in the fourth aspect or the pharmaceutical composition described in the fifth aspect, and the use includes at least one of the following: preparing a drug for preventing and / or treating a disease; preventing and / or treating a disease; reducing the expression or activity of a target gene; targeted delivery of an active drug to a cell; the cell is preferably a liver cell and / or a kidney cell.

[0173] The conjugates of the present invention can be used for targeting and delivery of active drugs through the compounds or their stereoisomers, tautomers or pharmaceutically acceptable salts, so that the active drugs (e.g., the oligonucleotides / nucleic acids of the present invention) are linked to the desired cells and / or tissues in the body (e.g., targeted delivery of oligonucleotides to target silencing of target genes in target cells and / or tissues), thereby effectively preventing and / or treating related diseases.

[0174] In the eighth aspect of the present invention, the present invention proposes the conjugate described in the fourth aspect or the pharmaceutical composition described in the fifth aspect, for use in preventing and / or treating diseases, and / or preparing drugs for reducing the expression or activity of target genes, and / or for targeted delivery of active drugs to cells; the cells are preferably hepatocytes and / or kidney cells.

[0175] The conjugates of the present invention can be used for targeting and delivery of active drugs through the compounds or their stereoisomers, tautomers or pharmaceutically acceptable salts, so that the active drugs (e.g., the oligonucleotides / nucleic acids of the present invention) are linked to the desired cells and / or tissues in the body (e.g., targeted delivery of oligonucleotides to target silencing of target genes in target cells and / or tissues), thereby effectively preventing and / or treating related diseases.

[0176] In a ninth aspect, the present invention provides a method for preventing and / or treating a disease. According to an embodiment of the present invention, the method comprises administering a pharmaceutically acceptable dose of the conjugate of the fourth aspect or the pharmaceutical composition of the fifth aspect to a subject.

[0177] The effective amount of the conjugate or pharmaceutical composition of the present invention may vary depending on the mode of administration and the severity of the disease to be treated. The preferred effective amount can be determined by one of ordinary skill in the art based on various factors (e.g., through clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, the route of administration, and the like.

[0178] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0179] The above and / or additional aspects and advantages of the present application will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0180] FIG1 shows the hCFB protein retention level of the siRNA conjugate in Test Example 3 of the present invention in Tg-hCFB mice. DETAILED DESCRIPTION

[0181] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0182] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0183] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.

[0184] As used herein, the terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0185] As used herein, the term "small interfering RNA (siRNA)" refers to a double-stranded RNA consisting of a sense strand and an antisense strand. siRNAs mediate the targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway by forming a silencing complex. Specifically, siRNAs direct the specific degradation of mRNA sequences through the RNA interference (RNAi) process, inhibiting the translation of mRNA into amino acids and protein.

[0186] As used herein, the term "antisense strand (or guide strand)" includes a region that is substantially complementary to a target sequence, such as an mRNA encoding a target protein. "Sense strand (or follower strand)" refers to an iRNA strand that is substantially complementary to the antisense strand. The term "substantially complementary" refers to complete complementarity or at least partial complementarity, for example, the antisense strand is completely complementary to the target sequence or at least partially complementary. In the case of partial complementarity, mismatches can exist within the interior or terminal regions of the molecule, wherein the most tolerated mismatches exist within the terminal regions, for example, within 5, 4, 3 or 2 nucleotides of the 5'- and / or 3'-end of the iRNA.

[0187] It should be noted that "at least a portion of the antisense strand is substantially complementary to an mRNA" means that the antisense strand comprises a polynucleotide that is substantially complementary to a continuous portion of the mRNA of interest (e.g., an mRNA encoding a target protein). Alternatively, if a polynucleotide is substantially non-interruptedly complementary to a portion of the mRNA encoding a target protein, then the antisense strand is complementary to at least a portion of the mRNA encoding a target protein.

[0188] As used herein, the term "target sequence" or "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription encoding a target gene, including mRNA that is a product of RNA processing of a primary transcript.

[0189] It should be noted that, for the structural formula and chemical formula descriptions in the embodiments or embodiments of the present invention, the present invention is intended to cover all replacements, modifications and equivalent technical solutions, which are all within the scope of the present invention as defined in the claims. Those skilled in the art will recognize that many methods and materials similar or equivalent to those described in the present invention can be used to practice the present invention. The present invention is in no way limited to the methods and materials described in the present invention. In the event that one or more of the combined documents, patents and similar materials differ from or contradict the present application (including but not limited to defined terms, term applications, described technologies, etc.), the present invention shall prevail.

[0190] It will be further appreciated that certain features of the invention, which for clarity are described in the context of separate embodiments or implementations, may also be provided in combination in a single embodiment or implementation. Conversely, various features of the invention, which for brevity are described in the context of a single embodiment or implementation, may also be provided separately or in any suitable subcombination.

[0191] Unless otherwise specified, technical and scientific terms used in the present invention have the same meanings as commonly understood by those skilled in the art to which the present invention belongs, and unless otherwise specified, all patent publications cited in the entire disclosure of the present invention are incorporated herein by reference in their entirety.

[0192] The following definitions apply to the present invention unless otherwise indicated. For purposes of the present invention, the chemical elements are defined according to the Periodic Table of the Elements, CAS version, and the Chemical Handbook, 75th Ed, 1994. Additionally, general principles of organic chemistry are found in "Organic Chemistry," Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry," by Michael B. Smith and Jerry March, John Wiley & Sons, New York: 2007, all of which are hereby incorporated by reference herein.

[0193] The compounds of the present invention may contain asymmetric centers or chiral centers and therefore exist in different stereoisomeric forms. It is contemplated that all stereoisomeric forms of the compounds of the present invention, including but not limited to diastereomers, enantiomers and atropisomers and mixtures thereof such as racemic mixtures, are also included within the scope of the present invention. Many organic compounds exist in optically active forms, i.e., they have the ability to rotate the plane of plane polarized light. When describing a compound with optical activity, the prefixes D and L or R and S are used to represent the absolute configuration of the molecule with respect to the chiral center (or multiple chiral centers) in the molecule. The prefixes d and l or (+) and (-) are symbols for specifying the rotation of plane polarized light caused by the compound, where (-) or l indicates that the compound is left-handed. Compounds prefixed with (+) or d are right-handed. With respect to a given chemical structure, these stereoisomers are identical except that they are mirror images of each other. A specific stereoisomer may also be referred to as an enantiomer, and a mixture of such isomers is often referred to as a mixture of enantiomers. A 50:50 mixture of enantiomers is called a racemic mixture or racemate, which can occur when there is no stereoselectivity or stereospecificity in a chemical reaction or process.

[0194] Depending on the choice of starting materials and process, the compounds of the present invention may exist as one of the possible isomers or as a mixture thereof, for example as pure optical isomers, or as a mixture of isomers, such as a racemic and diastereomeric mixture, depending on the number of asymmetric carbon atoms. Optically active (R)- or (S)-isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. If the compound contains a double bond, the substituents may be in the E or Z configuration; if the compound contains a disubstituted cycloalkyl group, the cycloalkyl substituents may be in the cis or trans configuration.

[0195] The compounds of the present invention may contain asymmetric centers or chiral centers and therefore exist in different stereoisomeric forms. It is contemplated that all stereoisomeric forms of the compounds of the present invention, including but not limited to diastereomers, enantiomers and atropisomers and geometric (or conformational) isomers and mixtures thereof, such as racemic mixtures, are within the scope of the present invention.

[0196] Unless otherwise indicated, structures depicted herein are also meant to include all isomers (e.g., enantiomers, diastereomeric atropisomers, and geometric (or conformational) forms of such structures; for example, R and S configurations at various asymmetric centers, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric mixtures, diastereomeric mixtures, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention.

[0197] Any asymmetric atom (e.g., carbon, etc.) of the compounds of the present invention may exist in a racemic or enantiomerically enriched form, such as in the (R)-, (S)-, or (R,S)-configuration. In certain embodiments, each asymmetric atom has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in terms of (R)- or (S)-configuration. Substituents on atoms with unsaturated double bonds may exist in cis-(Z)- or trans-(E)-form, if possible.

[0198] Thus, as described herein, the compounds of the invention may exist in the form of one of the possible isomers, rotamers, atropisomers, tautomers or mixtures thereof, for example, as substantially pure geometric (cis or trans) isomers, diastereomers, optical isomers (enantiomers), racemates or mixtures thereof.

[0199] Any resulting mixtures of isomers can be separated on the basis of the physicochemical differences of the constituents into the pure or substantially pure geometric or optical isomers, diastereomers, racemates, for example, by chromatography and / or fractional crystallization.

[0200] Any racemate of the resulting final product or intermediate can be resolved into its optical antipodes by methods familiar to those skilled in the art using known methods, such as by separating the resulting diastereoisomer salts thereof. Racemic products can also be separated by chiral chromatography, such as high pressure liquid chromatography (HPLC) using a chiral adsorbent. In particular, enantiomers can be prepared by asymmetric synthesis.

[0201] As used herein, the term "tautomer" or "tautomeric form" refers to structural isomers with different energies that can be converted into each other through a low energy barrier. If tautomerism is possible (such as in solution), a chemical equilibrium of the tautomers can be reached. For example, proton tautomers (also known as prototropic tautomers) include interconversions that occur through proton migration, such as keto-enol isomerization and imine-enamine isomerization. Valence tautomers include interconversions that occur through the reorganization of some bonding electrons. Unless otherwise indicated, all tautomeric forms of the compounds of the invention are within the scope of the invention.

[0202] As used herein, the term "pharmaceutically acceptable salts" refers to organic and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as described in SM Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66: 1-19.

[0203] The group description of the present invention It is used to describe the position of group substitution.

[0204] In the chemical structure of the ligand or compound disclosed herein, the bond Indicates that the configuration is not specified. If chiral isomers exist in the chemical structure, the bond Can be or include both Although all of the above structural formulae are drawn as certain isomers for simplicity, the present disclosure may include all isomers, such as tautomers, rotational isomers, geometric isomers, diastereomers, racemates, and enantiomers.

[0205] As used herein, the terms "optionally substituted," "optionally substituted," and "substituted or unsubstituted" are used interchangeably. Generally, the term "optionally," whether or not preceded by the term "substituted," indicates that one or more hydrogen atoms in a given structure are replaced by a specified substituent. Unless otherwise indicated, an optional substituent group may be substituted at each substitutable position of the group. When more than one position in a given structural formula can be substituted by one or more substituents selected from a specified group, the substituents may be the same or different at each position. Such substituents may include, but are not limited to, F, Cl, Br, CN, OH, NH2, NO2, and the like.

[0206] As used herein, the term "one or more" (e.g. in the definition of substituents of compounds of the general formula of the invention) means "one, two, three, four or five, in particular one, two, three or four, more in particular one, two or three, even more in particular one or two".

[0207] In addition, it should be noted that, unless otherwise explicitly stated, the description methods used in the present invention such as "each...independently is" and "...each independently is" and "...independently is" can be interchanged and should be understood in a broad sense. They can mean that in different groups, the specific options expressed by the same symbols do not affect each other, or that in the same group, the specific options expressed by the same symbols do not affect each other.

[0208] As used herein, the term "halogen" refers to a fluorine, chlorine, bromine or iodine atom.

[0209] In this document, the minimum and maximum carbon atom content in a hydrocarbon group is indicated by a prefix, for example, the prefix C a～b Refers to a carbon atom containing "a" to "b". For example, "C 1～n ” refers to a linear or branched saturated / unsaturated carbon chain containing 1, 2, 3, 4, 5, ... or n carbon atoms; it is further understood that “C 1～n " shall be interpreted as including any sub-ranges therein, such as C 1～10 、C 1～6 etc., C. 1～6 Contains C 1～5 、C 1～4 、C 1～3 、C 1～2 、C 2～5 、C 2～4 、C 2～3 、C 3～5 、C 3～4 、C 4～5 .

[0210] It should be noted that the term "C1～10 ”, for example, in “C 1～10 In the context of the definition of "alkyl", it refers to an alkyl group having a limited number of carbon atoms from 1 to 10, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms. It is further understood that the term "C 1～10 " shall be interpreted as including any sub-ranges therein, such as C 1～6 、C 2～5 、C 3～4 、C 1～2 、C 1～3 、C 1～4 、C 1～5 ; especially C 1～2 、C 1～3 、C 1～4 、C 1～5 、C 1～6 ; especially C 2～6 .

[0211] Similarly, as used herein, the term "C 2～6 ”, for example, in “C 2～6 Alkenyl" and "C 2～6 In the context of the definition of "alkynyl", it is understood to refer to alkenyl or alkynyl groups having a limited number of carbon atoms of 2 to 6, i.e. 2, 3, 4, 5 or 6 carbon atoms. It is further understood that the term "C 2～6 " shall be interpreted as including any sub-ranges therein, e.g., C 2～6 、C 3～5 、C 3～4 、C 2～3 、C 2～4 、C 2～5 ; especially C 2～3 .

[0212] In this article, the term “C 1～10 "Alkyl" refers to a linear or branched saturated monovalent hydrocarbon group having 1, 2, 3, 4, 5, ... or 10 carbon atoms, such as C 1～6 Alkyl, C 1～5 Alkyl, C 1～4 Alkyl, C 1～3 Alkyl, C 2～5 Alkyl, C 2～4 Alkyl, C 2～3Alkyl. These include, but are not limited to, methyl, ethyl, n-propyl (n-Pr, -CH2CH2CH3), isopropyl (i-Pr, -CH(CH3)2), n-butyl (n-Bu, -CH2CH2CH2CH3), isobutyl (i-Bu, -CH2CH(CH3)2), sec-butyl (s-Bu, -CH(CH3)CH2CH3), tert-butyl (t-Bu, -C(CH3)3), n-pentyl (-CH2CH2CH2C H2CH3), 2-pentyl (-CH(CH3)CH2CH2CH3), 3-pentyl (-CH(CH2CH3)2), 2-methyl-2-butyl (-C(CH3)2CH2CH3), 3-methyl-2-butyl (-CH(CH3)CH(CH3)2), 3-methyl-1-butyl (-CH2CH2CH(CH3)2), 2-methyl-1-butyl (-CH2CH(CH3)CH2CH3), n-hexyl ( -CH2CH2CH2CH2CH2CH3), 2-hexyl (-CH(CH3)CH2CH2CH2CH3), 3-hexyl (-CH(CH2CH3)(CH2CH2CH3)), 2-methyl-2-pentyl (-C(CH3)2CH2CH2CH3), 3-methyl-2-pentyl (-CH(CH3)CH(CH3)CH2CH3), 4-methyl-2-pentyl (-CH(CH3)CH2CH(CH3)2), 3-methyl-3-pentyl (-C(CH3)(CH2CH3)2), 2-methyl-3-pentyl (-CH(CH2CH3)CH(CH3)2), 2,3-dimethyl-2-butyl (-C(CH3)2CH(CH3)2), 3,3-dimethyl-2-butyl (-CH(CH3)C(CH3)3), wherein the alkyl groups may independently be unsubstituted or substituted with one or more substituents described herein.

[0213] In this context, the term "alkylene" refers to a group formed by removing a hydrogen atom from an "alkyl" group, wherein "C 1～6 "Alkylene" includes methylene, ethylene, propylene, isopropylene (such as ), butylene (such as ), pentylene (such as ), hexamethylene (such as )wait.

[0214] As used herein, the terms "heterocycloalkyl", "heterocycle" and "heterocycloalkane" all refer to saturated or non-aromatic unsaturated rings containing at least one heteroatom; wherein a heteroatom refers to a nitrogen atom, an oxygen atom, a sulfur atom, etc. Generally, it refers to a monovalent saturated or partially unsaturated monocyclic or bicyclic ring system with multiple ring atoms, which contains 1, 2 or 3 ring heteroatoms selected from N, O and S, and the remaining ring atoms are carbon.

[0215] The 4-10 membered heterocycle mentioned in the present invention refers to a 4-, 5-, 6-, ... or 10-membered saturated or unsaturated heterocycle, wherein the unsaturated refers to a group or molecule containing a carbon-carbon double bond, a carbon-carbon triple bond, a carbon-oxygen double bond, a carbon-sulfur double bond, a carbon-nitrogen triple bond, etc.

[0216] As used herein, "pharmaceutical composition" may refer to a composition for use in treating a disease or in vitro cell culture experiments. When used in treating a disease, the term "pharmaceutical composition" generally refers to a pharmaceutical composition in unit dosage form and can be prepared by any of the methods well known in the pharmaceutical art. All methods include the step of combining the active ingredient with an excipient that constitutes one or more adjunct ingredients. Typically, the composition is prepared by uniformly and thoroughly combining the active siRNA with a liquid excipient, a finely divided solid excipient, or both.

[0217] As used herein, the term "pharmaceutically acceptable" means that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients of the formulation and / or the mammal to be treated therewith. Preferably, the term "pharmaceutically acceptable" as used herein means approved by federal regulatory agencies or national governments or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopeia for use in animals, particularly humans.

[0218] As used herein, the term "pharmaceutically acceptable excipient" includes any solvent, diluent, or other liquid excipient, etc., suitable for the particular intended dosage form. Except to the extent that any conventional excipient is incompatible with the siRNA of the present invention, such as by producing any adverse biological effect or interacting in a deleterious manner with any other component of the pharmaceutically acceptable composition, their use is contemplated by the present invention.

[0219] In addition to any conventional excipients, to the extent that they are incompatible with the siRNA of the present invention, such as by producing any adverse biological effects or interacting in a deleterious manner with any other component of the pharmaceutically acceptable composition, their use is also contemplated by the present invention.

[0220] As used herein, the term "treatment" refers to a method for obtaining a desired pharmacological and / or physiological effect. The effect may be preventive in terms of completely or partially preventing a disease or its symptoms, and / or therapeutic in terms of partially or completely curing a disease and / or the adverse effects caused by the disease. "Treatment" as used herein covers diseases in mammals, particularly humans, and includes: (a) preventing the occurrence of a disease or condition in an individual who is susceptible to the disease but has not yet been diagnosed with the disease; (b) inhibiting the disease, such as arresting the progression of the disease; or (c) alleviating the disease, such as alleviating the symptoms associated with the disease. "Treatment" as used herein covers any medication that administers a drug or siRNA to an individual to treat, cure, alleviate, improve, reduce or inhibit the individual's disease, including but not limited to administering a drug containing an siRNA or siRNA conjugate as described herein to an individual in need.

[0221] Detailed description of the targeting compound for nucleic acid delivery and its use of the present invention

[0222] The present invention provides a compound represented by formula (I) or formula (II) or its stereoisomers, tautomers or pharmaceutically acceptable salts, conjugates, pharmaceutical compositions, protein-targeting methods, and related uses, which are described in detail below.

[0223] Compound

[0224] The present invention provides a compound represented by formula (I) or its stereoisomers, tautomers or pharmaceutically acceptable salts:

[0225] Wherein, L1 is -N(R1)-C(O)-(C 1-10 Alkylene)-, or -N(G4)-L2-;

[0226] L2 is C replaced by R1 1-6 alkylene;

[0227] G1, G2, G3, G4 are

[0228] R2 is a substituted or unsubstituted sugar residue;

[0229] R1 is -(C 0-10 Alkylene)-C(O)-R 10 ;

[0230] R 10 For the leaving group.

[0231] Herein, "leaving group" refers to a group in the compound represented by formula (I) that can react with other compounds to be removed.

[0232] According to an embodiment of the present invention, in R2, the substituent group includes, but is not limited to, a protecting group. Preferably, the protecting group is a protecting group that prevents a group (e.g., a hydroxyl group) in the compound from being destroyed during the reaction. The protecting group includes, but is not limited to, 4,4'-dimethoxytrityl (DMTr) or acetyl (Ac).

[0233] As used herein, the term "residue" refers to a group obtained by removing one hydrogen from the above sugars.

[0234] It should be noted that for the partial definition of each group in the compound represented by formula (I), please refer to the second aspect of the invention content of this specification.

[0235] ligand

[0236] As used herein, the term "ligand" or "targeting ligand" refers to a substance that has the ability to alter the distribution, targeting, or lifetime of an oligonucleotide. For example, the presence of a ligand can enhance the affinity of an oligonucleotide for a selected target (e.g., an mRNA encoding CFB) compared to an oligonucleotide without the ligand. The ligand can be a naturally occurring protein (e.g., human serum albumin (HSA)), a carbohydrate (e.g., dextran and chitosan), or a lipid; it can also be a recombinant or synthetic molecule, such as a synthetic polymer. Preferably, the ligand does not participate in the pairing of the sense and antisense strands in the oligonucleotide.

[0237] The present invention provides a ligand, which is a compound represented by formula (II) of the present invention or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof:

[0238] Wherein, L1' is -N(R1')-C(O)-(C 1-10 Alkylene)-, or -N(G4)-L2'-;

[0239] L2' is C substituted by R1' 1-6 alkylene;

[0240] G1, G2, G3, G4 are

[0241] R2 is a substituted or unsubstituted sugar residue;

[0242] R1' is n is any integer between 0 and 10;

[0243] X is empty or a connector;

[0244] The linker is -NH-(C 1-10 Alkylene)-O-, -NH-(C 1-10 Alkylene)-S-, optionally with one or more R a -C substituted with a group4～10 Heterocycloalkylene-(C 1-6 Alkylene)-O-, optionally substituted by one or more R a -C substituted with a group 4～10 Heterocycloalkylene-(C 1-6 Alkylene)-S-, -C 4～10 Heterocycloalkylene-O-, or -C 4～10 Heterocycloalkylene-S-, the R a The groups are each independently selected from -OH, -C 1-6 Preferably, X is a linker.

[0245] In an optional embodiment of the present invention, for the partial definition of each group in the compound represented by formula (II), please refer to the third aspect of the invention content of this specification.

[0246] use

[0247] The present invention provides a use of the compound described in the first aspect or the second aspect or its stereoisomers, tautomers or pharmaceutically acceptable salts in the preparation of a drug, wherein the drug is used to target liver cells and / or kidney cells.

[0248] The above-mentioned compounds of the present invention or their stereoisomers, tautomers or pharmaceutically acceptable salts can be used as targeting ligands to be conjugated with drugs such as oligonucleotides for the targeting and delivery of nucleic acid drugs, so that the nucleic acids are connected to the desired cells and / or tissues in the body (for example, targeted delivery of oligonucleotides to target and silence target genes in target cells and / or tissues), thereby effectively preventing and / or treating related diseases.

[0249] According to an embodiment of the present invention, the drug further comprises an oligonucleotide.

[0250] According to an embodiment of the present invention, the oligonucleotide is conjugated to the compound of the second aspect or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof;

[0251] And / or, the oligonucleotide is obtained by reacting with the compound described in the first aspect or its stereoisomers, tautomers or pharmaceutically acceptable salts as defined in formula (I).

[0252] According to an embodiment of the present invention, the oligonucleotides include siRNA, miRNA, and ASO.

[0253] Nucleic acid conjugates

[0254] When the active drug is a nucleic acid / oligonucleotide, the present invention provides a nucleic acid conjugate comprising an oligonucleotide and a ligand conjugated to the oligonucleotide; wherein the ligand is the structure represented by formula (II) defined in the compound described in the third aspect of the present invention or its stereoisomer, tautomer, or pharmaceutically acceptable salt, and the ligand is conjugated to the oligonucleotide (such as siRNA) directly or indirectly through a linker. The nucleic acid conjugate of the present invention can further target the oligonucleotide to the target cell by adding the ligand (for example, it can enhance the degradation of the mRNA encoding the target protein by the oligonucleotide), and can effectively prevent and / or treat related diseases.

[0255] Herein, oligonucleotides can be selected according to the disease type or target protein without any particular limitation, and all fall within the scope of protection of this application.

[0256] There is no particular limitation on the connection mode between the ligand and the siRNA. The ligand can be directly connected to the siRNA through a group without using an additional linker / linking group, or can be indirectly connected to the siRNA through a linker.

[0257] The connection mode of the part and the sense strand and / or antisense strand of the siRNA is also not particularly limited. Preferably, the part and the siRNA are connected through a phosphorothioate bond or a phosphate bond. Preferably, the part is connected to the 5' end or the 3' end of the sense strand. Preferentially, the part is connected to the 5' end or the 3' end of the antisense strand.

[0258] According to an embodiment of the present invention, the ligand has the structures shown as II-1, II-2, II-3, II-4, II-5, and II-6 in the ligand described in the second aspect, and is named as compound P7, P8, P9, P10, P11, and P12, respectively.

[0259] Thus, the use of the above-mentioned ligands can promote the targeting and delivery of oligonucleotides, allowing the oligonucleotides to be attached to the desired cells and / or tissues in the body, so as to target and silence the target genes in the target cells and / or tissues, thereby effectively preventing and / or treating related diseases.

[0260] Herein, unless otherwise specified, the oligonucleotide is not particularly limited and may be siRNA (such as the siRNA described in the first aspect of the present invention), miRNA or ASO.

[0261] According to an embodiment of the present invention, the oligonucleotide is synthesized to have a structure having an NH2-alkyl group (such as an NH2-C6 alkylene group) at the 5'-terminus of the siRNA sense strand, and the NH2-alkyl group comprises a linker structure (such as -NH-(C6)-alkylene) in the ligand structure of the second aspect. 1-10Alkylene)), i.e., NH2-alkyl group, which is connected to the ligand precursor in the present application (i.e., the compound represented by formula (I) or its stereoisomer, tautomer or pharmaceutically acceptable salt according to the first aspect of the present invention) to form the linker part structure in the ligand structure according to the second aspect (e.g., -NH-(C 1-10 In some embodiments, the oligonucleotide has an NH2-alkyl group, the terminal amino group of the NH2-alkyl group can then be combined with a ligand represented by formula (II) as described in the second aspect of the present invention to form a nucleic acid conjugate. In some embodiments, the phosphate group or thiophosphate group of the oligonucleotide reacts with a compound represented by formula (I) as described in the first aspect of the present invention or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof to form a nucleic acid conjugate. In some embodiments, the oligonucleotides disclosed herein are synthesized to have one or more alkyne groups at the 5'-terminus of the siRNA sense strand, and the terminal alkyne group can then react with a group of a ligand, such as described in the present invention, to form a conjugate.

[0262] In this context, when the oligonucleotide in the nucleic acid conjugate is an siRNA, the siRNA comprises a sense strand and an antisense strand, as well as a phosphorothioate bond or phosphate for connection to the linker in the ligand structure described in the third aspect. As previously noted, the aforementioned NH2-alkyl group is a ligand, and the NH2-alkyl group is pre-attached to the siRNA sense strand to facilitate the synthesis of the nucleic acid conjugate of the present invention.

[0263] connector

[0264] In some embodiments, when the active group R1 in the ligand precursor (i.e., the compound shown in formula (I) described in the first aspect of the present invention or its stereoisomer, tautomer or pharmaceutically acceptable salt) does not contain a joint, the active group R1 of the ligand can be directly conjugated / connected to the oligonucleotide, or it can be conjugated / connected to the oligonucleotide through a joint (connecting group). The joint of the present invention is not particularly limited. In some embodiments, when two or more oligonucleotides are included in the conjugate, the two or more oligonucleotides can use the same joint or different joints to be connected to the active group R1 of the ligand. According to embodiments of the present invention, there is no particular limitation on the manner in which the joint is conjugated to the oligonucleotide, and it can be connected to the 3' and / or 5' end of the sense strand of the oligonucleotide, or it can be connected to the 3' and / or 5' end of the antisense strand.

[0265] Examples of the linker include, but are not limited to: -NH-C6 alkylene-SS-C6 alkylene-O-, reactive groups such as primary amines (e.g., (NH2-C6), The structure after connecting the oligonucleotide and the ligand is and alkynes, alkenes, alkyl groups, abasic residues / nucleotides, amino acids, triyne functionalized groups, ribitol and / or PEG groups.

[0266] In an alternative embodiment of the present invention, the linker has the following structure after being linked to the phosphate or phosphorothioate group of the oligonucleotide:

[0267] Z is O or S.

[0268] Methods for preventing and / or treating disease

[0269] The present invention provides a method for preventing and / or treating a disease. According to an embodiment of the present invention, the method comprises administering a pharmaceutically acceptable dose of the conjugate of the fourth aspect or the pharmaceutical composition of the fifth aspect to a subject.

[0270] The effective amount of the conjugate or pharmaceutical composition of the present invention may vary depending on the mode of administration and the severity of the disease to be treated. The preferred effective amount can be determined by one of ordinary skill in the art based on various factors (e.g., through clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, the route of administration, and the like.

[0271] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.

[0272] Preparation Example 1: Preparation of Ligands I-1 to I-3

[0273] 1. Preparation of ligand I-1

[0274] The synthetic route is as follows:

[0275] Step 1: Synthesis of ethyl 4-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)butanoate (01B)

[0276] To a 500 mL single-necked flask, N-tert-butoxycarbonyl-1,3-propanediamine (30.00 g, 172.2 mmol), acetonitrile (250 mL), and potassium carbonate (47.59 g, 344.3 mmol) were added sequentially. The mixture was cooled to 0°C, and ethyl 4-bromobutyrate (26.87 g, 137.8 mmol) was slowly added dropwise. After the addition was complete, the mixture was naturally warmed to room temperature and reacted for 16 h. The reaction solution was filtered, and di-tert-butyl dicarbonate (56.36 g, 258.2 mmol) was added to the filtrate. The reaction mixture was reacted at room temperature for 5 h. The reaction solution was concentrated under reduced pressure to obtain the crude product, which was purified by column chromatography (petroleum ether / ethyl acetate (v / v) = 1:0-7:3) to obtain ethyl 4-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)butanoate (01B) (45.00 g, 84.08% yield).

[0277] LC-MS, M / Z(ESI):289.4[M-99] +

[0278] Step 2: Synthesis of 4-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)butanoic acid (01C)

[0279] To a 500 mL single-necked flask were added ethyl 4-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)butanoate (45.00 g, 115.8 mmol), methanol (200 mL), and a solution of lithium hydroxide (5.55 g, 231.8 mmol) in water (50 mL). The mixture was stirred at room temperature for 16 h. The reaction solution was concentrated under reduced pressure, water (50 mL) was added, and the pH was adjusted to 6 with 1N hydrochloric acid. The mixture was then extracted with ethyl acetate (150 mL x 3). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to yield 4-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)butanoic acid (01C) (24.00 g, 57.49% yield).

[0280] 1 H NMR(400MHz, DMSO-d6)δ6.73(s,1H),3.08(q,J=8.6,8.1Hz,4H),2.85(q,J=6.6Hz,2H), 2.12(t,J=7.3Hz,2H),1.67–1.60(m,2H),1.57–1.49(m,2H),1.36(s,9H),1.35(s,9H).

[0281] LC-MS, M / Z(ESI):383.4[M+Na] +

[0282] Step 3: Synthesis of tert-butyl (3-(pent-4-en-1-ylamino)propyl)carbamate (01E)

[0283] To a 500 mL single-necked flask, N-tert-butyloxycarbonyl-1,3-propanediamine (30.00 g, 172.2 mmol), acetonitrile (250 mL), and potassium carbonate (47.59 g, 344.3 mmol) were added sequentially. The mixture was cooled to 0°C, and 5-bromo-1-pentene (20.53 g, 137.8 mmol) was slowly added dropwise. After the addition was complete, the mixture was allowed to warm to room temperature and stirred for 16 h. The reaction mixture was filtered and concentrated under reduced pressure to obtain the crude product, which was purified by column chromatography (dichloromethane / methanol (v / v) = 1:0-20:1) to afford tert-butyl (3-(pent-4-en-1-ylamino)propyl)carbamate (01E) (16.00 g, 38.34% yield).

[0284] 1 H NMR(400MHz,DMSO-d6)δ6.78(t,J=5.0Hz,1H),5.84–5.74(m,1H),5.00–4.95(m,1H),4.93–4.89(m,1H),3.14 (s,1H),2.92(q,J=6.7Hz,2H),2.43(t,J=7.0Hz,4H),2.01(q,J=7.3Hz,2H),1.49–1.40(m,4H),1.34(s,9H).

[0285] LC-MS, M / Z(ESI):243.3[M+H] +

[0286] Step 4: Synthesis of tert-butyl(3-((tert-butoxycarbonyl)amino)propyl)(4-((3-((tert-butoxycarbonyl)amino)propyl)(pent-4-en-1-yl)amino)-4-oxobutyl)carbamate (01F)

[0287] To a 500 mL single-necked flask were added tert-butyl (3-(pent-4-en-1-ylamino)propyl)carbamate (16.00 g, 66.02 mmol), dichloromethane (200 mL), 4-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)butanoic acid (23.80 g, 66.03 mmol), 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (18.98 g, 99.01 mmol), monohydroxybenzotriazole (8.92 g, 66.01 mmol), and triethylamine (20.04 g, 198.0 mmol). The mixture was reacted at room temperature under nitrogen for 16 h. The reaction solution was washed with 0.5N hydrochloric acid (100 mL) and saturated aqueous sodium bicarbonate solution (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a crude product, which was purified by column chromatography (petroleum ether / ethyl acetate (V / V) = 1:0-0:1) to give tert-butyl (3-((tert-butoxycarbonyl)amino)propyl)(4-((3-((tert-butoxycarbonyl)amino)propyl)(pent-4-en-1-yl)amino)-4-oxobutyl)carbamate (01F) (19.00 g, 49.21% yield).

[0288] 1 H NMR(400MHz,DMSO-d6)δ6.91–6.60(m,2H),5.84–5.72(m,1H),5.06–4.89(m,2H),3.22–3.14(m,4H),3.12–3.0 6(m,4H),2.90–2.83(m,4H),2.23–2.10(m,2H),1.98–1.92(m,2H),1.47–1.66(m,8H),1.35(d,J=3.8Hz,27H).

[0289] LC-MS, M / Z (ESI): 607.6 [M+Na] +

[0290] Step 5: Synthesis of N-(3-aminopropyl)-4-((3-aminopropyl)amino)-N-(pent-4-en-1-yl)butanamide (trifluoroacetate) (01G)

[0291] To a 250 mL single-necked bottle were added tert-butyl (3-((tert-butoxycarbonyl)amino)propyl)(4-((3-((tert-butoxycarbonyl)amino)propyl)(pent-4-en-1-yl)amino)-4-oxobutyl)carbamate (5.00 g, 8.55 mmol), dichloromethane (200 mL) and trifluoroacetic acid (13.09 mL, 171.1 mmol), and the mixture was stirred at room temperature for 16 h. The reaction solution was concentrated under reduced pressure to give N-(3-aminopropyl)-4-((3-aminopropyl)amino)-N-(pent-4-en-1-yl)butanamide (trifluoroacetate) (01G) (5.34 g, 99.7% yield).

[0292] LC-MS, M / Z(ESI):285.46[M+H] +

[0293] Step 6: Synthesis of (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-((15-(5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoyl)-5,11,20-trioxo-10-(pent-4-en-1-yl)-6,10,15,19-tetraazaeicosane-1,24-diyl)bis(oxy))bis(5-acetylamino-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (01I)

[0294] To a 250 mL single-necked bottle were added N-(3-aminopropyl)-4-((3-aminopropyl)amino)-N-(pent-4-en-1-yl)butanamide (trifluoroacetate) (01G) (3.30 g, 5.27 mmol), dichloromethane (100 mL), 5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (8.26 g, 18.5 mmol), 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (5.05 g, 26.3 mmol), monohydroxybenzotriazole (2.14 g, 15.8 mmol) and triethylamine (5.34 g, 52.8 mmol) in sequence. Under nitrogen protection, the mixture was stirred at room temperature for 16 h. The reaction solution was washed with 0.5N hydrochloric acid (100 mL) and saturated sodium bicarbonate aqueous solution (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a crude product, which was purified by column chromatography (dichloromethane / methanol (V / V) = 1:0-9:1) to give (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-((15-(5-(((2R,3R,4R,5R,6R)-3-acetyl Amino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoyl)-5,11,20-trioxo-10-(pent-4-en-1-yl)-6,10,15,19-tetraazaeicosane-1,24-diyl)bis(oxy)bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (7.00 g, yield 84.5%)

[0295] 1 H NMR(600MHz,DMSO-d6)δ7.85–7.77(m,4H),7.71–7.69(m,1H),5.83–5.77(m,1H),5.19(d,J =3.3Hz,3H),5.05–4.91(m,5H),4.46(dd,J=8.4,4.1Hz,3H),4.02–3.99(m,9H),3.89–3.82( m,3H),3.70–3.68(m,3H),3.40–3.37(m,3H),3.25–3.16(m,8H),3.04–2.95(m,4H),2.30–2 .17(m,4H),2.08(s,9H),2.05–1.94(m,15H),1.87(s,9H),1.75(s,9H),1.61–1.43(m,20H).

[0296] LC-MS, M / Z(ESI):787.26[M+2H]2+

[0297] Step 7: Synthesis of 4-(4-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoylamino)propyl)pentanoylamino)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoylamino)propyl)butanoylamino)butyric acid (01J)

[0298] To a 250 mL single-necked bottle, (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-((15-(5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoyl)-5,11,20-trioxo-10-(pent-4-en-1-yl)-6,10,15, 1,24-Diyl-1,9-tetraazaeicosane-1,24-diyl)bis(oxy)bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (7.00 g, 4.45 mmol), dichloromethane (30 mL), acetonitrile (30 mL), and water (48 mL) were stirred until uniform, followed by the addition of sodium periodate (4.76 g, 22.3 mmol) and ruthenium trichloride (18.5 mg, 89.0 μmol). The mixture was stirred at room temperature under nitrogen for 16 h. The reaction mixture was filtered, and saturated aqueous sodium bicarbonate was added to the filtrate to adjust the pH of the aqueous phase to 7–8. After separation, the aqueous phase was washed with dichloromethane (50 mL x 2), adjusted to a pH of approximately 5–6 with 1N hydrochloric acid, and extracted with dichloromethane (100 mL x 3). The obtained organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give 4-(4-(5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)- 4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoylamino)propyl)butanoylamino)butanoic acid (01J) (3.50 g, 49.4% yield).

[0299] 1H NMR(600MHz,DMSO-d6)δ12.12(s,1H),7.84–7.81(m,4H),7.74–7.71(m,1H),5.19(d,J=3.2Hz, 3H),4.94(dd,J=11.2,3.3Hz,3H),4.47(d,J=8.4Hz,3H),4.00–3.99(m,9H),3.88–3.83(m,3H) ,3.71–3.66(m,3H),3.40–3.37(m,3H),3.22–3.17(m,8H),3.04–2.95(m,4H),2.30–2.13(m,6H ),2.08(s,9H),2.04–2.01(m,4H),1.98(s,9H),1.87(s,9H),1.75(s,9H),1.69–1.43(m,20H).

[0300] LC-MS, M / Z(ESI):796.60[M+2H] 2+

[0301] Step 8: Synthesis of (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-((15-(5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoyl)-10-(4-(4-nitrophenoxy)-4-oxobutyl)-5,11,20-trioxo-6,10,15,19-tetraazaeicosane-1,24-diyl)bis(oxy))bis(5-acetylamino-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (I-1)

[0302] To a 100 mL single-necked bottle, 4-(4-(5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoylamino)propyl)pentanoylamino)-N-(3-(5-((( To the mixture of 2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoylamino)propyl)butyrylamino)butyric acid (900 mg, 0.566 mmol), dichloromethane (20 mL), 4-nitrophenol (94.5 mg, 0.679 mmol), N,N'-dicyclohexylcarbodiimide (175.11 mg, 0.85 mmol), the mixture was stirred at room temperature for 16 h under nitrogen protection. The reaction solution was filtered and the filtrate was concentrated to obtain a crude product, which was purified by column chromatography (dichloromethane / methanol (V / V) = 1:0-9:1) to obtain (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-((15-(5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H- 4-triyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (I-1) (850 mg, yield 87.8%).

[0303] 1H NMR (400MHz, DMSO-d6) δ8.29(dd,J=9.2,2.7Hz,2H),7.82–7.67(m,4H),7.74–7.66(m,1H),7.44(dd,J=9.1,2. 1Hz, 2H), 5.19 (d, J = 3.3Hz, 3H), 4.94 (dd, J = 11.2, 3.4Hz, 3H), 4.46 (d, J = 8.4Hz, 3H), 4.00 (s, 9H), 3.85 (q, J = 9. 2Hz,3H),3.72–3.65(m,3H),3.41–3.37(m,3H),3.24–3.19(m,8H),3.06–2.92(m,4H),2.77–2.49(m,2H),2.36– 2.15(m,4H),2.07–2.08(m,9H),2.03–2.02(m,4H),1.97(s,9H),1.87(s,9H),1.75(s,9H),1.67–1.37(m,20H).

[0304] LC-MS, M / Z(ESI):856.5[M+2H] 2+

[0305] 2. Preparation of ligand I-2

[0306] The synthetic route is as follows:

[0307] Step 1: Synthesis of methyl 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoate (02B)

[0308] To a 100 mL single-necked flask, methyl 3-bromo-2-(bromomethyl)propionate (2.00 g, 7.69 mmol), N-tert-butyloxycarbonyl-1,3-propanediamine (5.36 g, 30.8 mmol), and acetonitrile (30 mL) were added sequentially and stirred at room temperature for 16 h. The reaction mixture was concentrated under reduced pressure, and dichloromethane (30 mL), di-tert-butyl dicarbonate (6.72 g, 30.8 mmol), and N,N-diisopropylethylamine (3.98 g, 30.8 mmol) were added and stirred at room temperature for 16 h. 50 mL of water was added to the reaction mixture, and the mixture was extracted with dichloromethane (50 mL x 3). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude product. Purification by column chromatography (petroleum ether / ethyl acetate (V / V) = 1:0-3:2) gave methyl 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoate (02B) (3.50 g, 70.7% yield).

[0309] Step 2: Synthesis of 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoic acid (02C)

[0310] To a 100 mL single-necked flask, methyl 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoate (3.50 g, 5.44 mmol), methanol (30 mL), and a lithium hydroxide (389 mg, 16.2 mmol) aqueous solution (10 mL) were added in sequence and stirred at room temperature for 16 h. The organic solvent was removed by concentration under reduced pressure, 50 mL of water was added, the pH was adjusted to 6 with 1N hydrochloric acid, and ethyl acetate (150 mL × 3) was added for extraction. The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain a crude product. Purification by column chromatography (petroleum ether / ethyl acetate (V / V) = 1:0-0:1) gave 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoic acid (02C) (3.00 g, 87.6% yield).

[0311] LC-MS, M / Z(ESI):533.5[M-99] + .

[0312] Step 3: Synthesis of benzyl 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoate (02D)

[0313] To a 500 mL single-necked flask, 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoic acid (3.00 g, 4.74 mmol), N,N-dimethylformamide (30 mL), potassium carbonate (1.97 g, 14.3 mmol), and benzyl bromide (0.93 g, 5.4 mmol) were added sequentially and stirred at room temperature for 16 h. The reaction mixture was filtered, and 30 mL of water was added to the filtrate, followed by extraction with ethyl acetate (60 mL x 3). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude product. Purification by column chromatography (petroleum ether / ethyl acetate (V / V) = 1:0-1:1) gave benzyl 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoate (02D) (3.00 g, 87.5% yield).

[0314] 1 H NMR(400MHz,DMSO-d6)δ7.39–7.31(m,5H),6.79–6.68(m,2H),5.07(s,2H),3.28–3.25(m,4H),3 .15–3.05(m,3H),2.98–2.92(m,2H),2.90–2.82(m,4H),1.54–1.50(m,4H),1.37–1.35(m,36H).

[0315] Step 4: Synthesis of benzyl 3-((3-aminopropyl)amino)-2-(((3-aminopropyl)amino)methyl)propionate tetra(trifluoroacetic acid) salt (02E)

[0316] To a 250 mL single-necked flask, benzyl 3-((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)-2-(((tert-butoxycarbonyl)(3-((tert-butoxycarbonyl)amino)propyl)amino)methyl)propanoate (4.50 g, 6.22 mmol), dichloromethane (60 mL), and trifluoroacetic acid (21.3 g, 187 mmol) were added sequentially, and the mixture was stirred at room temperature for 16 h. The reaction solution was concentrated under reduced pressure to give benzyl 3-((3-aminopropyl)amino)-2-(((3-aminopropyl)amino)methyl)propanoate tetrakis(trifluoroacetic acid) salt (02E) (4.85 g).

[0317] LC-MS, M / Z(ESI):323.04[M+H] + .

[0318] Step 5: Synthesis of (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-(((1,23-bis(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-12-((benzyloxy)carbonyl)-5,19-dioxo-6,10,14,18-tetraazatriane-10,14-diyl)bis(5-oxopentan-5,1-diyl))bis(oxy))bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (02F)

[0319] To a 250 mL single-necked bottle were added benzyl 3-((3-aminopropyl)amino)-2-(((3-aminopropyl)amino)methyl)propanoate tetra(trifluoroacetate) (4.85 g, 6.23 mmol), dichloromethane (100 mL), 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (12.55 g, 28.05 mmol), 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (7.17 g, 37.4 mmol), 1-hydroxybenzotriazole (3.37 g, 24.9 mmol) and N,N-diisopropylethylamine (12.1 g, 93.5 mmol) in sequence, and the mixture was stirred at room temperature for 16 h under nitrogen protection. The reaction solution was washed with 0.5N aqueous hydrochloric acid (100 mL) and saturated sodium bicarbonate solution (100 mL) in sequence, the combined organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain a crude product. Purification by column chromatography (dichloromethane / methanol (V / V) = 1:0-9:1) gave (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-(((1,23-bis(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl) Bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (02F) (9.00 g, yield 70.8%)

[0320] 1 H NMR (400MHz, DMSO-d6) δ7.82–7.64(m,6H),7.37–7.25(m,5H),5.17(d,J=3.3Hz,4H),4.98(d ,J=10.7Hz,2H),4.93(dd,J=11.2,3.3Hz,4H),4.45(d,J=8.4Hz,4H),3.98(s,12H),3.84(q,J =9.2Hz,4H),3.69-3.64(m,4H),3.57–3.36(m,8H),3.10–2.90(m,9H),2.20–2.11(m,4H),2.0 6(s,12H),2.03–1.98(m,4H),1.95(s,12H),1.85(s,12H),1.73(s,12H),1.58–1.37(m,20H).

[0321] LC-MS, M / Z(ESI):1020.9[M+2H] 2+ .

[0322] Step 6: 3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)pentanamido)-2-(( Synthesis of 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)pentanamido)methyl)propanoic acid (02G)

[0323] To a 100 mL single-necked bottle, add (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-(((1,23-bis(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-12-((benzyloxy)carbonyl)-5,19-dioxo-6,10,14 A mixture of bis(5-oxopentan-5,1-diyl,18-tetraazatrioxane-10,14-diyl)bis(5-oxopentan-5,1-diyl)bis(oxy)bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (0.18 g, 88 μmol), methanol (5 mL), ethyl acetate (5 mL), and 10% palladium on carbon (18 mg) was stirred at room temperature under a hydrogen atmosphere (1 atm) for 16 hours. The reaction mixture was filtered through celite, the filter cake was washed with methanol, and the filtrates were combined. The filtrate was concentrated under reduced pressure to give 3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)pentanamido)-2-((5-(( (2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)pentanamido)methyl)propanoic acid (02G) (0.12 g, 70% yield).

[0324] 1H NMR (400MHz, DMSO-d6) δ7.83–7.81(m,5H),7.72–7.68(m,1H),5.21(d,J=3.3Hz,4H),4.96(dd,J =11.2,3.3Hz,4H),4.49(dd,J=8.4,3.3Hz,4H),4.04–3.99(m,12H),3.87(q,J=10.5,9.8Hz,4H), 3.75–3.66(m,4H),3.59–3.39(m,8H),3.27–3.13(m,3H),3.08–2.90(m,6H),2.34–2.15(m,4H), 2.10(s,12H),2.07–2.02(m,4H),1.99(s,12H),1.88(s,12H),1.77(s,12H),1.61–1.43(m,20H).

[0325] LC-MS, M / Z(ESI):975.9[M+2H] 2+ .

[0326] Step 7: Synthesis of (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-(((1,23-bis(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-12-((4-nitrophenoxy)carbonyl)-5,19-dioxo-6,10,14,18-tetraazatriane-10,14-diyl)bis(5-oxopentan-5,1-diyl))bis(oxy))bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (I-2)

[0327] To a 100 mL single-necked bottle, 3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)pentanamido)-2-((5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)pentanamido)- To the mixture of 4-nitrophenol (21.4 mg, 0.154 mmol), dichloromethane (10 mL), 4-nitrophenol (21.4 mg, 0.154 mmol) and N,N'-dicyclohexylcarbodiimide (31.7 mg, 0.154 mmol) was stirred at room temperature for 16 h under nitrogen. The reaction solution was filtered, and the filtrate was concentrated to obtain a crude product. Purification by column chromatography (dichloromethane / methanol (V / V) = 1:0-8:2) gave (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-(((1,23-bis(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy) -12-((4-nitrophenoxy)carbonyl)-5,19-dioxo-6,10,14,18-tetraazatrioxane-10,14-diyl)bis(5-oxopentan-5,1-diyl))bis(oxy))bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (I-2) (120 mg, yield 56.5%).

[0328] 1H NMR (400MHz, DMSO-d6) δ8.33–8.29(m,2H),7.79–7.69(m,6H),7.43–7.31(m,2H),5.18(d,J=3.3Hz,4 H),4.94(dd,J=11.2,3.3Hz,4H),4.45(d,J=8.4Hz,4H),3.99(s,12H),3.89–3.80(m,4H),3.69–3.61 (m,5H),3.49–3.31(m,7H),3.29–3.13(m,5H),3.09–2.94(m,4H),2.35–2.17(m,4H),2.07(d,J=2.7H z,12H),2.04–2.01(m,4H),1.96(d,J=2.0Hz,12H),1.86(s,12H),1.74(s,12H),1.65–1.39(m,20H).

[0329] 3. Preparation of ligand I-3

[0330] The synthetic route is as follows:

[0331] Step 1: (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-((15-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoyl)-10-(4-((2S,4R)-2-(( Synthesis of Bis(4-methoxyphenyl)(phenyl)methoxymethyl)-4-hydroxypyrrolidin-1-yl)-4-oxobutyl)-5,11,20-trioxo-6,10,15,19-tetraazaeicosane-1,24-diyl)bis(oxy)bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (03B)

[0332] To a 100 mL single-necked bottle were added 4-(4-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)pentanamido)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2 The mixture was stirred at room temperature for 16 h under nitrogen atmosphere to obtain 1-hydroxybenzotriazole (5-[(4-methoxyphenyl)-2-yl)-1-[(4-methoxyphenyl ... Purification by column chromatography (dichloromethane (2% triethylamine) / methanol (V / V) = 1:0-9:1) gave (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-((15-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoyl)-10-(4-(( 2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-4-oxobutyl)-5,11,20-trioxo-6,10,15,19-tetraazaeicosane-1,24-diyl)bis(oxy))bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (03B) (1.0 g, yield 80%).

[0333] 1H NMR (400MHz, DMSO-d6) δ7.86–7.65(m,5H),7.32–7.29(m,4H),7.21–7.17(m,5H),6.90–6.86(m,4 H),5.21(s,3H),5.03–4.89(m,4H),4.48(d,J=8.3Hz,3H),4.36(m,1H),4.16(s,1H),4.02(s,9H) ,3.87(q,J=9.8Hz,3H),3.73–3.68(m,9H),3.64–3.45(m,7H),3.19–2.93(m,12H),2.35–2.14(m, 6H),2.09(s,9H),2.06–2.02(m,4H),1.99(s,9H),1.88(s,9H),1.76(s,9H),1.74–1.25(m,22H).

[0334] Step 2: 4-(((3R,5S)-1-(4-(4-(5-(((2R,3R,4R,5R,6R))-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)- Synthesis of (1-3)-((((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy)-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)butanamido)butyryl)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3-yl)oxy)-4-oxobutanoic acid

[0335] To a 100 mL single-necked bottle, (2R,2'R,3R,3'R,4R,4'R,5R,5'R,6R,6'R)-((15-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoyl)-10-(4-((2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-4- oxobutyl)-5,11,20-trioxo-6,10,15,19-tetraazaeicosane-1,24-diyl)bis(oxy))bis(5-acetamido-2-(acetoxymethyl)tetrahydro-2H-pyran-6,3,4-triyl)tetraacetate (800 mg, 0.402 mmol), dichloromethane (30 mL), succinic anhydride (321 mg, 3.21 mmol) and 4-dimethylaminopyridine (12.3 mg, 0.101 mmol) were stirred at room temperature for 16 h under nitrogen protection. The reaction solution was concentrated under reduced pressure and the crude product was subjected to reverse preparation (column: Waters Xbridge Prep C18 (150 mm × 40 cm × 10 μm, mobile phase: A = water (0.1% ammonium bicarbonate), B = acetonitrile; gradient: 15%-45%), to give 4-(((3R,5S)-1-(4-(4-(5-(((2R,3R,4R,5R,6R))-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)- (acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)pentanamido)-N-(3-(5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy)-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanamido)propyl)butanamido)butyryl)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3-yl)oxy)-4-oxobutanoic acid (I-3) (630 mg, 75.0% yield).

[0336] 1H NMR(400MHz,DMSO-d6)δ7.90–7.79(m,4H),7.76–7.69(m,1H),7.31-7.27(m,4H),7.23–7.17(m,5H),6.89–6.87(m,4 H),5.37–5.28(m,1H),5.21(d,J=2.9Hz,3H),4.97(dd,J=11.2,3.0Hz,3H),4.49(d,J=8.4Hz,3H),4.21(s,1H),4.02( s,9H),3.91–3.84(m,3H),3.73–3.70(m,9H),3.56–3.39(m,7H),3.23–3.19(m,8H),3.04–2.97(m,4H),2.49–2.40(m ,4H),2.29–2.17(m,6H),2.09(s,9H),2.05–2.04(m,4H),1.99(s,9H),1.89(s,9H),1.77(s,9H),1.72–1.40(m,22H).

[0337] Example 1: Design and synthesis of siRNA or its conjugates

[0338] 1. Design and synthesis of siRNA conjugates

[0339] 1.1 Synthesis steps of the siRNA sequence for connecting the conjugated group to the 3' end of the siRNA sense strand. Taking C3 in Table 1 as an example, the specific steps are as follows:

[0340] 1) Preparation of GalNAc solid phase support: The ligand I-3 prepared in Preparation Example 1 was condensed with aminomethyl resin (CPG, Dynaxin) under HBTU / DIEA conditions to obtain I-3-CPG. The loading capacity of the prepared support was tested for subsequent solid phase synthesis.

[0341] 2) Synthesis of single-stranded oligoribonucleotides: Synthesize oligoribonucleotides using phosphoramidite solid phase synthesis technology. All 2'-modified RNA phosphoramidite monomers (Tangzhi Pharmaceuticals) and auxiliary reagents are commercially available reagents. All phosphoramidites were dissolved in anhydrous acetonitrile (Suzhou Kelema) and molecular sieves were added. The coupling time was 8-12 minutes using 5-ethylthio-1H-tetrazole (ETT) as an activating agent (Suzhou Kelema). A 0.05 M iodine solution (dissolved in pyridine / water = 9:1, Suzhou Kelema) was used to construct the phosphate bond; a 0.2 M solution of hydrogenated xanthan gum (Suzhou Kelema) in anhydrous acetonitrile / pyridine (v / v = 1 / 1) was used to generate the phosphorothioate bond, with a reaction time of 5 minutes. All sequences were synthesized after the final removal of the DMT group.

[0342] 3) Cleavage and Deprotection of the CPG-Bound Oligoribonucleotide: After the solid-phase synthesis is completed, the protecting groups are removed by treatment with acetonitrile containing 20% ​​diethylamine (Chinese medicine) for 10 minutes. The resulting CPG support is then heated with concentrated aqueous ammonia (Chinese medicine) to remove the protecting groups on the support and bases. After filtration, a solution containing the product is obtained.

[0343] 4) Purification of Single-Stranded Oligoribonucleotides: Oligomers were purified by HPLC using NanoQ anion exchange. Buffer A consisted of 20 mM sodium hydroxide solution; and buffer B contained 20 mM sodium hydroxide solution and 3 M sodium chloride. The target product was then desalted on a gel.

[0344] 5) The sense strand and antisense strand obtained by chemical synthesis were subjected to base complementary pairing at a molar ratio of 1:1. The reaction conditions were 70°C for 10 minutes and then slowly returned to room temperature to finally obtain the product.

[0345] 1.2 The synthesis steps of the siRNA conjugate in which the conjugation group is connected to the 5' end of the siRNA sense strand (i.e., C1-C2, C4-C5), taking C1 in Table 1 as an example, the specific steps are as follows:

[0346] 1) Synthesis of single-stranded oligoribonucleotides: oligoribonucleotides were synthesized using phosphoramidite solid phase synthesis technology. All phosphoramidites (Tangzhi Pharmaceutical & Shanghai Zhaowei) and auxiliary reagents are commercially available reagents. The phosphoramidites containing conjugated groups are prepared from the corresponding compounds in Example 1. All phosphoramidites are dissolved in anhydrous acetonitrile (Suzhou Kelema) and molecular sieves are added. The coupling time was 8-12 minutes using 5-ethylthio-1H-tetrazole (ETT) as an activating agent (Suzhou Kelema). A 0.05 M iodine solution (dissolved in pyridine / water = 9:1, Suzhou Kelema) was used to construct the phosphate bond; a 0.2 M solution of hydrogenated xanthan gum (Suzhou Kelema) in anhydrous acetonitrile / pyridine (v / v = 1 / 1) was used to generate the phosphorothioate bond, with a reaction time of 5 minutes. All sequences were synthesized after the final removal of the DMT group.

[0347] 2) Cleavage and Deprotection of the CPG-Bound Oligoribonucleotide: After the solid-phase synthesis is completed, the protecting groups are removed by treatment with acetonitrile containing 20% ​​diethylamine (Chinese medicine) for 10 minutes. The resulting CPG support is then heated with concentrated aqueous ammonia (Chinese medicine) to remove the protecting groups on the support and bases. After filtration, a solution containing the product is obtained.

[0348] 3) Purification of Single-Stranded Oligoribonucleotides: Oligomers were purified by HPLC using NanoQ anion exchange. Buffer A consisted of 20 mM sodium hydroxide solution; and Buffer B contained 20 mM sodium hydroxide solution and 3 M sodium chloride. The desired product was then desalted on a gel.

[0349] 4) Coupling and purification of the conjugated group: First, dissolve the purified nucleic acid sequence containing NH2-C6 at the end (prepared and purified using conventional methods in the art) in 100mM PB buffer. Dissolve the ligands I-1 and I-2 from Preparation Example 1 in DMF or DMSO and add them to the nucleic acid solution. React at room temperature for 4-16 hours. After mass spectrometry monitoring, add 2 times the volume of the reaction solution (25% ammonia water: 40% methylamine aqueous solution = 1:1), stir at room temperature for 0.5 hours, and quench with water. Desalt the mixed solution to remove the organic reagent and purify it to obtain a nucleic acid chain with a conjugated group at the end.

[0350] 5) The sense strand and antisense strand obtained by chemical synthesis were subjected to base complementary pairing at a molar ratio of 1:1. The reaction conditions were 70°C for 10 minutes and then slowly returned to room temperature to finally obtain the product.

[0351] Among them, the nucleotide sequences of the sense chain and antisense chain of the siRNA conjugate obtained by the present invention are shown in Table 1. The specific structures of the ligands (II-1, II-2, II-3) in Table 1 are shown in the invention content section of this specification (i.e., II-1, II-2, II-3 in the compound described in the third aspect or its stereoisomers, tautomers or pharmaceutically acceptable salts). II-1 is derived from ligand I-1, II-2 is derived from ligand I-2, and II-3 is derived from ligand I-3.

[0352] Table 1:

[0353] Among them, the preparation of AD-560018 refers to patent WO2021 / 222549A1. In Table 1, the lowercase letters c, g, u, a, and t are all 2'-methoxy-modified nucleotides (i.e., c, g, u, and a respectively indicate that the ribose 2'-OH of the nucleotide represented by the corresponding capital letter is replaced by a methoxy group); f indicates that the nucleotide represented by the letter before f is a 2'-fluoro-modified nucleotide (i.e., the 2'-OH of the nucleotide represented by the letter before f is replaced by a fluorine atom); s indicates that the residues between the two adjacent nucleotide residues on the left and right of s are phosphorothioate (i.e., the 5'-phosphate group of the nucleotide represented by the letter before s is replaced by a 5'-phosphorothioate group).

[0354] Currently, five GalNAc-siRNA conjugates on the market (Givosiran, Inclisiran, Lumasiran, Vutrisiran, etc.) use L96 as a carrier. Their preparation methods can be found in WO2014 / 025805.

[0355] The structures of EVpu and EVpa are shown below:

[0356] 2. The unmodified siRNA sequence for C4 in Table 1 (referred to as siRNA-4) was synthesized as follows:

[0357] Oligoribonucleotides were synthesized using phosphoramidite solid phase synthesis technology. All 2'-modified RNA, DNA, ligand phosphoramidites, and auxiliary reagents were commercially available (Tangzhi Pharmaceuticals). All phosphoramidites were dissolved in anhydrous acetonitrile and molecular sieves were added. The coupling time using 5-ethylthio-1H-tetrazole (ETT, Suzhou Kelema Biotechnology Co., Ltd.) as an activator was 200 seconds, and the coupling ligand time was 10 minutes. A 50mM iodine (Suzhou Kelema Biotechnology Co., Ltd.) pyridine (Chinese medicine) / water solution was used to generate phosphates, with a reaction time of 5 minutes. A 0.2M hydrogenated xanthan gum (Shanghai Zhaowei Technology Development Co., Ltd.) pyridine (Chinese medicine) solution was used to generate phosphorothioate bonds, with a reaction time of 3 minutes. All sequences were synthesized after the final removal of the DMT group.

[0358] After the solid-phase synthesis was completed, the dried solid support was treated with aqueous ammonia solution at 55°C for 16 hours. Some monomers were deprotected using a 5:1 mixture of DMSO and triethylamine hydrogen fluoride (Beijing J&K Technology Co., Ltd.) at 25°C for 4 hours. The solution was evaporated, and the solid residue was redissolved in water.

[0359] The crude product was purified by reverse phase HPLC using a Waters XBridge C18 column and an Autotide 100 system. Buffer A was 100 mM TEAA, pH 7.5, containing 5% acetonitrile, and buffer B was 100% acetonitrile. UV traces were recorded at 260 nm and appropriate fractions were pooled.

[0360] The single-stranded oligoribonucleotides to be annealed were prepared at a concentration of 200 μM using sterile RNase-free water (RNA hydrolase-free). The annealing reaction system was set up as follows: 10 nmol of the mixture, in a total volume of 100 μL, was placed in a 95°C water bath for 5 minutes (amounts ≥ 100 nmol require 20 minutes at high temperature). The mixture was quickly placed in a 60°C water bath and allowed to cool naturally. The annealed solution should not be stored at high temperatures. Complementary strands were formed by combining equimolar single-stranded oligoribonucleotide solutions, ultimately yielding siRNA-4. Liquid chromatography-mass spectrometry (LC-MS) was used to determine the molecular weight of the siRNA. Comparison of the measured molecular weight with the theoretical value indicated that the measured value was approximately the theoretical value, indicating that siRNA-4 (specific nucleotide sequence: UAUGGAAAACCUGGAAGAUGU (sense strand); ACAUCUUCCAGGUUUUCCAUAUU (antisense strand)) was obtained.

[0361] Test Example 1: Inhibitory effect of siRNA conjugates taken up freely by human primary hepatocytes on CFB mRNA expression

[0362] The siRNA conjugate prepared in Example 1 was prepared into a stock solution of corresponding concentration using Nuclease-Free Water.

[0363] Diluted test siRNA conjugates were added to a collagen-coated 96-well plate, followed by a suspension of primary human hepatocytes (PHH) (from Chengdu WuXi AppTec). A control group containing no siRNA conjugate and nuclease-free water was also prepared. The plates were incubated in a 5% CO2, 37°C incubator for 48 hours.

[0364] After 48 hours of free uptake, the culture medium was removed, the cell plates were washed once with PBS, and cell lysis buffer was added. Total RNA was extracted using an RNA extraction kit (Qiagen-74182). gDNA was removed using the reverse transcription kit HiScript III RT SuperMix for qPCR (Vazyme-R323-01), and then cDNA was synthesized using random primers for reverse transcription.

[0365] The target gene cDNA will be detected by qPCR, and the corresponding internal reference gene (GAPDH cDNA) will be detected in parallel. The qPCR reaction program (TapMan Probe) is as follows: 50°C for 2 minutes, 95°C for 10 minutes, and then enter the cycling mode, heating at 95°C for 10 seconds, followed by 60°C for 1 minute, for a total of 40 cycles.

[0366] The target gene mRNA expression level for each sample was calculated using the ΔΔCT quantification method. The relative expression of the target gene was expressed as 2-ΔΔCT.

[0367] The calculation formula is as follows:

[0368] ΔCT = average Ct value of target gene - average Ct value of reference gene;

[0369] ΔΔCT = ΔCT (drug-added group) - ΔCT (Nuclease-Free Water control group);

[0370] Relative expression of target gene = 2-ΔΔCT;

[0371] Target gene inhibition rate (%) = (1-relative expression level of sample / average expression level of Nuclease-Free Water control) × 100%;

[0372] The inhibition rate results are expressed as mean ± SD. See Table 2 for the test results.

[0373] Table 2

[0374] The results show that the siRNA conjugates of the present invention have a significant silencing effect on CFB gene expression in human primary hepatocytes under free uptake conditions, which shows that the targeting ligands of the present invention can significantly enhance the ability of siRNA conjugates to enter hepatocytes and have no obvious effect on the silencing effect of siRNA.

[0375] Test Example 2: Inhibitory effect of siRNA and its conjugates on CFB mRNA expression in Hep3B cells

[0376] siRNA conjugate: Prepare a 20 μM stock solution in Nuclease-Free Water.

[0377] Hep3B cells were provided by Chengdu WuXi AppTec New Drug Development Co., Ltd. Hep3B cells were cultured in EMEM medium containing 10% fetal bovine serum, 1% glutamine, 1% NEAA, and 1% penicillin-streptomycin.

[0378] The primers and probes for the target gene CFB (Thermo, Assay ID-Hs00156060_m1) were purchased from Thermo Fisher Scientific Inc., and the Taqman primers and probes for the internal reference gene GAPDH were designed and provided by WuXi.

[0379] Experimental methods:

[0380] Hep3B cells (2×10 4 Cells / well) were plated onto a 96-well cell plate, and siRNA was transfected into the cells using Lipofectamine™ RNAiMAX. 9 concentration points of siRNA were tested (with 10 nM as the starting concentration, 6-fold dilution), with 3 replicates. TM The RNAiMAX control group without compound was cultured in a 37°C 5% CO2 incubator for 48 hours.

[0381] 48 hours after transfection, the culture medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using QIAGEN 96 Kit (QIAGEN-74182), and cDNA was synthesized using the FastKing RT kit (with gDNase) / FastKing cDNA First Strand Synthesis Kit (TIANGEN-KR116-03) according to the manufacturer's instructions.

[0382] Target gene cDNA will be detected by qPCR, with GAPDH cDNA being tested in parallel as an internal control. 8 μL of the prepared PCR reaction solution and 2 μL of sample cDNA will be added to each 384-well plate. The qPCR reaction program is as follows: preheat at 50°C for 2 minutes, heat at 95°C for 10 minutes, then enter cycling mode: heat at 95°C for 15 seconds, then 60°C for 1 minute, for a total of 40 cycles.

[0383] The target gene mRNA expression level for each sample was calculated using the ΔΔCT relative quantification method. The relative expression of the target gene was expressed as 2-ΔΔCT.

[0384] The calculation formula is as follows:

[0385] ΔCT = average CT value of target gene - average CT value of reference gene;

[0386] ΔΔCt=ΔCT(sample group)-ΔCT(Lipofectamine TM RNAiMAX control group);

[0387] Relative expression of target gene = 2-ΔΔCT;

[0388] Inhibition rate % = (1-relative expression level of sample / average expression level of PBS control) × 100;

[0389] See Table 3 for test results.

[0390] Table 3

[0391] The results show that the siRNA conjugates of the present invention have a significant silencing effect on the CFB gene expression in Hep3B cells, which can indicate that the targeting ligand of the present invention can significantly enhance the ability of the siRNA conjugate to enter Hep3B cells and has no obvious effect on the silencing effect of siRNA.

[0392] Test Example 3: Inhibitory effect of siRNA conjugates on hCFB expression in Tg-hCFB mice

[0393] The in vivo efficacy of CFB siRNA conjugates was evaluated using 6-8 week old male Tg-hCFB transgenic mouse models (purchased from Biocytogen Jiangsu Gene Biotechnology Co., Ltd.).

[0394] The test sample (siRNA conjugate obtained in Example 1) was prepared with normal saline (0.4 mg / mL) on the day of administration, stored at room temperature, and the administration was completed within 2 hours. The remaining test sample was stored in a -20°C refrigerator. The animals were divided into a normal control group and 4 test drug groups, with 5 mice in each group. The mice were grouped according to the level of hCFB protein in the mouse serum (blood collection on day-3). The test drug group received a single subcutaneous injection of the test drug, and the normal control group received an equal volume of normal saline. The day of administration was recorded as Day 0. Starting from one day before administration, the mice were weighed once a week.

[0395] Approximately 200 μL of blood was collected from the inner canthus of each mouse on the day before dosing (Day 1) and on Days 7, 14, 21, 28, and 35 after dosing. Whole blood samples were incubated at 37°C for 1 hour before centrifugation, followed by centrifugation at 3000 rpm for 10 minutes. The supernatant was collected as fresh serum and assayed for hCFB protein using ELISA. At the endpoint of the study, liver samples were harvested and hCFB mRNA expression in liver tissue was assayed using qPCR.

[0396] Experimental data are presented as mean ± standard deviation (mean ± SD) and were analyzed graphically using GraphPad Prism 8.3 software. Statistical analysis was performed using the T-test, with P < 0.05 indicating statistical significance. The hCFB level for each animal at a specific time point was divided by the level before drug administration (Day-1) to determine the residual expression rate. The residual expression rate for a single animal in the test drug group at a specific time point was divided by the average residual expression rate for all mice in the control group to obtain the "normalized residual expression rate," and the average value for each group was calculated. The test results are shown in Table 4 and Figure 1.

[0397] Table 4

[0398] The results showed that the siRNA conjugate of the present invention had a significant and lasting silencing effect on the expression of hCFB in Tg-hCFB mice, indicating that the liver-targeted delivery effect of the ligand disclosed in the present invention was better than that of L96.

[0399] Test Example 4: In vitro liver S9 stability experiment of siRNA conjugates

[0400] Test sample stock solution: 2 mg / mL nuclease-free aqueous solution;

[0401] Control stock solution: 2 mM nuclease-free aqueous solution; dilute to 20 μM with nuclease-free water before use.

[0402] Seven 96-well incubation plates were prepared, designated BK, T1440, T360, T240, T120, T60, and T0. 190 μL of liver S9 working solution (liver S9 protein concentration: 1.05 mg / mL) was added to each incubation plate (BK, T1440, T360, T240, T120, T60, and T0). Then, 200 μL of stop solution (containing 2.50 mM TCEP (Triscarboxyethylphosphine, Thermo, ZG394848) and 2000 ng / mL IS-WuXi in 30% ammonia-free nuclease-free aqueous solution) was added to the T0 stop plate.

[0403] Reactions were initiated by adding 10 μL of compound per well to all incubation plates (T1440, T360, T240, T120, T60, and T0) except for BK. Therefore, the final concentration of the test or control compound (Inclisiran) in the reaction was 1 μM, and the concentration of human liver S9 (BioIVT) was 1.0 mg / mL.

[0404] After incubation at 37°C for appropriate times (60, 120, 240, 360, and 1440 minutes), 200 μL of stop solution (30% ammonia-nuclease-free aqueous solution containing 2.50 mM TCEP and 2000 ng / mL IS-WuXi) was added to each sample well of the stop plate, and the plate was sealed.

[0405] All sample plates were shaken for 10 minutes. Subsequently, 200 μL of DNA extraction reagent and 500 μL of dichloromethane were added to each well and shaken thoroughly. All sample plates were shaken thoroughly and centrifuged at 3220 × g for 20 minutes at 4°C. 100 μL of supernatant from each well was collected for analysis by liquid chromatography-tandem mass spectrometry.

[0406] In this test example, the sample analysis was performed using liquid chromatography-tandem mass spectrometry (LC-MS / MS). The in vitro elimination rate constants k for the test and control compounds were calculated by converting the peak area ratio of the compound to the internal standard (IS-WuXi) into the residual percentage using the following formula: e :

[0407] when

[0408] If the residual amount of the compound at the maximum reaction time point (1440 minutes in this experiment) is greater than 75%, the compound is considered to be metabolically stable within the acceptable experimental error (CV = 25%). 1 / 2 >3469 minutes). Calculated by the above formula, the intrinsic clearance value of human liver S9 (CL int(S9) The experimental results are shown in Table 5. In the sample names, AS and SS represent the antisense and sense strands of the siRNA conjugate, respectively.

[0409] Table 5

[0410] The results showed that the positive chain of the siRNA conjugate of the present invention had a higher residual rate in human liver S9, while the antisense chain had a higher residual rate and a lower intrinsic clearance rate in human liver S9; for siRNA conjugates with the same sequence, the targeting ligand disclosed in the present invention had better human metabolic stability than L96 used in AD-560018.

[0411] Test Example 5: In vitro oligonucleotide liver lysosome stability experiment of siRNA conjugates

[0412] Test sample stock solution: 2 mg / mL nuclease-free aqueous solution;

[0413] Control stock solution: 2 mM nuclease-free aqueous solution; dilute to 20 μM with nuclease-free water before use.

[0414] Prepare seven 96-well incubation plates, designated BK, T1440, T360, T240, T120, T60, and T0. Add 190 μL of human liver lysosomal working solution (liver lysosomal protein concentration 1.05 mg / mL) to each incubation plate (BK, T1440, T360, T240, T120, T60, and T0). Then, add 200 μL of stop solution (2.50 mM TCEP and 2000 ng / mL IS-WuXi in 30% ammonia, nuclease-free aqueous solution) to the T0 stop plate.

[0415] Reactions were initiated by adding 10 μL of compound per well to all incubation plates (T1440, T360, T240, T120, T60, and T0) except for BK. Therefore, the final concentration of the test or control compound (Inclisiran) in the reaction was 1 μM, and the concentration of human liver lysosomes was 1.0 mg / mL.

[0416] After incubation at 37°C for appropriate times (60, 120, 240, 360, and 1440 minutes), 200 μL of stop solution (30% ammonia-nuclease-free aqueous solution containing 2.50 mM TCEP and 2000 ng / mL IS-WuXi) was added to each sample well of the stop plate, and the plate was sealed.

[0417] All sample plates were shaken for 10 minutes. Subsequently, 200 μL of DNA extraction reagent and 500 μL of dichloromethane were added to each well and shaken thoroughly. All sample plates were shaken thoroughly and centrifuged at 3220 × g for 20 minutes at 4°C. 100 μL of supernatant from each well was collected for analysis by liquid chromatography-tandem mass spectrometry.

[0418] In this test example, the sample analysis of the test and control compounds was performed using liquid chromatography-tandem mass spectrometry (LC-MS / MS). The in vitro elimination rate constants k for the test and control compounds were calculated by converting the peak area ratio of the compound to the internal standard into the residual percentage using the following formula: e :

[0419] when

[0420] If the residual amount of the compound at the maximum reaction time point (1440 minutes in this experiment) is greater than 75%, the compound is considered to be metabolically stable within the acceptable experimental error (CV = 25%).1 / 2 >3469 minutes). The liver lysosomal intrinsic clearance value (CL int(LYS) The experimental results are shown in Table 6. In the sample names, AS and SS represent the antisense and sense strands of the siRNA conjugate, respectively.

[0421] Table 6

[0422] The results showed that the positive sense chain of the siRNA conjugate of the present invention had a higher residual rate in human liver lysosomes, while the antisense chain had a higher residual rate and a lower intrinsic clearance rate in human liver lysosomes; for siRNA conjugates with the same sequence, the targeting ligand disclosed in the present invention had better human metabolic stability than L96 used in AD-560018.

[0423] Test Example 6: Toxicity evaluation experiment of siRNA conjugates in rats

[0424] SD rats (purchased from Weitonglihua Laboratory Animal Technology Co., Ltd.), SPF grade, 6-9 weeks old, weighing 210g-250g, were randomly divided into groups according to body weight and administered subcutaneously once every two weeks (Day 1, Day 14, and Day 28). The specific dosage design and grouping are as follows:

[0425] Detection indicators:

[0426] Clinical observation: Clinical observation was performed twice daily;

[0427] Body weight: All surviving animals were weighed twice a week;

[0428] Food intake: Food intake of all surviving animals was measured twice a week;

[0429] Hematology and blood biochemistry: Blood samples were collected on day 29 after administration for testing of hematology and blood biochemistry.

[0430] Gross autopsy and histopathology: After blood collection, the animal was dissected and the major organs, including the liver, spleen, and kidneys, were collected and weighed and histopathologically examined. The test results are as follows:

[0431] The results showed that compared with AD-560018, the siRNA conjugate prepared using the ligand of the present invention can induce less increase in major liver function indicators including ALT, AST and ALP. The siRNA conjugates C1 and C2 disclosed in the present invention have low liver toxicity and an excellent drug safety window, which shows that siRNA conjugates with the same sequence using the targeting ligand disclosed in the present invention have better safety than L96.

[0432] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0433] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A compound of formula (I) or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof: Among them, L1 is -N(R1)-C(O)-(C 1-10 alkylene)-, or -N(G4)-L2-; L2 is C substituted by R1 1-6 an alkylene group; G1, G2, G3, and G4 are R2 is a residue of a substituted or unsubstituted sugar; R1 is -(C 0-10 alkylene)-C(O)-R 10 ; R 10 is a leaving group.

2. The compound represented by formula (I) according to claim 1, or its stereoisomer, tautomer or pharmaceutically acceptable salt, characterized in that, satisfies at least one of the following conditions: 1) L2 is an alkylene group substituted by R1 2-4 ; 2) L1 is -N(R1)-C(O)-(C 1-6 alkylene)-, or L1 is -N(G4)-CH2-CH(R1)-CH2-; 3)R 10 selected from Preferably, The group is 4) R1 is Preferably, For Preferably, For 5) The sugar is glucose, lactose, galactose, or fructose; 6) Each R2 is independently selected from the residues of the following compounds: N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-formyl-galactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine; 7) G1, G2, G3, and G4 are Preferably, G1, G2, G3, G4 are 3. The compound represented by formula (I) according to claim 1 or 2, or its stereoisomer, tautomer or pharmaceutically acceptable salt, characterized in that, The compound represented by the formula (I) has the structures represented by the formula (Ia) and (Ib): Among them, in formula (Ia), R1 is -(C 1-6 alkylene)-C(O)-R 10 ; In formula (Ib), R1 is -C(O)-R 10 .

4. The compound of formula (I) according to claim 1, or its stereoisomer, tautomer or pharmaceutically acceptable salt, characterized in that, It has the following structure:

5. A compound or its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, which has the structure shown in formula (II): Among them, L1’ is -N(R1’)-C(O)-(C 1-10 alkylene)-, or -N(G4)-L2’-; L2’ is an alkylene group substituted by R1’ 1-6 ; G1, G2, G3, and G4 are R2 is a residue of a substituted or unsubstituted sugar; R1’ is n is any integer between 0 and 10; X is empty or a linker; The linker is -NH-(C 1-10 alkylene)-O-, -NH-(C 1-10 alkylene)-S-, -C 4～10 heterocycloalkylene-O-, or -C 4～10 heterocycloalkylene-S-, optionally substituted by one or more R a groups; -C 4～10 heterocycloalkylene-(C 1-6 alkylene)-O-, or optionally substituted by one or more R a groups; -C 4～10 heterocycloalkylene-(C 1-6 alkylene)-S-, wherein the R a groups are each independently selected from -OH, -C 1-6 alkylene; Preferably, X is a linker.

6. The compound or its stereoisomer, tautomer or pharmaceutically acceptable salt according to claim 5, characterized in that, satisfies at least one of the following conditions: 1) L2’ is an R1’-substituted C 2-4 alkylene; 2) L1’ is -N(R1’)-C(O)-(C 1-6 alkylene)-, -N(G4)-CH2-CH(R1’)-CH2-; 3) The linker is -NH-(C 4-8 alkylene)-O-, -C 4～10 heteroalkylene-O-, or -C 4～10 heteroalkylene-CH2-O- optionally substituted by -OH; Preferably, the joint is 4) R1’ is selected from Preferably, R1' is selected from 5) Among G1, G2, G3, and G4, each R2 is independently selected from the residues of the following compounds: N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-formyl-galactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine; Preferably, G1, G2, G3, G4 are 7. The compound according to claim 5, or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof, characterized in that, The compound has the structures shown in formula (IIa) and (IIb): Among them, in formula (IIa), R1’ is n is any integer between 1 and 6; In formula (IIb), R1’ is n is 0.

8. The compound according to claim 5, or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof, characterized in that, The compound has the following structure:

9. Use of the compound according to any one of claims 1 to 8 or its stereoisomer, tautomer or pharmaceutically acceptable salt in the preparation of a drug; Preferably, the drug is used for targeted delivery of an active drug to cells; Preferably, the drug is used for targeted delivery of an oligonucleotide to cells; Preferably, the cells are preferably hepatocytes and / or renal cells Preferably, the drug is used to reduce the expression or activity of a target gene.

10. A conjugate, characterized in that, comprises an active drug and a ligand conjugated to the active drug; wherein the ligand is selected from the compound according to any one of claims 5 to 8 or its stereoisomer, tautomer or pharmaceutically acceptable salt.

11. The conjugate according to claim 10, wherein The active drug is an oligonucleotide, and the conjugate comprises an oligonucleotide and a ligand conjugated to the oligonucleotide; wherein the ligand is selected from the compound according to any one of claims 5 to 8 or its stereoisomer, tautomer or pharmaceutically acceptable salt.

12. The conjugate according to claim 11, wherein The conjugate satisfies at least one of the following conditions: i) The oligonucleotide is an ASO, siRNA, miRNA; ii) The ligand is linked to the sense strand and / or the antisense strand in the siRNA; iii) The ligand is linked to the sense strand and / or the antisense strand through a phosphorothioate bond or a phosphate bond; iv) The ligand is linked to the 5'-end or 3'-end of the sense strand; v) The ligand is linked to the 5'-end or 3'-end of the antisense strand; vi) The ligand is linked to the oligonucleotide through the R1' group in the ligand, or the ligand is linked to the oligonucleotide through a linker of the R1' group in the ligand.

13. The conjugate according to claim 10, wherein, The conjugate is a compound of formula (III) or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof: wherein, L1” is -N(R1”)-C(O)-(C 1-10 alkylene)-, or -N(G4)-L2”-; "L2" is C substituted by R1" 1-6 alkylene; G1, G2, G3, and G4 are R2 is a residue of a substituted or unsubstituted sugar; R1” is -(C 0-10 alkylene)-C(O)-linker-R 12 ; R 12 is an active pharmaceutical ingredient; preferably an oligonucleotide.

14. The conjugate according to claim 13, wherein, satisfies at least one of the following conditions: 1) "L2" is an alkylene group substituted by "R1"; 2-4 alkylene group; 2) L1” is -N(R1”)-C(O)-(C 1-6 alkylene)-, -N(G4)-CH2-CH(R1”)-CH2-; 3)R 12 be ASO, siRNA, miRNA; 4) G1, G2, G3, and G4 are 5) R1” is selected from 15. The conjugate according to claim 13, wherein The compound represented by the formula (III) has the structures represented by the formula (IIIa) and (IIIb):

16. The conjugate according to claim 13, wherein, The conjugate has the following structure: wherein, R 12 is an active drug; preferably an oligonucleotide; Optionally, R 12 is an ASO, siRNA, miRNA.

17. The conjugate according to claim 13, wherein The conjugate has the following structure: Among them, represents the oligonucleotide; X represents O or S.

18. A pharmaceutical composition, characterized in that, comprises the compound according to any one of claims 5-8 or its stereoisomer, tautomer or pharmaceutically acceptable salt, or the conjugate according to any one of claims 10-17; Optionally, the pharmaceutical composition further comprises: a pharmaceutically acceptable carrier.

19. Use of the conjugate according to any one of claims 10-17 or the pharmaceutical composition according to claim 18, the use comprising at least one of the following: Preparation of a medicament for preventing and / or treating a disease; Preparation of a medicament for reducing the expression or activity of a target gene; Preventing and / or treating a disease; Reducing the expression or activity of a target gene; Targeted delivery of an active medicament to a cell; preferably the cell is a hepatocyte and / or a renal cell.

20. The conjugate according to any one of claims 10-17 or the pharmaceutical composition according to claim 18, for preventing and / or treating a disease and / or for targeted delivery of an active medicament to a cell; Preferably the cell is a hepatocyte and / or a renal cell.

21. A method for preventing and / or treating a disease, characterized in that, Comprising: Administering to a subject a pharmaceutically acceptable dose of the conjugate according to any one of claims 10-17 or the pharmaceutical composition according to claim 18.

Images