Novel Anti-tuberculosis engineered protein, and use thereof

Abstract

The present invention relates to a novel antituberculosis engineered protein and, more specifically, to an antituberculosis use of a human tryptophanyl-tRNA synthesis 1-based engineered protein comprising one or more amino acid mutations. The engineered protein according to the present invention has high thermal stability and has the effect of significantly inhibiting the growth of Mycobacterium tuberculosis. In addition, it has been experimentally identified that the engineered protein of the present invention promotes penetration of immune cells into tissue. The engineered protein of the present invention has excellent antituberculosis efficacy and immune enhancement efficacy, and thus can be variously utilized in the fields of tuberculosis treatment and immune enhancement.

Description

Novel anti-tuberculosis protein modification and its use

[0001] The present invention relates to a novel anti-tuberculosis protein modification, and more particularly, to the anti-tuberculosis use of a protein modification based on human tryptophanyl-tRNA synthetase 1 comprising one or more amino acid mutations.

[0002] Tuberculosis is a disease transmitted through coughing, sneezing, or speaking. Typically caused by infection with Mycobacterium tuberculosis (Mtb), tuberculosis can be either active or inactive. Active tuberculosis can infect healthy individuals, but inactive tuberculosis is not contagious.

[0003] Regardless of the type, tuberculosis is known to infect one-third of the world's population. Currently, mutations in mycobacteria, including Mtb, and Bacillus Calmette-Guérin (BCG) bacteria frequently occur, leading to antibiotic resistance. Therefore, the development of technologies for the appropriate diagnosis, prevention, and treatment of tuberculosis is urgently needed.

[0004] Accordingly, the inventors of the present invention developed a protein modification comprising WARS1 having one or more amino acid mutations, and confirmed the improved thermal stability and growth inhibition effect of the protein modification, thereby completing the present invention.

[0005] Accordingly, the purpose of the present invention is to provide a protein modification comprising a polypeptide represented by the amino acid sequence of SEQ ID NO: 2, wherein the polypeptide comprises one or more amino acid mutations.

[0006] Another object of the present invention is to provide a nucleic acid encoding the above protein modification.

[0007] Another object of the present invention is to provide a recombinant vector comprising a nucleic acid encoding the above protein modification.

[0008] Another object of the present invention is to provide a composition for preventing, improving or treating tuberculosis comprising the above protein modification.

[0009] Another object of the present invention is to provide an immune-enhancing composition comprising the above protein modification.

[0010] Another object of the present invention is to provide a method for treating tuberculosis, comprising the step of administering the protein modification to a subject in need thereof.

[0011] To achieve the above purpose, the present invention provides a protein modification comprising a polypeptide represented by the amino acid sequence of SEQ ID NO: 2, wherein the polypeptide comprises one or more amino acid mutations.

[0012] The present invention also provides a pharmaceutical composition for preventing or treating tuberculosis comprising the above protein modification.

[0013] The present invention also provides a food composition for preventing or improving tuberculosis comprising the above protein modification.

[0014] In addition, the present invention provides a health functional food composition for preventing or improving tuberculosis, which comprises the above protein modification.

[0015] The present invention also provides an immune-enhancing composition comprising the above protein modification.

[0016] The present invention also provides a method for treating tuberculosis, comprising the step of administering the modified protein to a subject in need thereof.

[0017] The protein modified composition of the present invention not only exhibits high thermal stability but also significantly inhibits the growth of Mycobacterium tuberculosis. Furthermore, the protein modified composition of the present invention was experimentally confirmed to promote the infiltration of immune cells into tissues. This indicates that the protein modified composition of the present invention exhibits excellent anti-tuberculosis and immune-enhancing effects, and thus can be utilized in various fields such as tuberculosis treatment and immune-enhancing.

[0018] Figure 1 is a diagram showing the results of evaluating the in vitro efficacy of a single protein modified form according to the present invention through cytokine and chemokine expression analysis.

[0019] Figure 2 is a diagram showing the results of evaluating the in vitro efficacy of a complex protein modified body according to the present invention through cytokine and chemokine expression analysis.

[0020] Figure 3 is a diagram showing the results of evaluating the in vitro stability of a single protein modified product and a complex protein modified product according to the present invention.

[0021] Figure 4 is a diagram showing the results of evaluating the in vitro anti-tuberculosis efficacy when the complex protein modified L046I / A376C / V398C according to the present invention was administered alone; the wild type alone; or the complex protein modified L046I / A376C / V398C and an anti-tuberculosis drug (INH) were administered together (P < 0.001, P < 0.01 vs. INH (single administration group)).

[0022] Figure 5 is a diagram showing the results of analyzing the distribution of immune cells in lung tissue according to the route of administration of the complex protein modified L046I / A376C / V398C according to the present invention.

[0023] Figure 6 is a diagram showing the results of evaluating the in vivo anti-tuberculosis efficacy of the complex protein modified L046I / A376C / V398C according to the present invention according to the administration dose and administration route (P < 0.001, , P < 0.05 vs. Vehicle or Wild type, P < 0.01 vs. Intranasal administration).

[0024] Hereinafter, the present invention will be described in detail.

[0025] According to an aspect of the present invention, the present invention provides a protein modification comprising a polypeptide represented by the amino acid sequence of SEQ ID NO: 2, wherein the polypeptide comprises one or more amino acid mutations.

[0026] In a specific embodiment of the present invention, the protein modified compound may be used for the treatment of tuberculosis. In an embodiment of the present invention, it was confirmed that the protein modified compound significantly inhibits the growth of tuberculosis bacteria in vitro and in vivo.

[0027] The polypeptide of the present invention may be composed of an amino acid sequence represented by SEQ ID NO: 2, may be encoded by a base sequence represented by SEQ ID NO: 1, and includes a functional equivalent of the protein.

[0028] The above "functional equivalent" refers to a peptide having at least 80%, preferably 90%, and more preferably 95% sequence homology (i.e., identity) with the peptide of SEQ ID NO: 2 as a result of addition, substitution, or deletion of amino acids, including, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% sequence homology, and exhibiting substantially the same physiological activity as the peptide of SEQ ID NO: 2. In this specification, sequence homology and identity are defined as the percentage of amino acid residues in the candidate sequence relative to the amino acid sequence of SEQ ID NO: 2 after aligning the candidate sequence with the amino acid sequence of SEQ ID NO: 2 and introducing gaps. If necessary, conservative substitutions are not considered as part of the sequence identity to obtain the maximum percentage sequence identity. N-terminal, C-terminal, or internal extensions, deletions, or insertions of the amino acid sequence of SEQ ID NO: 1 are not construed as sequences that affect sequence identity or homology.

[0029] Additionally, the sequence identity can be determined by standard methods commonly used to compare similar portions of the amino acid sequences of two polypeptides. Computer programs such as BLAST or FASTA align two polypeptides so that each amino acid matches optimally (along the full length of one or both sequences or along predicted portions of one or both sequences). The programs provide default opening penalties and default gap penalties, and provide scoring matrices such as PAM250 (a standard scoring matrix) that can be used in conjunction with the computer program. For example, the percent identity can be calculated as follows: the total number of identical matches is multiplied by 100, and then divided by the sum of the length of the longer sequence within the matched span and the number of gaps introduced into the longer sequence to align the two sequences.

[0030] As used herein, "substantially identical physiological activity" refers to anti-tuberculosis or immune-enhancing activity. The scope of "functional equivalents" of the present invention includes derivatives in which some of the chemical structures of the peptide are modified while maintaining the basic backbone of the peptide of SEQ ID NO: 2 and the anti-tuberculosis or immune-enhancing activity. For example, this includes structural modifications to alter the stability, storability, volatility, or solubility of the peptide.

[0031] In the present invention, "amino acid mutation" refers to a protein having a sequence that differs from the amino acid sequence by one or more amino acid residues being deleted, inserted, non-conservative or conservatively substituted, or a combination thereof. Amino acid exchanges in proteins and peptides that do not alter the overall activity of the molecule are well known in the art. The polypeptide or its variant may be extracted from nature, synthesized, or produced by genetic recombination methods based on a DNA sequence.

[0032] In a specific embodiment of the present invention, the polypeptide may contain a mutation at one or more positions selected from the group consisting of P006, A007, S008, E011, F013, T018, S032, V044, S045, L046, K047, S049, A054, T089, R127, L132, R133, 1136, F137, A168, F360, A376 and V398 of the amino acid sequence of SEQ ID NO: 2. The polypeptide of the present invention may have conservative substitutions at the aforementioned positions.

[0033] In the present invention, a conservative substitution refers to replacing one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartate; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. Additionally, amino acids can be classified into those with electrically charged side chains and those with uncharged side chains. Charged side chain amino acids include aspartic acid, glutamic acid, lysine, arginine, and histidine. Uncharged side chain amino acids can be further classified into nonpolar amino acids or polar amino acids. Nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline. Polar amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0034] In a preferred embodiment of the present invention, the polypeptide may comprise one or more amino acid mutations selected from the group consisting of P006C, A007C, A007G, S008T, E011D, F013Y, T018A, S032P, V044L, V044M, S045Q, L046I, K047R, S049T, A054T, T089N, R127K, L132M, R133H, I136M, F137Y, A168C, F360C, A376C and V398C, and preferably, the polypeptide may comprise two or more amino acid mutations selected from the group consisting of A168C, A376C, V398C, L046I, F360C and K047R. More preferably, the polypeptide may further comprise an amino acid mutation of L046I or K047R.

[0035] More specifically, a polypeptide comprising one amino acid mutation may be P006C, A007C, A007G, S008T, E011D, F013Y, T018A, S032P, V044L, V044M, S045Q, L046I, K047R, S049T, A054T, T089N, R127K, L132M, R133H, I136M, F137Y, A168C, F360C, A376C or V398C. Also, examples of polypeptides comprising two amino acid mutations of the present invention may be L046I / K047R, L046I / R133H, L046I / I136M, L046I / F137Y, K047R / R133H, K047R / I136M, K047R / F137Y, R133H / I136M, R133H / F137Y, I136M / F137Y, A168C / F360C or A376C / V398C. Also, examples of polypeptides comprising three amino acid mutations of the present invention may be L046I / K047R / R133H, L046I / K047R / I136M, L046I / K047R / F137Y, K047R / R133H / I136M, K047R / R133H / F137Y, R133H / I136M / F137Y, L046I / A168C / F360C, L046I / A376C / V398C, K047R / A168C / F360C or K047R / A376C / V398C. The polypeptides of the present invention may comprise the above-mentioned amino acid mutation combinations, but the scope of the present invention is not limited thereto.

[0036] In a preferred embodiment of the present invention, the polypeptide may comprise amino acid mutations of (a) A376C and V398C; or (b) A168C and F360C; which may significantly improve the thermal stability of the protein variant.

[0037] In a more preferred embodiment of the present invention, the polypeptide comprises amino acid mutations of (a) A376C and V398C; or (b) A168C and F360C; and may further comprise amino acid mutations of L046I or K047R. The resulting modified complex protein was confirmed to not only exhibit improved thermal stability but also exhibit excellent anti-tuberculosis efficacy.

[0038] Specific examples of exemplary protein modifications of the present invention are as shown in Table 2 of Example 1 described below.

[0039] The protein modified composition of the present invention not only exhibits high thermal stability but also significantly inhibits the growth of Mycobacterium tuberculosis. Furthermore, the protein modified composition of the present invention was experimentally confirmed to promote the infiltration of immune cells into tissues. This indicates that the protein modified composition of the present invention exhibits excellent anti-tuberculosis and immune-enhancing effects, and thus can be utilized in various fields such as tuberculosis treatment and immune-enhancing.

[0040]

[0041] According to another aspect of the present invention, the present invention provides a nucleic acid encoding the protein modification; and a recombinant vector comprising the nucleic acid.

[0042] The nucleic acid according to the present invention may include a nucleic acid encoding a polypeptide represented by the amino acid sequence of SEQ ID NO: 2, and preferably may include a nucleic acid represented by the base sequence of SEQ ID NO: 1. In addition, the nucleic acid of the present invention may be a nucleic acid encoding a polypeptide represented by the amino acid sequence of SEQ ID NO: 2 including one or more amino acid mutations, and more specifically, may be a nucleic acid encoding a polypeptide variant described in Table 2.

[0043] In addition, variants of the above base sequence are included within the scope of the present invention. Specifically, the gene has a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more with the base sequence of SEQ ID NO: 1, and means a sequence that exhibits substantially the same physiological activity as the base sequence represented by SEQ ID NO: 1. The "% of sequence homology" for a polynucleotide is determined by comparing two optimally arranged sequences with a comparison region, and a part of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to the reference sequence for the optimal arrangement of the two sequences (which does not include additions or deletions).

[0044] In the present invention, a vector refers to a means for expressing a target gene in a host cell. For example, it includes a plasmid vector, a cosmid vector, a bacteriophage vector, an adenovirus vector, a retrovirus vector, and a viral vector such as an adeno-associated virus vector. A vector that can be used as the recombinant vector can be produced by manipulating a plasmid (e.g., pGLS, pSC101, pGV1106, pACYC177, ColE1, pKT230, ME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, and pUC19, etc.), a phage (e.g., λgt4λB, λCharon, λΔz1, and M13, etc.) or a virus (e.g., CMV, SV40, etc.) that is frequently used in the art.

[0045] In the recombinant vector, the nucleic acid encoding the protein variant may be operably linked to a promoter. The term "operably linked" refers to a functional linkage between a nucleotide expression regulatory sequence (e.g., a promoter sequence) and another nucleotide sequence. Thus, the regulatory sequence can regulate the transcription and / or translation of the other nucleotide sequence.

[0046] The recombinant vector may be constructed typically as a cloning vector or an expression vector. The expression vector may be any vector commonly used in the art to express foreign proteins in plants, animals, or microorganisms. The recombinant vector may be constructed using various methods known in the art.

[0047] The above recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when a eukaryotic cell is used as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, the CMV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionine promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus (CMV) promoter, and a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0048]

[0049] According to another aspect of the present invention, the present invention provides a composition for preventing, improving, or treating tuberculosis, comprising the modified protein. The composition according to the present invention may be a pharmaceutical composition, a food composition, or a health functional food composition.

[0050] In a specific embodiment of the present invention, the composition of the present invention may further comprise an anti-tuberculosis agent, and the anti-tuberculosis agent may be at least one selected from the group consisting of rifampicin, isoniazid, pyrazinamide, and ethambutol. When the protein modification of the present invention and the anti-tuberculosis agent are administered together, the therapeutic effect of the anti-tuberculosis agent can be enhanced.

[0051] In the present invention, the pharmaceutical composition may be formulated and used in various forms according to conventional methods. For example, it may be formulated in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, and syrups, and may be formulated and used in the form of topical preparations, suppositories, sterile injection solutions, transdermal preparations, and nasal inhalants.

[0052] The pharmaceutical composition of the present invention may be prepared by including one or more pharmaceutically acceptable carriers in addition to the above-mentioned effective ingredient for administration. The pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above-mentioned ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like.

[0053] The dosage of the pharmaceutical composition of the present invention may vary depending on the method of formulating the pharmaceutical composition, the method of administration, the time of administration, and / or the route of administration, and may vary depending on various factors including the type and degree of the response to be achieved by administration of the pharmaceutical composition, the type, age, weight, general health condition, symptoms or degree of the disease, sex, diet, excretion, drugs used simultaneously or simultaneously in the subject, other components of the composition, and similar factors well known in the medical field, and a person having ordinary knowledge in the relevant technical field can easily determine and prescribe an effective dosage for the desired treatment.

[0054] The dosage of the pharmaceutical composition of the present invention may be, for example, 1 mg / kg to 1,000 mg / kg per day, but the dosage does not limit the scope of the present invention in any way.

[0055] The route and method of administration of the pharmaceutical composition of the present invention may be independent of each other, and are not particularly limited in their method, and any route and method of administration may be followed as long as the pharmaceutical composition can reach the target area.

[0056] The pharmaceutical composition may be administered orally or parenterally. Parenteral administration methods include, for example, inhalation, intravenous, intraperitoneal, intramuscular, transdermal or subcutaneous administration, and intranasal administration.

[0057] The food composition according to the present invention can be manufactured using methods commonly used in the art, and can be manufactured by adding raw materials and ingredients commonly added in the art. Furthermore, the food composition can be manufactured without limitation in any formulation recognized as a food composition.

[0058] Foods according to the present invention include, for example, various foods, beverages, gums, tea, vitamin complexes, functional foods, etc. In addition, foods include, but are not limited to, special nutritional foods (e.g., formulated milk, infant and toddler food, etc.), processed meat products, fish products, tofu, jelly, noodles (e.g., ramen, noodles, etc.), bread, health supplements, seasoned foods (e.g., soy sauce, soybean paste, red pepper paste, mixed paste, etc.), sauces, confectionery (e.g., snacks), candies, chocolates, gums, ice cream, processed dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various kimchi, pickled vegetables, etc.), beverages (e.g., fruit drinks, vegetable drinks, soy milk, fermented drinks, etc.), natural seasonings (e.g., ramen soup, etc.), food additives, etc. The above foods, beverages, or food additives can be manufactured by a conventional manufacturing method.

[0059] When the composition of the present invention is used as a health functional food additive, the composition can be added as is or used together with other health functional food ingredients, and can be used appropriately according to a conventional method. The mixing amount of the active ingredient can be appropriately determined depending on the intended use. Generally, when manufacturing food or beverage, the composition of the present invention can be added in an amount of preferably 50 parts by weight or less, more preferably 25 parts by weight or less, relative to the raw material. However, in the case of long-term intake for the purpose of health control and hygiene, the amount can be below the above range, and since there is no problem in terms of stability, the active ingredient can also be used in an amount above the above range.

[0060] The food composition of the present invention, in addition to containing the protein modified active ingredient, may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional food compositions. Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., and conventional sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As the flavoring agent, natural flavoring agents (thaumatin), stevia extracts (such as rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.

[0061] In addition, the food composition may contain, in addition to the protein modifier, various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the food composition of the present invention may contain fruit pulp for producing natural fruit juice, fruit juice drinks, and vegetable drinks.

[0062]

[0063] According to another aspect of the present invention, the present invention provides an immune enhancing composition comprising a protein modified body.

[0064] In the present invention, immunostimulation is one of the important therapeutic strategies that reinforces the body's defense mechanisms against various diseases such as infectious diseases, cancer, and inflammatory diseases, and can achieve an immune-enhancing effect by increasing the activity of immune cells to stimulate the immune response. For example, phagocytes play a key role in the immune response. The main role of macrophages, phagocytosis, is to absorb microorganisms and other pyrogenic particles, and also secrete a number of cytokines such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-12 (IL-12), and cytotoxic and inflammatory substances such as nitric oxide (NO), thereby stimulating the immune response. Therefore, increasing macrophage activity can be one means of immune-enhancement. Since the occurrence of infections and diseases mainly occurs when the immune function is weakened, various studies are being conducted to enhance these immune responses through immune-enhancing substances when the function of the body's immune system is weakened.

[0065] The composition for enhancing immunity according to the present invention may contain a pharmaceutically effective amount of a protein modified substance and an excipient or diluent.

[0066] The pharmaceutically effective amount described above refers to an amount sufficient to exert an immune-enhancing effect. The term "pharmaceutically acceptable" refers to a composition that is physiologically acceptable and, when administered to humans, does not typically cause allergic reactions, such as gastrointestinal upset or dizziness, or similar reactions.

[0067]

[0068] According to another aspect of the present invention, a method for treating tuberculosis is provided, comprising the step of administering a protein modified substance to a subject in need thereof.

[0069] In a specific example of the present invention, the subject may be, but is not limited to, a subject expected to develop tuberculosis; a subject that has developed tuberculosis; or a subject that has been judged to be cured.

[0070] Additionally, the treatment method of the present invention can be administered simultaneously or simultaneously with the protein modification and an anti-tuberculosis agent known in the art. Examples of the anti-tuberculosis agent include rifampicin, isoniazid, pyrazinamide, and ethambutol, but the scope of the present invention is not limited thereto.

[0071] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0072]

[0073] Example 1. Design of a protein variant containing WARS1

[0074] A modified human tryptophanyl-tRNA synthetase I (WARS1) protein with a tuberculosis treatment effect (hereinafter referred to as the "protein modified protein") was designed. Specifically, a protein modified protein containing one to three amino acid mutations was designed.

[0075] The sequence information of the wild-type WARS1 (WARS1 WT) used in this example is as shown in Table 1.

[0076] 서열번호종류명칭서열1DNAHuman tryptophanyl-tRNA Synthetase I, WARS1CAGCCCTGCAGGGCGCCCAGACCAAAATGAGTGCCAGCGACCCCAACTCCTCCATCTTCCTCACCGACACGGCCAAGCAGATCAAAACCAAGGTCAATAAGCATGCGTTTTCTGGAGGGAGAGACACCATCGAGGAGCACAGGCAGTTTGGGGGCAACTGTGATGTGGACGTGTCTTTCATGTACCTGACCTTCTTCCTCGAGGACGACGACAAGCTCGAGCAGATCAGGAAGGATTACACCAGCGGAGCCATGCTCACCGGTGAGCTCAAGAAGGCACTCATAGAGGTTCTGCAGCCCTTGATCGCAGAGCACCAGGCCCGGCGCAAGGAGGTCACGGATGAGATAGTGAAAGAGTTCATGACTCCCCGGAAGCTGTCCTTCGACTTTCAGTAG2AAHuman tryptophanyl-tRNA Synthetase I, WARS1MPNSEPASLLELFNSIATQGELVRSLKAGNASKDEIDSAVKMLVSLKMSYKAAAGEDYKADCPPGNPAPTSNHGPDATEAEEDFVDPWTVQTSSAKGIDYDKLIVRFGSSKIDKELINRIERATGQRPHHFLRRGIFFSHRDMNQVLDAYENKKPFYLYTGRGPSSEAMHVGHLIPFIFTKWLQDVFNVPLVIQMTDDEKYLWKDLTLDQAYSYAVENAKDIIACGFDINKTFIFSDLDYMGMSSGFYKNVVKIQKHVTFNQVKGIFGFTDSDCIGKISFPAIQAAPSFSNSFPQIFRDRTDIQCLIPCAIDQDPYFRMTRDVAPRIGYPKPALLHSTFFPALQGAQTKMSASDPNSSIFLTDTAKQIKTKVNKHAFSGGRDTIEEHRQFGGNCDVDVSFMYLTFFLEDDDKLEQIRKDYTSGAMLTGELKKALIEVLQPLIAEHQARRKEVTDEIVKEFMTPRKLSFDFQ

[0077] Protein variants containing one to three designed amino acid mutations are shown in Table 2.

[0078] Sequential mutations Sequential mutations Single protein variant 1P006C Complex protein variant 26L046I / K047R2A007C27L046I / R133H3A007G28L046I / I136M4S008T29L046I / F137Y5E011D30K047R / R133H6F013Y31K047R / I136M7T018A32K047 R / F137Y8S032P33R133H / I136M9V044L34R133H / F137Y10V044M35I136M / F1 37Y11S045Q36A168C / F360C12L046I37A376C / V398C13K047R38L046I / K047 R / R133H14S049T39L046I / K047R / I136M15A054T40L046I / K047R / F137Y16T 089N41K047R / R133H / I136M17R127K42K047R / R133H / F137Y18L132M43R133 H / I136M / F137Y19R133H44L046I / A168C / F360C20I136M45L046I / A376C / V3 98C21F137Y46K047R / A168C / F360C22A168C47K047R / A376C / V398C23F360C 24A376C 25V398C

[0079]

[0080] In the examples described below, protein variants containing 1 to 3 amino acid mutations of Table 2 were used.

[0081]

[0082] Example 2. In vitro efficacy evaluation of single and complex protein modifications

[0083] The in vitro efficacy of the single protein modified constructs (sequence numbers 1 to 25 in Table 2) and complex protein modified constructs (sequence numbers 26 to 47 in Table 2) designed in Example 2 above was evaluated. Specifically, J774a.1 (ATCC, TIB-67) was seeded in a 96-well plate at 2 x 10 per well.4 Each cell was seeded and cultured in DMEM containing FBS for 24 h. Afterwards, WARS1 WT and single or complex protein modified compounds were treated with various concentrations to the cells, and after 18 h, the cell culture medium was harvested and ELISA for mCXCL2 and mTNFα (R&D systems, DY452, Biolegend, #430904) was performed. The results of evaluating the in vitro efficacy of single and complex protein modified compounds through ELISA are shown in Figures 1 and 2.

[0084] As shown in Figures 1 and 2, among the single protein variants, L046I, K047R, R133H, I136M, and F137Y were confirmed to significantly increase IL-8 homologues mCXCL2 / MIP2 and mTNFα compared to wild-type WARS1.

[0085] In addition, as shown in Fig. 2, it was confirmed that the complex protein modified constructs A168C / F360C, A376C / V398C, L046I / A168C / F360C, and L046I / A376C / V398C increased the expression of mTNF and mCXCL2 / MIP2.

[0086]

[0087] Example 3. In vitro stability evaluation of single protein modified compounds and complex protein modified compounds.

[0088] In this example, the in vitro stability of single protein variants (L046I, K047R, R133H, I136M, and F137Y); and complex protein variants (A168C / F360C, A376C / V398C, L046I / A168C / F360C, L046I / A376C / V398C, K047R / A168C / F360C, and K047R / A376C / V398C) was evaluated. Specifically, the temperature resistance of the complex modified variants was evaluated using the Protein Thermal Stability (PTS) test. Specifically, 5 μg of wild-type WARS1, single protein variants, or complex protein variants was added, and Protein Thermal Shift™ Dye (ThermoFisher, #4461146) and distilled water were added to prepare the analysis sample. The prepared analytical samples were analyzed according to the manufacturer's methodology (ThermoFisher (Protein Thermal Shift™ Software v1.4). Through the above analysis, the melting point (Tm, ℃) of each protein modification was analyzed, and an increase in Tm is interpreted as an increase in the stability of the material. The results of evaluating the in vitro stability of single protein modifications and complex protein modifications are shown in Fig. 3.

[0089] As shown in Fig. 3, the Tm of proteins under harsh conditions was analyzed, and it was confirmed that the single protein variants R133H and I136M had a decreased Tm, whereas L046I, K047R, and F137Y had an increased Tm. The complex protein variants containing the A168C / F360C combination or the A376C / V398C combination had an increased Tm.

[0090]

[0091] Example 4. In vitro anti-tuberculosis efficacy evaluation of the complex protein modified L046I / A376C / V398C

[0092] In the above-described examples, it was confirmed that the complex protein modified L046I / A376C / V398C increased the expression of mTNF and mCXCL2 / MIP2, and also had high stability. Therefore, in this example, the in vitro anti-tuberculosis efficacy of the complex protein modified L046I / A376C / V398C was evaluated. Specifically, wild-type WARS1 and the complex modified mutant (L046I / A376C / V398C) were treated alone or simultaneously with the first-line anti-tuberculosis drug isoniazid (INH) in Mtb-infected mouse macrophage J774.1A cells. Thereafter, the anti-tuberculosis efficacy of the candidate substance was confirmed by measuring the number of Mycobacterium tuberculosis bacteria (cfu).

[0093] - Dosage concentration: J774.1A mouse macrophage cell line was infected with H37Rv at 10 Moi, and each cell was treated with (i) INH 0.1 ug / ml; (ii) wild-type WARS1 100 nM; (iii) L046I / A376C / V398C complex protein modified complex 100 nM; or (iv) L046I / A376C / V398C complex protein modified complex 100 nM + INH 0.1 ug / ml. The number of tuberculosis bacteria was measured on days 1 and 3.

[0094] - Method for measuring the number of tuberculosis bacteria: The number of viable tuberculosis bacteria in cells on the 1st and 3rd days was measured by sequentially diluting the whole organ homogenate and plating it on Middlebrook 7H11 agar, culturing it at 37℃ for 3 to 4 weeks, and counting the colonies. The results were expressed as a % compared to the control group.

[0095] The results confirming the anti-tuberculosis efficacy of the candidate substance are shown in Figure 4.

[0096] As shown in Fig. 4, the wild-type WARS1 alone treatment group and the combined protein modified L046I / A376C / V398C alone treatment group were confirmed to have significantly higher tuberculosis bacteria killing ability than the INH alone treatment group. In addition, the combined protein modified L046I / A376C / V398C+INH treatment group was confirmed to have significantly higher tuberculosis bacteria killing ability than the combined protein modified L046I / A376C / V398C alone treatment group. The above results imply that the anti-tuberculosis effect can be significantly enhanced when the combined protein modified L046I / A376C / V398C is administered with an anti-tuberculosis drug.

[0097]

[0098] Example 5. Analysis of immune cell distribution in lung tissue according to the route of administration of the complex protein modified L046I / A376C / V398C.

[0099] We compared the immune cell infiltration patterns in lung tissue according to the route of administration of the L046I / A376C / V398C complex protein variant. Specifically, the L046I / A376C / V398C complex protein variant was administered via tail vein administration (10 mpk) or intranasal administration (1.5 mpk) to C57BL / 6 tuberculosis-infected mice. For W / T, PBS was administered via tail vein at 10 mpk. Four hours after administration, the lungs of the mice were removed, and single cells were dissociated using GentleMACS after adding 1 mg / mL of collagenase D and 10 unit / mL of DNase I. Subsequently, FACS staining was performed using antibodies for FACS, live / dead staining solution, and FcγR blockade. iNOS and CD206 were stained intracellularly using Fix / Perm buffer (ebioscience, #00-5523-00). Neutrophils are living cells with CD45 + CD11b + SiglecF - Ly6G +% of eosinophils are living cells with CD45 + CD11b int SiglecF + Ly6G - % of lung tissue-specific macrophages, alveolar macrophages, are CD45-positive cells in living cells. + CD11b int SiglecF + Ly6G + CD64 + % of the samples were analyzed. The antibody information used in the analysis is shown in Table 3.

[0100] Target FACS antibody (fluorescence) manufacturer Cat. NoZombi-AquaBiolegend423102FcγR blockadeebioscience14-0161-82CD45-APC.eflour780ebioscience47-0451-82CD11b -PE cy5ebioscience15-0112-82anti-mouse CD64-APCebioscience17-0641-82siglecF-PEebioscience12-1702-82Ly6G-efluor450ebioscience48-9668-82iNOS -FITCebioscience53-5920-82CD206-PE-cy7ebioscience25-2061-82

[0101] The results of analyzing the distribution of immune cells in lung tissue according to the route of administration of the complex protein modified L046I / A376C / V398C are shown in Figure 5.

[0102] As shown in Fig. 5, tail vein administration of the modified complex protein L046I / A376C / V398C significantly increased the infiltration of macrophages, neutrophils, and eosinophils, and showed an increased polarization toward iNOS-positive M1 macrophages. In addition, it was confirmed that the infiltration of macrophages and neutrophils into lung tissue increased 1.4-2.2 times in the intranasal administration group compared to the tail vein administration group. The above results imply that even low concentrations of the modified complex protein L046I / A376C can efficiently infiltrate immune cells into lung tissue.

[0103]

[0104] Example 6. In vivo evaluation of antituberculosis efficacy of the modified complex protein L046I / A376C / V398C.

[0105] The antituberculosis efficacy was evaluated after tail vein administration of the modified complex protein L046I / A376C / V398C or wild-type WARS1 in mice with active tuberculosis infection. Specifically, mice with active tuberculosis infection were infected with 624 Mycobacterium tuberculosis (M.tb Erdman) through airway infection, and after 2 weeks, the modified complex protein L046I / A376C / V398C or wild-type WARS1 was administered three times a week for a total of 13 times to treat tuberculosis. During the treatment period, the modified complex protein L046I / A376C / V398C (0.25mpk) or wild-type WARS1 (0.25mpk) was administered through the tail vein, respectively, and the tuberculosis Cfu in the lung tissue and spleen was confirmed, and the degree of inflammation was analyzed through lung tissue staining.

[0106] The above tuberculosis Cfu measurement was performed by extracting lung and spleen tissues from mice in each experimental group and measuring the number of tuberculosis bacteria. The number of viable tuberculosis bacteria in lung and spleen tissues was measured by plating the whole organ homogenate suspension on Middlebrook 7H11 agar by serial dilution, culturing it at 37°C for 3 to 4 weeks, and counting the colonies. The results were calculated as the average log per tissue of the whole lung and spleen. 10 It is expressed as CFU ± standard deviation.

[0107] The results of evaluating the in vivo antituberculosis efficacy of the complex protein modified L046I / A376C / V398C are shown in Figure 6.

[0108] As shown in Figure 6, the tail vein administration group of the modified complex protein L046I / A376C / V398C significantly inhibited the growth of Mycobacterium tuberculosis compared to the tail vein administration group of the wild-type WARS1. In addition, both the tail vein administration group and the intranasal administration group of the modified complex protein L046I / A376C / V398C significantly inhibited the growth of Mycobacterium tuberculosis even at low concentrations.

[0109]

[0110] In summary, the inventors of the present invention have developed a protein variant comprising WARS1 with one to three amino acid mutations. The protein variant not only exhibits high thermal stability but also significantly inhibits the growth of Mycobacterium tuberculosis. This indicates that the protein variant of the present invention exhibits excellent anti-tuberculosis efficacy, and thus can be utilized in various fields such as the prevention, improvement, or treatment of tuberculosis.

[0111]

[0112] While specific aspects of the present invention have been described in detail, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Containing a polypeptide represented by the amino acid sequence of sequence number 2, A protein modified product, wherein the above polypeptide comprises one or more amino acid mutations.

2. In the first paragraph, the protein modified product is a protein modified product for the treatment of tuberculosis.

3. A protein modification according to claim 1, wherein the polypeptide comprises a mutation at one or more positions selected from the group consisting of P006, A007, S008, E011, F013, T018, S032, V044, S045, L046, K047, S049, A054, T089, R127, L132, R133, I136, F137, A168, F360, A376, and V398 of the amino acid sequence of SEQ ID NO:

2.

4. A protein modified product comprising at least one amino acid mutation selected from the group consisting of P006C, A007C, A007G, S008T, E011D, F013Y, T018A, S032P, V044L, V044M, S045Q, L046I, K047R, S049T, A054T, T089N, R127K, L132M, R133H, I136M, F137Y, A168C, F360C, A376C, and V398C, in the third paragraph.

5. In the fourth paragraph, the polypeptide is a protein modification comprising two or more amino acid mutations selected from the group consisting of A168C, A376C, V398C, L046I, F360C, and K047R.

6. In the fifth paragraph, the protein modification further comprises an amino acid mutation of L046I or K047R.

7. A nucleic acid encoding a protein modification according to any one of claims 1 to 6.

8. A recombinant vector containing the nucleic acid of clause 7.

9. A pharmaceutical composition for preventing or treating tuberculosis, comprising a protein modified form according to any one of claims 1 to 6.

10. A pharmaceutical composition for preventing or treating tuberculosis, in claim 9, wherein the composition further comprises at least one antituberculosis agent selected from the group consisting of rifampicin, isoniazid, pyrazinamide, and ethambutol.

11. A food composition for preventing or improving tuberculosis, comprising a protein modified form according to any one of claims 1 to 6.

12. A health functional food composition for preventing or improving tuberculosis, comprising a protein modified form according to any one of claims 1 to 6.

13. An immune-enhancing composition comprising a protein modified form according to any one of claims 1 to 6.

14. An immune-enhancing composition according to claim 13, wherein the protein modification promotes infiltration of neutrophils, eosinophils or macrophages into tissues.

15. A method for treating tuberculosis, comprising the step of administering a protein modified substance according to any one of claims 1 to 6 to a subject in need thereof.

Images