Retroviral vectors
By reversing the sense direction of the GOI and incorporating GOI and PKR inhibitors, the process addresses issues of constitutive GOI expression and cell death in retroviral vector production, ensuring efficient and consistent LVV production without altering particle properties or requiring new processes for each GOI change.
Patent Information
- Application Number
- PCT/GB2025/050126
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-25
- Filing Date
- 2025-01-24
- Publication Date
- 2025-07-31
AI Technical Summary
Current retroviral vector production systems face challenges such as constitutive expression of the lentiviral vector (LVV) gene of interest (GOI) hindering production, and membrane-bound GOIs altering physicochemical properties of LVV particles, requiring new process development for each GOI change, while silencing GOI expression risks damaging nucleic acid and triggering cell death.
The process involves reversing the sense direction of the GOI with respect to the retroviral vector RNA, using a plasmid that encodes an inhibitor of the GOI mRNA and a protein kinase R (PKR) inhibitor to prevent cell death, ensuring high LVV production and consistent particle properties without altering downstream processes.
This approach effectively silences GOI expression during production, maintains LVV yield, and ensures consistent particle properties, reducing the need for process adjustments with GOI changes and minimizing cell death, thus enhancing production efficiency and consistency.
Smart Images

Figure GB2025050126_31072025_PF_FP_ABST
Abstract
Description
[0001] RETROVIRAL VECTORS
[0002] The present invention relates to processes for the production of retroviral vectors comprising a transgene. The process comprises expressing in a cell: (i) a retroviral vector plasmid comprising a transgene, wherein the transgene is in reverse orientation in the plasmid; (ii) an inhibitor of the transgene RNA; and (iii) an inhibitor of the cell death response. The invention also provides retroviral transfer plasmids and production cell lines for use in the processes of the invention.
[0003] Retroviruses (including lentiviruses) are positive-sense RNA viruses that undergo a complex life-cycle involving the reverse transcription of their genome into deoxyribonucleic acid (DNA), which subsequently becomes integrated into the host cell genome following viral infection. They are capable of inserting their genomes, as DNA, into almost any loci in the genome of target cells and mediating long-term expression of virus genes, with the DNA being copied into each daughter cell when the infected cell divides. They generate their genome as an un-spliced mRNA molecule by using the cellular RNA polymerase for transcription. The virus genome is then transported into the cytoplasm using a virus protein called Rev. The genome is then packaged into virus particles in the cytosol using the virus encoded structural proteins Envelope (Env), Gag and Polymerase (Pol). The retrovirus genome is typically 7-1 Okb in length; in the case of the commonly studied HIV virus, the genome is 9.7kb in length. It exists in each virus particle at 2 copies per virion.
[0004] The retrovirus life cycle, and its structural flexibility, affords a number of biotechnological applications, such as the delivery of DNA into the genome of mammalian cells. Furthermore, retroviruses can be modified to contain non-retrovirus glycoproteins in their surface, endowing retrovirus particles with the cellular tropism of the virus from which the glycoprotein originated. This is particularly important when the natural retrovirus glycoprotein has a limited cellular tropism. An example of this is the GP160 glycoprotein of HIV-1 , which has evolved to bind the CD4 receptor and only infects cells bearing this protein on their surface. In the case of HIV-1 , virus particles are frequently modified to contain a glycoprotein that is different from the natural glycoprotein in a process called pseudotyping. Most commonly, this is achieved with the glycoprotein from vesicular stomatitis virus (VSV-G) to provide a much broader cell tropism.
[0005] When using retroviruses in the laboratory as tools, they are typically modified to form replication-incompetent vectors that can express either one or more transgenes or shRNA molecules, and these modified viruses provide versatile vectors for cellular transgene expression and engineering. The flexibility of the retrovirus packaging process also allows for varying genome sizes to be accommodated: genomes as small as 3kb and as large as 10-13kb can be packaged, although virus titre can be compromised at these extremes.
[0006] Several clinical trials have now been performed using retroviruses (and latterly lentiviruses) to infect stem cells ex vivo to express transgenes to be supplemented in the treatment of inherited single-gene disorders, before reintroducing them into patients. This is usually done on an autologous basis, although some stem cells can also be applied as heterologous transplants.
[0007] Retro / lentiviruses are also finding important applications in the field of adoptive cell transfer, most notably to allow expression of hybrid ‘chimeric antigen receptors’ (CAR) within T-cells before cell expansion and reinfusion into patients. The CARs generally have an extracellular antibody structure, and an intracellular structure based on the T- cell receptor, but modified (in 2nd and 3rd generation CARs) to improve the quality of cell stimulation following binding of the outside portion to its antigen. This ‘CAR T cell’ approach has shown impressive success using lentiviral vectors encoding CARs recognising CD19 in the clinical treatment of B cell lymphoma, and the first US product licence is expected to be granted to Novartis for their CD19-specific CAR T cell, known as CTL019, in the near future. The field of application is now being expanded to address other molecular targets and other malignancies. Hence, there is an expanding need for large scale manufacture of lentiviral vectors, something that is challenging to achieve using existing virus production systems. Alongside clinical use, many laboratories frequently use lentivi rus vectors for research and development, where the insertion of exogenous DNA into the cellular genome is required. The versatility of lentiviruses has allowed them to be used to introduce DNA into a wide range of cell types, including but not limited to, human and mouse stem cells, cancer cells, primary tissue cells (e.g. liver, neurons, and fibroblasts).
[0008] The infection of these cells is only made possible by coating, or pseudotyping, the virus with a broad-tropism glycoprotein, most commonly the VSV-G surface glycoprotein. This protein enables the infection of cells from almost all organs and across many species, including but not limited to, humans, mice, rats, hamsters, monkeys, rabbits, donkeys and horses, sheep, cows and old world apes.
[0009] Although wild-type retro / lentiviruses can replicate in host cells, the retro / lentivirus vectors used for transgene and shRNA expression are typically disabled in a range of ways to remove their ability to replicate and cause disease. This means that in order to grow a batch of infectious virus particles which are capable of a single infection round, for experimental or clinical use, it is necessary to provide several virus genes (and thereby virus proteins) that have been genetically removed from the virus genome at the same time into the cells used for virus packaging. These genes are generally provided in three or four separate plasmids, and co-transfected into cells. The central component is a plasmid encoding the virus vector genome (including any transgenes and associated promoters to regulate transcription in target cells) containing packaging signals to direct the assembling virus particles to incorporate the corresponding RNA into the new virus particles. The genes for other virus proteins such as Gag-Pol, Tat and Rev are generally provided from other plasmids that are co-transfected; and yet another plasmid provides the glycoprotein to be incorporated into the envelope of newly-formed virus particles that will direct their infectious tropism. The gag-pol expression cassette encodes virus capsid and internal structural proteins and polymerase and protease activity. The rev gene acts to enhance nuclear export of retro / lentivirus genomes by binding to a specific region of the virus genome called the Rev Response Element (RRE). The complexity of retrovirus and lenti virus packaging systems has resulted in a number of ‘generations’ of systems, each with increasing safety on the previous system. In the ‘1st generation’ packaging systems, three plasmids were used: one plasmid encoding all of the HIV genes except for the envelope gene; a second plasmid to provide a surface glycoprotein (most often VSV-G); and a plasmid containing the virus genome to be packaged. This system has the disadvantage that the plasmid containing the virus genes contained large regions of DNA with homology to the virus genome plasmid, potentially allowing for recombination between plasmids. This could result in infectious virus being produced capable of causing disease. Other problems included the presence of many virus genes that were not needed for the virus production, including VPU, VIF, VPR and Nef.
[0010] In the ‘2nd generation’ systems, five of the nine HIV-1 gene coding regions were removed from the system. This method also resulted in a three-plasmid system, with one plasmid containing the gag-pol genes and the ancillary genes for Tat and Rev proteins, a second plasmid encoding a glycoprotein (most often VSV-G) and a third plasmid that encoded the virus genome to be packaged. The virus genomes in this system typically contain wild-type 5’ Long Terminal Repeats (LTRs) and hence require the tat gene for transcriptional activation and genome production. This system had the advantage that the reduction in homology between the virus genome and the packaging plasmids reduced the likelihood of the formation of potentially hazardous replication- competent retrovirus.
[0011] In the most recent ‘3rd generation’ lentiviral vector system, four plasmids are used instead of three. By splitting the system into 4 plasmids (3 helper plasmids and 1 containing the vector genome plus transgene), the ‘3rd generation’ system offers a number of advantages (primarily by increasing the number of recombination events required to form replication-competent virus). However, the ‘3rd generation’ systems also have another significant advantage because they have a modified 5-LTR that includes a promoter, and hence transcription of the genome is not dependent on transcriptional activation by the Tat protein - thereby removing the need for Tat to be encoded in the system. They do not contain the Tat protein on any of the plasmids used. The rev gene was also placed on an individual plasmid. Therefore, in 3rd generation systems, the four plasmids contain 1 : gag-pol, 2: a glycoprotein (most frequently VSV-G), 3: rev, and 4: a plasmid encoding a self-inactivating lentivirus genome containing the transgene or RNA of interest. With specific reference to the glycoprotein plasmid, several envelope glycoproteins are available and have been used, but the most widely used is the glycoprotein from Vesicular Stomatitis Virus, known as VSV-G.
[0012] The inventors have recognised two problems with the current production system:
[0013] (1) Constitutive expression of the lentiviral vector (LVV) gene of interest (GOI) in the production cell line can hinder LVV production. Silencing the GOI during LVV production could thus result in higher LVV production regardless of the GOI identity.
[0014] (2) If the GOI product is membrane-bound, it can be displayed on the surface of the LVV particles. This could alter the physicochemical properties of the LVV particles, thus altering downstream process requirements. Thus, for every new membrane-bound GOI product encoded, a new process must be developed. Silencing the GOI would result in LVV particles that do not display the GOI product on their surface. Thus, changing the GOI would not result in alterations to the physicochemical properties of the LVV, thus no downstream process development would be required, resulting in significant time / cost savings.
[0015] However, the inventors also recognised a problem with silencing the expression of GOI. The nucleic acid packaged within LVV is RNA (viral RNA or “vRNA”). Thus, to preserve high LVV production, the vRNA must not be damaged and its generation by transcription must not be inhibited. However, since the GOI is encoded within the vRNA sequence, targeting the GOI mRNA by RNA interference would also target the vRNA; and preventing transcription of the GOI mRNA would also impose a block on vRNA transcription. The solution provided by the inventors involves reversing the sense direction of the GOI with respect to the orientation of the vRNA in the LVV. Thus, the GOI mRNA is no longer encoded within the vRNA, rather the reverse complement of it is. Thus, targeting the GOI mRNA by RNA interference does not result in cleavage of the vRNA. The inventors also found that reversing the sense direction of the GOI results in the generation of a large double-stranded RNA (i.e. a double stranded RNA molecule formed by the binding of the vRNA to the GOI mRNA) can trigger cell death in production cells. Thus, this process also requires knockdown of the protein kinase R gene (PKR), which is the key initiator of cell death under such circumstances.
[0016] It is therefore an object of the current invention to provide an enhanced process for the production of retroviral vectors.
[0017] The invention provides retroviral transfer vector plasmids and production cell lines for use in the process of the invention.
[0018] In one embodiment, the invention provides a process for producing a retroviral vector comprising a transgene, the process comprising the steps:
[0019] (A) expressing, in a cell:
[0020] (a) a first nucleic acid molecule comprising:
[0021] (i) a first promoter;
[0022] (ii) a retroviral 5’ LTR;
[0023] (iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter; and
[0024] (iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter; (b) a second nucleic acid molecule coding for a second RNA molecule capable of binding to all or part of the first RNA molecule;
[0025] (c) one or more further nucleic acid molecules expressing retroviral gag-pol, env and rev genes; wherein the cell death response is prevented or inhibited within the cell; under conditions suitable for the production of retroviral vectors comprising (ii), (iii) and (iv); and optionally
[0026] (B) harvesting the retroviral vectors from the cell or from cell media around the cell.
[0027] Preferably, the retroviral vector is a lentiviral vector.
[0028] In another embodiment, the invention provides a retroviral transfer plasmid comprising:
[0029] (a) a first nucleic acid molecule comprising:
[0030] (i) a first promoter;
[0031] (ii) a retroviral 5’ LTR;
[0032] (iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter; and (iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter;
[0033] (b) a second nucleic acid molecule coding for a second RNA molecule capable of binding to all or part of the first RNA molecule; and (c) a third nucleic acid molecule coding for a PKR inhibitor, preferably coding for an RNA molecule capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA.
[0034] The invention also provides a kit comprising:
[0035] (a) a first nucleic acid molecule comprising:
[0036] (i) a first promoter;
[0037] (ii) a retroviral 5’ LTR;
[0038] (iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter; and (iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter;
[0039] (b) a second nucleic acid molecule coding for a second RNA molecule capable of binding to all or part of the first RNA molecule; and
[0040] (c) a third nucleic acid molecule coding for a PKR inhibitor, preferably coding for an RNA molecule capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA; optionally wherein the first, second and third nucleic acid molecules are present on one or more plasmids, and wherein:
[0041] (i) the first and second nucleic acid molecules are located on the same plasmid;
[0042] (ii) the first and third nucleic acid molecules are located on the same plasmid;
[0043] (iii) the second and third nucleic acid molecules are located on the same plasmid; or
[0044] (iv) the first, second and third nucleic acid molecules are located on the same plasmid.
[0045] The invention also provides a host cell comprising: a) a first nucleic acid molecule comprising:
[0046] (i) a first promoter; (ii) a retroviral 5’ LTR;
[0047] (iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter; and
[0048] (iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter;
[0049] (b) a second nucleic acid molecule coding for a second RNA molecule capable of binding to all or part of the first RNA molecule; and
[0050] (c) a third nucleic acid molecule coding for a PKR inhibitor, preferably coding for an RNA molecule capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA.
[0051] Lentiviruses are a subset of the retroviridae family that are increasingly being vectorised and then used for transgene delivery and protein expression, particularly in progenitor cell populations such as haematopoietic stem cells and T cells. Unlike most retroviruses, lentiviruses are able to deliver their genome, or modified forms thereof, independent of the cell cycle, and often achieve higher efficiency of cellular infection in a shorter time frame. This makes them a much more effective viral vector for both research and clinical use.
[0052] The lentivirus family consists of 10 viruses at present. These species are divided into five groups including: Bovine lentivirus group (Bovine immunodeficiency virus and Jembrana disease virus), Equine lentivirus group (Equine infectious anaemia virus, Feline lentivirus group, Feline immunodeficiency virus, Puma lentivirus), Ovine / caprine lentivirus group (Caprine arthritis encephalitis virus, Visna / maedi virus), Primate lentivirus group, (Human immunodeficiency virus 1 , Human immunodeficiency virus 2, Simian immunodeficiency virus). In a preferred embodiment, the lentivirus is Human immunodeficiency virus 1 , Simian immunodeficiency virus or Equine infectious anaemia virus.
[0053] In a more preferable embodiment, the lentivirus is Human immunodeficiency virus 1 or Equine infectious anaemia virus.
[0054] As used herein, the term “retroviral vector” refers to a non-replicative retrovirus-like particle that is capable of transferring genetic material from the cell in which it was produced to a target cell. Examples of retroviral vectors include gamma-retroviral vectors (e.g. vectors derived from murine leukaemia viruses) and lentiviral vectors. Preferably, the retroviral vector is a lentiviral vector.
[0055] Retroviral vectors have RNA, preferably single-stranded RNA, genomes. Therefore, the retroviral vectors produced by the process of the invention have RNA, preferably singlestranded RNA, genomes.
[0056] The following elements are commonly present in the genomes of lentiviral vectors, but are not all essential for the invention: packaging signal, Rev response element, central poly-purine tract, chain termination sequence, primer activation sequence, major splice donor site and woodchuck hepatitis virus post-transcriptional regulatory element. The retroviral vectors of the invention may have one or more or all of the aforementioned elements.
[0057] As used herein, the term “retroviral vector genome” refers to elements (ii), (iii) and (iv).
[0058] As used herein, the term “retroviral vector plasmid” refers to a plasmid that is useful in the production of retroviral vectors.
[0059] As used herein, the term “lentiviral vector plasmid” refers to a vector or plasmid which is useful in the production of lentiviral vector. For example, the retroviral vector plasmid may be a transfer plasmid, packaging plasmid, an envelope plasmid or a packaging / envelope plasmid.
[0060] For example, the lentivi ral vector plasmid may be a transfer plasmid, packaging plasmid, an envelope plasmid or a packaging / envelope plasmid.
[0061] Preferably, the retroviral vector plasmid is a transfer plasmid. A transfer plasmid is a plasmid which encodes the retroviral vector genome.
[0062] The cells are preferably mammalian cells. Examples of mammalian cells include those from any organ or tissue from humans, mice, rats, hamsters, monkeys, rabbits, donkeys, horses, sheep, cows and apes. Preferably, the cells are human cells. The cells may be primary or immortalised cells. The cells may be adherent, or suspension adapted. The cells may form a clonal or heterogeneous population.
[0063] Preferred cells include HEK-293, HEK 293T, HEK-293E, HEK-293 FT, HEK-293S, HEK-293SG, HEK-293 FTM, HEK-293SGGD, HEK-293A, MDCK, C127, A549, HeLa, CHO, mouse myeloma, PerC6, 911 , and Vero cell lines.
[0064] HEK-293 cells have been modified to contain the E1A and E1 B proteins and this allows the creation of viruses that have a deletion of the E1 A and E1 B regions to be grown in this cell line by trans-complementation. Similarly, PerC6 and 911 cells contain a similar modification and can also be used.
[0065] Most preferably, the human cells are HEK293, HEK293T, HEK293A, PerC6 or 911 . Other preferred cells include CHO and VERO cells. Preferably, the cells of the invention are capable of inducibly-expressing the env and gag-pol genes.
[0066] The cells may be isolated cells, e.g. they are not situated in a living animal. The cells are recombinant cells, i.e. they are not naturally-occurring. The first nucleic acid molecule is preferably a DNA molecule, more preferably a doublestranded DNA molecule.
[0067] The first nucleic acid may be termed a “retroviral vector plasmid” or “transfer plasmid”.
[0068] In some embodiments, the first nucleic acid molecule is a plasmid or vector, located episomally within the cell. The first nucleic acid may be located within a bacterial artificial chromosome or a yeast artificial chromosome.
[0069] In other embodiments, the first nucleic acid molecule is integrated into the genome of the cell.
[0070] The first promoter is one which is capable of driving transcription of the retroviral vector genome, i.e. elements (ii), (iii) and (iv).
[0071] Preferably, the first promoter is a cytomegalovirus (CMV) promoter or a Rous sarcoma virus (RSV) promoter.
[0072] Most preferably, the first promoter is a cytomegalovirus (CMV) promoter.
[0073] The first promoter is operably-associated with the retroviral vector genome (i.e. elements (ii), (iii) and (iv).
[0074] Retroviral long terminal repeats (LTRs) are found on either side of a retroviral provirus. The 5’ LTR acts as an RNA pol II promoter.
[0075] Wild-type retroviral LTRs comprise U3-R-U5 regions. The U3 (Unique 3’) region contains sequences necessary for activation of viral genomic RNA transcription.
[0076] In a wild-type retrovirus, Tat binds to the R (Repeat) region. Transcription begins, by definition, at the beginning of R and proceeds through U5 and the rest of the provirus. The U5 (Unique 5') is transcribed to form the 5' end of the viral genomic RNA.
[0077] Third generation retroviral vectors use a hybrid 5' LTR with a constitutive promoter, such as CMV or RSV.
[0078] The second promoter, which is optional, is one which is capable of driving transcription of the transgene. The transgene is transcribed from the second promoter in a sense orientation (with respect to the second promoter; antisense with respect to the first promoter). In the absence of a second promoter, expression of the transgene may be driven from a viral transcript promoter.
[0079] Examples of suitable second promoters include the Spleen focus-forming virus (SFFV) promoter, elongation factor 1 -alpha 1 (EF-1a) promoter, elongation factor 1 -alpha short (EFS) promoter, Rous sarcoma virus (RSV) promoter, cytomegalovirus (CMV) promoter, U6 promoter and H1 promoter. Further examples include pol ll / pol III promoters.
[0080] Preferably, the second promoter is selected from the group consisting of the Spleen focus-forming virus (SFFV) promoter, elongation factor 1 -alpha 1 (EF-1a) promoter and elongation factor 1 -alpha short (EFS) promoter. In some embodiments, the second promoter is the SFFV promoter.
[0081] The second promoter, when present, is operably-associated with the transgene. As used herein, the term “operably-associated” refers to the association of nucleic acid molecules on a single nucleic acid fragment so that the function of one nucleic acid molecule affects the function of the other nucleic acid molecule. The nucleic acid molecules may be juxtaposed, adjacent or contiguously-linked; one may be upstream of the other. The terms imply a physical connection between the nucleic acid molecules within a distance which allows the function of one nucleic acid molecule to affect the function of the other nucleic acid molecule. For example, a promoter is operably-associated with a nucleic acid molecule when the promoter is capable of affecting (i.e. promoting) the expression of that nucleic acid molecule (i.e. that the nucleic acid molecule is under the transcriptional control of the promoter). Coding polynucleotides in sense or antisense orientation can be operably- associated with regulatory polynucleotides.
[0082] The terms “transgene” and “gene of interest” (GOI) are used interchangeably herein. The transgene is capable of expressing, i.e. it encodes, a first RNA molecule. The transgene will generally comprise a 5’ untranslated region, a polypeptide-encoding region or a functional RNA-encoding region, and a 3’ untranslated region.
[0083] The first RNA molecule may be a functional RNA molecule or it may encode a polypeptide. Examples of functional RNA molecules include shRNA and miRNA.
[0084] Preferably, the transgene is one whose expression within a mammalian cell would be toxic to that cell.
[0085] In some embodiments, the transgene codes for a therapeutic polypeptide or a fragment thereof. In some embodiments, the transgene encodes one or more polypeptides.
[0086] Examples of preferred therapeutic polypeptides include antibodies, CAR-T molecules, scFV, BiTEs, DARPins and T-cell receptors. In some embodiments, the therapeutic polypeptide is a G-protein coupled receptor (GPCR), e.g. DRD1. In some embodiments, the therapeutic polypeptide is a functioning copy of a gene involved in human vision or retinal function, e.g. RPE65 or REP. In some embodiments, the therapeutic polypeptide is a functioning copy of a gene involved in human blood production or is a blood component, e.g. Factor IX, or those involved in beta and alpha thalassemia or sickle cell anaemia. In some embodiments, the therapeutic polypeptide is a functioning copy of a gene involved in immune function such as that in severe combined immune-deficiency (SCID) or Adenosine deaminase deficiency (ADA-SCID). In some embodiments, the therapeutic polypeptide is a protein which increases / decreases proliferation of cells, e.g. a growth factor receptor. In some embodiments, the therapeutic polypeptide is an ion channel polypeptide. In some preferred embodiments, the therapeutic polypeptide is an immune checkpoint molecule. Preferably, the immune checkpoint molecule is PD1 , PDL1 , CTLA4, Lag1 or GITR.
[0087] In some preferred embodiments, the transgene encodes a CRISPR enzyme (e.g. Cas9, dCas9, Cpf1 or a variant or derivative thereof) or a CRISPR sgRNA.
[0088] The following transgene (GOI) gene products are known to be either directly toxic to mammalian cells or to interfere with lenti viral vector production:
[0089] • Coagulation factor VIII
[0090] • Coagulation factor IX
[0091] • Tumour protein P53
[0092] • B-cell lymphoma 2-associated X-protein (BAX)
[0093] • Cyclo-oxygenase-2 (COX-2)
[0094] It would be expected that if any of these genes were the transgene encoded within the LVV genome, the effects could include one or more of the following: Slow growth of production cells compared to the cells from which they were derived; an unacceptable level of cell death during LVV production; low LVV production compared to production cells that do not encode a toxic GOI; and reduced transduction efficiency of LVV that is produced, e.g. coagulation factor VIII is known to impact the display of VSV-G (vesicular stomatitis virus G protein) on the surface of LVV particles, which reduces infectious titre without impacting physical titre (Radcliffe et al., Gene Then, 2008 Feb; 15: 289-297). Silencing a toxic GOI during LVV production would thus be expected to ameliorate these issues. Hence in some embodiments, the transgene encodes one of the above- mentioned gene products.
[0095] All chimeric antigen receptors (CARs) e.g. anti-CD19 CAR and anti-B-cell maturation antigen CAR, are displayed on the cell surface. Thus, if encoded by the transgene, they would also be expected to be displayed on the lentiviral vector surface, as it is an enveloped viral vector whose envelope is derived from the production cell membrane. Thus, silencing CAR genes during lentiviral vector production would be beneficial as it would prevent the display of the transgene gene product on the lentiviral vector surface, making the end-product consistent, making downstream processing simpler and reducing the risk of immunogenicity.
[0096] The maximum cloning capacity of a lentiviral vector is about 8.5 kb, but inserts of greater than about 3 kb are packaged less efficiently. Preferably, therefore, the transgene size is less than 3 kb.
[0097] The 3’ LTR also comprises U3-R-U5 regions. The transcription which started in the 5' LTR terminates in the 3’ LTR by the addition of a poly A tract just after the R sequence.
[0098] In some embodiments, the 3’ LTR includes a deletion relative to the wild-type 3’ LTR, rendering the retroviral vector “self-inactivating” (SIN) after integration into a mammalian genome.
[0099] Elements (i), (ii), (iii) and (iv) are attached in the stated 5’-3’ order, (notwithstanding the fact that element (iii) is in reverse orientation). Element (iii) is in reverse orientation with respect to the first promoter.
[0100] The second nucleic acid molecule codes for (and is capable of expressing) a second RNA molecule which is capable of binding to all or part of the first RNA molecule. For example, the second nucleic acid molecule may comprise a third promoter, operably- associated with a nucleotide sequence encoding the second RNA molecule. The third promoter may be a constitutive or inducible promoter.
[0101] If the first RNA molecule encodes a polypeptide, then the function of the second RNA molecule is to bind to all or part of the first RNA molecule in order to inhibit or prevent the translation of the first RNA molecule in the cell. If the first RNA molecule encodes a functional RNA, then the function of the second RNA molecule is to bind to all or part of the first RNA molecule in order to inhibit or prevent the activity of that functional RNA.
[0102] The first and second RNA molecules will bind to each other by Watson-Crick binding. The second RNA molecule will have a ribonucleotide sequence which is antisense compared to all or part of the ribonucleotide sequence of the first RNA molecule.
[0103] The ribonucleotide sequences of the first and second RNA molecules will therefore be fully or partially complementary.
[0104] Preferably, the first and second RNA molecules have at least 50%, 60%, 70%, 80% or 90% complementary sequence identity over all or part of their lengths.
[0105] In some embodiments, the ribonucleotide sequences of the first and second RNA molecules are complementary or partially complementary over a stretch of at least 30 bp.
[0106] Examples of the second RNA molecule include short hairpin RNA (shRNA), short interfering RNA (siRNA), microRNA (miRNA) and primary microRNA (pri-miRNA), having a ribonucleotide sequence which is complementary to all or part of the first RNA molecule. shRNA molecules comprise a sense strand, stem loop and an antisense strand. For example, the sense strand and antisense strand may be 17-22 or 19-22 nucleotides each, and the loop may be 4-11 nucleotides. Preferably, the sense strand and antisense strand are about 21 nucleotides each, and the loop is 7 nucleotides.
[0107] A siRNA may, for example, be 20-25 nucleotides in length.
[0108] In some embodiments, the second RNA molecule is a miRNA which binds to a complementary sequence in the 5’ UTR or 3’UTR (preferably the 3’UTR) of the first RNA molecule. The complementary sequence in the 5’ UTR or 3’UTR of the first RNA molecule may be a sequence which is part of the endogenous transgene sequence or the complementary sequence in the 5’ UTR or 3’UTR may be a heterologous sequence (i.e. designed for binding to the miRNA). In some embodiments, the second RNA molecule is a shRNA which comprises a sense strand, stem loop and an antisense strand, wherein the base-pairing between the sense and antisense strands at the 5’-end of the antisense strand (e.g. within 1-5 nucleotides of the stem loop) is destabilised (e.g. by the presence of 1 , 2, 3, 4 or 5 non- complementary nucleotides). This enhances the strand specificity of the shRNA, i.e. it will be less prone to aberrantly targeting the viral RNA.
[0109] In some embodiments, the second RNA molecule is an miRNA (micro RNA) wherein the nucleotide sequence of the miRNA is partially or fully complementary to the nucleotide sequence of the first RNA molecule except for 1 , 2 or 3 nucleotides thus preventing the cleavage of the first RNA molecule. The rationale is that due to the partial mismatch, mRNA cleavage is prevented while retaining translational repression by routes that do not require mRNA cleavage. Thus any aberrant targeting of the viral RNA will not disrupt packaging of the viral RNA into the viral vector.
[0110] In some embodiments, the second RNA molecule is a primary miRNA (pri-miRNA). When an shRNA is processed to form the complex that performs gene silencing, the antisense strand is loaded into a nucleoprotein complex which performs gene silencing. However, although the antisense strand is preferentially loaded, it is also possible for the sense strand to be loaded. This means that a fraction of the shRNA-derived gene silencing complexes in the cell will target the opposite strand to that which is intended to be targeted; in this case, this would be the viral RNA. Conversion of the shRNA to a pri- miRNA as per Kaadt et al. (Molecular Therapy Nucleic Acids, 2018 Nov; 14: 318-328) abolishes the aberrant loading of the sense strand. Thus using this approach, one can be certain that there would be no targeting of the viral RNA by the silencing system.
[0111] A second advantage is that conversion of shRNA to pri-miRNA as per Kaadt et al. would permit driving the expression of the second RNA molecule by any Pol II promoter, which could be much stronger than the Pol III promoters that must be used with shRNAs. This could enable an increase in the amount of second RNA molecule in the production cells, thus achieving more effective GOI knockdown. The second RNA molecule could be designed to target the 5’ or 3’ UTR, or a custom sequence that is inserted into the 5’ or 3’ UTR, of the GOI (transgene).
[0112] The second nucleic acid molecule is expressed (to produce the second RNA molecule) in the cell in which the first nucleic acid molecule is expressed. The second nucleic acid molecule may, for example, be integrated into the (nuclear or mitochondrial) genome of the cell or it may be present episomally, e.g. on a plasmid or vector within the cell.
[0113] The second nucleic acid may be located within a bacterial artificial chromosome or a yeast artificial chromosome.
[0114] One or more further nucleic acid molecules expressing retroviral gag-pol, env and rev genes are also present within the cell. These genes (and the polypeptides that they encode) are required in order to produce and package retroviral vectors within the cell.
[0115] The env, gag-pol and rev genes are preferably viral genes or derived from viral genes. More preferably, they are retroviral genes or derived from retroviral genes.
[0116] Examples of suitable retroviruses include lentiviruses, alpha-retroviruses, gammaretroviruses (e.g. murine leukaemia viruses) and foamy-retrovi ruses. Preferably, the retrovirus is a lentivirus.
[0117] The env, gag, pol and rev genes may be from one or more different viruses (e.g. 2, 3 or 4 different viruses). For example, the env gene may be from Rhabdoviridae (e.g. VSV- G) whilst other the gag, pol and rev genes may be from HIV-1 .
[0118] It is recognised by those in the art that the env, gag, pol and rev genes of retroviruses vary by clade and isolate. The sequences of these genes from all such clades and isolates are encompassed herein, as well as derivatives thereof. env is a gene that encodes the protein which forms the viral envelope. The expression of the env gene enables retroviruses to target and attach to specific cell types, and to infiltrate the target cell membrane. Examples of the env gene include the HIV-1 env gene and derivatives thereof.
[0119] In HIV, the env gene codes for the gp160 protein which forms a homotrimer, and is cleaved into gp120 and gp41 by the host cell protease, Furin. The HIV-1 env nucleotide and amino acid sequences are given in SEQ ID NOs: 1 and 2, respectively.
[0120] As used herein, the term “HIV-1 env gene” refers preferably to a nucleotide sequence having the sequence given in SEQ ID NO: 1 or a nucleotide sequence encoding SEQ ID NO: 2, or a nucleotide sequence having at least 80%, 85% 90%, 95% or 99% sequence identity thereto and which encodes a gp160 protein which is capable of forming a homotrimer and is capable of being cleaved into gp120 and gp41 polypeptide by the HIV-1 protease.
[0121] The viral envelope may be pseudo-typed by using an env gene from a virus such as Vesicular Stomatitis virus (VSV), e.g. the VGV-G gene, or a derivative thereof.
[0122] The VSV-G protein is a single-pass membrane glycoprotein. It mediates a broad infectious tropism. The gene is encoded by a 1536 bp open reading frame and produces a protein consisting of 511 amino acids. The protein contains a 16 amino signal peptide at the N-terminus (amino acid sequence: MLSYLIFALAVSPILG, SEQ ID NO: 11) which is cleaved from the mature protein during export through the secretory pathway to the cell surface. The glycoprotein contains an extracellular region of 458 amino acids and a membrane spanning region (transmembrane region) of 21 amino acids followed by an intracellular (cytosolic) C-terminal region of 22 amino acids. The shuttling of VSV-G protein from the endoplasmic reticulum is rapid, and this is achieved by the specific trafficking signals in the C-terminal tail, including a DxE motif (where x is any amino acid) within the broader trafficking signal Tyr-Thr-Asp-lle-Glu-Met that contains the DxE motif (Sevier et al., Mol. Biol. Cell. 2000 Jan; 11 (1): 13-22). The efficiency of export of VSV-G protein may in part contribute to its effectiveness for retrovirus and lentivirus production. The VSV-G receptor is frequently described as a non-specific fusogenic protein; however, it was recently determined the VSV-G binds to the low-density lipid receptor (LDL-R) (Finkelstein et al., Proc. Natl. Acad. Sci. USA 2013; 110(18)7306-7311), which explains its broad cellular tropism and broad application in retrovirus and lentivirus pseudo-typing.
[0123] As used herein, the term “VSV-G gene” refers preferably to a nucleotide sequence having the sequence given in SEQ ID NO: 3 or a nucleotide sequence encoding SEQ ID NO: 4, or a nucleotide sequence having at least 80%, 85% 90%, 95% or 99% sequence identity thereto and which encodes a polypeptide which is capable of attaching to the LDL receptor.
[0124] As used herein, the term “gag-pol” includes contiguous / overlapping gag-pol genes and independent gag and pel genes.
[0125] The Gag-Pol protein of lentiviruses is produced as a single poly-protein that encodes a protease that enables the proteolytic cleavage of the Gag-Pol protein into a number of smaller proteins serving a number of virus functions. The HIV-1 Gag protein is produced from the first translated open reading frame from the 5’-end of the virus genome and contains a sequence known as the frame-shift sequence. This signal causes the translating ribosome to shift back on the mRNA molecule one base during translation approximately every 1 in 20 translation runs. This process produces the Gag-Pol protein. The result is that lentivirus produce Gag and Gag-Pol at an approximate ratio of 1 :20. The Gag protein encodes three major structural proteins: p18, p24 and p15. The Pol protein segment also encodes three major proteins called p10 (protease), p66 / 55 (reverse transcriptase) and p32 (integrase). The protease is responsible for all of the cleavage events required to produce each of these proteins by proteolytic cleavage. However, the protease recognition sequences that define these cleavage events are poorly defined, suggesting that the protease has broad specificity. This is therefore likely to result in the cleavage of proteins that are not virus related. Indeed, the expression of Gag-Pol proteins is reported to be highly toxic to cells because of this (Blanco et al., The Journal of Biochemistry, 278, 2, 1086-1093, 2003). In some viruses, the coding sequences of the gag and pol genes overlap. The coding sequences of the gag and pol genes of the invention may be contiguous, noncontiguous, overlapping or non-overlapping.
[0126] Preferably, the gag-pol sequence is from a lenti virus. Examples of the gag, pol and gag- pol genes include HIV-1 gag-pol genes and derivatives thereof. Preferably, the gag-pol genes are from HIV-1 . In HIV-1 , the reading frames of the gag and pol genes overlap, i.e. in a gag-pol gene. The HIV-1 gag-pol nucleotide sequence is given in SEQ ID NO: 5.
[0127] As used herein, the term “HIV-1 gag-pol gene” refers preferably to a nucleotide sequence having the sequence given in SEQ ID NO: 5, or a nucleotide sequence having at least 80%, 85% 90%, 95% or 99% sequence identity thereto and which encodes matrix, capsid and nucleocapsid proteins, and a reverse transcriptase, integrase, and protease.
[0128] Rev is a trans-activating protein that is essential to the regulation of HIV-1 protein expression. A nuclear localization signal is encoded in the rev gene, which allows the Rev protein to be localized to the nucleus, where it is involved in the export of unspliced and incompletely spliced mRNAs. Rev binds to a region in the lentivirus genome called the Rev Response Element which allows the nuclear export of unspliced, full length genomes, which is essential for lentivirus production.
[0129] Examples of the rev gene include the HIV-1 rev gene and derivatives thereof. The HIV- 1 rev nucleotide and Rev amino acid sequences are given in SEQ ID NOs: 6 and 7, respectively.
[0130] As used herein, the term “HIV-1 rev gene” refers preferably to a nucleotide sequence having the sequence given in SEQ ID NO: 6 or a nucleotide sequence encoding SEQ ID NO: 7, or a nucleotide sequence having at least 80%, 85% 90%, 95% or 99% sequence identity thereto and which encodes a protein which is capable of binding to the Rev Response Element (RRE). In some other embodiments, the further nucleic acid molecules do not comprise a nucleic acid comprising a rev gene.
[0131] VSV-G is generally cytotoxic to cells. It is capable of inducing cell fusion and the formation of syncytia. Some of the gag-pol gene products are also cytotoxic. In particular, the pel gene encodes a protease that cleaves proteins within the cell and leads to cell death.
[0132] The expression of one or more apoptosis inhibitors mitigates or prevents apoptosis of the cell which would otherwise have been initiated by the cytotoxicity of the cytotoxic polypeptide(s). Therefore, the further nucleic acid molecules of the invention may additionally comprise one or more nucleotide sequences encoding apoptosis inhibitors. The one or more apoptosis inhibitors may independently, for example, be polypeptide or RNA.
[0133] In some embodiments, the further nucleic acid molecules of the invention additionally comprise 1 , 2, 3, 4 or 5, more preferably, 1 or 2 nucleotide sequences encoding apoptosis inhibitors. In some embodiments, the apoptosis inhibitor is an inhibitor of the APAF-1 (e.g. AVEN), Caspase 9 (e.g. IAP or XlAP), BAK, BAX, BOK or BAD (e.g. BCL2, E1 B-19K or BCL-XL) pathway. Preferably, more than one gene is used that inhibits more than one apoptosis pathway or step (e.g. AVEN combined with E1 B-19K) to provide improved resistance to apoptosis.
[0134] In some embodiments, the one or more of the apoptosis inhibitor is one which inhibits an apoptotic protein whose production is stimulated by loss of cell membrane integrity, by cell-cell fusion or by syncytia formation or one which is stimulated by a protease that cleaves proteins within the cell.
[0135] Examples of apoptosis-inhibiting polypeptides include Celovirus GAM1 , Adenovirus E4 Orf6, Adenovirus E1 B 55K, Adenovirus E1 B 19K, Myxoma virus M11 L, Cytomegalovirus IE1 , Cytomegalovirus IE2, Baculovirus p35, Baculovirus IAP-1 , Herpesvirus US3, Herpesvirus Saimiri ORF16, Herpes Simplex 2 LAT ORF 1 , Human XIAP, African Swine Fever ASFV-5-HL (LMW-5-HL / A179L), Kaposi’s Sarcoma virus KSbcl2, Vaccinia virus SPI-2, Cowpoxvirus CrmA, Epstein Barr virus BHRF1 , Epstein Barr virus EBNA-5, Epstein Barr virus BZLF-1 , Papillomavirus E6, Human Aven, Human BCL2 and Human BCL-XL.
[0136] In some embodiments, one or more of the apoptosis inhibitors is an RNA, preferably an antisense or shRNA. Other examples of RNA apoptosis inhibitors include Herpesvirus LAT and Adenovirus VA1 .
[0137] Preferably, the apoptosis inhibitors are selected from the group consisting of IAP1 , EBNA5 and BCL-XL. Particularly-preferred combinations of apoptosis inhibitors include: IAP1 + EBNA5; IAP1 + BCL-XL; and EBNA5 + BCL-XL. Nucleotide sequences of apoptosis inhibitors IAP1 , EBNA5 and BCL-XL are given herein as SEQ ID NOs: 8, 9 and 10, respectively.
[0138] Particularly preferred are further nucleic acid molecules of the invention which additionally comprises a nucleotide sequence encoding an apoptosis inhibitor comprising SEQ ID NO: 8, 9 or 10, or a nucleotide sequence having at least 80%, 85%, 90%, 95% or 99% sequence identity thereto.
[0139] Each of the genes in the further nucleic acid molecules are preferably operably- associated with one or more regulatory elements. This ensures that the appropriate polypeptide is expressed at the desired level and at the desired time.
[0140] In this context, the term “regulatory elements” includes one or more of an enhancer, promoter, intron, polyA, insulator or terminator.
[0141] The genes used in the vectors herein are preferably separated by polyA signals and / or insulators in an effort to keep transcriptional read-through to other genes to a minimum and also to insulate the genes which it is desired to repress (VSV-G and gag-pol) under normal circumstances from genes which it is desired to be expressed (e.g. TetR and the apoptosis inhibitors).
[0142] While some advantages may be obtained by using copies of the same regulatory element (e.g. promoter sequence) with more than one polypeptide or RNA-encoding nucleotide sequence (in terms of their co-ordinated expression), in this context of this invention, it is highly desirable to use different regulatory elements with each polypeptide or RNA-encoding nucleotide sequence.
[0143] Preferably, therefore, the env and gag-pol genes are operably associated with different regulatory elements, e.g. different promoter, different intron, different polyA, different insulator and / or different terminator sequences.
[0144] The further nucleic acid molecules may, for example, independently be integrated into the (nuclear or mitochondrial) genome of the cell or they may be present episomally, e.g. on a plasmid or vector within the cell. One or more of the nucleic acids may be located within a bacterial artificial chromosome or a yeast artificial chromosome within the cell. Preferably, they are all integrated into the (nuclear or mitochondrial) genome of the cell.
[0145] The binding of the first RNA molecule to the retroviral vector RNA molecule (partially or completely) generates a double-stranded RNA molecule which can trigger a cell-death response within the cell, thus leading to the death of the cell. (Mammalian cells perceive the presence of double-stranded RNA molecules as being associated with viral infection.) It is therefore necessary to prevent the triggering of this cell-death response within the cell.
[0146] In mammalian cells, the cell death response is initiated by the activation of the endogenous protein kinase R. The cell’s nuclear genome comprises a PKR gene which encodes a PKR RNA, which encodes a PKR polypeptide. Protein kinase R (PKR) is also known as Protein kinase RNA-activated, interferon- induced, double-stranded RNA-activated protein kinase, and eukaryotic translation initiation factor 2-alpha kinase 2 (EIF2AK2). It is an enzyme that in humans is encoded by the EIF2AK2 gene on chromosome 2. PKR is a serine / tyrosine kinase that is 551 amino acids long.
[0147] The cell death response may be inhibited or prevented by expressing an inhibitor of the endogenous PKR gene or endogenous PKR polypeptide within the cell.
[0148] The PKR inhibitor may be expressed in the cell either constitutively or inducibly.
[0149] In some embodiments, the cell death response is prevented or inhibited within the cell by expressing in the cell: (d) a third nucleic acid molecule coding for a PKR inhibitor.
[0150] The third nucleic acid molecule may be present within the cell genome or may be present episomally within the cell. The third nucleic acid may located within a bacterial artificial chromosome or a yeast artificial chromosome within the cell. In other embodiments, the PKR inhibitor is present in the cell media surrounding the cell. Preferably the PKR inhibitor is a RNA molecule having a ribonucleotide sequence which is complementary to all or part of the endogenous PKR RNA.
[0151] Examples of PKR inhibitors include short hairpin RNA (shRNA), short interfering RNA (siRNA), microRNA (miRNA) and primary microRNA (pri-miRNA) having a ribonucleotide sequence which is complementary to all or part of the PKR RNA. Preferably, the PKR inhibitor is a shRNA against the PKR RNA.
[0152] In other embodiments, the PKR inhibitor is an inhibitor of the PKR polypeptide. Examples of inhibitors of the PKR polypeptide include C16 (PKRi, GW 506033X; CAS number 608512-97-6); and the small molecule inhibitors described in Jammi et al. (Biochemical and Biophysical Research Communications, vol. 308, Issue 1 , 15 August 2003, Pages 50-57) and Cusack et al. (Bioorganic & Medicinal Chemistry Letters Volume 79, 1 January 2023, 129047). - T1 -
[0153] In some embodiments, the PKR inhibitor is a shRNA which comprises a sense strand, stem loop and an antisense strand, wherein the base-pairing between the sense and antisense strands at the 5’-end of the antisense strand (e.g. within 1 -5 nucleotides of the stem loop) is destabilised (e.g. by the presence of 1 , 2, 3, 4 or 5 non-complementary nucleotides).
[0154] In some embodiments, the cell death response is prevented or inhibited by performing a process in a cell wherein the PKR genes have been knocked out, i.e. the PKR genes are not functional or have been fully or partially deleted.
[0155] In another embodiment of the invention, the first and second nucleic acid molecules are present on a plasmid together with a third nucleic acid molecule which encodes a PKR inhibitor. One example of this “one plasmid system” is given in Figure 8. In some preferred embodiments, a nucleotide (gene) sequence in accordance with this embodiment is as shown in SEQ ID NO: 16.
[0156] The advantages of this system compared to the system in which the transfer plasmid and a PKR inhibitor plasmid are separate are as follows: the lenti viral vector production process is simplified as only one plasmid needs to be prepared and transfected; and the ratio of anti-PKR RNA to GOI mRNA would be increased compared to the system with separate plasmids, potentially improving the effectiveness of gene silencing.
[0157] The invention therefore provides a process as described herein wherein:
[0158] (a) (i.e. the first nucleic acid) and
[0159] (b) (i.e. the second nucleic acid) are provided on a plasmid within the cell, wherein the plasmid additionally comprises:
[0160] (c) a third nucleic acid molecule coding for a PKR inhibitor, preferably wherein the PKR inhibitor is an anti-PKR RNA molecule which is capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA.
[0161] In yet another aspect of the invention, there is provided a retroviral transfer plasmid comprising: (a) a first nucleic acid molecule comprising:
[0162] (i) a first promoter;
[0163] (ii) a retroviral 5’ LTR;
[0164] (iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter; and
[0165] (iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter;
[0166] (b) a second nucleic acid molecule coding for a second RNA molecule capable of binding to all or part of the first RNA molecule; and
[0167] (c) a third nucleic acid molecule coding for a PKR inhibitor, preferably coding for an RNA molecule capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA.
[0168] The invention also provides a process as described herein wherein: a first nucleic acid molecule of the invention; a second nucleic acid molecule of the invention; and a third nucleic acid molecule coding for a PKR inhibitor, preferably wherein the PKR inhibitor is an anti-PKR RNA molecule which is capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti- PKR shRNA, are all present in the cell and are located on one or more plasmids; and wherein:
[0169] (i) the first and second nucleic acid molecules are located on the same plasmid;
[0170] (ii) the first and third nucleic acid molecules are located on the same plasmid;
[0171] (iii) the second and third nucleic acid molecules are located on the same plasmid; or
[0172] (iv) the first, second and third nucleic acid molecules are located on the same plasmid. The invention also provides a host cell comprising: a first nucleic acid molecule of the invention; a second nucleic acid molecule of the invention; and a third nucleic acid molecule coding for a PKR inhibitor, preferably wherein the PKR inhibitor is an anti-PKR RNA molecule which is capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA.
[0173] In yet another aspect of the invention, there is provided a kit comprising: a first nucleic acid molecule of the invention; a second nucleic molecule acid of the invention; and a third nucleic acid molecule coding for a PKR inhibitor, preferably wherein the PKR inhibitor is an anti-PKR RNA molecule which is capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA; optionally wherein the first, second and third nucleic acid molecules are all present on one or more plasmids, and wherein:
[0174] (i) the first and second nucleic acid molecules are located on the same plasmid;
[0175] (ii) the first and third nucleic acid molecules are located on the same plasmid;
[0176] (iii) the second and third nucleic acid molecules are located on the same plasmid; or
[0177] (iv) the first, second and third nucleic acid molecules are located on the same plasmid.
[0178] In yet another embodiment of the invention, the first and second nucleic acid molecules are present on a plasmid together, within the cell. Furthermore, a fragment of a PKR gene is inserted within the 3’ UTR of the transgene; and the ribonucleotide sequence of the second RNA molecule is tailored to be complementary to the fragment of the PKR gene. One example of this “universal” plasmid is given in Figure 9. In some preferred embodiments, a nucleotide (gene) sequence in accordance with this embodiment is as shown in SEQ ID NO: 17.
[0179] In this system, the fragment of the PKR gene within the 3’ UTR of the transgene (i.e. part of the first RNA molecule) will be targeted by the anti-PKR RNA molecule (i.e. the second RNA molecule) and this will silence expression of the first RNA molecule. The anti-PKR RNA molecule will also target the cell’s endogenous PKR RNA, thus preventing initiation of the cell death response within the cell.
[0180] The advantage of this system is as follows: since the sequence targeted by the anti- PKR RNA molecule to silence the transgene expression is outside of the codondetermining sequence (CDS) of the transgene, the transgene could be modified or replaced without the need to screen a panel of anti-transgene shRNAs to find an effective one. This shortens development timelines when customising this system for novel applications.
[0181] The invention therefore provides a process as described herein wherein:
[0182] (a) the first nucleic acid molecule comprises:
[0183] (i) a first promoter;
[0184] (ii) a retroviral 5’ LTR;
[0185] (iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter, wherein the transgene (and first RNA molecule) comprises a 5’ or 3’ untranslated region (UTR) which comprises a fragment of a PKR gene; and
[0186] (iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter; and
[0187] (b) the second nucleic acid molecule codes for an anti-PKR RNA molecule, wherein the anti-PKR RNA molecule is capable of binding to both the 5’ or 3’ UTR of the first RNA molecule (i.e. to the portion of the first RNA molecule having the ribonucleotide sequence of the fragment of the PKR gene) and endogenous PKR mRNA expressed from the cell’s genome.
[0188] Preferably, the anti-PKR RNA molecule is an anti-PKR shRNA or miRNA. In yet a further aspect of the invention, there is provided a retroviral transfer plasmid comprising:
[0189] (a) a first nucleic acid molecule comprising:
[0190] (i) a first promoter;
[0191] (ii) a retroviral 5’ LTR;
[0192] (iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter, wherein the transgene comprises a 5’ or 3’ untranslated region (UTR) which comprises a fragment of a PKR gene; and
[0193] (iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter; and
[0194] (b) a second nucleic acid molecule coding for an anti-PKR RNA molecule, wherein the anti-PKR RNA molecule is capable of binding to both the 5’ or 3’ UTR of the first RNA molecule (i.e. to the portion of the first RNA molecule having the ribonucleotide sequence of the fragment of the PKR gene) and a PKR mRNA molecule (such as that expressed from an endogenous PKR gene within a cell).
[0195] Preferably, the anti-PKR RNA molecule is an anti-PKR shRNA or miRNA.
[0196] The length of the fragment of the PKR gene may, for example, be 19 to 1000. nucleotides, preferably 19 to 100 nucleotides. In some preferred embodiments, the nucleotide (gene) sequence of the fragment of the PKR gene is:
[0197] 5’ GCTGAACTTCTTCATGTATGT 3’ (SEQ ID NO: 28).
[0198] The invention also provides a cell, preferably one as disclosed herein, which comprises a retroviral transfer plasmid of the invention. In a further embodiment, there is provided a process for producing a retroviral packaging cell, the process comprising the steps: introducing a retroviral transfer plasmid of the invention into a mammalian cell which expresses retroviral env and gag-pol genes, and optionally the rev gene.
[0199] The invention also provides the use of a retroviral packaging cell of the invention in the production of a retroviral vector.
[0200] The first, second, further and third (when present) nucleic acid molecules are expressed in the cell under conditions which are suitable for the production of lenti viral vectors comprising (ii), (iii) and (iv). The cells will be cultured in a cell media, preferably in a liquid cell media. In some embodiments, the cells will be cultured in suspension.
[0201] Suitable conditions for performing the process of the invention are well known in the art (e.g. Benskey, M.J., Manfredsson, F.P. (2016). “Lentivirus Production and Purification”. In: Manfredsson, F. (eds) Gene Therapy for Neurological Disorders. Methods in Molecular Biology, vol 1382. Humana Press, New York, NY).
[0202] Step (B) relates to harvesting the retroviral vectors from the cell or from the cell media around the cell. The retroviral vectors will be secreted into the cell media. The cells could be removed from the cell media by, for example, centrifugation, filtration (e.g. tangential flow filtration), leaving the desired retroviral vectors in the cell supernatant.
[0203] The invention also provides a retroviral vector obtained or obtainable by a process of the invention.
[0204] Preferably, the process / method steps are carried out (one after the other) in the order specified.
[0205] There are many established algorithms available to align two amino acid or nucleic acid sequences. Typically, one sequence acts as a reference sequence, to which test sequences may be compared. The sequence comparison algorithm calculates the percentage sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters. Alignment of amino acid or nucleic acid sequences for comparison may be conducted, for example, by computer- implemented algorithms (e.g. GAP, BESTFIT, FASTA or TFASTA), or BLAST and BLAST 2.0 algorithms.
[0206] Percentage amino acid sequence identities and nucleotide sequence identities may be obtained using the BLAST methods of alignment (Altschul et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402; and http: / / www.ncbi.nlm.nih.gov / BLAST). Preferably the standard or default alignment parameters are used.
[0207] Standard protein-protein BLAST (blastp) may be used for finding similar sequences in protein databases. Like other BLAST programs, blastp is designed to find local regions of similarity. When sequence similarity spans the whole sequence, blastp will also report a global alignment, which is the preferred result for protein identification purposes.
[0208] Preferably the standard or default alignment parameters are used. In some instances, the "low complexity filter" may be taken off.
[0209] BLAST protein searches may also be performed with the BLASTX program, score=50, wordlength=3. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. (See Altschul et al. (1997) supra). When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs may be used.
[0210] With regard to nucleotide sequence comparisons, MEGABLAST, discontiguous- megablast, and blastn may be used to accomplish this goal. Preferably the standard or default alignment parameters are used. MEGABLAST is specifically designed to efficiently find long alignments between very similar sequences. Discontiguous MEGABLAST may be used to find nucleotide sequences which are similar, but not identical, to the nucleic acids of the invention. The BLAST nucleotide algorithm finds similar sequences by breaking the query into short subsequences called words. The program identifies the exact matches to the query words first (word hits). The BLAST program then extends these word hits in multiple steps to generate the final gapped alignments. In some embodiments, the BLAST nucleotide searches can be performed with the BLASTN program, score=100, wordlength=12.
[0211] One of the important parameters governing the sensitivity of BLAST searches is the word size. The most important reason that blastn is more sensitive than MEGABLAST is that it uses a shorter default word size (11). Because of this, blastn is better than MEGABLAST at finding alignments to related nucleotide sequences from other organisms. The word size is adjustable in blastn and can be reduced from the default value to a minimum of 7 to increase search sensitivity.
[0212] A more sensitive search can be achieved by using the newly-introduced discontiguous megablast page (www.ncbi.nlm. nih.gov / Web / Newsltr / FallWinterO2 / blastlab.html). This page uses an algorithm which is similar to that reported by Ma et al. (Bioinformatics. 2002 Mar; 18(3): 440-5). Rather than requiring exact word matches as seeds for alignment extension, discontiguous megablast uses non-contiguous word within a longer window of template. In coding mode, the third base wobbling is taken into consideration by focusing on finding matches at the first and second codon positions while ignoring the mismatches in the third position. Searching in discontiguous MEGABLAST using the same word size is more sensitive and efficient than standard blastn using the same word size. Parameters unique for discontiguous megablast are: word size: 11 or 12; template: 16, 18, or 21 ; template type: coding (0), non-coding (1), or both (2).
[0213] In some embodiments, the BLASTP 2.5.0+ algorithm may be used (such as that available from the NCBI) using the default parameters. In other embodiments, a BLAST Global Alignment program may be used (such as that available from the NCBI) using a Needleman-Wunsch alignment of two protein sequences with the gap costs: Existence 11 and Extension 1 . As used herein, the term “sequence identity” in the context of amino acid sequences may alternatively be replaced by “sequence similarity”. The term “similarity” allows conservative substitutions of amino acid residues having similar physicochemical properties over a defined length of a given alignment. The percentage of similarity is determinable with any reasonable similarity-scoring matrix.
[0214] The disclosure of each reference set forth herein is specifically incorporated herein by reference in its entirety.
[0215] BRIEF DESCRIPTION OF THE FIGURES
[0216] Figure 1. Gene of interest expression during lentiviral vector production in the presence of shRNA plasmid EP2340. Enhanced green fluorescent protein (EGFP) expression, expressed as median fluorescence intensity multiplied by the percentage of EGFP- positive cells. N = three production replicates and two analytical replicates. Error bars indicate standard deviation.
[0217] Figure 2. Infectious titre of lentiviral vector production in the presence of shRNA plasmid EP2340. Infectious titre measured by quantitative polymerase chain reaction quantitation of integrated vector copy number in adherent HEK 293T cells transduced by LVV supernatants. N = three production replicates and two analytical replicates.
[0218] Error bars indicate standard deviation.
[0219] Figure 3. Gene of interest (GOI) expression per transducing unit in target cells transduced by lentiviral vectors produced in the presence of GOI-silencing shRNAs. MFI = median fluorescence intensity. TU = transducing units. N = three production replicates and two analytical replicates. Error bars indicate standard deviation.
[0220] Figure 4. Gene of interest expression during lentiviral vector production in the absence of shRNA plasmid EP2340. Enhanced green fluorescent protein (EGFP) expression, expressed as median fluorescence intensity multiplied by the percentage of EGFP- positive cells. N = three production replicates and two analytical replicates. Error bars indicate standard deviation.
[0221] Figure 5. Infectious titre of lentiviral vector production in the absence of shRNA plasmid EP2340. Infectious titre measured by quantitative polymerase chain reaction quantitation of integrated vector copy number in adherent HEK 293T cells transduced by LVV supernatants. N = three production replicates and two analytical replicates. Error bars indicate standard deviation.
[0222] Figure 6. Gene of interest (GOI) expression per transducing unit in target cells transduced by lentiviral vectors produced in the absence of GOI-silencing shRNAs. MFI = median fluorescence intensity. TU = transducing units. N = three production replicates and two analytical replicates. Error bars indicate standard deviation.
[0223] Figure 7. Genetic constructs to simulate perfect gene of interest (GOI) knockdown and demonstrate the necessity of reversing the orientation of the GOI.
[0224] (A(i)) Schematic diagram of GOI in the same orientation as the viral RNA (vRNA) promoter. Although no GOI mRNA is produced, the GOI is translated from the vRNA. (A(ii)) Flow cytometry analysis of suspension HEK293 cells transfected as per the axis labels.
[0225] (B(i)) GOI in the opposite orientation to the vRNA promoter. No GOI mRNA is produced and there is no GOI translation from the vRNA as it no longer encodes the GOI transcript.
[0226] (B(ii)) Flow cytometry analysis of a suspension HEK293 cells transfected as per the axis labels. N = three transfection replicates in all cases.
[0227] Figure 8. Example of a one-plasmid gene of interest-silencing system. A plasmid that encodes a lentiviral vector genome with the GOI in the opposite orientation to the viral RNA promoter; and an anti-PKR shRNA; and an anti-GOI shRNA.
[0228] Figure 9. Example of a universal gene of interest silencing system. A plasmid that encodes a lentiviral vector genome with the GOI in the opposite orientation to the viral RNA promoter; and a fragment of the PKR gene in the 3’ untranslated region (UTR) of the GOI; and an anti-PKR shRNA that targets both the PKR gene and the fragment of the PKR gene in the 3’ UTR of the GOI.
[0229] Figure 10. Effect of silencing toxic genes of interest during lentiviral vector (LVV) production. (A) Anti-CD19 CAR expression during LVV production. (B) Production cell viability during production of anti-CD19 CAR-encoding LVV. (C) Production cell growth during production of anti-CD19 CAR-encoding LVV. (D) Infectious titre of anti-CD19 CAR-encoding LVV. (E) Production cell viability during production of BAX-encoding LVV. (F) Production cell growth during production of BAX-encoding LVV. (G) Physical titre of BAX-encoding LVV. NTC = non-transfected control cells. Error bars indicate standard deviation (n = 3).
[0230] Figure 11. One-plasmid universal GOI-silencing system with various GOI promoters. GOI expression from conventional and silenced transfer plasmids during lentiviral vector production with either (A) SFFV promoter, (B) EFS promoter, or (C) EF-1a promoter driving GOI expression. NTC = non-transfected control. (D) Infectious titre of lentiviral vector preparations. Plasmid and promoter type indicated on x axis. Error bars indicate standard deviation (n = 3).
[0231] Figure 12. Generation of producer cell lines that encode anti-CD19 CAR within the GOI- silencing system. (A) Density of cell cultures following transfection / integration of transfer plasmids. Average cell count calculated from two measurements, one from each of two replicate cell lines. Error bars indicate standard deviation. (B) Viability of cell cultures following transfection / integration of transfer plasmids. Average cell viability calculated from two measurements, one from each of two replicate cell lines. Error bars indicate standard deviation. (C) Infectious titre of lentiviral vectors (LVVs) prepared using producer cell lines. Infectious titration by ddPCR measurement of integrated vector copy number in transduced HEK293T cells. Average infectious titre calculated as the mean of one measurement each of three production replicates, each from two replicate cell lines (thus six total measurements). Error bars indicate standard deviation. Figure 13. Performance of the GOI-silencing system in four-plasmid-transfection-based LVV production. Various transfer plasmids were used, as indicated in the figure. (A) Expression level of DEGFP in production cells at the point of LVV harvest. (B) Expression level of anti-CD19 CAR on production cells at the point of LVV harvest, harvest. (C) Production cell density at the point of LVV harvest. (D) Production cell viability at the point of LVV (E) Infectious titre of DEGFP-encoding LVV supernatants. (F) Infectious titre of anti-CD19 CAR-encoding LVV supernatants. Error bars indicate standard deviation (n = 3). “NTC” = non-transfected control.
[0232] EXAMPLES
[0233] The present invention is further illustrated by the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.
[0234] Example 1 : Plasmids used
[0235] To test the lentiviral vector (LVV) gene of interest (GOI) silencing idea, the following LVV transfer plasmids were made:
[0236] 1 ) R2435 (SEQ ID NO: 12), the “current process”, which encodes an LVV genome with an enhanced green fluorescent protein (EGFP) as the GOI. The LVV genome and the GOI were encoded in the same sense orientation as each other.
[0237] 2) R4751 (SEQ ID NO: 13), “Flip GOI(1)”, which encodes an LVV genome with an EGFP as the GOI. The LVV genome and GOI were encoded in the opposite sense orientation to one another. A rabbit alpha globin polyadenylation signal was encoded downstream of the LVV genome. 3) R4875 (SEQ ID NO: 14), “Flip GOI (2)”, which encodes an LVV genome with an EGFP as the GOI. The LVV genome and GOI were encoded in the opposite sense orientation to one another. A bovine growth hormone polyadenylation signal was encoded downstream of the LVV genome.
[0238] 4) A plasmid was assembled to knock down EGFP and PKR (protein kinase R) genes. This plasmid (EP2340 or “shRNA” plasmid, SEQ ID NO: 15) encodes two short hairpin RNAs (shRNAs): one targeted to the EGFP mRNA and the other targeted to the PKR mRNA.
[0239] Since in the case of Flip GOI (1) and Flip GOI (2), the EGFP gene is encoded in the opposite sense direction to the LVV genome, it was expected that EGFP would be knocked down by the shRNA plasmid and the viral RNA would not be knocked down. If the GOI were not reversed, the EGFP gene and viral RNA would be encoded in the same sense direction as each other so it would be expected that both would be knocked down, hence the GOI was reversed in sense orientation.
[0240] Since in the case of Flip GOI (1) and Flip GOI (2), the EGFP gene was encoded in the opposite sense direction to the LVV genome, the entire length of the GOI mRNA would have reverse complementarity to a section of the viral RNA. It was thus expected that a double-stranded RNA would be formed (comprising the GOI mRNA and the viral RNA), which would be expected to trigger a cell death cascade mediated by PKR. It is for this reason that an shRNA targeted to PKR was encoded within the shRNA plasmid (to inhibit the cell death cascade).
[0241] Table 1 : Summary of the descriptions of the plasmids used. Plasmid sequences are disclosed in the Sequence Listing.
[0242] Example 2: Production of lentiviral vectors (LWs)
[0243] LVV production was performed by transfecting LVV transfer plasmid variants simultaneously with the shRNA plasmid (Table 1 and Table 2) into LVV packaging cells in the following combinations:
[0244] (i) R2435 alone,
[0245] (ii) R4751 + EP2340, and
[0246] (iii) R4875 + EP2340. Four to five hours after plasmid transfection, doxycycline was added to the cell cultures to a final concentration of 1 pg / mL (to induce the expression of VSV-G and GagPol). Twenty-four hours later, sodium butyrate was added to cell cultures to a final concentration of 5 mM (to enhance LVV production by relaxing the structure of cellular chromatin). Forty-eight hours later, LVV supernatants were harvested by removal of production cells by centrifugation as per Table 2.
[0247] Table 2: Lentiviral vector production experimental procedure.
[0248] On the day of LVV supernatant harvest, the median fluorescence intensity (MFI) of the production cells and the percentage of the production cell population that was positive for EGFP / DEGFP expression was measured by flow cytometry to determine the extent to which the GOI was silenced (Table 3).
[0249] Table 3: Flow cytometry experimental procedure. Finally, the MFI of the HEK 293T cells against which the LVV supernatants were titrated was measured to determine whether the shRNA affected GOI expression in the target cells and whether the modifications made to the LVV transfer plasmid affected GOI expression in the target cells (Table 3).
[0250] Results
[0251] The first comparison between the current process and the gene-silenced process was between the levels of GOI expression during LVV production (Figure 1). The level of GOI expression is expressed as median fluorescence intensity multiplied by the percentage of EGFP-positive cells (= “fluorescent volume”).
[0252] The current process had a fluorescent volume of 5.88 x106(SD = 6.42 x105). When the GOI was reversed in orientation and the shRNA plasmid was present, GOI expression was substantially reduced: ([Flip GOI (1 ) + shRNA] fluorescent volume = 1.81 xi o6, SD = 7.25 x4; [Flip GOI (2) + shRNA] fluorescent volume = 2.15 x6, SD = 1.64 x5) (Figure 1). Both gene-silenced processes yielded a significant decrease in GOI expression during LVV production compared to the current process (Flip GOI (1) p = 0.0015; Flip GOI (2) p = 0.0023; Welch’s T test, two tails, two sample equal variance performed using Microsoft Excel).
[0253] Next, infectious titres of LVV supernatants produced by the current process were compared to those of the gene-silenced process (Figure 2). The current process yielded 1.48 x8TU / mL (SD = 3.42 x7TU / mL) of LVV. [Flip GOI (1) + shRNA] yielded 8.43 x107TU / mL (SD = 2.95 x7TU / mL) of LVV. [Flip GOI (2) + shRNA] yielded 1.33 x8TU / mL (SD = 4.89 x7TU / mL) of LVV (Figure 2). Neither gene-silenced process yielded a significant decrease in LVV compared to the current process (Flip GOI (1) p = 0.1170; Flip GOI (2) p = 0.7459; Welch’s T test, two tails, two sample equal variance performed using Microsoft Excel).
[0254] The final comparison between the current process and the gene-silenced process compared GOI expression per transducing unit in model target cells (adherent HEK 293T cells (Figure 3). Gene expression is expressed as MFI multiplied by the percentage of EGFP-positive cells, all divided by the total number of transducing units added to the target cells (i.e. fluorescent volume per transducing unit). The fluorescent volume per TU of LVV produced by the current process was 17.14 / TU (SD = 4.98 / TU). The fluorescent volume per TU of LVV produced by Flip GOI (1) + shRNA was 26.46 / TU (SD = 10.76 / TU). The fluorescent volume per TU of LVV produced by Flip GOI (2) + shRNA was 18.29 / TU (SD = 8.60 / TU). Neither gene-silenced process yielded a significant change in GOI expression in target cells compared to the current process (Flip GOI (1) p = 0.1533; Flip GOI (2) p = 0.8030; Welch’s T test, two tails, two sample equal variance performed using Microsoft Excel).
[0255] Next, to highlight the role of the shRNAs in the GOI-silencing system, LVV productions were performed in the absence of the shRNAs. This experiment was performed inparallel with the experiment described above; hence the R2435 only / current process values are the same.
[0256] In the absence of the shRNA plasmid, GOI expression from the Flip GOI (1) and Flip GOI (2) plasmids was still substantially lower than the GOI expression using the current process (Figure 4). The fluorescent volume when using Flip GOI (1) was 6.31 *105(SD = 5.14 x104). The fluorescent volume when using Flip GOI (2) was 7.10 xio5(SD = 3.14 X104). Both flipped-GOI plasmids yielded a significant decrease in GOI expression during LVV production compared to the current process (Flip GOI (1) p = 0.0005; Flip GOI (2) p = 0.0006; Welch’s T test, two tails, two sample equal variance performed using Microsoft Excel). This result was unexpected as no shRNA against the GOI had been added; thus GOI expression was not expected to have been repressed. However, either one of the following two explanations for this observation is possible: 1) The GOI promoter is weaker than the viral RNA promoter, thus when in opposition the viral RNA promoter outcompetes the GOI promoter, thus repressing GOI expression; 2) Since PKR was not knocked down, the production cells that produced the most doublestranded RNA, i.e. those that expressed the GOI mRNA or the viral RNA most strongly, would have had the greatest initiation of cell death in the population. Thus, at the point of harvest, the remaining cell population would express the GOI or viral RNA to a lower extent than cells that had not had that selective pressure applied i.e. the cells with the current process plasmid only.
[0257] Next, infectious titres of LVV supernatants produced by the current process were compared to those of the flipped-GOI plasmids (Figure 5). The current process yielded 1.48 x8TU / mL (SD = 3.42 *107TU / mL) of LVV. Flip GOI (1 ) yielded 5.24 x7TU / mL (SD = 8.02 x6TU / mL) of LVV. Flip GOI (2) yielded 6.91 x7TU / mL (SD = 1.58 x7TU / mL) of LVV (Figure 5). Both flipped-GOI plasmids, in the absence of the shRNA plasmid, yielded a significant decrease in LVV compared to the current process (Flip GOI (1) p = 0.0183; Flip GOI (2) p = 0.0415; Welch’s T test, two tails, two sample equal variance performed using Microsoft Excel).
[0258] Finally, GOI expression per transducing unit in model target cells was measured, comparing the current process to the flipped-GOI plasmids in the absence of the shRNA plasmid (Figure 6). The fluorescent volume per TU of LVV produced by the current process was 17.14 / TU (SD = 4.98 / TU). The fluorescent volume per TU of LVV produced by Flip GOI (1 ) was 2.03 / TU (SD = 0.36 / TU). The fluorescent volume per TU of LVV produced by Flip GOI (2) was 2.47 / TU (SD = 0.60 / TU). Both flipped-GOI plasmids, in the absence of the shRNA plasmid, yielded a significant decrease in GOI expression in target cells compared to the current process (Flip GOI (1 ) p = 0.0058; Flip GOI (2) p = 0.0061 ; Welch’s T test, two tails, two sample equal variance performed using Microsoft Excel).
[0259] Summary and conclusions
[0260] The experiments above demonstrated that:
[0261] 1 ) If, in an LVV genome, the GOI is reversed in orientation with respect to the viral RNA and a plasmid that encodes shRNAs targeted against the GOI and the PKR gene is present, GOI expression during LVV production is significantly reduced (Figure 1), infectious titre is not significantly reduced (Figure 2), and GOI expression in target cells is not significantly reduced (Figure 3). 2) If the GOI is reversed in orientation with respect to the viral RNA and a plasmid that encodes shRNAs targeted against the GOI and the PKR gene is absent, GOI expression during LVV production, infectious titre, and GOI expression in target cells are all significantly reduced (Figures 4-6).
[0262] It was discussed above that the reason for unexpected GOI silencing in the flipped-GOI plasmids in the absence of the shRNA plasmid could have been due to either promoter competition or selection against plasmids that express the GOI or viral RNA highly due to generation of double-stranded RNA. If promoter competition had been the cause of GOI silencing, one would expect that GOI expression per TU in target cells would not have been impacted, since the promoter competition would have been removed by the loss of the viral RNA promoter during reverse transcription. Since GOI expression per TU in target cells was significantly reduced, it seems likely that in the absence of the shRNA plasmid, the formation of double-stranded RNA caused a selective pressure against GOI expression. It seems likely that the shRNA plasmid alleviated this selective pressure as it would be expected to protect the production cells from double-stranded RNA either by the removal of one RNA strand by the anti-GOI shRNA (thus leaving single stranded RNA), or by the inhibition of the cellular response to the doublestranded RNA.
[0263] In summary, we have demonstrated that the LVV GOI-silencing technology:
[0264] 1 ) silences the LVV GOI during LVV production;
[0265] 2) does not negatively impact LVV production;
[0266] 3) retains GOI expression in target cells.
[0267] Example 3: Knocking out the GOI promoter
[0268] We engineered a situation in which production of the GOI mRNA had been eliminated, by knocking out the GOI promoter from a transfer plasmid with the vRNA promoter and the GOI in the same orientation (Figure 7, A(i)), and from a transfer plasmid with the GOI in the opposite orientation to the vRNA promoter (Figure 7, B(i)) (GOI = enhanced green fluorescent protein, EGFP). When the GOI promoter was deleted from the transfer plasmid with GOI and vRNA in the same orientation, a large portion of GOI (EGFP) expression remained, as indicated by the median fluorescence intensity (MFI) of cells transfected with this plasmid (Figure 7, A(ii); ‘GOI promoter KO’ vs ‘Normal transfer plasmid’). In addition, these cells had higher MFI than cells without plasmid, confirming that the observed fluorescence was due to expression from the promoter- deleted plasmid. (KO = knock out.)
[0269] In contrast, when the GOI promoter was deleted from the transfer plasmid with flipped GOI, cells transfected with this plasmid had an MFI that was greatly reduced compared to cells transfected with the ‘normal transfer plasmid’ (Figure 7, B (ii)). Cells transfected with the flipped GOI / promoter KO plasmid had an MFI that was not significantly different from that of un-transfected cells (p = 0.91 ; two-tailed, homoscedastic T test), indicating that translation from the vRNA was eliminated by flipping the GOI.
[0270] In summary, we have demonstrated that even if one were to perfectly knock-down a sense-oriented GOI mRNA without knocking down the viral RNA, GOI expression would remain high due to GOI translation from the viral RNA. Thus, we have demonstrated that reversing the orientation of the GOI enables the production of lenti vira I vectors comprising any GOI, particularly ones which would be toxic to mammalian cells.
[0271] Example 4: Expression of toxic genes of interest (GOIs)
[0272] The following GOI gene products are known to be either directly toxic to mammalian cells or to interfere with lentiviral vector production:
[0273] • Coagulation factor VIII
[0274] • Coagulation factor IX
[0275] • Tumour protein P53
[0276] • B-cell lymphoma 2-associated X-protein (BAX)
[0277] • Cyclo-oxygenase-2 (COX-2)
[0278] It would be expected that if any of these genes were the GOI encoded within the LVV genome, the effects could include the following: Slow growth of production cells compared to the cells from which they were derived; An unacceptable level of production cell death during LVV production; Low LVV production compared to production cells that do not encode a toxic GOI; Reduced transduction efficiency of LVV that is produced e.g. coagulation factor VIII is known to impact the display of VSV-G (vesicular stomatitis virus G protein) on the surface of LVV particles, which reduces infectious titre without impacting physical titre (Radcliffe et al., Gene Ther., 2008 Feb; 15: 289-297). Silencing a toxic GOI during LVV production would thus be expected to ameliorate these issues.
[0279] To test the effect of silencing a toxic GOI during viral vector production, first, one of the genes listed above (or any other that has a deleterious effect on the production cells, viral vector production or both) is cloned into the LVV transfer plasmid of the GOI silencing system.
[0280] Next, an shRNA that targets the GOI is identified by a screen whereby production cells are transfected with the transfer plasmid and plasmids that encode various shRNA variants designed to target the toxic GOI and PKR. After a period of incubation (72-96 hours post-transfection), GOI expression is measured by one or more of the following methods: measurement of GOI mRNA level by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR); measurement of GOI protein production by immunoblotting techniques; cell viability assay (if the GOI is toxic to the production cells, their death will imply GOI expression). GOI expression is compared to a control that is transfected with the transfer plasmid and an shRNA plasmid that does not target the GOI and does target PKR. The shRNA plasmid that is transfected into the cells that exhibited the lowest level of GOI expression compared to the control is selected as the shRNA plasmid for further use.
[0281] Next, the effect of silencing the toxic GOI on viral vector production is tested as follows:
[0282] Production cells are transfected with the toxic GOI-encoding transfer plasmid and the top shRNA-encoding plasmid is identified in the above screen. Four to five hours after plasmid transfection, doxycycline is added to cell cultures to a final concentration of 1 pg / mL. Twenty-four hours later, sodium butyrate is added to cell cultures to a final concentration of 5 mM. Forty-eight hours later, LVV supernatants are harvested by removal of production cells by centrifugation as per Table 2. Infectious titres of LVV supernatants are acquired by the measurement by qPCR (quantitative polymerase chain reaction) of the integrated vector copy number in transduced HEK293T cells, or by cell viability assay if the GOI is too toxic to permit titration by qPCR. Physical titres of LVV supernatants are measured by RT-qPCR targeted to a packaged sequence, or by enzyme-linked immunosorbent assay (ELISA) targeted to p24. The titre of the supernatant from cells transfected with the transfer plasmid and the GOI-targeted shRNA plasmid is compared to the titre of the supernatant from cells transfect with the transfer plasmid and a plasmid that encodes a plasmid that does not target the GOI. An increase in viral vector titre is expected as a result of the inclusion of the GOI-targeted shRNA.
[0283] Finally, GOI expression in the transduced HEK293T cells is measured by one or more of the following methods: measurement of GOI mRNA level by RT-qPCR; measurement of GOI protein production by immunoblotting techniques; cell viability assay (if the GOI is toxic to the production cells, their death will imply GOI expression). An increase in GOI expression in transduced HEK293T cells is expected as a result of the inclusion of the GOI-silencing shRNA during LVV production when compared to a control to which an shRNA that does not target the GOI was added.
[0284] Example 5: Expression of membrane-displayed genes (GOIs) of interest
[0285] All chimeric antigen receptors (CARs), e.g. anti-CD19 CARs and anti-B-cell maturation antigen CARs, are displayed on the cell surface. Thus, if encoded as the GOI, they would also be expected to be displayed on the lentiviral vector surface, as it is an enveloped viral vector whose envelope is derived from the production cell membrane. Thus, silencing these genes during lentiviral vector production would be beneficial as it would prevent the display of the GOI gene product on the lentiviral vector surface, making the end-product consistent, making downstream processing simpler and reducing the risk of immunogenicity.
[0286] To test the effect of GOI silencing on the display of GOI gene product on the surface of LVV, first, a CAR gene (or gene of another membrane-displayed protein) is cloned into the LVV transfer plasmid of the GOI silencing system. Next, an shRNA that targets the GOI is identified by a screen whereby production cells are transfected with the transfer plasmid and plasmids that encode various shRNA variants designed to target the GOI and PKR. After a period of incubation (72-96 hours post-transfection), GOI expression is measured by one or more of the following methods: measurement of GOI mRNA level by RT-qPCR; measurement of GOI protein production by immunoblotting techniques; cell viability assay (if the GOI is toxic to the production cells, their death will imply GOI expression). GOI expression is compared to a control that is transfected with the transfer plasmid and an shRNA plasmid that does not target the GOI and does target PKR. The shRNA plasmid that is transfected into the cells that exhibited the lowest level of GOI expression compared to the control is selected as the shRNA plasmid for further use.
[0287] Next, viral vector is produced as follows: Production cells are transfected with the GOI- encoding transfer plasmid and the top shRNA-encoding plasmid identified in the above screen. Four to five hours after plasmid transfection, doxycycline is added to cell cultures to a final concentration of 1 pg / mL. Twenty-four hours later, sodium butyrate is added to cell cultures to a final concentration of 5 mM. Forty-eight hours later, LVV supernatants are harvested by removal of production cells by centrifugation as per Table 2.
[0288] Next, display of GOI gene product on viral vector surface is measured by immunoblotting techniques e.g. ELISA. It is expected that GOI gene product display on the lentiviral vector surface is reduced by the inclusion of a GOI-targeted shRNA during LVV production compared to a control to which an shRNA that does not target the GOI was added.
[0289] Finally, the effect on downstream processing of silencing a GOI that encodes a membrane-displayed protein is tested as follows: Downstream processing of LVV supernatants is performed according to a protocol that has been optimised for LVV that do not display the GOI gene product on the viral vector surface e.g. LVV that encodes EGFP. Efficiency of downstream processing is measured by comparison of LVV titre before and after downstream processing. The efficiencies of downstream processing of the following samples are compared: Membrane protein-encoding LVV produced in the presence of GOI-targeted shRNA; Membrane protein-encoding LVV produced in the absence of GOI-targeted shRNA; Non-membrane protein-encoding LVV. It is expected that when a membrane-bound GOI is encoded by the transfer plasmid, the inclusion of an shRNA targeted to the GOI results in more-efficient downstream processing in a process that is optimised for LVV that do not display the GOI gene product on their surface, than when an shRNA is included that does not target the GOI. Ideally, the downstream processing efficiency of the LVV with silenced membrane-bound GOI matches that of LVV that does not encode a membrane-bound GOI.
[0290] Example 6: Testing the effect of silencing a toxic GOI during LW production
[0291] As discussed above, it was expected that silencing a toxic GOI during LVV production would ameliorate the issues of: (1) low growth of production cells compared to the cells from which they were derived; (2) unacceptable level of production cell death during LVV production; and (3) low LVV production compared to production cells that do not encode a toxic GOI.
[0292] To test this, an anti-CD19 CAR gene and a B-cell lymphoma-associated X-protein (BAX) gene were inserted into gene-silencing LVV transfer plasmids (Figure 9) and conventional LVV transfer plasmids (with the GOI in the same orientation as the LTRs; SEQ ID NOs: 24-27). LVV production was performed with conventional and silenced anti-CD19 CAR and BAX plasmids, and the following were measured: anti-CD19 CAR expression during LVV production; production cell growth; production cell viability; infectious titre of anti-CD19 CAR LVV; and the physical titre of BAX LVV.
[0293] Anti-CD19 CAR expression was measured by staining live production cells with biotinylated recombinant protein L, then streptavidin-phycoerythrin, and then measurement of fluorescence levels by flow cytometry. This revealed that the silencing system reduced anti-CD19 CAR expression during LVV production by 55% (Figure 10A). Production cell growth and viability were measured by ViCell BLU Cell Viability Analyser (Beckman Coulter). This revealed that silencing anti-CD19 CAR during LVV production resulted in an increase in both production cell viability (Figure 10B) and growth (Figure 10C) during LVV production.
[0294] Anti-CD19 CAR-encoding LVV infectious titre was measured by droplet digital PCR measurement of integrated vector copy number in transduced adherent HEK293T cells. This revealed that silencing anti-CD19 CAR expression during LVV production resulted in an increase in LVV infectious titre from 8.89 x106TU / mL (sd = 1.32 x106TU / mL) to 1.56 x7TU / mL (sd = 3.39 x6TU / mL) (Figure 10D).
[0295] Production cell growth and viability were measured by ViCell BLU Cell Viability Analyser (Beckman Coulter). This revealed that encoding BAX in a silenced transfer plasmid rather than a conventional one resulted in an increase in both production cell viability (Figure 10E) and growth (Figure 10F) during LVV production.
[0296] BAX-encoding LVV physical titre was measured by reverse transcriptase quantitative PCR. This revealed that encoding BAX in a silenced transfer plasmid rather than a conventional one resulted in an increase in LVV physical titre from 4.22 x5vg / mL (sd = 2.94 x4vg / mL) to 1.69 x6vg / mL (sd = 1.34 x5vg / mL) (Figure 10G).
[0297] Example 7: Testing the “universal plasmid” LW GOI-silencing system with various transgene promoters
[0298] To test the “universal plasmid” LVV GOI-silencing system with various transgene promoters, transfer plasmids were assembled as shown in Figure 9 with either SFFV, EFS or EF-1a promoter driving expression of the GOI (which was destabilised EGFP, i.e. ‘DEGFP’) (SEQ ID NOs: 18-23).
[0299] LVV production was performed by transfection of transfer plasmids into LVV packaging cells. DEGFP expression was monitored throughout production by flow cytometry. This revealed GOI knockdown in all cases (Figure 11 A-C), confirming the function of the universal system with various promoters driving GOI expression. LVV infectious titre was also measured by droplet digital PCR measurement of integrated vector copy number in transduced adherent HEK293T cells. This revealed that silencing DEGFP expression during LVV production resulted in a 42-56% decrease in LVV infectious titre (Figure 11 D). Although the purpose of the GOI-silencing system is to increase LVV production, the lack of an increase in LVV titre was expected in this case as DEGFP is not toxic to the cells, thus there would be no advantage to silencing it. The advantage to silencing toxic GOIs during LVV production has been demonstrated in Example 6.
[0300] Example 8: Testing the effect of integrating anti-CD19 CAR-encoding transfer plasmids into the genome of LW packaging cells
[0301] To generate LVV producer cell lines that utilise the GOI-silencing system, conventional and silenced anti-CD19 CAR-encoding transfer plasmids were integrated into the genome of LVV packaging cells (LVPack13-14 cells) by transposase-mediated integration.
[0302] Integrated cells were cultured in growth media supplemented with antibiotic to which the transfected transfer plasmid encodes resistance, with twice-weekly monitoring of cell count and viability. This revealed that cells transfected / integrated with conventional antiCD 19 CAR-encoding transfer plasmid failed to recover; this is likely to be due to GOI toxicity (Figure 12 A-B). These cells were thus discarded 17 days post-transfection. In contrast, cells transfected with silenced anti-CD19 CAR-encoding transfer plasmid recovered after transfection, indicating that the transfer plasmid can be integrated in the genome of the cell and that the GOI-silencing system can enable the recovery of otherwise non-recoverable producer cell lines (Figure 12 A-B). Specifically, the observation that the cells were able to grow in media supplemented with antibiotic to which the transfected transfer plasmid encodes resistance, long after residual episomally-located plasmid would be expected to have been removed by dilution, indicates that the transfer plasmid was located within the genome of the cell. Notably, prior to 14 days post-transfection, cell cultures were sub-cultured by total media replacement without removal of any cells. After 14 days post-transfection, cells were sub-cultured by dilution of cells with fresh media and partial removal of cells. This alteration in cell subculture regimen is the reason for the rapid cell growth before 14 days, and the subsequent apparent decline in cell growth rate (Figure 12A).
[0303] Next, LVVs were produced by addition of doxycycline to producer cell line cultures. Cell lines encoding silenced anti-CD19 CAR construct produced 4.71 *106TU / mL (sd = 1.70 x105TU / mL) (Figure 12C). Since cell lines encoding conventional anti-CD19 CAR construct failed to recover post-transfection, it was not possible to produce LVVs using such cell lines. This experiment thus demonstrated the successful function of the transfer plasmid when integrated into the genome of the cell.
[0304] Example 9: Testing the performance of the GOI-silencing system in four-plasmid- transfection-based LW production
[0305] The “universal plasmid” (Figure 9) GOI-silencing system was tested in a four-plasmid transfection production modality in suspension HEK293 cells (WXATUS0028 cell line). Cells were transfected with plasmids encoding VSV-G, gag-pol, and Rev, and one of several transfer plasmids, either conventional (with the GOI in the same orientation as the LTRs) or GOI-silencing (Figure 9; SEQ ID NOs: 19, 22, 24 or 25). Either DEGFP or anti-CD19 CAR were used as the GOI. Cell growth and viability were measured at the point of LVV harvest. DEGFP expression level was measured throughout production at 24-hour intervals. Anti-CD19 CAR expression level was measured at the point of LVV harvest.
[0306] The GOI-silencing system caused DEGFP and anti-CD19 CAR knockdown (Figure 13 A-B). Production cell density / viability at harvest did not change when DEGFP was knocked down (Figure 13C-D; p = 0.0511 and 0.8432, respectively). Production cell density / viability at harvest significantly increased when anti-CD19 CAR was knocked down (Figure 13C-D; p = 0.0003 and 0.0003, respectively).
[0307] Next, DEGFP- and anti-CD19 CAR-encoding LVV was titrated by ddPCR measurement of integrated vector copy number in transduced HEK293T cells. This revealed that silencing DEGFP or anti-CD19 CAR resulted in no change to infectious titre (Figure 13E-F; p = 0.4839 and 0.3865, respectively). Although the impacts on LVV production in a four-plasmid production system did not match those in packaging cells, the effects on GOI expression in the two cell lines matched closely. This confirms that the GOI silencing system is functional when the gag-pol, env and rev genes are supplied on one or more further nucleic acid molecules.
[0308] BRIEF DETAILS OF THE SEQUENCES
[0309] SEQ ID NO: 1 - HIV-1 env nucleotide
[0310] SEQ ID NO: 2 - HIV-1 Env amino acid
[0311] SEQ ID NO: 3 - VSV-G nucleotide
[0312] SEQ ID NO: 4 - VSV-G amino acid
[0313] SEQ ID NO: 5 - HIV-1 gag-pol nucleotide
[0314] SEQ ID NO: 6 - HIV-1 rev nucleotide
[0315] SEQ ID NO: 7 - HIV-1 Rev amino acid
[0316] SEQ ID NO: 8 - Apoptosis Inhibitor IAP1
[0317] SEQ ID NO: 9 - Apoptosis Inhibitor EBNA5
[0318] SEQ ID NO: 10 - Apoptosis Inhibitor BCL-XL
[0319] SEQ ID NO: 11 - N-terminal signal peptide from VSV-G
[0320] SEQ ID NO: 12 - Plasmid R2435 sequence (11029 bp)
[0321] SEQ ID NO: 13 - Plasmid R4751 sequence (11029 bp)
[0322] SEQ ID NO: 14 - Plasmid R4875 sequence (11038 bp)
[0323] SEQ ID NO: 15 - Plasmid EP2340 sequence (2789 bp)
[0324] SEQ ID NO: 16 - One-plasmid system
[0325] SEQ ID NO: 17 - Universal gene of interest-silencing system sequence
[0326] SEQ ID NO: 18 - Conventional transfer plasmid with SFFV DEGFP (R6922)
[0327] SEQ ID NO: 19 - Conventional transfer plasmid with EFS DEGFP (R6928)
[0328] SEQ ID NO: 20 - Conventional transfer plasmid with EF-la DEGFP (R6925)
[0329] SEQ ID NO: 21 - Silenced transfer plasmid with SFFV DEGFP (R6924)
[0330] SEQ ID NO: 22 - Silenced transfer plasmid with EFS DEGFP (R6930)
[0331] SEQ ID NO: 23 - Silenced transfer plasmid with EF-la DEGFP (R6927)
[0332] SEQ ID NO: 24 - Conventional transfer plasmid with EF-la anti-CD19 CAR
[0333] (R7016)
[0334] SEQ ID NO: 25 - Silenced transfer plasmid with EF-la anti-CD19 CAR (R7018)
[0335] SEQ ID NO: 26 - Conventional transfer plasmid with EF-la BAX (R7243)
[0336] SEQ ID NO: 27 - Silenced transfer plasmid with EF-la BAX (R7245)
[0337] SEQ ID NO: 28 - Fragment of the PKR gene
[0338] The Sequence Listing filed with this patent application is fully incorporated herein as part of the description.
Claims
CLAIMS1 . A process for producing a retroviral vector comprising a transgene, the process comprising the steps:(A) expressing, in a cell:(a) a first nucleic acid molecule comprising:(i) a first promoter;(ii) a retroviral 5’ LTR;(iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter; and(iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter;(b) a second nucleic acid molecule coding for a second RNA molecule capable of binding to all or part of the first RNA molecule;(c) one or more further nucleic acid molecules expressing retroviral gag-pol, env and rev genes; wherein the cell death response is prevented or inhibited within the cell; under conditions suitable for the production of retroviral vectors comprising (ii), (iii) and (iv); and optionally(B) harvesting the retroviral vectors from the cell or from cell media around the cell.
2. A process as claimed in claim 1 , wherein the retroviral vector is a lentiviral vector.
3. A process as claimed in claim 1 or claim 2, wherein the first promoter is a cytomegalovirus (CMV) promoter or a Rous sarcoma virus (RSV) promoter.
4. A process as claimed in any one of the preceding claims, wherein the second promoter, when present, is selected from the group consisting of the Spleen focusforming virus (SFFV) promoter, elongation factor 1 -alpha 1 (EF-1a) promoter and elongation factor 1 -alpha short (EFS) promoter.
5. A process as claimed in any one of the preceding claims, wherein the transgene encodes a therapeutic polypeptide.
6. A process as claimed in any one of the preceding claims, wherein the second RNA molecule is selected from the group consisting of a short hairpin RNA (shRNA), short interfering RNA (siRNA), microRNA (miRNA) and primary microRNA (pri-miRNA).
7. A process as claimed in any one of the preceding claims, wherein the cell death response is inhibited or prevented by expressing an inhibitor of the endogenous PKR gene or endogenous PKR polypeptide within the cell.
8. A process as claimed in any one of the preceding claims, wherein the first nucleic acid molecule is integrated into the genome of the cell.
9. A process as claimed in any one of claims 1-7, wherein the first nucleic acid molecule and the second nucleic acid molecule are provided together on the same plasmid within the cell, wherein the plasmid additionally comprises: a third nucleic acid molecule coding for a PKR inhibitor, preferably wherein the PKR inhibitor is an anti-PKR RNA molecule which is capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA.
10. A process as claimed in any one of claims 1 -7, wherein(a) the first nucleic acid molecule;(b) the second nucleic acid molecule; and(c) a third nucleic acid molecule coding for a PKR inhibitor, preferably wherein the PKR inhibitor is an anti-PKR RNA molecule which is capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti- PKR shRNA, are all present in the cell and are located on one or more plasmids; and wherein:(i) the first and second nucleic acid molecules are located on the same plasmid;(ii) the first and third nucleic acid molecules are located on the same plasmid;(iii) the second and third nucleic acid molecules are located on the same plasmid; or(iv) the first, second and third nucleic acid molecules are located on the same plasmid.
11. A process as claimed in any one of claims 1 -7, wherein:(a) the first nucleic acid molecule comprises:(i) a first promoter;(ii) a retroviral 5’ LTR;(iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter, wherein the transgene (and first RNA molecule) comprises a 5’ or 3’ untranslated region (UTR) which comprises a fragment of a PKR gene; and(iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter; and(b) the second nucleic acid molecule codes for an anti-PKR RNA molecule, wherein the anti-PKR RNA molecule is capable of binding to both the 5’ or 3’ UTR of the first RNA molecule (i.e. to the portion of the first RNA molecule having the ribonucleotide sequence of the fragment of the PKR gene) and to endogenous PKR mRNA expressed from the cell’s genome.
12. A process as claimed in claim 11 , wherein the first nucleic acid molecule and the second nucleic acid molecule are provided on the same plasmid within the cell.
13. A retroviral transfer plasmid comprising:(a) a first nucleic acid molecule comprising:(i) a first promoter;(ii) a retroviral 5’ LTR;(iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter; and(iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter;(b) a second nucleic acid molecule coding for a second RNA molecule capable of binding to all or part of the first RNA molecule; and(c) a third nucleic acid molecule coding for a PKR inhibitor, preferably coding for an RNA molecule capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA.
14. A retroviral transfer plasmid comprising:(a) a first nucleic acid molecule comprising:(i) a first promoter;(ii) a retroviral 5’ LTR;(iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter, wherein the transgene comprises a 5’ or 3’ untranslated region (UTR) which comprises a fragment of a PKR gene; and(iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter; and(b) a second nucleic acid molecule coding for an anti-PKR RNA molecule, wherein the anti-PKR RNA molecule is capable of binding to both the 5’ or 3’ UTR of the first RNA molecule and a PKR mRNA molecule.
15. A kit comprising:(a) a first nucleic acid molecule comprising:(i) a first promoter;(ii) a retroviral 5’ LTR;(iii) a transgene capable of expressing a first RNA molecule, optionally wherein the transgene is operably-associated with a second promoter; and(iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter;(b) a second nucleic acid molecule coding for a second RNA molecule capable of binding to all or part of the first RNA molecule; and(c) a third nucleic acid molecule coding for a PKR inhibitor, preferably coding for an RNA molecule capable of binding to all or part of a PKR RNA molecule, more preferably wherein the PKR inhibitor is an anti-PKR shRNA;optionally wherein the first, second and third nucleic acid molecules are present on one or more plasmids, and wherein:(i) the first and second nucleic acid molecules are located on the same plasmid;(ii) the first and third nucleic acid molecules are located on the same plasmid;(iii) the second and third nucleic acid molecules are located on the same plasmid; or(iv) the first, second and third nucleic acid molecules are located on the same plasmid.
16. A kit comprising:(a) a first nucleic acid molecule comprising:(i) a first promoter;(ii) a retroviral 5’ LTR;(iii) a transgene capable of expressing a first RNA molecule, (optionally wherein the transgene is operably-associated with a second promoter), wherein the transgene comprises a 5’ or 3’ untranslated region (UTR) which comprises a fragment of a PKR gene; and(iv) a retroviral 3’ LTR; in the above 5’-3’ order; wherein (iii) is in reverse orientation with respect to the first promoter; and(b) a second nucleic acid molecule coding for an anti-PKR RNA molecule, wherein the anti-PKR RNA molecule is capable of binding to both the 5’ or 3’ UTR of the first RNA molecule and a PKR mRNA molecule.
17. A host cell comprising:(A) a retroviral transfer plasmid as claimed in claim 13 or claim 14;(B) first, second and third nucleic acid molecules as defined in claim 15; or(C) first and second nucleic acid molecules as defined in claim 16.
Citation Information
Patent Citations
Viral vector production
WO2018209216A1
Packaging cells with targeted gene knockouts that improve retroviral vector titers
WO2022225973A1
Lentiviral vectors
WO2023062363A1
Retroviral vectors
WO2023062366A1