Gene providing resistance against peronospora farinosa in spinach
A novel resistance gene with specific genomic and protein sequences addresses the rapid adaptation of Peronospora farinosa by providing broad-spectrum resistance, enabling spinach cultivars resistant to multiple pathogens, suitable for organic farming.
Patent Information
- Application Number
- PCT/EP2024/087997
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-29
- Filing Date
- 2024-12-20
- Publication Date
- 2025-07-03
AI Technical Summary
There is a need for spinach cultivars with genetically encoded resistances against Peronospora farinosa, as existing resistance genes are rapidly bypassed by the pathogen, and organic production methods preclude the use of fungicides, leading to challenges in managing downy mildew and other pathogens like Stemphylium and Cucumber Mosaic Virus.
Introduction of a novel resistance gene with a specific genomic sequence (SEQ ID No. 1) and encoded protein (SEQ ID Nos. 3) that provides resistance to Peronospora farinosa races Pfs 13 to Pfs 18, optionally combined with resistance to Stemphylium and CMV, achieved through genome editing techniques such as CRISPR/Cas, Agrobacterium transformation, and mutagenesis.
The novel resistance gene confers broad-spectrum resistance to Peronospora farinosa races and potentially other pathogens, enabling development of spinach cultivars suitable for organic farming without the need for fungicides, as demonstrated by disease assay and VIGS experiments.
Smart Images

Figure IMGF000009_0001 
Figure 00000021_0000 
Figure 00000021_0001
Abstract
Description
[0001] NOVEL GENE PROVIDING RESISTANCE AGAINST PERONOSPORA FARINOSA Description The present invention relates to genes, coding sequences and / or proteins providing resistance against Peronospora farinosa and especially to genes, coding sequences and / or proteins providing resistance against Peronospora farinosa in a spinach plant. The present invention further relates to spinach plants comprising the present resistance genes, coding sequences and / or proteins and to methods for providing and / or identifying Peronospora farinosa resistant spinach plants using the present genes, coding sequences and / or proteins. Spinach is commercially grown worldwide for its attractive and nutritious leaves. Spinach (Spinacia oleracea or S. oleracea) is a member of the Amaranthaceae family, subfamily Chenopodioideae. Other well-known family members include quinoa and beet. The latter is a cultivated plant of major importance for agriculture with sugar beet, red beet, and Swiss chard as examples. Regarding nutritional value, while providing only relatively small amounts of calories (23 for 100 grams of cooked spinach), spinach is a rich source of vitamins A, B2 (or folate), B6, C, E and K and, additionally, magnesium, manganese, calcium, potassium, iron, and dietary fibre. Spinach flowering is induced by (long) day lengths and under optimal conditions can reach even up to 4 generations in a year with a life cycle from seed to new harvest completed within 3 months. A bottleneck can be caused by seed dormancy. Spinach is a wind pollinator and its pollen can reach far. A spinach line is considered male if it converts from female or mixed flowering to (all) male flowering within a week. Female spinach lines stay so for at least three weeks without producing any pollen. Hybrids of spinach can be produced making use of plants which have a female flowering phase and plants which have a male flowering phase as pollinator. Before the female spinach plants develop male flowers, all female flowers are fertilized by the male spinach plant. The setting of seeds occurs rapidly within 3 days and after that the ripening of the seed takes approximately a month. Under optimal conditions commercial elite spinach lines are grown and harvested within 25 days. Breeding resulted in spinach plants which are rapid growing without premature flowering. Older varieties tend to have narrower leaves and have a stronger, somewhat bitter taste; newer varieties have broader leaves and a milder taste. Also, recent types have little tendency for bolting in warm conditions and therefore will not prematurely flower and produce seeds. Spinach is cultivated for the leaves. Commercial spinach can have round leaves of a dark green color. Leaf morphology is of interest to spinach breeders. A significant share of the market of cultivated spinach is the early harvested baby leaf spinach. For spinach growers it is important that the leaves stand straight up which facilitates easy harvest and dark green colour is desirable. Spinach originated from middle Asia but it is now produced all over the world. Traditional areas where spinach was grown as a crop are Europe and Northern America, however contemporarily the biggest volume of spinach is produced in China. Spinach is produced for the food processing industry (canned or frozen spinach) as well as for the fresh market, where especially baby leaf spinach is in demand. Breeders develop lines with characteristics best suited for the location or the purpose. An important development in the production and sales of fresh spinach was the introduction of bagged spinach. For this application the desired leaf morphology is such that the leaves are not too closely packed. Basic types of spinach presently on the market are: - A savoy type with dark green, curly and crinkly leaves (mainly for the fresh market); - A flat, or smooth, leaf spinach with broad, smooth leaves that can be cleaned easily. This type is used for industry (canned or frozen spinach, as well as processed food and baby food); - Semi savoy is an intermediate type of spinach with a comparable texture as the savoy type but easy to clean as the smooth type of spinach. It is cultivated both for fresh market and industry. - An oriental type which is heat tolerant, has long petioles, pointed leaves with several side lobes and as plant has an upright growth. Most spinach is produced at high plant densities for fresh market production creating an ideal environment for disease development. Additionally, there is an increasing demand to produce organic vegetables, i.e., vegetables that are obtained without the use of pesticides, fungicides, insecticides and without chemical treatment of the seeds. The challenge here is that such organic vegetable production conditions promote the development of plant diseases. Accordingly, there is a need in the art for spinach cultivars that encompass genetically encoded resistances against pathogens. Common pathogens causing disease in spinach are Peronospora, Fusarium, Stemphyllium, Colletotrichum, Cercospora and Cucumber Mosaic Virus. A major disease in spinach is downy mildew caused by the oomycete pathogen Peronospora farinosa or Peronospora effusa (also designated as P. farinosa f. sp. spinaciae or abbreviated Pfs). The short lifecycle of Pfs results in rapid multiplication of the pathogen on susceptible cultivars. At first, small pale-yellow irregular spots appear on the upper surface of the leaves together with a purple downy growth on the lower surface of the spots. Spores develop on the leaves 9-12 days after first infection and are spread by wind and splashes of water. Infected leaves are no longer attractive for consumption and prone to other, secondary (microbial) infections. One way to combat downy mildew is to spray the plants with fungicide. This approach is highly undesirable due to its heavy impact on the environment, high costs and labor intensity. Moreover, half of the agriculturally produced spinach is meant for the organic vegetable market for which the use of fungicide is not desirable or even suitable. Peronospora effuse / farinosa is a pathogen that rapidly overcomes, or breaks, resistance. Within a period of 2 to 3 years, newly introduced resistance genes are observed to be bypassed by the pathogen necessitating a constant demand for identification of new resistance sources. Official races have been described by the International Working group on Peronospora effusa / farinosa / Pfs (IWGP). Since only a limited set of resistance to Peronospora farinosa (RPF) genes have been described that originate from S. oleracea, wild relatives are a potential interesting source of novel and alternative RPF genes. Effector triggered immunity (ETI) is a part of plant immune system, NB-LRR proteins form a class of proteins that can trigger ETI. NB-LRR proteins obtain their name from a central Nucleotide-Binding domain and a C-terminal Leucine Rich Repeat domain. Many plant disease resistant proteins are NB-LRR proteins wherein NB-LRR proteins recognize the pathogen effector and activate host defense. The C-terminal LRR domains of NB-LRR proteins are highly irregular, have varying lengths and differ in the number of LRR repeats. The LRR domain is involved in pathogen recognition and mutations in the C-terminal half of the LRR domains have been shown to influence recognition specificity. LRR domains contain patches with epitopes involved in effector binding. Recognition of the pathogen effector through the LRR domain transduces a signal to the rest of the protein. WO2018059651 and related patent literature documents disclose WOLF genes encoding proteins of the CC-NB-LRR family providing resistance against Peronospora farinosa in spinach plants. Considering that a significant part of the spinach production is grown organically, i.e., in the absence of, amongst others, fungicides, there is a high demand for spinach varieties having resistance to all know Peronospora farinosa races (presently Pfs 1-19). However, in fields with fully resistant, i.e., resistant to Pfs 1 to 19, spinach cultivars the problem encountered by growers changes from Peronospora farinosa to other pathogens that can affect spinach. An example of such a pathogen is the fungus Stemphylium, the causal agent of Stemphylium leaf spot. Two species of Stemphylium have been described to cause disease on spinach that include Stemphylium beticola (previously Stemphylium botryosum) and Stemphylium vesicarium. In recent years, S. vesicarium is the most prevalent species of the two species. Stemphylium vesicarium produces typical conidiospores that germinate on the leaf surface and cause small necrotic lesions on spinach leaves with brown rings. Leaf spots can significantly reduce the quality and yield of spinach especially for the fresh market. Varietal differences in response to S. vesicarium have been observed. Another pathogen that affects spinach production is the virus Cucumber Mosaic Virus (CMV) the causal agent of spinach blight. CMV belongs to the family of Bromoviridae and the genus Cucumovirus and exhibits a broad host range of 1200 plant species in over 100 plant families. Economically important crops that can suffer from CMV infection include cucurbits, pepper, lettuce, celery, tomato, and beans. Genetically encoded resistance to CMV can prevent spread of CMV especially when crop rotations with susceptible crops is normal practice. Symptoms on spinach include yellowing of the leaves, distortion of the crown leaves, rolling leaves, stunting and dying plants. Leaves with yellowing are unsuitable to sell for fresh market spinach. Therefore, genetic resistance to CMV is a welcome addition for disease resilience in spinach plants. As indicated, there is a rapid adaptation of Peronospora farinosa to the genetically encoded resistance. New Peronospora farinosa isolates continuously emerge capable of evading host recognition thereby bypassing resistance. To counter this rapid adaptation, breeders either search for new resistance genes or combine, or stack, known resistances, i.e., introduce two or more different Peronospora farinosa resistance genes into one plant to increase the chance that a plant can overcome Peronospora infection or reduce the probability that the 19 pathogen races that are currently recognized, overcome the resistance. There is thus a need in the art to provide new and alternative genetically encoded resistances against Peronospora farinosa to enable breeders to develop novel spinach cultivars that are resistant to the plant pathogen Peronospora farinosa. It is an object of the present invention, amongst other objects, to meet this need in in the art. This object, amongst other objects, is met by the present invention as outlined in the appended claims. Specifically, this object of the present invention, amongst other objects, is met by providing a resistance gene capable of providing Peronospora farinosa resistance in spinach, wherein the resistance is comprised in the genomic sequence of SEQ ID No.1. According to a preferred embodiment, the present resistance gene capable of providing Peronospora farinosa resistance in spinach encodes a protein having the amino acid sequence of SEQ ID Nos.3, or amino acid sequences having at least 95% sequence identity with SEQ ID Nos.3. According to another preferred embodiment, the present resistance gene capable of providing Peronospora farinosa resistance in spinach encodes a protein with an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID Nos.3. According to another preferred embodiment, the present resistance gene capable of providing Peronospora farinosa resistance in spinach comprises a coding sequence having the nucleotide sequence of SEQ ID Nos.2, or nucleotide sequences having at least 95% sequence identity with SEQ ID Nos.2. According to yet another preferred embodiment, the present resistance gene capable of providing Peronospora farinosa resistance in spinach comprises a coding sequence having at least 95%, 96%, 97%, 98%, 99% sequence identity with SEQ ID Nos.2. The resistance gene according to the present invention provide resistance to at least Peronospora farinosa races Pfs 13 to Pfs 18. The present invention relates to a genomic sequence according to SEQ ID No.1; nucleotide sequence SEQ ID Nos.2; or amino acid sequence SEQ ID Nos.3. Additionally, the present invention relates to spinach plants comprising a resistance gene as defined above; or to Peronospora farinosa resistant spinach plants comprising a genomic sequence according to SEQ ID No.1; nucleotide sequence SEQ ID Nos.2; or amino acid sequence SEQ ID Nos.3. According to the present invention, the present resistance gene can be homozygous or heterozygous present in a Peronospora farinosa resistant spinach plant. The spinach plants as defined above can be additionally resistant to Stempyllium and / or CMV. The present invention also relates to methods for providing a spinach plant that is resistant to downy mildew, wherein the methods comprise the step of introducing into the genome of a spinach plant a resistance gene as defined above or modifying the genome of a spinach plant for providing a genome comprising, or encoding, a sequence as defined above. The present methods preferably comprise one or more steps of genome editing, CRISPR Cas, Agrobacterium transformation and / or mutagenesis. The present invention provides method for providing a spinach plant that is resistant to downy mildew, wherein the methods comprise the steps of: i) providing the spinach plant as defined above; ii) crossing the spinach plant of step i) with spinach plant; iii) optionally, selfing the spinach plant obtained in step ii) for at least one time; iv) selecting spinach plants that are resistant to downy mildew. The present invention also provides methods for identifying a downy mildew resistant spinach plant, the methods comprise the steps of: i) isolating nucleic acid material form a spinach plant; ii) establishing in the isolated nucleic acid material of step (i) the presence or absence of a nucleotide sequence as defined above; iii) identifying a downy mildew resistant spinach plant based on the presence of a nucleotide sequence as defined above. According to the invention, the sequence identified herein can be used for identifying or providing a downy mildew resistant spinach plant. The present invention will be further detailed in the examples below. In the examples, reference is made to figure 1 and figure 2, wherein Figure 1: shows the schematic organization of the genomic DNA and the cDNA. The line represents the genomic DNA. The black-filled rectangles represent the exons. The sum of the black-filled rectangles represents the cDNA. The scale bar represents 100 bp. Figure 2: shows silencing of PDS resulting in white leaves. In spinach the PDS gene was silenced as described in Example 4. The silencing of PDS resulted in loss of green color (middle and right panel) while the plants treated with the empty vector still look like wildtype (left panel).
[0002] Examples Example 1. Peronospora farinosa- disease trial Resistance to Peronospora farinosa f.sp. spinaciae (synonym P. effusa, hereafter Pfs) was tested in a qualitative disease assay. In short, 10 to 14 days after untreated seeds were sown in soil, a minimum of 8 plants were inoculated with a spore suspension of a single Pfs race or isolate. Pfs was maintained on a living susceptible host plant, for example, Viroflay or Blight or plant material with spores stored for a maximum of 1 year at -20oC. Inoculated plants were incubated under plastic at high humidity (80-100%) at a temperature ranging from 16oC-20oC. After 24 hours, plastic was removed and plants were assessed at 9 to 12 days after inoculation. When sporulation was observed on the cotyledons or true leaves a plant was considered susceptible and when no sporulation was observed a plant was considered resistant. A differential set as described in Table 1 is included in each disease trial under the same environmental conditions to confirm the race. This differential set for Pfs was developed by the International Working Group on Peronospora farinosa (IWGP) and can be found on the website of the International Seed Federation (ISF). This differential set that consists of spinach varieties and near-isogenic lines (NILs) is used to determine the Pfs race. In this table “–“ indicates resistance (no sporulation), “+” indicates susceptibility (sporulation), “(-)” indicates intermediate resistance (sparse sporulation on the tips of cotyledons), “n.t.” indicates that the current strain was not tested. Seeds of this differential set and Pfs races can be obtained at Naktuinbouw (P.O. Box 40, NL-2370 AA, Roelofarendsveen, Netherlands, naktuinbouw.com). Spinach plants comprising the novel resistance gene according to the invention (comprised in SEQ ID No.1) were tested against several Pfs isolates – Table 2.
[0003] Table 1. IWGP Spinach differential set for Pfs. Where “–“ is resistant, “+” is susceptible Race Pfs Variety / NIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Viroflay + + + + + + + + + + + + + + + + + + + NIL5 - - + + + + + + + + + + + + + + + + + NIL3 - + - + - + + - - + - - + - + - + + - NIL4 - - - - + + + + + + + + + + - + + + + NIL6 - + - - - + - + + + - + (-) + - - + - + NIL1 - - - - - - - + - + - + - + - - + - + NIL2 - - - - - - - - - - + + + + - + + + + Pigeon - - - - - - - - - - - - - + - + + + + Caladonia - - - - - - - - - - - - - - + - + + - Meerkat - - - - - - - - - - - - - - - + (-) + + Hydrus - - - - - - - - - - - - - - - - - - +
[0004] Table 2. Resistance pattern of spinach plants according to the invention. Where “-“ is resistant and “+” is susceptible and “n.t.” is not tested. Race Pfs Plants with novel resistance gene (comprised in Seq ID No 1) 1 n.t. 2 - 3 n.t. 4 n.t. 5 n.t. 6 - 7 - 8 n.t. 9 n.t. 10 n.t. 11 n.t. 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 n.t. Example 2. Peronospora resistance providing gene: genomic DNA sequences, cDNA and protein. In an internal genetic pool, a spinach plant (Spinacia oleracea) was identified with resistance to the pathogen Peronospora farinosa. The selected plant was sequenced with Illumina sequencing. The sequencing data has been mapped against the S. oleracea reference genome and de novo genome assemblies were performed. Previously performed marker analysis resulted in the identification of a QTL. Within the span of the QTL a highly interesting gene coding for a putative resistance protein was observed. Comparative genomics between the S. oleracea reference genome and the de novo sequenced plant resulted in the identification of the resistance providing gene. The genomic sequence of the identified gene is SEQ ID No.1. Subsequently, experiments were performed to obtain the cDNA sequence of the resistance gene. Total RNA was isolated (innuPREP Plant RNA Kit (Analytik Jena # 845-KS- 2060250)) from single cotyledons of resistant seedlings and subsequently cDNA was synthesized with the ProtoScript First Strand cDNA Synthesis Kit (NEB # E6300L)An exon spanning PCR was performed with primers located in the first and last exon. 5’ RACE cDNA was synthesized according to the protocol of the Template Switching RT Enzyme Mix (NEB #M0466) by using a template-switching (TS) RNA oligo, a gene-specific primer (GCATATCGGGTAGACTTTGGC), and template-switching reverse transcriptase. Subsequently a PCR was performed with a TS-specific oligo (CATTGCAAGCAGTGGTATCAAC) and a gene specific primer (CGTCGAGAGGAGATTGGTCA). Similarly, 3’ RACE cDNA was generated with an anchored oligo-d(T)23VN primer and M-MULV reverse transcriptase (ProtoScript First Strand cDNA Synthesis Kit (NEB # E6300L)) . A gene specific forward primer (GTGTGTCCAAGAAAGCCCTG) and oligo- d(T)23VN ) primer were used to obtain a PCR product. To enhance specificity for the resistance gene-derived cDNA, a nested PCR (ACGAATTCGGTCACCCTTGA x oligo-d(T)23VN) was performed on the resulting fragments. All amplified fragments were sequenced using Nanopore sequencing, aligned to the genomic DNA and assembled to obtain complete cDNA sequences. The cDNA of the resistance gene has the sequence SEQ ID No.2 which corresponds to the amino acid sequence SEQ ID No.3. Below an alignment is presented between the genomic DNA (SEQ ID No.1) and cDNA (SEQ ID No.2). Clustal Omega was used to perform the alignment. Additionally the organization of the genomic DNA versus the cDNA is schematically shown in Figure 1. The gene comprises five exons. gDNA ATGGAGCGAAATATGAATAGTGAAGTCGCGAGAAGTTCTTCAATTTCAAGCTTATCAAGCGACAACAATG 70 cDNA ---------------------------------------------------------------------- 70 gDNA GCGATAACAAGTCTATCGTCGTTAGGGTTAAGCGCAAGCTTGACCAATCTCCTCTCGACGCTTTCTGTAT 140 cDNA ---------------------------------------------------------------------- 140 gDNA GTTCCTCTTCTATTTTAATTTTCTTTTAAATTTCTGCAAAATTAAATTTCACTTTTGATGATTTTTGCAA 210 cDNA ---------------------------------------------------------------------- 210 gDNA TGCAAGGCTTGAAATCAACGAGAGATCTGTTGAGCGTCCGTTAATAGATTTTGATCAGCTATCCGTTTCG 280 cDNA ---------------------------------------------------------------------- 280 gDNA ATCTGATTCTTCTACTCAAGTTATATTGTAATTTTGGTTTTGATAGTTGTAATTTTGGTTTTGATAGTTG 350cDNA ---------------------------------------------------------------------- 350gDNA TAATTCTGGGTTTATTAAAGTAAATTACTTAATAAGGGTGATTATGATGTGATTAGTCGACTAATTGGGC 420 cDNA ---------------------------------------------------------------------- 420 gDNA GGAAAACGTATTAATTGACAACGAATTAGTAATTGACCTCCATTGTTAGAAAAATAGCTAATAATTGACA 490 cDNA ---------------------------------------------------------------------- 490 gDNA ACTTTTAACAAAACCTATGTAGTAATTAGTTAGTAATTGACAACTTATAGTATGGAGTAGTTAGTAATTG 560 cDNA ---------------------------------------------------------------------- 560gDNA ACAAAGTTCTAAACAACTTACTTGACAAATTTTCCAATACATAACAATGGAAATGCATTGTACATTTCTA 630cDNA ---------------------------------------------------------------------- 630 gDNA CTCTATTGTTTTCGTGTTGGGCCCGAACATAAGGTCATGTCTTCTCTTTCAAAGACTTGGTTATTTCGAC 700 cDNA ---------------------------------------------------------------------- 700 gDNA TTGACTCCGGTGGGGCTGTGTTGAGTATGGTTATACACGTTGTTTTACTTGACCTGATCCTAAACTTGGA 770 cDNA ---------------------------------------------------------------------- 770 gDNA CCTAACTCTGTATTACTTGAAAGGTTGCGTACACCCTCCGTCCCTTGCCTCGTAGACGATGTGTGCTTTA 840 cDNA ---------------------------------------------------------------------- 840 gDNA TTAAGGATTGAACCGAAAATTTACAAGGAATTTGGGGGTATCTATGTCTTTTTGACTTTTTGAGTGTATA 910 cDNA ---------------------------------------------------------------------- 910 gDNA CAAGTGGGATAAATGGTGGGGACATGTTACTATATAAGGAAATTAGAAACCGGACAATTTTTAAAGGATG 980 cDNA ---------------------------------------------------------------------- 980 gDNA GACCAAAATAAAATATGGGGAAAACAAATAGGGATAGAGGGTATTAAATTTATCAATTATCCTCCACAAA 1050 cDNA ---------------------------------------------------------------------- 1050 gDNA AGTTGAGGAAAATCAACGTTGCTGTCAAGTTGGGCTTGAGATGAGATGGGTGGAAGAAAATGAGCCCTTT 1120 cDNA ---------------------------------------------------------------------- 1120 gDNA CAGTATAGTTGATGCAGCAAGTAGGCAAGTTGCAATATGTCAAGTCAACTCAAGTAAACGAAGAAAAATG 1190 cDNA ---------------------------------------------------------------------- 1190 gDNA TGGCTTAAGCAAGTTTGTCATATGTTATTTACTTGTGGGTCTACCAACTAACCTTGAAAATCACTTGTAC 1260 cDNA ---------------------------------------------------------------------- 1260 gDNA TGTTGTACATACTTTGGACAAGACAATGTCTTTGCTTTTCTCACTCTTTCCTCACTCTTTCCTCGAATTG 1330 cDNA ---------------------------------------------------------------------- 1330gDNA TAAGACGTTCTTCCAGCCCAAACACAATACAAGTATATGCCTTTATTTATAACGGAGTAGAGGAATTTTA 1400cDNA ---------------------------------------------------------------------- 1400 gDNA AAACTCACTTCATTATTTCCTTTGCATTCCTCAAAATAAGCAATACTAATTCATAACAAAAGAGAGAGAG 1470 cDNA ---------------------------------------------------------------------- 1470 gDNA ATGGATGTGTCTGCAGGCCTTTCACTAGTACAAACTGTCCTCGAATTGTTGGGTTCTCCCATTTGGACGC 1540 cDNA ---------------------------------------------------------------------- 1540 gDNA AGATTCAATCTTTGTTGGGTGTGGAGTACTCACAGCTTGACAAACTCAAGGCCACCATGTCCACTATTGA 1610 cDNA ---------------------------------------------------------------------- 1610 gDNA GGCTGTGCTCCTTGATGCTGAAGATCAAGAGCAGTTGCATCAATATCGTCGTAGCCATGTTGAACTGGAT 1680 cDNA ---------------------------------------------------------------------- 1680 gDNA AGGCTTCAGAGGCTTAAGGAAGCTCTTTATATAGCTGATGACTTGTTCGACAAGATTGCCACTCTTGCTC 1750 cDNA ---------------------------------------------------------------------- 1750 gDNA AACGCAAAACCCTCATAATGCGTTTTAATAACAAGCTGCTTAATGAGGTATGCCTTTTCTTCTCTTCCTC 1820 cDNA ---------------------------------------------------------------------- 1820 gDNA TAATAAGCTTCGTTCTGCTTTCACTGGGTCTCGTGAGATGGAGAACATAAGGGAGATGTTGAATGATATT 1890 cDNA ---------------------------------------------------------------------- 1890 gDNA GTCAAAGATCATCGCTATGACTTTGGCTCCAGACACCCCGTTAGTCTGGATGCGAAACAGCTGAGAATCA 1960 cDNA ---------------------------------------------------------------------- 1960 gDNA AAGCAAGGGAAACTCATTCCTTTGTTTGCGAGGAAGATATGATCATTGGGAGGGATGATGACAAGCGGAA 2030 cDNA ---------------------------------------------------------------------- 2030 gDNA AGTGATAGATATGGTACTAAACACTTCTTGTGAGGAGAAGGATATTTCTGTTGTCAGCATAGTGGGGATT 2100 cDNA ---------------------------------------------------------------------- 2100 gDNA GGGGGGCTGGGAAAAACAACTCTAGCCCGACTTGTTTATAATGATGAGAAGATAGGTAGTAAATTCTCTC 2170cDNA ---------------------------------------------------------------------- 2170gDNA TGAAAATGTGGGTTTGTGTCTCTGATAGTTTCAATGTCAAAGATCTTGTTGCTGAAATCCTTGCAGCCGT 2240 cDNA ---------------------------------------------------------------------- 2240 gDNA AAACCCTAGAAGAAAGCACGATGCCCTGAGTATGAGTATGGACCAGCTTCAGATGAAAATTCGGGACGAA 2310 cDNA ---------------------------------------------------------------------- 2310 gDNA CTGGATGGGAAGATATACCTCCTTGTTTTGGATGATGTATGGACTGAAGATCCCATTAAATGGCATGAGT 2380 cDNA ---------------------------------------------------------------------- 2380gDNA TGAGAAAACTATTGATTGGAGGTAGAAACGGTAGCAGAATTCTGGTGACTACTCGCTCAAGTGGGGTGGC 2450cDNA ---------------------------------------------------------------------- 2450 gDNA GAAAGTTGTTGGAAGCTATCATATTCATAAATTGGAAGGACTCTCTAATAAAGAGTCTTGGGATTTGTTT 2520 cDNA ---------------------------------------------------------------------- 2520 gDNA GAGAGGATGACACTTGAACCAGGACAACATCAAATGCAAGAGCACTTGGTTAAAATTGGAAAAGATATTG 2590 cDNA ---------------------------------------------------------------------- 2590 gDNA TGAGAAAGTGTGCAAATGTTCCACTTGCTATAAGGGTGGTTGGAAGTCTTCTTCGAGGTCAGGGTGAAAG 2660 cDNA ---------------------------------------------------------------------- 2660 gDNA TAGGTGGCAATATTTGAAAAACACTGACTTGGCAAATATACCACAAGATGAGATCAATGGTATTTTACCT 2730 cDNA ---------------------------------------------------------------------- 2730 gDNA GTTTTGAAGATTAGTTATTATTATCTTCCGTTCCATTTGAAGAGTTGCTTTAAGTATTGTTCTGTATTCC 2800 cDNA ---------------------------------------------------------------------- 2800gDNA CCAAGGATTACAAGATTATCAAGGAGGATTTGATCAGTCTCTGGATGGCACAAGGCTTCATCATCTCATC 2870cDNA ---------------------------------------------------------------------- 2870 gDNA AAATGAAGAGAGTTTCGAAAATGCAGGTGAGGAATATTTCAAACAATTACTCCAAAGGTGTTTCTTCCAA 2940cDNA ---------------------------------------------------------------------- 2940gDNA GATGTAGAACGGGCCGAGGGTACTGATGAAATTCTATCATGCAAGATGCATGACTTGATTCATGACCTTG 3010 cDNA ---------------------------------------------------------------------- 3010 gDNA CTAGTGAAGTAGCAGGAACAGAAATCGTGTCGTCCAAGTATAATATAAGGGGGTTTAGCGAGAAAACTCG 3080 cDNA ---------------------------------------------------------------------- 3080 gDNA CCATATATTTATTGATAGAGATGCCGTTAAAGATATTTATCGTCATTTCACCAATATGAAAAGGATGCGT 3150 cDNA ---------------------------------------------------------------------- 3150gDNA TCAATTTTTAGAATAGATGCGCTTTCTTCTAATTCAACATATTTGTTATCAAAAGTGGAATATTTAAGGG 3220cDNA ---------------------------------------------------------------------- 3220 gDNA TCTTAAGCTTGAATAACTCTGATTTGGAAATGTTGCCGAGTGAGATAGGTAACTTGTTGCATCTAAGATA 3290 cDNA ---------------------------------------------------------------------- 3290 gDNA TCTTGACCTATCAGATAATTACCGTCTCTCTAAGTTGCCTACCTCCATTACCAAGCTTTACAACTTGCAA 3360 cDNA ---------------------------------------------------------------------- 3360 gDNA ATATTGAAGTTACGTGAGTGTCGTGGTCTAAAAACTTTGCCAAGCGATTTGAGGAAATTAGTAAATCTAA 3430 cDNA ---------------------------------------------------------------------- 3430 gDNA GGCACCTAGATATACAAGGCTGTAAGAGTTTGTCGCATATGCCCCGGGGGATGAATAGCATGACATCTCT 3500 cDNA -----------------------------------------------------------ATGAC------ 3500 ***** gDNA GCATAAACTGACAGGGTTTGTAGTGAGCAGAAAAAGAAATAGCTGGAATCGGGGGTCAGTTAGTGTTGGT 3570 cDNA ---------------------------------------------------------------------- 3570 gDNA GAGCTGGGAGATTTGAAAAATTTCAGCAATCATAGCCACAATATGGTAATTTATGTCAAAAAAGATGCAG 3640 cDNA ---------------------------------------------------------------------- 3640 gDNA TTGATGCTAGGGAAAAGGGGTTTCTATTAAAAAGTGAACATTTGAGGGAAATTCAGTATGTTTGGAATCA 3710 cDNA ---------------------------------------------------------------------- 3710 gDNA TGAGAGTGAGGGGACTGATGCAGATGCATTGCTGCAAGGGAAAAATGCAGATGTGGTGCTGCAAGGGCTG 3780 cDNA ---------------------------------------------------------------------- 3780 gDNA CAACCCCATCTTAATCTCCGAATGTTGGAGTTGAGGGATTATCCAGGAATTAGGTTCCCAAGCTGGGGGA 3850 cDNA ---------------------------------------------------------------------- 3850 gDNA GGTCATCAATGAATCTCCATACTTGTCTCCCAAATCTTGTTAGCATAACACTATACGGATGTACAAGGTT 3920 cDNA ---------------------------------------------------------------------- 3920 gDNA GGAGCATCTTCCATTGATGAGTCAACTGCGTCATTTGAAATTCCTTACATTACGATATTTGAGTGAAGTG 3990cDNA ---------------------------------------------------------------------- 3990gDNA GTGTATATGGAGAATAGTATTATCAGCGCAGAAGGGGTTGCATCGACATCAGGAGGGTCAAGTCATGGAG 4060 cDNA ---------------------------------------------------------------------- 4060 gDNA GAGCAGATGAGGACTTGGTTTTCTTTCCATCCCTTGAAAAGCTTGAGCTTTGGAGTATGCCAAAGTTGGA 4130 cDNA ---------------------------------------------------------------------- 4130 gDNA AGGATGGTGGAAATCAGAATCAGATATGGGTGAGACACGAGAAGTAGCAGGGTTTCAATCACATTCGTAT 4200 cDNA ---------------------------------------------------------------------- 4200gDNA TCGTTCCATCACCTTTCTCATCTGTTAATTACATTTTGTGATAATTTGAGAAATTTTCCTCTCTGTCCGA 4270cDNA ---------------------------------------------------------------------- 4270 gDNA AACTGGAAGAATCAAACTCCCAACTACAGGAAATCAGAAATCTGAATCATTCTTTTACCAGTAAGATCTT 4340 cDNA ---------------------------------------------------------------------- 4340 gDNA CTTTTTTTTTGTGTGTGTGTAAAAGGTTACATATTTTTATATATACCTAGTAGCTCCTAACTATCTACAA 4410 cDNA ---------------------------------------------------------------------- 4410 gDNA GTATAACTTTGTTCATGGTATAAGTGCAGAAGACGAAGTTGAGTCCCTCCAATCCTTGCAATTTGACCTT 4480 cDNA ---------------------------------------------------------------------- 4480 gDNA GAAACTATAGAAATTGCAACACATAACTTTTCTGATGATAATAAGATCGGAGAAGGCATCGGCCCGGTTT 4550 cDNA ---------------------------------------------------------------------- 4550 gDNA ATAAGGTACTAATTCAGTTAATATAGTACTGGTGTACTACGTATTAGTGTATTACTTCAAATGATTAACC 4620 cDNA ---------------------------------------------------------------------- 4620 gDNA AGCTTATTTGTTCTTTGTAGGGTATACTTCCTGATGGGCAAGAGATAGCAGTTAAGAGGCTTTATAGGAA 4690 cDNA ---------------------------------------------------------------------- 4690 gDNA CCCGGGCCAGGGAGAGGATGAGTTCAAAAATGAAATTTTGATATTAGCCAAGGTCCGGCACAAGAATTTG 4760 cDNA CCCGGGCCAGGGAGAGGATGAGTTCAAAAATGAAATTTTGATATTAGCCAAGGTCCGGCACAAGAATTTG 4760 **********************************************************************gDNA GTGAAACTTCTAGGATTTTGCTTGCATGGAGAAGAAAGGATTCTTGTCTATGAGTTTGTTGCCAACAGAA 4830 cDNA GTGAAACTTCTAGGATTTTGCTTGCATGGAGAAGAAAGGATTCTTGTCTATGAGTTTGTTGCCAACAGAA 4830 ********************************************************************** gDNA GCCTTGACAACTTTATATTTGGTATGTAATCACTACTACAATTCGAGATTTTACACATACTACCGGGATG 4900 cDNA GCCTTGACAACTTTATATTTG------------------------------------------------- 4900 ********************* gDNA TATAACAATCCAATCCGGGTGATTTTCAAATGATTATGATGTATATTAGATTTGTTTACGACTCTAAGGA 4970 cDNA ---------------------------------------------------------------------- 4970 gDNA CTAGTTTCATTGCATGATACATGTATCCAGTGTCCATCATACTATTTTGGTAATAAAATGCAGATCCATT 5040cDNA ---------------------------------------------------------------ATCCATT 5040******* gDNA GAGTCGTCAGTCTATGCAATGGGAAATTCGTTATAAGATTATCAATGGCATAGCTAGAGGGATTCTATAC 5110 cDNA GAGTCGTCAGTCTATGCAATGGGAAATTCGTTATAAGATTATCAATGGCATAGCTAGAGGGATTCTATAC 5110 ********************************************************************** gDNA CTCCATGAAGGTTCCAGACTAATGATCATACATCGCAACCTAAAAGCAGGAAGTGTTCTACTTGATGAAG 5180 cDNA CTCCATGAAGGTTCCAGACTAATGATCATACATCGCAACCTAAAAGCAGGAAGTGTTCTACTTGATGAAG 5180 ********************************************************************** gDNA ATTTTTGTCCCAAGATTGCAGATTTTGGTATGGCATGGCTATTTAACATAGATCAAACTCAAACAGAGGC 5250 cDNA ATTTTTGTCCCAAGATTGCAGATTTTGGTATGGCATGGCTATTTAACATAGATCAAACTCAAACAGAGGC 5250 **********************************************************************gDNA TAGCACAATCGCTGGAACCTTGTAAGCATCGGAACTTTATATTTAGTTAATTACATAATGTCTAATACTC 5320cDNA TAGCAGAATCGCTGGAACCTT------------------------------------------------- 5320 ***** *************** gDNA TGTATGCTTTTGTTTTCTTATTTTGAGAAACGATTTTTGTTATTCAGAGGATATATGGCACCTGAGTACG 5390 cDNA -----------------------------------------------AGGATATATGGCACCTGAGTACG 5390 *********************** gDNA CTGAGCAAAGTCAAGTATCAGTAAAGTTAGACGTATACAGCTTTGGTGTACTAGTCCTAGAGATAGTAAG 5460 cDNA CTGTGCAAAGTCAAGTATCAGTAAAGTTAGACGTATACAGCTTTGGTGTACTAGTCCTAGAGATAGTAAG 5460 *** ******************************************************************gDNA CGGGCAGAGGATTACTTCATTTTGTTACGAGGGAGAAAACCTCACGACCTCTGTAAGTTTGATTATCTGA 5530 cDNA CGGGCAGAGGATTACTTCATTTTGTTACGAGGGAGAAAACCTCACGACCTCTG----------------- 5530 ***************************************************** gDNA TTGGTTAATTCTAAATTTACGTTGCAAAAAATTGACAAACTTGACCTCATTCATGGATGACATTTGTGTA 5600 cDNA ---------------------------------------------------------------------- 5600 gDNA TAGGCATGGAGAAACTGGAATGAAGGCACAGCTTGGAATCTGGTAGATCCTGTGTTACTAGGCAGCTCTA 5670 cDNA ----CATGGAGAAACTGGAATGAAGGCACAGCTTGGAATCTGGTAGATCCTGTGTTACTAGGCAGCTCTA 5670 ****************************************************************** gDNA GAACCGAGATACTGCGATGCATCCATATCGGTTTGTTGTGTGTCCAAGAAAGCCCTGCAGACAGGCCAAC 5740 cDNA GAACCGAGATACTGCGATGCATCCATATCGGTTTGTTGTGTGTCCAAGAAAGCCCTGCAGACAGGCCAAC 5740 ********************************************************************** gDNA TATGTCTGAGGTTCATGTTATGTTGAGTACGAATTCGGTCACCCTTGAAGCACCTTTGCAGCCTGCATTT 5810 cDNA TATGTCTGAGGTTCATGTTATGTTGAGTACGAATTCGGTCACCCTTGAAGCACCTTTGCAGCCTGCATTT 5810 **********************************************************************gDNA TGTACAGATAGCCAAAGTCTACCCGATATGCTTCTGGAGTGGAGCACAACTAATAGTCAAGTATCAGATG 5880 cDNA TGTACAGATAGCCAAAGTCTACCCGATATGCTTCTGGAGTGGAGCACAACTAATAGTCAAGTATCAGATG 5880 ********************************************************************** gDNA ATGAATCGGAGCCGTAGGGGAGGTGATAAATCCAAGGAAAATTTACTTCTTCCATGGAAATCCACATTTT 5950 cDNA ATGAATCGGAGCCG-------------------------------------------------------- 5950 ************** gDNA TCAAAACTAATTTTCTTGGAAAAAGTGATTTTTTTCCCCCTTGGATTTGTCATTTGCCAAACAGGAGTAG 6020 cDNA ---------------------------------------------------------------------- 6020 gDNA TTCAGTAAATGGTGTTTATGTAACAGAGTTGCACCCTAGATCATGTAATTTCCTAGATTTCAATTGGTGT 6090cDNA ---------------------------------------------------------------------- 6090gDNA ATATTGTATAGGGGCTTGATTGATATAATTTCTAGGTCATTTTGTGTAGCAAAGTGATAAAGGTCGTAAC 6160 cDNA ---------------------------------------------------------------------- 6160 gDNA TTGCGAC 6167 cDNA ------- 6167 Example 3 Virus Induced Gene Silencing Experiment (VIGS) to silence the novel resistance providing gene. Tobacco rattle virus (TRV)-derived VIGS vectors have been abundantly described to study gene function in Arabidopsis thaliana, Nicotiana benthamiana, Lycopersicon esculentum and other plants. Prior to the experiment we received plasmids 0155-157 pTRV1 and 0158-160 pTRV2-MCS from the Arabidopsis Biological Resource Center. To confirm that the genomic fragment comprising the novel resistance gene is responsible for the observed resistance phenotype, a VIGS experiment can be carried out. For this purpose, VIGS constructs, targeting the earlier described cDNA (SEQ ID No.2) were designed with SiFi21. In addition, a positive VIGS control was used, and this positive control targets the (Phytoene Desaturase) PDS gene. The negative control is the empty TRV2 vector. Function Seqeunce SEQ ID No. VIGS construct to silence the CCCTCCAATCCTTGCAATTTGACCTTGAAA CTATAGAAATTGCAACACATAACTTTTCTG 4 resistance gene ATGATAATAAGATCGGAACAGAAGCCTTG ACAACTTTATATTTGATCCATTGAGTCGTC AGTCTATGCAATGGGAAATTCGTTATAAG ATTATCAATGGCATAGCTAGAGGGATTCTA TACCTCCATGAAGGTTCCAGACTAATGATC ATACATCGCAACCTAAAAGCAGGAAGTGT TCTACTTGATGAAGATTTTTGTCCCAAGAT TGCAGATTTTGGTATGGCATGGCTATTTAA CATAGATCAAACT
[0005] SEQ ID No. Phytoene Desaturase (PDS gene) GGATTTCCCGCAGTGACACTGACATT 5 ATCGAAGCAACAATGAAGGAACTTGC CAAACTTTTCCCAGACGAAATTGCAG CTGATGGGAGCAAGGCTAAGATCCTC AAATATCATGTTGTCAAGACTCCAAG GTCTGTTTATAAGACAGTTCCAGACT GTGAGCCTTGTCGGCCACTGCAAAGA TCACCACTAGAAGGTTTCTATTTATCT GGTGATTACACAAAGCAAAAATATTT GGCTTCAATGGAAGGTGCTGTTTTAT CTGGGAAGTTTTGTGCACA In the positive control – where PDS gene was silenced – as expected the leaves of the plants have transiently turned white thereby confirming that PDS gene has been silenced and that the VIGS approach is effective. See Figure 1 for details. After the VIGS silencing, the obtained transformed plants can be subjected to a disease test using P. farinosa race 17. The non-transformed plants are still resistant to the pathogen, while it is expected that the plants where the VIGS experiments was successful, will become susceptible to P. farinosa. Example 4. CRISPR / Cas knock-out of the novel resistance gene. To assess whether the novel resistance gene is indeed a functional gene for providing resistance against the plant pathogen Peronosposa farinosa in spinach plants, a knockout of the gene according to the invention can be made using CRISPR / Cas9 in a spinach plant comprising the resistance providing gene according to the invention (SEQ ID No.1). Three target sites were identified and used to generate guide RNAs (gRNAs): SEQ ID No 6, SEQ ID No 7 and SEQ ID No 8, see Table 4, below. The mutation(s) introduced can be either insertion, deletion or another modification. The CRISPR machinery, gRNA and Cas9 proteins, can be delivered in spinach plant cells, via either PEG 10 mediated transfection of ribonucleoproteins (RNP), or Agrobacterium-mediated gene transfer. Edited cells can be regenerated to obtain viable plants. Plants that contain a mutation in the resistance providing gene according to the invention can be selfed to obtain spinach plants where the defective gene is present homozygous. Spinach plants where the defective gene is present homozygous are expected to become sensitive to the plant pathogen Peronospora farinosa. This can be tested by subjecting these plants to a pathogen infection with the plant pathogen race Pfs 17. For details of the disease trial see Example 1. Table 4. GuideRNA designed to target the novel resistance gene. Name of the sequence Sequence SEQ ID No. 6 GGGATTCTATACCTCCATGANGG SEQ ID No. 7 GAGTCGTCAGTCTATGCAATNGG SEQ ID No. 8 TGAGTCGTCAGTCTATGCAANGG
Claims
CLAIMS 1. Resistance gene capable of providing Peronospora farinosa resistance in spinach, wherein the resistance is comprised in the genomic sequence of SEQ ID No.
1.
2. Resistance gene according to claim 1, wherein the resistance gene encodes a protein having the amino acid sequence of SEQ ID Nos.3, or amino acid sequences having at least 95% sequence identity with SEQ ID Nos.
3.
3. Resistance gene according to claim 1 or claim 2, wherein the resistance gene comprises a coding sequence having the nucleotide sequence of SEQ ID Nos. 2, or nucleotide sequences having at least 95% sequence identity with SEQ ID Nos.
2.
4. Resistance gene according to anyone of the claims 1 to 3, wherein the resistance gene provides resistance to at least Peronospora farinosa races Pfs 13 to Pfs 18.
5. A genomic sequence according to SEQ ID No.1; or nucleotide sequence SEQ ID Nos.2; or amino acid sequence SEQ ID Nos.
3.
6. Spinach plant comprising a resistance gene according to any one of the claims 1 to 4.
7. Peronospora farinosa resistant spinach plant comprising a sequence according to claim 5.
8. Spinach plant according to claim 6, wherein the resistance gene is homozygous or heterozygous present.
9. Spinach plant according to any one of the claims 6 to 8, wherein the spinach plant is additionally resistant to Stempyllium and / or CMV.
10. Method for providing a spinach plant that is resistant to downy mildew, wherein the method comprises the step of introducing into the genome of a spinach plant a resistance gene according to any one of the claims 1 to 4 or modifying the genome of a spinach plant for providing, or encoding, a sequence according to claim 5.
11. Method according to claim 10, wherein the method comprises one or more steps of genome editing, CRISPR Cas, Agrobacterium transformation and / or mutagenesis.
12. Method for providing a spinach plant that is resistant to downy mildew, wherein the method comprises the steps of: i) providing the spinach plant according to any one of the claims 6 to 9; ii) crossing the spinach plant of step i) with spinach plant; iii) optionally, selfing the spinach plant obtained in step ii) for at least one time; iv) selecting spinach plants that are resistant to downy mildew.
13. Method for identifying a downy mildew resistant spinach plant, the method comprises the steps of: i) isolating nucleic acid material form a spinach plant; ii) establishing in the isolated nucleic acid material of step (i) the presence or absence of a nucleotide sequence of claim 5; iii) identifying a downy mildew resistant spinach plant based on the presence of a nucleotide sequence of claim 5.
14. Use of one or more sequences of claim 5 for identifying or providing a downy mildew resistant spinach plant.
Citation Information
Patent Citations
Method for modifying the resistance profile of spinacia oleracea to downy mildew
WO2018059651A1
Spinach plant resistant to downy mildew and novel resistance gene
WO2022008296A1
Spinach plants resistant to peronospora farinosa and stemphylium vesicarium
WO2022111797A1