Vector compositions for guide nucleic acid delivery and uses thereof

Abstract

Provided herein are compositions for delivering a guide nucleic acid and / or a gene editing system to a cell. Various vectors, promoters, guide nucleic acid sequences, self-cleaving peptide sequences, and regulatory elements are disclosed. Methods, compositions, and kits provided herein can be used as biotechnology tools for analyzing genetic interactions, cell phenotyping, single cell genomics, and to deliver guides for gene editing system assays.

Description

VECTOR COMPOSITIONS FOR GUIDE NUCLEIC ACID DELIVERY AND USESTHEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to, and the benefit of U.S. Provisional Application No. 63 / 625,846 filed on January 26, 2024, the contents of which is entirely incorporated herein by reference for all purposes and commonly owned.BACKGROUND

[0002] Cell lineage-specific gene expression, time-efficient enrichment of gRNA- containing cells and the detection of genetic alterations (e.g., point mutations, copy number alterations, insertions and deletions, etc.) in pooled and single-cell CRISPR screens is challenging and extremely costly. Therefore, new compositions and methods of single cell and cell population phenotype analyses are needed to improve the accuracy of detection of genetic alterations, improve gene editing efficiency analysis for therapeutic use, and provide a facile process for cell enrichment and identifying cell lineage-specific differences in gene expression.SUMMARY

[0003] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: an EF-1 alpha (a) promoter; and a first sequence downstream of the EF-1 a promoter that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2.

[0004] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2, wherein N is any nucleotide; and a second sequence downstream of the second sequence encoding a self-cleaving peptide.

[0005] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence encoding a self-cleaving peptide; and a second sequence downstream to the first sequence that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2.

[0006] Provided herein are compositions comprising a vector, wherein the vector comprises a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 3 or SEQ ID NO: 22, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

[0007] Provided herein are compositions comprising a vector, wherein the vector comprises a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 4 or SEQ ID NO: 23, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

[0008] Provided herein are compositions, wherein the compositions comprise: a gene editing system comprising: (a) an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and (b) a lenti viral vector comprising a nucleic acid, wherein the nucleic acid comprises: (i) a sequence that encodes for a protein that is expressed on the surface of a cancer cell; (ii) a guide nucleic acid; and (iii) a barcode. Provided herein are compositions, wherein the cancer cell is a glioblastoma cell.

[0009] Provided herein are compositions, wherein the compositions further comprise a gene editing system enzyme, an endonuclease, a transcriptional activator, a transcriptional repressor, or any combination thereof, or a polynucleotide having a sequence encoding any of the forgoing.

[0010] Provided herein are compositions, wherein the compositions further comprise a catalytically inactive Cas protein fused to a repressor protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the repressor protein.

[0011] Provided herein are compositions, wherein the compositions further comprise a catalytically inactive Cas protein fused to a transcriptional activator protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the transcriptional activator protein.

[0012] Provided herein are compositions, wherein the compositions further comprise a gene editing system.

[0013] Provided herein are gene editing systems, wherein the gene editing systems comprise: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: an EF-1 alpha (a) promoter; and a sequence downstream of the EF-1 a promoter that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2.

[0014] Provided herein are gene editing systems, wherein the gene editing systems comprise: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; and a second sequence downstream the first sequence encoding a self-cleaving peptide.

[0015] Provided herein are gene editing systems, wherein the gene editing systems comprise: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence encoding a self-cleaving peptide; and a second sequence downstream the first sequence that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2.

[0016] Provided herein are cells, wherein the cells comprise: any composition, gene editing system, or nucleic acid provided herein.

[0017] Provided herein are kits, wherein the kits comprise a composition or a gene editing system provided herein, materials and instructions therefor.

[0018] Provided herein are methods, wherein the methods comprise: modifying expression of a transcriptional product in a cell. Provided herein are methods, wherein the methods comprise: contacting the cell with a composition or a gene editing system provided herein, thereby modifying the expression of the transcriptional product in the cell, wherein the transcriptional product is an RNA or a protein.

[0019] Provided herein are methods, wherein the methods comprise tagging a population of cells for isolation. Provided herein are methods, wherein the methods comprise: contacting a population of cells with a composition provided herein and isolating the population of cells that comprise a CD-4 or a CD-90 sequence.INCORPORATION BY REFERENCE

[0020] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0022] FIG. 1 shows a schematic representation of an exemplary guide nucleic acid lentiviral vector comprising an EF 1 promoter, a T2A peptide, a truncated CD-4 sequence (SEQ ID NO: 1), a guide sequence, and barcode. The full-length sequence is provided herein as SEQ ID NO: 22.

[0023] FIG. 2 shows a schematic representation of an exemplary guide nucleic acid vector comprising an EFl promoter, a T2A peptide, a CD-90 sequence, a guide sequence, and barcode. The full-length sequence is provided herein as SEQ ID NO: 23.

[0024] FIG. 3 shows a schematic representation of an exemplary guide nucleic acid vector comprising an EFl promoter, a CD-90 sequence, a T2A peptide a guide sequence, and barcode. The full-length sequence is provided herein as SEQ ID NO: 4.

[0025] FIG. 4 shows a vector map of the lentiviral dCas9 plasmid used to generate dCas9 cell lines. dCas9 KRAB is constitutively expressed under an EFla promoter. Puromycin was used to select for transduced cells.

[0026] FIG. 5 shows a schematic representation of an exemplary guide nucleic acid vector comprising an EFl promoter, a CD-4 sequence, a T2A peptide a guide sequence, and barcode. The full-length sequence is provided herein as SEQ ID NO: 3.

[0027] FIG. 6 shows a schematic and flow cytometry graphs confirming transduction and expression of the lentiviral vectors. Left side: Schematics of the vectors, right side: flow cytometry graphs. X- axis: 488 (positive) or 525 (negative) fractions. Y-axis: cell count.

[0028] FIG. 7 shows a cumulative frequency graph showing the percentage of guide- UMTs with a count greater than the value on the x-axis. The dashed line represents 5 counts, with the percentage of guide-UMTs stabilizing across count values higher than 5.

[0029] FIG. 8 shows a graphs of GFP-percentages for 24 GBM cell lines before (preMACS - light grey) and after (postMACS - dark grey) MACS enrichment for CD90 expressing cells during a genome-wide CRISPRi screen.

[0030] Various aspects now will be described more fully hereinafter. Such aspects may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey its scope to those skilled in the art.DETAILED DESCRIPTION OF THE INVENTION

[0031] Provided herein are compositions, methods, and kits for use in the perturbation and cell enrichment of cells that that have been contacted with a gene editing system. Further provided herein are compositions, methods, and kits, for use in the detection of a genetic perturbation, a genetic alteration, an agent, and / or the presence or absence of a barcode (e.g., molecular tag, barcode, or unique molecular tag sequence) in a cell or subpopulations of cells. The methods provided herein can be used to resolve genetic diversity and correlate perturbation and underlying genetics to aid therapeutic target discovery.Definitions

[0032] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some embodiments, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0033] Throughout this application, various embodiments may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0034] As used in the specification and claims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a sample” includes a plurality of samples, including mixtures thereof.

[0035] The terms “determining”, “measuring”, “evaluating”, “assessing”, “assaying”, “analyzing” and their grammatical equivalents are often used interchangeably herein to refer to forms of measurement and include determining if an element may be present or not (for example, detection). These terms can include quantitative, qualitative or quantitative, and qualitative determinations. Assessing can be alternatively relative or absolute. “Detecting the presence of’ or “identifying the presence of’ are used interchangeably to include determining the amount of something present (e.g. , a genetic perturbation, a genetic alteration, or a barcode provided herein), as well as determining whether it may be present or absent.

[0036] As used herein, the term “about” a number refers to that number plus or minus: 1%, 2%, 5%, or 10% of that number. The term ‘about’ a range can refer to that range minus: 1%, 2%, 5%, or 10% of its lowest value and plus 10% of its greatest value.

[0037] The terms “barcode” or “unique molecular tag” or “UMT” can be used interchangeably herein to refer to a sequence of nucleotides (for example, DNA or RNA) that are used as an identifier for an associated nucleic acid sequence or as an identifier of the source of anassociated molecule, such as a cell-of-origin. A barcode can also refer to any unique nucleic acid sequence, which can be non-naturally occurring- which can, for example, mean not naturally present in a cell, not found in nature, or any combination of these, where the barcode can be used to identify the originating source of a polynucleotide sequence in a cell, or a cell. In some embodiments, a barcode is a random set of nucleotides. In some embodiments, the barcodes comprise random nucleotides, semi-random nucleotides, or a combination of random and non- random nucleotides. In some embodiments, a barcode is predetermined from a library of barcodes. A library of barcodes includes a collection of stored nucleic acid sequences with associated information. Each sequence and the associated information in the library are stored in a database with information such as e.g., the sequence, pattern, cell type, cell subpopulation, promoter type, label type, genetic alteration type, cell group assignment, or epigenetic status. In some embodiments, a barcode comprises at least about 4 nucleobases, at least about 5 nucleobases, at least about 6 nucleobases, at least about 7 nucleobases, at least about 8 nucleobases, at least about 9 nucleobases, or at least about 10 nucleobases in length, whereby each nucleobase can be any of the 4 nucleobases (e.g., adenine (A), guanine (G), cytosine (C), or thymine (T) and / or a modified nucleobase thereof. In some embodiments, a barcode comprises at least about 4 nucleotides, at least about 5 nucleotides, at least about 6 nucleotides, at least about 7 nucleotides, at least about 8 nucleotides, at least about 9 nucleotides, or at least about 10 nucleotides in length, whereby each nucleotide can comprise any of the 4 nucleobases (e.g., adenine (A), guanine (G), cytosine (C), or thymine (T) and / or a modified nucleobase thereof. In some embodiments, a barcode comprises a sequence (N)x, wherein N is any nucleobase or nucleotide and x is a number between 1 and 10. In some embodiments, a barcode comprises a sequence of NNNN, NNNNN, or NNNNNN. In some embodiments, the barcode comprises 6 nucleobases or nucleotides and / or a modified nucleobase or nucleotide thereof.

[0038] An alteration can be any change in a polynucleotide. For example, a change in a polynucleotide can occur when a molecule associates with, hybridizes to, or intercalates into a polynucleotide or a double stranded polynucleotide. For example, a non-covalent binding (e.g., van der Waals interactions, hydrogen bonding, base pairing, wobble base pairing, base stacking) of an agent or a composition provided herein, such as: an interfering RNA to a polynucleotide, a protein, or a fragment thereof, an antibody or a fragment thereof, an aptamer, an enzyme, or a de- activated enzyme, is an example of an alteration. In some instances, a protein which can be a CRISPRi protein can bind to the polynucleotide. Similarly, the introduction of a CRISPR system can result in sequential alterations. The first can be binding of a guide nucleic acid to the polynucleotide. The second can be, when capable of being facilitated by the guide nucleic acid anda biologically active protein (e.g., Cas9), covalent modification of the polynucleotide following binding of the guide to the polynucleotide. In some instances, an alteration results in a chemical modification of a polynucleotide or a double stranded polynucleotide. Alterations can include chemically modified base of a nucleotide of a polynucleotide (e.g., adding a methyl, hydroxymethyl, formyl, or carboxyl group to the base of the polynucleotide, or hydrolyzing an amino group of an adenosine to form an inosine), a chemically modified sugar of a base of a polynucleotide (e.g. , replacing a hydroxyl group with a hydrogen or a methoxy group or a fluorine atom, or forming a locked nucleic acid), or altering a phosphate group or a phosphodiester bond (e.g., to replace phosphorus with sulfur or to replace an oxygen with sulfur). Chemical modification is meant to illustrate changes that can occur on one or more nucleotides of the polynucleotide and is not limited in the way the modification is enacted. For example, a chemical modification such as addition of a methyl epigenetic mark can be affected by an enzyme or a biologically active fragment thereof (e.g, Dmntl). Individual nucleotides of a polynucleotide can be independently chemically modified. In some embodiments, chemical modification and covalent modification are used interchangeably. Other exemplary agents that can cause alterations include ethidium bromide, radiation, and enzymes that introduce, alter, or remove epigenetic marks. An alteration to a polynucleotide can include a genetic alteration, for example, an alteration in a coding region of the polynucleotide (e.g., an alteration in an exon). Alterations in a polynucleotide can occur in non-coding regions, including, for example, introns and promoters. In some instances, an alteration to a polynucleotide results in a chemical modification to the polynucleotide.

[0039] The term “perturbation” refers to any intentionally introduced or targeted alteration of a polynucleotide. Thus, alterations encompass intentional changes (perturbations) to a polynucleotide, or for example, using a CRISPR-Cas system to add a nucleotide or delete a nucleotide at a pre-determined nucleic acid of a polynucleotide, or binding or hybridizing an interfering RNA to a target RNA represent examples of perturbations because these make targeted changes to a target nucleotide or a fragment thereof. As another example, a CRISPRi or a CRISPRa system can be used to perturb a specific gene sequence by modulating the expression of the RNA or protein encoded by the gene. In some instances, a perturbation, an alteration, or both, can independently occur on the same polynucleotide or on two different polynucleotides. For example, a targeted edit of a polynucleotide by a CRISPR-Cas system is a perturbation and an alteration, but an off-target edit resulting from the same CRISPR-Cas system is an alteration but not a perturbation.

[0040] As used herein, the term “reference sequence”, can be used to refer to a known nucleotide sequence, e.g., a chromosomal region whose sequence is deposited at NCBFs Genbankdatabase or other databases. A reference sequence can be a wild-type sequence. In some embodiments, a reference sequence can be a nucleotide sequence obtained from a healthy individual or a group of healthy individuals without a disease or condition.

[0041] A “downstream effect” is any resulting change in a cell arising directly or indirectly from an alteration, a perturbation, or both. For example, a targeted deletion of a nucleotide from a polynucleotide (perturbation) can result in a frameshift resulting in a transcribed RNA that may be converted to an mRNA which codes for a non-functional protein after being translated. In this example, the altered coding sequence of the mRNA and the translation of the mRNA to a non- functional protein and any loss of function resulting from loss of the functional protein, are each effects of the perturbation. In some instances, a downstream effect can be a phenotypic change in a cell, a tissue, an organ, a system, or an organism. In some instances, a downstream effect can include altered levels of mRNAs and / or protein.

[0042] An “agent” provided herein can be any substance (e.g., a chemical, a gene editing system or a component thereof, an alkylating molecule, a nucleic acid, an exogenous polynucleotide that encodes a protein, a plasmid, a vector, a viral vector, a pharmaceutical composition, a protein, an aptamer, a Dmnt, an enzyme, an enzyme inhibitor, a ligand that binds to a receptor or an enzyme, an interfering RNA, a dead Cas enzyme, a CRISPRi enzyme, a mutagen, a repressor, or an enhancer element) or energy (e.g., radiation, X-rays, ultraviolet rays, gamma rays, beta rays, electricity, or heat), an environmental change (e.g., cooling, altering a nutrient or nutrient-supplemented medium), or any combination of these which can be exogenous to a cell, tissue, organ, system, or organism that causes or affects an alteration, a perturbation, or both. In some embodiments, the agent is used to generate a perturbation. In some embodiments, the agent is a test agent (e.g., a prospective therapeutic agent).

[0043] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.Compositions and Vectors

[0044] Provided herein are compositions comprising a vector. In some embodiments, the vector is a lentiviral vector, an adenovirus vector, an adeno-associated viral (AAV) vector, achimeric viral vector, a retroviral vector, a Newcastle disease viral vector, an alphaviral vector, a minicircle vector, or a bacteriophage vector (e.g, M13 bacteriophage). In some embodiments, the vector is a lentiviral vector. In some embodiments, the lentiviral vector comprises a nucleic acid sequence coding a CD-4, a CD-90, a truncated form of CD-4 or CD-90, or a variant thereof.

[0045] Provided herein are compositions comprising a nucleic acid sequence coding a modified CD-4 sequence. In some embodiments, the modified CD-4 sequence is truncated, comprises a deletion of the sequence encoding the C-terminal region, or comprises a mutation. In some embodiments, the modified CD-4 sequence comprises a sequence that is at least 85% identical to SEQ ID NO: 1. In some embodiments, the modified CD-4 sequence comprises a sequence that is at least 90% identical to SEQ ID NO: 1. In some embodiments, the modified CD- 4 sequence comprises a sequence that is at least 95% identical to SEQ ID NO: 1. In some embodiments, the modified CD-4 sequence comprises a sequence that is at least 99% identical to SEQ ID NO: 1. In some embodiments, the modified CD-4 sequence comprises SEQ ID NO: 1.

[0046] Provided herein are compositions comprising a nucleic acid sequence coding a modified CD-90 sequence. In some embodiments, the modified CD-90 sequence is truncated, comprises a deletion of the sequence encoding the C-terminal region, or comprises a mutation. In some embodiments, the modified CD-90 sequence comprises a sequence that is at least 85% identical to SEQ ID NO: 2. In some embodiments, the modified CD-90 sequence comprises a sequence that is at least 90% identical to SEQ ID NO: 2. In some embodiments, the modified CD- 90 sequence comprises a sequence that is at least 95% identical to SEQ ID NO: 2. In some embodiments, the modified CD-4 sequence comprises a sequence that is at least 99% identical to SEQ ID NO: 1. In some embodiments, the modified CD-90 sequence comprises SEQ ID NO: 2.

[0047] Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 3 or SEQ ID NO: 4. Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 3 and SEQ ID NO: 4. Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 3 and SEQ ID NO: 4. Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 3 and SEQ ID NO: 4. Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is 100% identical to SEQ ID NO: 3 and SEQ ID NO: 4. Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 22 or SEQ ID NO: 23. Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 22 and SEQ ID NO: 23. Provided herein is a composition comprising avector comprising a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 22 and SEQ ID NO: 23. Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 22 and SEQ ID NO: 23. Provided herein is a composition comprising a vector comprising a nucleic acid sequence that is 100% identical to SEQ ID NO: 22 and SEQ ID NO: 23.

[0048] Provided herein are compositions and vectors comprising a CD-4 and / or a CD-90 sequence in combination with one or more additional nucleic acid sequences. Non-limiting examples of additional nucleic acid sequences include those coding or encoding for: a self-cleaving peptide (e.g., a T2A), an EF-1 alpha (EF-la) promoter, a bacterial resistance gene, a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), Rev Response Element (RRE), a CAP binding site, a lac promoter, a lac operator, an M13 rev site, a T3 promoter, an RSV promoter, an HIV-1 Psi element, central polypurine tract / central termination sequence (cPPT / CTS), a fluorescent protein, a U6 promoter, an SV -40 polyA signal, a restriction enzyme site, a Kozak sequence, a cell marker sequence, a cell-type specific promoter sequence, a barcode, variants, and / or combinations thereof. In some embodiments, the compositions provided herein comprise a sequence that is at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 5 or SEQ ID NO: 6.

[0049] In some embodiments, the compositions, vectors, or lentiviral vectors provided herein comprise a nucleic acid sequence that is at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to a sequence listed in Table 1. In some embodiments, the compositions, vectors, or lentiviral vectors provided herein comprise two or more nucleic acid sequences that are each at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to a sequence listed in Table 1. In some embodiments, the compositions, vectors, or lentiviral vectors provided herein comprise SEQ ID NO: 1 and a sequence that is at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to a sequence listed in Table 1. In some embodiments, the compositions, vectors, or lentiviral vectors provided herein comprise SEQ ID NO: 2 and a sequence that is at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to a sequence listed in Table 1.Table 1. Nucleic acid Sequences.

[0050] Provided herein are compositions, vectors, and lentiviral vectors comprising a nucleic acid sequence coding a guide nucleic acid. In some embodiments, the guide nucleic acid is DNA. In some embodiments, the guide nucleic acid is RNA (gRNA). In some embodiments, the guide nucleic acid comprises sequence coding both DNA and RNA segments. In some embodiments, the guide nucleic acid comprises secondary or tertiary structure that recruits an enzyme to bind to the nucleic acid. In some embodiments, the enzyme is a gene editing system enzyme.

[0051] Provided herein are compositions comprising a gene editing system enzyme, a transcriptional repressor, or a transcriptional activator or a polynucleotide having a sequence that encodes any of the foregoing. In some embodiments, the gene editing system comprises: a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / Cas system, a catalytically inactive endonuclease, a Transcription Activator-Like Effector Nucleases (TALENS), a transposon system (e.g., Sleeping Beauty), a zinc finger nuclease (ZFN), a meganuclease, a fusion protein, a derivative, a variant, or a mutant thereof. In some embodiments, the gene editing systemis a CRISPR system. A CRISPR system can comprise an endonuclease and one or more guide RNAs. In some embodiments, the endonuclease is selected from the group consisting of: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl l, Casl2, Casl3, Casl4, Csyl , Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, CsxlS, Csfl, Csf2, CsO, Csf4, Cpfl, c2cl, c2c3, and Cas9HiFi. In some embodiments, an endonuclease induces a genetic perturbation in a target nucleic acid sequence.

[0052] In some embodiments, the composition further comprises a Cas protein. In some embodiments, the Cas protein is catalytically inactivated. In some embodiments, the Cas protein is fused with or linked to a transcriptional repressor protein. In some embodiments, the Cas protein is fused with or linked to a transcriptional activator protein. In some embodiments, the composition further comprises a cell.Methods of introducing a genetic perturbation in a nucleic acid

[0053] Provided herein are methods of introducing a genetic perturbation in a nucleic acid sequence, a cell, or a population of cells. Also provided herein are methods of detecting a vector provided herein in a cell. The detecting can be used for cellular reprogramming, differentiation, or for isolation of cell populations and their subtypes. In some embodiments, a perturbation is generated or introduced by contacting a cell with a composition provided herein. In some embodiments, the perturbation comprises a single nucleotide polymorphism, one or more nucleobase substitutions, one or more nucleotide substitutions, a deletion, a double strand break in a target gene, an insertion (e.g., of a transgene), methylation, RNA silencing, gene overexpression or repression, or any combination thereof. In some embodiments, the guide nucleic acid is a guide ribonucleic acid (gRNA). In some embodiments, the gene editing system comprises a CRISPR protein such as a Cas enzyme or a variant thereof. In some embodiments, the Cas enzyme is a deactivated Cas enzyme. In some embodiments, the Cas enzyme is a Casl Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl l, Casl2a, Casl3 or any combination thereof. In some embodiments, the compositions provided herein generate a genetic perturbation or a genetic alteration in an endogenous nucleic acid of a cell or cellular genome.

[0054] In some embodiments, the compositions provided herein further comprise: a chemical, a protein, an antibody or an antibody fragment, a nucleic acid, a plasmid, a vector, a viral vector, a transcriptional regulator, a nucleic acid encoding a transcriptional regulator, a gene editing system, a nucleic acid encoding a gene editing system, a nucleic acid encoding a guide nucleic acid (e.g., a guide RNA), or an interfering RNA (RNAi). In some embodiments, the RNAicomprises a silencing RNA (siRNA), a small hairpin RNA (shRNA), a microRNA (miRNA). The agents and compositions provided herein can be formulated for delivery to a cell, population of cells, or a tissue. In some embodiments, the compositions provided herein are in complex with a carrier (e.g., a nanoparticle, a liposome, an extracellular vesicle, or a lipid carrier). In some embodiments, the vectors provided herein are encapsulated by a carrier. In some embodiments, the compositions provided herein comprise a vector comprising a nucleic acid, a guide nucleic acid, a gene editing system, or any combination thereof.

[0055] A database can be used to identify regions of a target nucleic acid sequence that are permissive to genetic engineering depending on the method of editing. For example, a database can be ENCODE (encyclopedia of DNA Elements) (available on the world wide web at genome.gov / 10005107), CHOP tool (available on the world wide web at chopchop.cbu.uib.no), GenomeCRISPR (available on the world wide web at genomecrispr.org), the Basic Local Alignment Search Tool (BLAST) (available on the world wide web at blast.ncbi.nlm.nih.gov / Blast.cgi), or the Sanger Institute Genome Editing (WGE) (available on the world wide web at wge.stemcell.sanger.ac.uk).

[0056] Targeted genetic perturbations can begin from the generation of nuclease-induced double -stranded breaks (DSBs) or single stranded breaks, that lead to the stimulation of highly efficient recombination mechanisms of cellular DNA in mammalian cells. Double strand breaks are introduced into a cell using one or more endonucleases (e.g., S. pyrogenes Cas9 deoxyribonucleic acid (DNA) endonuclease) and one or two nucleic acid guide sequences to affect a pair of double-strand breaks (DSBs). In some embodiments, the gene editing system comprises one or more guide nucleic acid. In some embodiments, one or more guide nucleic acid comprises an RNA, a DNA, or a combination thereof. In some embodiments, the one or more guide nucleic acid is a DNA-RNA hybrid.

[0057] In some embodiments, targeting of the genetic perturbation is determined by identifying where a protospacer adjacent motif (PAM) sequence is located in a target sequence. The PAM sequence is capable of hybridizing to a portion of a guide nucleic acid sequence. For example, a genetic perturbation can be within about 20 base pairs, about 10 base pairs, about 5 base pairs, about 3 base pairs, or about 2 base pairs from a protospacer adjacent motif (PAM) sequence. A PAM can be a nucleotide sequence within a gene, genome, or chromosome that is targeted by a guide RNA. The site of cleavage by an RNA-guided nuclease is within a protospacer sequence or adjacent to the sequence. For example, when a guide RNA sequence targets a specific protospacer, the Cas protein will generate a double strand break within the protospacer sequence, thereby cleaving the protospacer and disrupting the target gene sequence. Following cleavage,disruption of the protospacer can result though non-homologous end j oining (NHEJ) or homology- directed repair (HDR). Disruption of the protospacer can result in the deletion of the protospacer and / or target gene. Additionally, or alternatively, disruption of the protospacer can result in an exogenous nucleic acid sequence being inserted into the protospacer or replacing the protospacer sequence.

[0058] In some embodiments, the methods comprise contacting a population of cells with a CRISPR interference (CRISPRi) system or a CRISPR activation (CRISPRa) system. In some embodiments, the CRISPRi system comprises a catalytically dead or deactivated endonuclease enzyme (e.g., a dead Cas9 or dCas9) fused to one or more repressor proteins (e.g., SALL1 or SDS3). In some embodiments, the CRISPRi system further comprises a guide RNA, wherein the guide RNAs binds to a target sequence of a polynucleotide that is upstream or downstream of a transcriptional start site (e.g., within 50 base pairs). The guide in a CRISPRi system can associate the enzyme-repressor protein fusion protein and direct the repressor domain of the protein to the target sequence in a polynucleotide, thereby inhibiting transcription of the polynucleotide. In some embodiments, the CRISPRa system comprises a catalytically dead or deactivated endonuclease enzyme (e.g., dCas9) fused to a transcriptional activator (e.g., Vp64). In some embodiments, the CRISPRa system comprises a guide RNA. In some embodiments, the guide RNA of the CRISPRa system binds to a target sequence in a polynucleotide, wherein the target sequence is upstream of a promoter or the transcriptional start site. The guide in a CRISPRa system can associate the enzyme-activator fusion protein domain of the fusion protein to the target activation sequence in a polynucleotide, thereby activating transcription of the polynucleotide. In some embodiments, the presence of a guide RNA sequence in a cell, indicates that the cell comprises a genetic perturbation that was introduced by the guide RNA.Methods of determining the effect of a genetic perturbation

[0059] Provided herein are methods of determining the effect of a genetic perturbation described herein on a cell or a subpopulation of cells (e.g., a downstream effect). In some embodiments, a cell or a population of cells comprise a genetic perturbation. In some embodiments, a cell or a population of cells comprise a genetic alteration. In some embodiments, the genetic perturbation is introduced in a target polynucleotide by a composition or gene editing system provided herein. In some embodiments, the methods provided herein comprise: (a) isolating nucleic acids from a single cell of the mixed population of cells to obtain isolated nucleic acids, optionally, isolating RNA from the single cell and reverse transcribing the RNA to cDNA; (b) identifying the presence or the absence of the barcode in the cell, wherein the identifyingcomprises sequencing DNA and / or cDNA, thereby obtaining determined data; (c) processing the determined data from each single cell of the mixed population of cells into groups, wherein each group is assigned to a group according to the barcode, thereby forming aggregated data; and (d) processing the aggregated data for the presence or absence of a genetic alteration in each group from step (c), thereby identifying the presence or absence of a genetic alteration in a subpopulation of cells in a mixed population of cells. In some embodiments, steps (a)-(d) are performed consecutively. In some embodiments, the methods further comprise: (i) a step of quantifying a level of expression of a gene relative to a reference in the mixed population of cells; (ii) assigning each cell to a group according to the level of expression of a gene relative to a reference in the mixed population of cells; or (iii) both (i) and (ii).

[0060] Provided herein are methods of characterizing a subpopulation of cells within a mixed population of cells. In some embodiments, the methods comprise (a) contacting a mixed population of cells with a composition provided herein that modulates a target nucleic acid in a cell within the mixed population of cells, thereby introducing a genetic perturbation in a target nucleic acid sequence; (b) contacting the mixed population of cells with a plurality of barcode sequences or a plurality of molecular tagging compositions that comprise a barcode sequence; (c) culturing the mixed population of cells for a period of time that permits a cellular division; (d) isolating DNA from the mixed population of cells or isolating RNA from the mixed population of cells and reverse transcribing the isolated RNA to cDNA; (e) sequencing the DNA and / or cDNA, thereby obtaining determined data; (f) processing the determined data from each single cell of the mixed population of cells into groups, wherein each group is assigned to a group according to the barcode sequence, the genetic perturbation introduced by the composition or gene editing system, and / or a genetic alteration, thereby forming aggregated data; and (g) identifying the number of cells that comprise: (i) the barcode sequence; (ii) the genetic alteration; (iii) the genetic perturbation; or (iv) a combination thereof, thereby characterizing a subpopulation of cells. In some embodiments, steps (a) and (b) occur consecutively. In some embodiments, steps (a) and (b) occur concurrently.

[0061] The methods provided herein can be used to determine the gene editing efficiency of a gene editing system. Provided herein are methods of quantifying gene editing efficiency of a gene editing system, where the methods comprise contacting a mixed population of cells with a gene editing system or a nucleic acid encoding a gene editing system to introduce a genetic perturbation in the genome of a cell or a subpopulation of cells within a mixed population of cells; and contacting the mixed population of cells with one or more barcodes.

[0062] In some embodiments, the methods comprise isolating nucleic acids, culturing a plurality of subpopulations of cells in a first cell culture medium for a period of time and contacting each subpopulation of cells separately with the barcode, wherein each subpopulation of cells comprises a different barcode. In some embodiments, the method further comprises a step of admixing the subpopulations of cells in a second cell culture medium for a period of time.

[0063] In some embodiments, the methods provided herein comprise culturing a population of cells for a period of time. In some embodiments, the period of time is at least about 24 hours (1 day), at least about 48 hours (2 days), at least about 72 hours (3 days), at least about 96 hours (4 days), at least about 120 hours (5 days), at least about 144 hours (6 days), at least about 168 hours (7 days), at least about 336 hours (14 days), at least about 504 hours (21 days), at least about 672 hours (28 days), up to 744 hours (31 days) or a period of time that permits a cell division of a subpopulation of cells in the mixed population of cells.

[0064] In some embodiments, the methods further comprise counting the number of viable cells in each subpopulation.

[0065] In some embodiments, the mixed population of cells comprise: prokaryotic cells, eukaryotic cells, or both. In some embodiments, the mixed population of cells comprise: a tissue, a clonal cell population, a population of cells isolated from a subject, a population of genetically modified cells, a population of dissociated cells, a population of cells that have been contacted with an agent or a composition provided herein, a population of in vitro-differentiated cells, a population of stem cells, a population of fibroblasts, a population of blood cells, a population of immune cells, a population of tumor cells isolated from a subject, or any combination thereof. In some embodiments, the mixed population of cells comprise mammalian cells. In some embodiments, the mammalian cells comprise human cells.

[0066] In some embodiments, the methods comprise isolating nucleic acids from the mixed population of cells; isolating DNA from the mixed population of cells or isolating RNA from the mixed population of cells and reverse transcribing the isolated RNA to cDNA. In some embodiments, the methods comprise a step of amplifying the isolated DNA or the isolated cDNA to form amplicons. Methods of forming amplicons, include, e.g., polymerase chain reaction techniques.

[0067] In some embodiments, the methods comprise identifying the presence or the absence of a barcode in the cell. In some embodiments, the isolating step and the identifying steps are conducted on a cell-by-cell basis. The barcode can be identified by sequencing to obtain determined data, sequencing the plurality of tagged nucleic acid molecules or derivatives thereof to generate sequence reads, wherein the sequence reads comprise the sequence of the nucleic acidmolecule and the sequence of the associated barcodes. In some embodiments, the methods comprise aligning the sequence reads to a reference sequence wherein the starting position and ending position of the sequence of the nucleic acid molecule from which the reads are derived can be determined. In some embodiments, the aligning is performed by a computer implemented method, wherein the reference sequence provides a sense strand and an anti-sense strand information. In some embodiments, the methods comprise determining which reference sequence the sequence reads align to in a library of reference sequences. In some embodiments, the methods comprise identifying reads with the same barcode that can be assigned to the same cell lineage via the genetic alteration, the composition, the barcode, or the genetic perturbation introduced by a gene editing system provided herein. In some embodiments, the methods comprise determining a count number of the nucleic acids that have been genetically altered and / or comprise a barcode. In some embodiments, the sequence can be aligned to the same reference sequence location by a computer implemented method.

[0068] In some embodiments, the methods comprise processing the determined data from each single cell of the mixed population of cells into groups, wherein each group is assigned to a group according to a barcode, wherein the barcode in each group is distinct from a barcode in a different group, thereby forming aggregated data. In some embodiments, the methods comprise processing the aggregated data for the presence or absence of a genetic perturbation in each group. In some embodiments, the methods comprise processing the aggregated data for the presence or absence of a sequence or nucleic acid provided herein in each group. In some embodiments, the methods comprise quantifying the number of cells that comprise a barcode, some embodiments, the methods comprise processing the aggregated data for the presence or absence of a genetic alteration in each group. In some embodiments, the methods comprise quantifying the number of cells that comprise a CD-4 sequence, a CD-90 sequence, a barcode sequence, a guide sequence, and / or a genetic perturbation. In some embodiments, the methods comprise quantifying the number of cells that comprise both a genetic alteration and a barcode. In some embodiments, the methods comprise quantifying the number of cells that comprise both a genetic perturbation and a barcode. In some embodiments, the methods comprise quantifying the number of cells that comprise: (a) a guide nucleic acid sequence, a CD-4 sequence, a CD-90 sequence, a fluorescent protein; and (b) a barcode. In some embodiments, the methods comprise quantifying the number of cells that comprise a genetic perturbation, a genetic alteration, an agent, a barcode, a downstream effect, or any combination thereof. In some embodiments, the methods comprise quantifying the percentage of cells that comprise the barcode and the agent or the genetic alteration relative to the populationof cells that have the same barcode and do not comprise the agent or the genetic alteration, thereby quantifying the gene editing efficiency of the gene editing system.

[0069] In some embodiments, the gene editing system comprises a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / Cas system. In some embodiments, the CRISPR / Cas system comprises one or more guide nucleic acid and an endonuclease selected from the group consisting of: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Cas 11, Cas 12, Casl3, Casl4, Cbfl, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Cpfl (or Cas 12a), Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, C2cl, C2c2, C2c3, Csyl, Csy2, homologs, fusions, and variants thereof. In some embodiments, the endonuclease is catalytically inactivated (also referred to herein as a dead or deactivated endonuclease (e.g., a dead Cas enzyme). In some embodiments, the gene editing system introduces a genetic perturbation in a cell. In some embodiments, the gene editing system further introduces a genetic alteration in a cell. In some embodiments, the genetic alteration is an off-target effect of the gene editing system. In some embodiments, genetic alteration is an indirect effect of gene editing. In some embodiments, the genetic perturbation comprises an insertion, a deletion, a change in copy number, a point mutation, a missense mutation, a nonsense mutation, a mutation in a stop codon, an epigenetic mark, a reduction in gene expression, an overexpression of a gene, or any combination thereof. In some embodiments, the genetic perturbation or the genetic alteration is comprised in an oncogene. In some embodiments, the agent that introduces the genetic perturbation is comprised in a promoter.

[0070] In some embodiments, the methods comprise a step of identifying the subpopulation or subpopulations of cells that comprise a genetic alteration induced by the gene editing system and an agent. In some embodiments, the methods comprise counting the number of viable cells in each subpopulation after the cells have been contacted with an agent or a gene editing system.

[0071] In some embodiments, the methods comprise a step of quantifying a level of expression of a gene relative to an appropriate control. In some embodiments, a level of expression of a gene is determined by determining a number of DNAs, RNAs, cDNAs, or any combination thereof.

[0072] In some embodiments, the processing steps are performed by computer or a device comprising a processor and a computer readable memory.Kits

[0073] Provided herein are kits for labeling a cell with a barcode, identifying a cell with a barcode, introducing a genetic perturbation, identifying a genetic perturbation or a genetic alteration, and any combination of methods provided herein. A kit can comprise a unit that comprises a barcode sequence, and / or a molecular tagging composition provided herein. In some embodiments, the kit comprises guide nucleic acids, in some embodiments, the kit comprises a gene editing system, an a catalytically inactive endonuclease, one or more guide nucleic acids, transcriptional repressors, transcriptional activators, or fusion proteins. In some embodiments, the kit comprises a unit comprising a reagent for carrying out nucleic acid isolation. In some embodiments, the kit comprises reagents for RNA isolation and reverse transcription reactions. In some embodiments, the kit comprises cell culture medium. In some embodiments the kit comprises reagents for sequencing nucleic acids. In some embodiments, the kit comprises a tag, adapter sequences, a set of primers, and / or an affinity probe.

[0074] In some embodiments, a molecular tagging composition described provided herein is prepared in a single container for contacting a plurality of cells. In some embodiments, a composition provided herein is prepared in two containers, separating the nucleic acid construct from the barcodes. As used herein, “container” includes vessel, vial, ampule, tube, cup, box, bottle, flask, jar, dish, well of a single-well or multi -well apparatus, reservoir, tank, or the like, or other device in which the herein disclosed compositions may be placed, stored and / or transported, and accessed to remove the contents. Examples of such containers include glass and / or plastic sealed or re-sealable tubes and ampules. In some embodiments, the containers are RNase free and / or DNase free.

[0075] In some embodiments, the barcodes provided herein, and the gene editing system or components thereof are in different vectors. In some embodiments, the barcode and the gene editing system provided herein are in different containers.Biotechnology and clinical applications

[0076] The compositions, methods, and kits provided herein can be used for various biotechnology and clinical applications. The methods provide here can be used for drug target discovery, evaluating gene editing system, gene silencing system, or gene activating system efficiency for their use in clinical applications. The methods and compositions provided herein can also be used to evaluate the effects of an agent on a subpopulation of cell within a mixed population of cells.

[0077] Provided herein are methods of labeling or tagging a cell or a subpopulation of cells within a mixed population of cells. The combination of a sequence provided herein and barcodeintegration within a cell or population of cells as determined by a single-cell sequencing assay can provide information on the effects of a perturbation on a genetic profde of a cell and also be used to enrich a specific subpopulation of cells that comprise the perturbation. In some embodiments, the methods comprise contacting a cell, a subpopulation of cells, or a mixed population of cells with a composition provided herein, a vector provided herein, and / or a barcode provided herein, thereby labeling or tagging the cell, the subpopulation of cells, or the mixed population of cells with a label. The method of labeling / tagging can be used to track single cells within a mixed population of cells, group cells into subpopulations using the unique barcode sequences, and identify the presence or absence of a unique barcode in combination with one or more of: an agent, a genetic perturbation, a genetic alteration, a downstream effect, or a combination thereof. The cells can be from any source, for example, an animal or a human. In some embodiments, the cells are mammalian cells. In In some embodiments, the cells are cancer cells, neurons, immune cells (e.g., T cells, macrophages, Natural Killer cells, B cells, or dendritic cells), cardiomyocytes, muscle cells, gastrointestinal cells, endothelial cells, hepatocytes, or stem cells. In some embodiments, the cells are genetically engineered to comprise a perturbation provided herein.

[0078] Provided herein are methods for single-cell sequencing. In some embodiments, the methods provided herein permit single cell tracking to their original starting populations. In some embodiments, the cells are tracked using a barcode provided herein that is linked to information that can then be used to group cells by their starting population, forming pseudo-bulk populations. Single cells within these pseudo-bulk populations can be used to define the characteristics of the entire population. The pseudo-bulk populations can be used to identify specific groups of cells that are responsive to a particular agent (e.g., a therapeutic agent, a composition provided herein, or a gene editing system). For example, if a mutation is detected in one or more single cells (but not all) from a particular pseudo-bulk population, the method identifies cells within the population that have the alteration and the unique barcode sequence. This approach is useful for a number of clinical applications, including but not limited to tumor staging, analysis of tumor cell heterogeneity, and analysis of anti-cancer agents that are intended to reduce the proliferation of a subpopulation of cancer cells or reduce vascularization of a tumor.

[0079] Provided herein are methods for introducing a genetic perturbation in a cell. When introducing a genetic perturbation in a population of cells (for example, via CRISPR / Cas system- induced gene inactivation) single-cell RNA-sequencing is performed to determine the impact of a given genetic perturbation and characterize downstream signaling or genetic alterations that arise from the genetic perturbation. After contacting a population of cells with a composition provided herein, cells are allowed to proliferate for a period of time (e.g., 7 to 10 days). The methodsprovided herein enable deconvolution of the population of cells and identify clonal phenotypes for cell subpopulations that comprise a particular barcode and / or genetic alteration. The genetically perturbed cells can be identified for a genetic alteration phenotype that is unique to a specific clone, unique to specific subsets, and / or a phenotype that is common to all cells within a tested cell population using the barcode in combination with a sequence provided herein.

[0080] Provided herein are methods for identifying the presence or absence of a genetic alteration in a cell population in-vitro, the methods comprising: contacting the cell population in- vitro with one or more of the compositions provided herein; isolating DNA on a cell-by-cell basis from a plurality of cells of the cell population to obtain isolated DNA. In some embodiments, the methods comprise isolating RNA on a cell-by-cell basis to form isolated RNA and reverse transcribing the isolated RNA to obtain cDNA. In some embodiments, the methods comprise amplifying the isolated DNA or the cDNA to form amplicons. In some embodiments, the methods comprise identifying the presence or absence of the genetic alteration in the plurality of cells, and the presence or absence of a barcode sequence, wherein the presence of the genetic alteration and the presence of a barcode sequence in at least about 10% of the plurality of cells indicates the presence of the genetic alteration in the cell population. In some embodiments, the cell population comprises a population of cancer cells.

[0081] Provided herein are methods of identifying a subpopulation of cells that are responsive to a therapeutic agent. Provided herein are methods of identifying a subpopulation of cancer cells that are responsive to an anti-cancer agent. In some embodiments, the methods comprise: contacting a cell, a population of cells, or a tissue (e.g. , a tumor or a population of cancer cells) with an agent; contacting the cell, population of cells, or tissue with a composition provided herein; isolating DNA on a cell-by-cell basis from a plurality of cells of the cell population to obtain isolated DNA. In some embodiments, the methods comprise isolating RNA on a cell-by- cell basis to form isolated RNA and reverse transcribing the isolated RNA to obtain cDNA. In some embodiments, the methods comprise amplifying the isolated DNA or the cDNA to form amplicons. In some embodiments, the methods comprise identifying the presence or the absence of the genetic alteration in a tumor or a population of cancer cells, and the presence or the absence of vector sequence (e.g., a barcode sequence, a guide sequence, a CD-4 sequence, a CD-90 sequence or any combination thereof), wherein the presence of the genetic alteration and the presence of a barcode sequence indicates the presence of the genetic alteration in the tumor or the population of cancer cells, thereby identifying a subpopulation of cancer cells that are responsive to the agent. In some embodiments, the agent is a gene editing system, a gene silencing system, a gene activating system, or a component thereof. In some embodiments, the agent is a chemical, anucleic acid, an antibody, a protein, or any combination thereof. In some embodiments, the method further comprises quantifying cell viability before and after contacting the tumor or the population of cells with the agent. The methods provided herein can be used to pair a transcriptional response (e.g., tumor sternness) or cellular phenotype (e.g., cell death) and disease-associated genetic features with greater resolution and accuracy than previous methods using the compositions provided herein.Exemplary Embodiments

[0082] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: an EF-1 alpha (a) promoter; and a first sequence downstream of the EF-1 a promoter that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2. Further provided herein are compositions, wherein the nucleic acid further comprises a sequence encoding a self- cleaving peptide. Further provided herein are compositions, wherein the sequence encoding the self-cleaving peptide is upstream to the first sequence and downstream to the EF-1 a promoter. Further provided herein are compositions, wherein the sequence encoding the self-cleaving peptide is downstream to the first sequence. Further provided herein are compositions, wherein the self- cleaving peptide comprises a 2A peptide or a variant thereof. Further provided herein are compositions, wherein the sequence encoding the self-cleaving peptide, wherein the sequence comprises a sequence that is at least 95% identical to SEQ ID NO: 5. Further provided herein are compositions, wherein the EF-1 a promoter comprises a sequence that is at least 95% identical to SEQ ID NO: 6. Further provided herein are compositions, wherein the nucleic acid further comprises a second sequence encoding for a guide ribonucleic acid (gRNA). Further provided herein are compositions, wherein the second sequence encoding for the gRNA is: downstream of the first sequence; or downstream of a sequence encoding a self-cleaving peptide. Further provided herein are compositions, wherein the nucleic acid further comprises a sequence coding for a barcode. Further provided herein are compositions, wherein the sequence coding for the barcode is: downstream of the first sequence; downstream of a sequence encoding a self-cleaving peptide; or downstream a sequence encoding for a guide ribonucleic acid (gRNA). Further provided herein are compositions, wherein the barcode comprises a random set of nucleotides. Further provided herein are compositions, wherein the barcode comprises a predetermined set of nucleotides.

[0083] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: an EF-1 alpha (a) promoter;a first sequence downstream of the EF-la promoter that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; and a barcode.

[0084] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: an EF-1 alpha (a) promoter; a first sequence downstream of the EF-la promoter that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; a barcode; and a guide nucleic acid.

[0085] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; and a second sequence downstream of the second sequence encoding a self- cleaving peptide. Further provided herein are compositions, wherein the first sequence further comprises a promoter upstream of sequence that is 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2. Further provided herein are compositions, wherein the promoter is an EF-la promoter. Further provided herein are compositions, wherein the EF-la promoter comprises a sequence that is at least 95% identical to SEQ ID NO: 6. Further provided herein are compositions, wherein the nucleic acid further comprises a third sequence encoding for a guide ribonucleic acid (gRNA). Further provided herein are compositions, wherein the third sequence encoding for the gRNA is: (a) downstream of the first sequence; or (b) downstream of a sequence encoding a self-cleaving peptide. Further provided herein are compositions, wherein the nucleic acid further comprises a sequence coding for a barcode. Further provided herein are compositions, wherein the sequence coding for the barcode is: (a) downstream of the first sequence; (b) downstream of the second sequence; or (c) downstream a sequence encoding for a guide ribonucleic acid (gRNA). Further provided herein are compositions, wherein the barcode comprises a random set of nucleotides. Further provided herein are compositions, wherein the barcode comprises a predetermined set of nucleotides. Further provided herein are compositions, wherein the self-cleaving peptide comprises a 2A self-cleaving peptide or a variant thereof. Further provided herein are compositions, wherein the second sequence comprises a sequence that is at least 95% identical to SEQ ID NO: 5.

[0086] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; a second sequence downstream of the second sequence encoding a self- cleaving peptide; and a barcode.

[0087] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; a second sequence downstream of the second sequence encoding a self- cleaving peptide; a barcode; and a guide nucleic acid.

[0088] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence encoding a self-cleaving peptide; and a second sequence downstream to the first sequence that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2. Further provided herein are compositions, wherein the nucleic acid further comprises a third sequence encoding for a guide ribonucleic acid (gRNA). Further provided herein are compositions, wherein the third sequence encoding for the gRNA is: (a) downstream of the second sequence; or (b) downstream of a sequence encoding a self-cleaving peptide. Further provided herein are compositions, wherein the nucleic acid further comprises a sequence coding for a barcode. Further provided herein are compositions, wherein the sequence coding for the barcode is: (a) downstream of the first sequence; (b) downstream of the second sequence; or (c) downstream a sequence encoding for a guide ribonucleic acid (gRNA). Further provided herein are compositions, wherein the barcode comprises a random set of nucleotides. Further provided herein are compositions, wherein the barcode comprises a predetermined set of nucleotides. Further provided herein are compositions, wherein the self-cleaving peptide comprises a 2A self- cleaving peptide or a variant thereof. Further provided herein are compositions, wherein the first sequence comprises a sequence that is at least 95% identical to SEQ ID NO: 5.

[0089] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence encoding a self-cleaving peptide; a second sequence downstream to the first sequence that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical,99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; and a third sequence comprising a barcode.

[0090] Provided herein are compositions, wherein the compositions comprise: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence encoding a self-cleaving peptide; a second sequence downstream to the first sequence that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; a third sequence comprising a barcode; and a guide nucleic acid sequence.

[0091] Provided herein are compositions comprising a vector, wherein the vector comprises a nucleic acid sequence that is at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 3 or SEQ ID NO: 22, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

[0092] Provided herein are compositions comprising a vector, wherein the vector comprises a nucleic acid sequence that is at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 4 or SEQ ID NO: 23, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

[0093] Provided herein are compositions, wherein the compositions comprise: a gene editing system comprising: (a) an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and (b) a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: (i) a sequence that encodes for a protein that is expressed on the surface of a cancer cell; (ii) a guide nucleic acid; and (iii) a barcode. Provided herein are compositions, wherein the cancer cell is a glioblastoma cell. Provided herein are compositions, wherein the protein is CD-4, CD-90, or a fragment thereof, wherein the fragment comprises SEQ ID NO: 1 or SEQ ID NO: 2. Provided herein are compositions, wherein the endonuclease is a Cas endonuclease. Provided herein are compositions, wherein the guide nucleic acid comprises a guide RNA. Provided herein are compositions, wherein the lentiviral vector further comprises a sequence that encodes for: a self-cleaving peptide (e.g., a T2A), an EF-1 alpha (EF-la) promoter, a bacterial resistance gene, a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), Rev Response Element (RRE), a CAP binding site, a lac promoter, a lac operator, an M13 rev site, a T3 promoter, an RSV promoter, an HIV-1 Psi element, central polypurine tract / central termination sequence (cPPT / CTS), a fluorescent protein, a U6 promoter, an SV-40 polyA signal, a restriction enzymesite, a Kozak sequence, a cell marker sequence, a cell-type specific promoter sequence, an additional barcode, or combinations thereof.

[0094] Provided herein are cells, wherein the cells comprise: any composition, gene editing system, or nucleic acid provided herein. In some embodiments, the cells are cancer cells, neurons, immune cells (e.g., T cells, macrophages, Natural Killer cells, B cells, or dendritic cells), cardiomyocytes, muscle cells, gastrointestinal cells, endothelial cells, hepatocytes, or stem cells. In some embodiments, the cells are glioblastoma cells. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are human cells. In some embodiments, the cells are genetically engineered to comprise a perturbation provided herein.

[0095] Provided herein are compositions, wherein the compositions further comprise a gene editing system enzyme, an endonuclease, a transcriptional activator, a transcriptional repressor, or any combination thereof, or a polynucleotide having a sequence encoding any of the forgoing.

[0096] Provided herein are compositions, wherein the compositions further comprise a catalytically inactive Cas protein fused to a repressor protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the repressor protein.

[0097] Provided herein are compositions, wherein the compositions further comprise a catalytically inactive Cas protein fused to a transcriptional activator protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the transcriptional activator protein.

[0098] Provided herein are compositions, wherein the compositions further comprise a gene editing system.

[0099] Provided herein are gene editing systems, wherein the gene editing systems comprise: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: an EF-1 alpha (a) promoter; and a sequence downstream of the EF-1 a promoter that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2.

[0100] Provided herein are gene editing systems, wherein the gene editing systems comprise: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, orSEQ ID NO: 1 and SEQ ID NO: 2; and a second sequence downstream the first sequence encoding a self-cleaving peptide.

[0101] Provided herein are gene editing systems, wherein the gene editing systems comprise: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence encoding a self-cleaving peptide; and a second sequence downstream the first sequence that is independently at least 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2.

[0102] Provided herein are kits, wherein the kits comprise a composition or a gene editing system provided herein, materials and instructions therefor.

[0103] Provided herein are methods, wherein the methods comprise: modifying expression of a transcriptional product in a cell. Provided herein are methods, wherein the methods comprise: contacting the cell with a composition or a gene editing system provided herein, thereby modifying the expression of the transcriptional product in the cell, wherein the transcriptional product is an RNA or a protein.

[0104] Provided herein are methods, wherein the methods comprise tagging a population of cells for isolation. Provided herein are methods, wherein the methods comprise: contacting a population of cells with a composition provided herein and isolating the population of cells that comprise a CD-4 or a CD-90 sequence. Further provided herein are methods, wherein the composition further comprises a barcode. Further provided herein are methods, wherein the method further comprises isolating a population of cells comprising the barcode. Further provided herein are methods, wherein the barcode is unique to a subset of cells within the population of cells. Further provided herein are methods, wherein the methods further comprise contacting the population of cells with a gene editing system enzyme or a sequence encoding the gene editing system enzyme. Further provided herein are methods, wherein the gene editing system enzyme comprises an endonuclease. Further provided herein are methods, wherein the endonuclease comprises a Cas enzyme. Further provided herein are methods, wherein the gene editing system enzyme is a deactivated Cas enzyme fused to a transcriptional repressor. Further provided herein are methods, wherein the gene editing system enzyme is a deactivated Cas enzyme fused to a transcriptional activator.EXAMPLESEXAMPLE 1: LENTIVIRAL VECTOR CONSTRUCTION

[0105] Lentiviral vectors were designed as shown in FIGS. 1-3 and provided herein as SEQ ID NOS: 3, 4, 22-27 for use in therapeutic target discovery assays to perturb a specific gene and identify downstream effects of the perturbation in individual cells and cell populations using sequencing techniques. The cells infected with a lentivirus can be identified by the following markers: (1) a truncated CD-4 sequence or transcriptional product; (2) a CD-90 sequence or transcriptional product; (3) a guide RNA; (4) a barcode (also referred to as a UMT); (5) a selectable marker or a fluorescent marker; or a combination of ( 1 )-(5) . Furthermore, the lentiviral vectors can be used in combination with gene editing system enzymes (e.g., a Cas enzyme) to perturb a gene of interest. In this example, the vector comprises a sequence encoding a gRNA that is designed to hybridize to the gene of interest and recruit the gene editing system enzyme to a target sequence within the gene of interest to perturb the target gene. Single cell sequencing can be used to detect the integrated markers and genetic alterations produced by the perturbation in a given cell.

[0106] FIGS. 1 and 5 show a lentiviral vector that encodes a truncated CD-4 protein driven by an EFl-a promoter sequence (SEQ ID NO: 22 and SEQ ID NO: 3). FIG. 1 shows a lentiviral vector comprising upstream to downstream: an EFl -a promoter sequence, EGFP, T2A, and CD4. A U6 promoter drives the expression of a gRNA downstream of the CD-4 (SEQ ID NO: 22) FIG. 5 shows a lentiviral vector comprising the CD-4 sequence, however, the T2A is downstream of the CD-4 and upstream of the EGFP (SEQ ID NO: 3).FIGS. 2 and 3 show lentiviral vectors that encode a CD-90 protein driven by an EFl -a promoter sequence. The sequence encoding CD-90 was modified at 3 nucleotides relative to the mouse CD- 90 encoding sequence. The sequence modifications are shown below in bold text.ATGAACCCAGCCATCAGCGTCGCTCTCCTGCTCTCAGTCTTGCAGGTGTCCCGAGGGCAGAAGGTGACCAGCCTGACA GCCTGCCTGGTGAACCAAAACCTTCGCCTGGACTGCCGCCATGAGAATAACACCAAGGATAACTCCATCCAGCATGAG TTCAGCCTGACCCGAGAGAAGAGGAAGCACGTGCTCTCAGGCACCCTTGGGATACCCGAGCACACGTACCGCTCCCGC GTCACCCTCTCCAACCAGCCCTATATCAAGGTCCTTACCCTAGCCAACTTCACCACCAAGGATGAGGGCGACTACTTT TGTGAGCTTCGCGTATCGGGCGCGAATCCCATGAGCTCCAATAAAAGTATCAGTGTGTATAGAGACAAGCTGGTCAA GTGTGGCGGCATAAGCCTGCTGGTTCAGAACACATCCTGGATGCTGCTGCTGCTGCTTTCCCTCTCCCTCCTCCAAGC CCTGGACTTCATTTCTCTG (SEQ ID NO: 2)

[0107] In FIG. 2, the CD-90 sequence is preceded by a sequence encoding a 2A self- cleaving peptide (SEQ ID NO: 23). In FIG. 3, the 2A self-cleaving peptide nucleic acid sequence is positioned downstream the CD-90 sequence (SEQ ID NO: 4). SEQ ID NOS; 3, 4, 22 and 23 are annotated sequences wherein “N” signifies any nucleotide for the sequence encoding the guideRNA region or the barcode region (UMT) and x is any number 1 to 50. Therefore, (N)xin the sequences provided herein signifies that the annotated stretch of sequence can be from 1 to 50 nucleotides in length. However, the number of nucleotides in the gRNA segment will depend on the length of a given target gene sequence and, in some cases, the position of a PAM for generating double stranded or single stranded breaks in a sequence with a CRISPR-Cas system.The 2A self-cleaving peptide was initially expected to permit similar expression levels of the open reading frame (ORF) upstream and the ORF downstream of the peptide. Surprisingly, this was not always the case as the ORF downstream of the peptide was often expressed less than the ORF upstream of the peptide. In addition, there was a possibility of undesired biological effects of the additional peptide residues left behind on either the upstream or the downstream ORF. Therefore, the position of the T2A affected the expression of both the CD-90 / CD-4 sequence as well as the EGFP sequence when tested in vitro. The T2A sequence position was strategically shifted in the vectors to determine how protein expression was affected in cells transduced with the SEQ ID NOS: 24-27 (FIGS. 1-3 and FIG. 5). There was no functional impairment of either GFP or CD4 / CD90 on either position of the peptide with either sequence. However, it was discovered that GFP expression levels decreased when the T2A sequence was put at the downstream position. Depending on the assay, it can be beneficial to use a construct expressing GFP or CD4 / CD90 upstream of the peptide to increase their expression level.EXAMPLE 2: GLIOBLASTOMA SCREENING

[0108] A lentiviral dCas9 plasmid was generated (FIG. 4). dCas9 glioblastoma multiforme (GBM) cells lines were generated via transduction of the cells with lentiviruses expressing dCas9 KRAB at a multiplicity of infection (MOI) of 1 in the presence of polybrene (5 pg / ml). Three days after transduction, cells were selected for one week using puromycin (5 pg / ml). The cells were routinely maintained in NeuroCult Proliferation Medium [Human] supplemented with recombinant human EGF (20 pg / ml), recombinant human bFGF (20 pg / ml) and heparin (2 pg / ml).

[0109] dCas9 GBM cell lines were infected with a gRNA lentiviral library at an MOI of 0.5 in the presence of polybrene (5 pg / ml) and at a minimum of 300-fold library coverage. The lentiviral vectors used for these studies contained two main components: an EFla promoter (SEQ ID NO: 6) driving the constitutive expression of EGFP (SEQ ID NO: 7) and CD-4 or CD-90; and a U6 promoter (SEQ ID NO: 9) driving the constitutive expression of the gRNA (annotated in SEQ ID NOS: 3, 4, 22, and 23 as (N)x). The EFla promoter also drives the expression of the poly- adenylated gRNA which was used for gRNA capture. The gRNA backbone downstream of the gRNA contained a barcode including 6 degenerate nucleotides (6N).

[0110] Glioblastoma multiforme (GBM) cells were transduced with plasmids carrying EGFP and either CD-90 or CD-4 in different orientations. Two days post-infection, transduced cells were detached using Accutase and enriched using either CD90.1 MicroBeads (Miltenyi, 130- 121-273) or CD4 MicroBeads (Miltenyi, 130-070-101) according to the manufacturer's instructions. Next, cells were analyzed for EGFP expression using flow cytometry to determine the percentage of plasmid-transduced cells (Pre-MACS) and stained with magnetic nanoparticles coated with antibodies for CD4 / CD90. After MACS treatment, negative and positive fractions were analyzed for EGFP expression to determine depletion and enrichment, respectively, using flow cytometry (FIG. 6). A genome-wide CRISPRi screen of 24 GBM cell lines was performed by analyzing GFP-percentages before and after MACS enrichment for CD90 expressing cells (FIG. 8)

[0111] Next-generation sequencing (NGS) libraries were generated by a two-step PCR while maintaining library coverage using the estimation of 7 pg of gDNA per 106cells. In a first step, 5 pg of gDNA per reaction was amplified with 14 PCR cycles using Q5 Hot Start High- Fidelity DNA Polymerase (NEB MO491L) and a set of 4 tiling forward primers and one reverse primer to increase library complexity. Forward primers were designed to bind upstream of the sgRNA (U6 promoter, SEQ ID NO: 9), and the reverse primer was designed to bind to a constant region downstream of the barcode. PCR reactions were cleaned up using SPRI beads (Cat M1378- 01) and eluted in 30.5 pl of EB buffer. 30 pl of PCR product was subjected to a second round of PCR using 12 cycles of PCR with primers that add Illumina i5 and i7 sequences as well as indexing barcodes for multiplexing downstream of the barcode sequence. The final PCR product was purified using SPRI beads and sequenced using single-end (SE) sequencing (lOObp, i7 8bp) on Illumina Nextseq™ 2000 at 40 million reads per library.

[0112] From the sequenced PCR products, 2FAST2Q (PMID: 36312750) was used to extract and count the expected amplicon, where amplicon here refers to the gRNA, the gRNA backbone, and the barcode. For a sequence to be extracted and counted, a minimal Phred-score of Q310 was used across (i) both search sequences and (ii) the extracted sequence. In addition, 2 mismatches were permitted in the upstream and downstream search sequences. Sequences extracted by 2FAST2Q were filtered using custom code to include only those of the expected amplicon length, which here equated to about 45 bp (20 bp sgRNA + 19 bp backbone + 6 bp barcode (UMI). Thereafter, gRNA sequences and barcodes were extracted based on their expected position in the amplicon and their length. Once gRNA and barcode sequences were extracted, counts were summed across each distinct combination of sgRNA and barcode sequences (FIG. 7).The cumulative frequency graph of FIG. 7 shows that guide-UMTs stabilized across count values higher than 5.SEQUENCESSEQ ID NO: 1: CD-4 Sequence (Truncated) ggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattga tccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggt gggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggta agtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctgg ctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagcc ccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcc tgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagat agtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcg tcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggc cggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcacca gttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagag cgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtac cgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttat gcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaa tttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcag gtgtcgtgaSEQ ID NO: 2: CD-90 Sequence (Truncated) atgaacccagccatcagcgtcgctctcctgctctcagtcttgcaggtgtcccgagggcagaaggtgaccagcctgaca gcctgcctggtgaaccaaaaccttcgcctggactgccgccatgagaataacaccaaggataactccatccagcatgag ttcagcctgacccgagagaagaggaagcacgtgctctcaggcacccttgggatacccgagcacacgtaccgctcccgc gtcaccctctccaaccagccctatatcaaggtccttaccctagccaacttcaccaccaaggatgagggcgactacttt tgtgagcttcgcGTAtcgggcgcgaatcccatgagctccaataaaagtatcagtgtgtatagagacaagctggtcaag tgtggcggcataagcctgctggttcagaacacatcctggatgctgctgctgctgctttccctctccctcctccaagcc ctggacttcatttctctgSEQ ID NO: 3: Full length CD-4 Vector (where N = any nucleotide, x = 1 to 50) EFla-CD4-T2A-EGFP-WPRE-U6-gRNA-Barcode (UMI)aacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagc aactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatg gcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacga tcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccgg agctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactat taactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatca ttgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatg aacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatata tactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgacca aaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctt tttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagc taccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagt taggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcca gtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgg ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaa gcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggg agcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgt gatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggc cttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgata ccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgc ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgca acgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtg gaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcact aaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgat gagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgc cttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtatt taagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagg gaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctgg taactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcg aaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcga ctggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgg gggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagta tgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactg ggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgt gtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagacc accgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataa atataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaag agcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgct gacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaaca gcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaagga tcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggag taataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagctt aatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggc aagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggt aggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagaa tcttgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaa tagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatccactttggcgccggctcgagggggcccgggtgcaaagatggataaagttttaaacag agaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgggaattggctccggtgcccgtcagtgggcag agcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgatccggtgcctagagaaggtggcgcg gggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcag tagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggc ctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccg agcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgagg cctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctc tagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatc tgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggc ggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcg cgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgc ttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaa ggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgatt agttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagt gggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatctt ggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgacgccaccatgaaccgg ggagtcccttttaggcacttgcttctggtgctgcaactggcgctcctcccagcagccactcagggaaagaaagtggtg ctgggcaaaaaaggggatacagtggaactgacctgtacagcttcccagaagaagagcatacaattccactggaaaaac tccaaccagataaagattctgggaaatcagggctccttcttaactaaaggtccatccaagctgaatgatcgcgctgac tcaagaagaagcctttgggaccaaggaaacttccccctgatcatcaagaatcttaagatagaagactcagatacttac atctgtgaagtggaggaccagaaggaggaggtgcaattgctagtgttcggattgactgccaactctgacacccacctg cttcaggggcagagcctgaccctgaccttggagagcccccctggtagtagcccctcagtgcaatgtaggagtccaagg ggtaaaaacatacagggggggaagaccctctccgtgtctcagctggagctccaggatagtggcacctggacatgcact gtcttgcagaaccagaagaaggtggagttcaaaatagacatcgtggtgctagctttccagaaggcctccagcatagtc tataagaaagagggggaacaggtggagttctccttcccactcgcctttacagttgaaaagctgacgggcagtggcgag ctgtggtggcaggcggagagggcttcctcctccaagtcttggatcacctttgacctgaagaacaaggaagtgtctgta aaacgggttacccaggaccctaagctccagatgggcaagaagctcccgctccacctcaccctgccccaggccttgcct cagtatgctggctctggaaacctcaccctggcccttgaagcgaaaacaggaaagttgcatcaggaagtgaacctggtg gtgatgagagccactcagctccagaaaaatttgacctgtgaggtgtggggacccacctcccctaagctgatgctgagc ttgaaactggagaacaaggaggcaaaggtctcgaagcgggagaaggcggtgtgggtgctgaaccctgaggcggggatg tggcagtgtctgctgagtgactcgggacaggtcctgctggaatccaacatcaaggttctgcccacatggtcgaccccg gtgcagccaatggccctgattgtgctggggggcgtcgccggcctcctgcttttcattgggctaggcatcttcttctgt gtcaggtgccggcacggatccggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggccca gtggccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgta aacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgc accaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctac cccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttc aaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaag ggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatc atggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctc gccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcact ctcggcatggacgagctgtacaagtgaacgcgttaagtcgacaatcaacctctggattacaaaatttgtgaaagattg actggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgct tcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtc aggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctc ctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggaca ggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgt gttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgc ggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcc tccccgcgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggac tggaagggctaattcactcccaacgaagacaagatttcaccattatcgtttcagacccacctcccaaccccgagggga cccagagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaatt aatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagtt ttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatc ttgtggaaaggaccaccg (N)xgtttAagagctaTGCTGGA (N)xAACAGCAtagcaagttTaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaagct tggcgtaaGaattcctagatcttgagacactgctttttgcttgtactgggtctctctggttagaccagatctgagcct gggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtg cccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgt atagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgt ttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcatt ctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccat cccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccga ggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccc tatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaa cttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaa cagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgc agcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgcc ggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtcc acgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataa gggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaata ttaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacatt caaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattc aacatttccgtgtcgcccSEQ ID NO: 4: Full length CD-90 vector (where N = any nucleotide, x = 1 to 50)EFla-CD90-T2A-EGFP-WPRE-U6-gRNA>CROPseq_Opti_CD90 . l_T2A_EGFP_gRNA_UMI ttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaag atcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagc aactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatg gcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacga tcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccgg agctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactat taactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccac ttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatca ttgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatg aacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatata tactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgacca aaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctt tttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagc taccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagt taggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcca gtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgg ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaa gcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggg agcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgt gatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggc cttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgata ccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgc ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgca acgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtg gaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcact aaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgat gagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgc cttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtatt taagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagg gaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctgg taactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcg aaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcga ctggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgg gggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagta tgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactg ggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgt gtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagacc accgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataa atataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaag agcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgct gacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaaca gcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaagga tcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagctt aatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggc aagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggt aggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagaa tcttgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaa tagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggttt attacagggacagcagagatccactttggcgccggctcgagggggcccgggtgcaaagatggataaagttttaaacag agaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgggaattggctccggtgcccgtcagtgggcag agcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgatccggtgcctagagaaggtggcgcg gggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcag tagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggc ctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccg agcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgagg cctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctc tagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatc tgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggc ggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcg cgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgc ttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaa ggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgatt agttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagt gggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatctt ggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgacgccaccatgaaccca gccatcagcgtcgctctcctgctctcagtcttgcaggtgtcccgagggcagaaggtgaccagcctgacagcctgcctg gtgaaccaaaacc t tcgcctggactgccgccatgagaataacaccaaggataactc cat ccagcatgagtt cage ctg acccgagagaagaggaagcacgtgctctcaggcacccttgggatacccgagcacacgtaccgctcccgcgtcaccctc tccaaccagccctatatcaaggtccttaccctagccaacttcaccaccaaggatgagggcgactacttttgtgagctt cgcGTAtcgggcgcgaatcccatgagctccaataaaagtatcagtgtgtatagagacaagctggtcaagtgtggcggc ataagcctgctggttcagaacacatcctggatgctgctgctgctgctttccctctccctcctccaagccctggacttc atttctctgggatccggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggcccagtggcc accatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggc cacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccacc ggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgac cacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggac gacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcat egage tgaagggcatc gacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggcc gacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgac cactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgcc ctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggc atggacgagctgtacaagtgaacgcgttaagtcgacaatcaacctctggattacaaaatttgtgaaagattgactggt attcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgt atggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttcc gggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggct cggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgcc acctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctg ctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccg cgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaag ggctaattcactcccaacgaagacaagatttcaccattatcgtttcagacccacctcccaaccccgaggggacccaga gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttg actgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaa ttatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtgg aaaggaccaccg (N)xgtttAagagctaTGCTGGA (N)xAACAGCAtagcaagttTaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaagct tggcgtaaGaattcctagatcttgagacactgctttttgcttgtactgggtctctctggttagaccagatctgagcct gggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtg cccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgt atagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgt ttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcatt ctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccat cccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccga ggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccc tatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaa cttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaa cagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgc agcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgcc ggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtcc acgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataa gggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaata ttaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacatt caaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattc aacatttccgtgtcgcccSEQ ID NO: 5-21: See Table 1SEQ ID NO: 22 Full Length CD-4 vector (where N = any nucleotide, x = 1 to 50) EF1-EGFP- T2A- CD4-WPRE- U6 - gRNA - Barcode (UMI) ggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattga tccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggt gggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggta agtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctgg ctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcc tgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagat agtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcg tcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggc cggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcacca gttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagag cgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtac cgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttat gcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaa tttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcag gtgtcgtgacgtacggc caeca tggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctg gacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctg aagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgc ttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgc accatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgc at egage tgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccac aacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggc agcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactac ctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgcc gccgggatcactctcggcatggacgagctgtacaaggagggcagaggaagtctgctaacatgcggtgacgt egaggag aatcctggcccaatgaaccggggagtcccttttaggcacttgcttctggtgctgcaactggcgctcctcccagcagcc actcagggaaagaaagtggtgctgggcaaaaaaggggatacagtggaactgacctgtacagcttcccagaagaagagc atacaattccactggaaaaactccaaccagataaagattctgggaaatcagggctccttcttaactaaaggtccatcc aagctgaatgatcgcgctgactcaagaagaagcctttgggaccaaggaaacttccccctgatcatcaagaatcttaag atagaagactcagatacttacatctgtgaagtggaggaccagaaggaggaggtgcaattgctagtgttcggattgact gccaactctgacacccacctgcttcaggggcagagcctgaccctgaccttggagagcccccctggtagtagcccctca gtgcaatgtaggagtccaaggggtaaaaacatacagggggggaagaccctctccgtgtctcagctggagctccaggat agtggcacctggacatgcactgtcttgcagaaccagaagaaggtggagttcaaaatagacatcgtggtgctagctttc cagaaggcctccagcatagtctataagaaagagggggaacaggtggagttctccttcccactcgcctttacagttgaa aagctgacgggcagtggcgagctgtggtggcaggcggagagggcttcctcctccaagtcttggatcacctttgacctg aagaacaaggaagtgtctgtaaaacgggttacccaggaccctaagctccagatgggcaagaagctcccgctccacctc accctgccccaggccttgcctcagtatgctggctctggaaacctcaccctggcccttgaagcgaaaacaggaaagttg catcaggaagtgaacctggtggtgatgagagccactcagctccagaaaaatttgacctgtgaggtgtggggacccacc tcccctaagctgatgctgagcttgaaactggagaacaaggaggcaaaggtctcgaagcgggagaaggcggtgtgggtg ctgaaccctgaggcggggatgtggcagtgtctgctgagtgactcgggacaggtcctgctggaatccaacatcaaggtt ctgcccacatggtcgaccccggtgcagccaatggccctgattgtgctggggggcgtcgccggcctcctgcttttcatt gggctaggcatcttcttctgtgtcaggtgccggcactgattaagtcgacaatcaacctctggattacaaaatttgtga aagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgc tattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcc cgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctg tcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctg ctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttcc ttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttg ggccgcctccccgcgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaag gggggactggaagggctaattcactcccaacgaagacaagatttcaccattatcgtttcagacccacctcccaacccc gaggggacccagagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataat tagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtt tgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggcttt atatatcttgtggaaaggacgaaacaccg (N)xgtttAagagctaTGCTGGA (N)xAACAGCAtagcaagttTaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaagct tggcgtaaGaattcctagatcttgagacactgctttttgcttgtactgggtctctctggttagaccagatctgagcct gggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtg cccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgt atagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgt ttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcatt ctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccat cccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccga ggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccc tatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaa cttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaa cagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgc agcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgcc ggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtcc acgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataa gggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaata ttaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacatt caaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattc aacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtga aagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttg agagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgta ttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacag aaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggcca acttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgcc ttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaa caacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcgg ataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagc gtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgggga gtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcag accaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatccttt ttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaag gatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttc ttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgt taccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgc agcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctac agcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaa caggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgac ttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggt tcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccg cctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagc gcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttc cggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagc gcgcaattaaccctcactaaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtc ttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagt aaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgca ttgcagagatattgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctggga gctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccg tctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccg aacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggca agaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgag agcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatat aaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaa ggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataataca gtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagag caaaacaaaagtaagaccaccgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattg gagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagt ggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatggg cgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgag ggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgt ggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcc ttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaat taacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattatt ggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataat gatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattc accattatcgtttcagaatcttgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggt acagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaa ttcaaaattttcgggtttattacagggacagcagagatccactttggcgccggctcgagggggcccgggtgcaaagat ggataaagttttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgggaattSEQ ID NO: 23 Full length CD-90 vector (where N = any nucleotide, x = 1 to 50) EF-la-EGFP- T2A-CD90-WPRE-U6-gRNA-Barcode (UMI)CROPseq_Opti_EGFP_T2A_CD90_UMI_gRNAggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattga tccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggt gggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggta agtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctgg ctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagcc ccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcc tgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagat agtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcg tcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggc cggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcacca gttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagag cgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtac cgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttat gcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaa tttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcag gtgtcgtgacgtacggccaecatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctg gacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctg aagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgc ttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgc accatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgc ategagetgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccac aacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggc agcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactac ctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgcc gccgggatcactctcggcatggacgagctgtacaaggagggcagaggaagtctgctaacatgcggtgacgtegaggag aatcctggcccaatgaacccagccatcagcgtcgctctcctgctctcagtcttgcaggtgtcccgagggcagaaggtg accagcctgacagcctgcctggtgaaccaaaaccttegeetggactgccgccatgagaataacaccaaggataactee atccagcatgagttcagcctgacccgagagaagaggaagcacgtgctctcaggcacccttgggatacccgagcacacg taccgctcccgcgtcaccctctccaaccagccctatatcaaggtccttaccctagccaacttcaccaccaaggatgag ggcgactacttttgtgagcttcgcGTAtcgggcgcgaatcccatgagctccaataaaagtatcagtgtgtatagagac aagctggtcaagtgtggcggcataagcctgctggttcagaacacatcctggatgctgctgctgctgctttccctctcc ctcctccaagccctggacttcatttctctgtgattaagtcgacaatcaacctctggattacaaaatttgtgaaagatt gactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgc ttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgt caggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagct cctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggac aggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctegeetg tgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccg cggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgc ctccccgcgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaagggggga ctggaagggctaattcactcccaacgaagacaagatttcaccattatcgtttcagacccacctcccaaccccgagggg acccagagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagt tttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatat cttgtggaaaggacgaaacaccg(N)xgtttAagagctaTGCTGGA(N)xAACAGCAtagcaagttTaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaagct tggcgtaaGaattcctagatcttgagacactgctttttgcttgtactgggtctctctggttagaccagatctgagcct gggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtg cccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgt atagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgt ttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcatt ctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccat cccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccga ggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccc tatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaa cttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaa cagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgc agcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgcc ggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtcc acgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataa gggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaata ttaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacatt caaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattc aacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtga aagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttg agagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgta ttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacag aaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggcca acttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgcc ttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaa caacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcgg ataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagc gtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgggga gtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcag accaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatccttt ttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaag gatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggttt gtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttc ttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgt taccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgc agcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctac agcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaa caggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggt tcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccg cctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagc gcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttc cggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagc gcgcaattaaccctcactaaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtc ttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagt aaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgca ttgcagagatattgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctggga gctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccg tctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccg aacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggca agaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgag agcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatat aaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaa ggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataataca gtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagag caaaacaaaagtaagaccaccgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattg gagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagt ggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatggg cgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgag ggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgt ggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcc ttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaat taacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattatt ggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataat gatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattc accattatcgtttcagaatcttgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggt acagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaa ttcaaaattttcgggtttattacagggacagcagagatccactttggcgccggctcgagggggcccgggtgcaaagat ggataaagttttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgggaattSEQ ID NO: 24 - CD4 Vector-1>CROPseq_Opti_CD4_T2A_EGFP_gRNA_UMI ttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaag atcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaag aacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagc aactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatg gcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacga tcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactat taactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccac ttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatca ttgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatg aacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatata tactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgacca aaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctt tttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagc taccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagt taggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcca gtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgg ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaa gcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggg agcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgt gatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggc cttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgata ccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgc ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgca acgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtg gaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcact aaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgat gagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgc cttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtatt taagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagg gaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctgg taactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcg aaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcga ctggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgg gggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagta tgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactg ggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgt gtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagacc accgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataa atataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaag agcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgct gacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaaca gcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaagga tcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggag taataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagctt aatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggc aagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggt aggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagaatcttgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaa tagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggttt attacagggacagcagagatccactttggcgccggctcgagggggcccgggtgcaaagatggataaagttttaaacag agaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgggaattggctccggtgcccgtcagtgggcag agcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgatccggtgcctagagaaggtggcgcg gggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcag tagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggc ctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccg agcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgagg cctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctc tagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatc tgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggc ggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcg cgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgc ttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaa ggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgatt agttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagt gggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatctt ggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgacgccaccatgaaccgg ggagtcccttttaggcacttgcttctggtgctgcaactggcgctcctcccagcagccactcagggaaagaaagtggtg ctgggcaaaaaaggggatacagtggaactgacctgtacagcttcccagaagaagagcatacaattccactggaaaaac tccaaccagataaagattctgggaaatcagggctccttcttaactaaaggtccatccaagctgaatgatcgcgctgac tcaagaagaagcctttgggaccaaggaaacttccccctgatcatcaagaatcttaagatagaagactcagatacttac atctgtgaagtggaggaccagaaggaggaggtgcaattgctagtgttcggattgactgccaactctgacacccacctg cttcaggggcagagcctgaccctgaccttggagagcccccctggtagtagcccctcagtgcaatgtaggagtccaagg ggtaaaaacatacagggggggaagaccctctccgtgtctcagctggagctccaggatagtggcacctggacatgcact gtcttgcagaaccagaagaaggtggagttcaaaatagacatcgtggtgctagctttccagaaggcctccagcatagtc tataagaaagagggggaacaggtggagttctccttcccactcgcctttacagttgaaaagctgacgggcagtggcgag ctgtggtggcaggcggagagggcttcctcctccaagtcttggatcacctttgacctgaagaacaaggaagtgtctgta aaacgggttacccaggaccctaagctccagatgggcaagaagctcccgctccacctcaccctgccccaggccttgcct cagtatgctggctctggaaacctcaccctggcccttgaagcgaaaacaggaaagttgcatcaggaagtgaacctggtg gtgatgagagccactcagctccagaaaaatttgacctgtgaggtgtggggacccacctcccctaagctgatgctgagc ttgaaactggagaacaaggaggcaaaggtctcgaagcgggagaaggcggtgtgggtgctgaaccctgaggcggggatg tggcagtgtctgctgagtgactcgggacaggtcctgctggaatccaacatcaaggttctgcccacatggtcgaccccg gtgcagccaatggccctgattgtgctggggggcgtcgccggcctcctgcttttcattgggctaggcatcttcttctgt gtcaggtgccggcacggatccggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggccca gtggccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgta aacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgc accaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctac cccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttc aaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaag ggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctc gccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccag tccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcact ctcggcatggacgagctgtacaagtgaacgcgttaagtcgacaatcaacctctggattacaaaatttgtgaaagattg actggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgct tcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtc aggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctc ctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggaca ggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgt gttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgc ggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcc tccccgcgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggac tggaagggctaattcactcccaacgaagacaagatttcaccattatcgtttcagacccacctcccaaccccgagggga cccagagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaatt aatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagtt ttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatc ttgtggaaaggaccaccgNNNNNNNNNNNNNNNNNNNNgtttAagagctaTGCTGGANNNNNNAACAGCAtagcaagt tTaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaagcttggcgtaaGaattcc tagatcttgagacactgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggct aactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtg actctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgtatagtagttcatgtc atcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttata atggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgt ccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccgcccctaactcc gcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctc tgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtat tacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgca gcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctg aatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctaca cttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaa gctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggt gatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagt ggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatt tcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatt taggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgc tcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcg cccSEQ ID NO: 25- CD4 Vector- 2gggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggta agtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctgg ctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagcc ccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcc tgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagat agtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcg tcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggc cggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcacca gttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagag cgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtac cgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttat gcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaa tttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcag gtgtcgtgacgtacggccaecatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctg gacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctg aagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgc ttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgc accatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgc at egage tgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccac aacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggc agcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactac ctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgcc gccgggatcactctcggcatggacgagctgtacaaggagggcagaggaagtctgctaacatgcggtgacgtegaggag aatcctggcccaatgaaccggggagtcccttttaggcacttgcttctggtgctgcaactggcgctcctcccagcagcc actcagggaaagaaagtggtgctgggcaaaaaaggggatacagtggaactgacctgtacagcttcccagaagaagagc atacaattccactggaaaaactccaaccagataaagattctgggaaatcagggctccttcttaactaaaggtccatcc aagctgaatgatcgcgctgactcaagaagaagcctttgggaccaaggaaacttccccctgatcatcaagaatcttaag atagaagactcagatacttacatctgtgaagtggaggaccagaaggaggaggtgcaattgctagtgttcggattgact gccaactctgacacccacctgcttcaggggcagagcctgaccctgaccttggagagcccccctggtagtagcccctca gtgcaatgtaggagtccaaggggtaaaaacatacagggggggaagaccctctccgtgtctcagctggagctccaggat agtggcacctggacatgcactgtcttgcagaaccagaagaaggtggagttcaaaatagacatcgtggtgctagctttc cagaaggcctccagcatagtctataagaaagagggggaacaggtggagttctccttcccactcgcctttacagttgaa aagctgacgggcagtggcgagctgtggtggcaggcggagagggcttcctcctccaagtcttggatcacctttgacctg aagaacaaggaagtgtctgtaaaacgggttacccaggaccctaagctccagatgggcaagaagctcccgctccacctc accctgccccaggccttgcctcagtatgctggctctggaaacctcaccctggcccttgaagcgaaaacaggaaagttg catcaggaagtgaacctggtggtgatgagagccactcagctccagaaaaatttgacctgtgaggtgtggggacccacc tcccctaagctgatgctgagcttgaaactggagaacaaggaggcaaaggtctcgaagcgggagaaggcggtgtgggtg ctgaaccctgaggcggggatgtggcagtgtctgctgagtgactcgggacaggtcctgctggaatccaacatcaaggtt ctgcccacatggtcgaccccggtgcagccaatggccctgattgtgctggggggcgtcgccggcctcctgcttttcatt gggctaggcatcttcttctgtgtcaggtgccggcactgattaagtcgacaatcaacctctggattacaaaatttgtga aagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgc tattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctg tcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctg ctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgct cgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttcc ttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttg ggccgcctccccgcgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaag gggggactggaagggctaattcactcccaacgaagacaagatttcaccattatcgtttcagacccacctcccaacccc gaggggacccagagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataat tagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtt tgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggcttt atatatcttgtggaaaggacgaaacaccgNNNNNNNNNNNNNNNNNNNNgtttAagagctaTGCTGGANNNNNNAACAGCAtagcaagttTaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaagcttggc gtaaGaattcctagatcttgagacactgctttttgcttgtactgggtctctctggttagaccagatctgagcctggga gctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccg tctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgtatag tagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttat tgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctag ttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccg cccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggcc gcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctata gtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaactta atcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagt tgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcg tgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggct ttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaac ttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgt tctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataaggga ttttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaa cgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaa tatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaaca tttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagt aaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagag ttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattga cgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaa gcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaactt acttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttga tcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaac gttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataa agttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgg gtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtca ggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagacca agtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatc ttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgttt gccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttct agtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttacc agtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcg gtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcg tgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacagg agagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttga gcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcct ggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctt tgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgccc aatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggc tcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgc aattaaccctcactaaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtcttgc aacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaagg tggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgc agagatattgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctc tctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctg ttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaaca gggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagag gcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcg tcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaat taaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggct gtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtag caaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaa acaaaagtaagaccaccgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggaga agtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtg cagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgca gcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggct attgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaa agatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttgg aatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaac aattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaa ttagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgata gtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaeca ttatcgtttcagaatcttgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacag tgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattca aaattttcgggtttattacagggacagcagagatccactttggcgccggctcgagggggcccgggtgcaaagatggat aaagttttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgggaattSEQ ID NO: 26- CD-90-Vector-l>CR0Pseq_0pti_CD9 Q . l_T2A_EGFP_gRNA_UMI ttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaag atcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaag aacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagc aactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatg gcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacga tcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccgg agctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactat taactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccac ttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatca ttgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatg aacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatata tactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgacca aaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctt tttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagc taccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagt taggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcca gtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgg ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaa gcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggg agcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgt gatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggc cttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgata ccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgc ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgca acgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtg gaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcact aaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgat gagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgc cttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtatt taagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagg gaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctgg taactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcg aaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcga ctggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgg gggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagta tgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactg ggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgt gtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagacc accgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataa atataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaag agcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaaca gcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaagga tcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggag taataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagctt aatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggc aagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggt aggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagaa tcttgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaa tagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggttt attacagggacagcagagatccactttggcgccggctcgagggggcccgggtgcaaagatggataaagttttaaacag agaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgggaattggctccggtgcccgtcagtgggcag agcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgatccggtgcctagagaaggtggcgcg gggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcag tagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggc ctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccg agcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgagg cctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctc tagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatc tgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggc ggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcg cgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgc ttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaa ggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgatt agttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagt gggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatctt ggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgacgccaccatgaaccca gccatcagcgtcgctctcctgctctcagtcttgcaggtgtcccgagggcagaaggtgaccagcctgacagcctgcctg gtgaaccaaaaccttcgcctggactgccgccatgagaataacaccaaggataactccatccagcatgagttcagectg acccgagagaagaggaagcacgtgctctcaggcacccttgggatacccgagcacacgtaccgctcccgcgtcaccctc tccaaccagccctatatcaaggtccttaccctagccaacttcaccaccaaggatgagggcgactacttttgtgagctt cgcGTAtcgggcgcgaatcccatgagctccaataaaagtatcagtgtgtatagagacaagctggtcaagtgtggcggc ataagcctgctggttcagaacacatcctggatgctgctgctgctgctttccctctccctcctccaagccctggacttc atttctctgggatccggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggcccagtggcc accatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggc cacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccacc ggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgac cacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggac gacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcategagetgaagggcatc gacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggcc gacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgac cactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgcc ctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtgaacgcgttaagtcgacaatcaacctctggattacaaaatttgtgaaagattgactggt attcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgt atggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaa cgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttcc gggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggct cggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgcc acctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctg ctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccg cgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaag ggctaattcactcccaacgaagacaagatttcaccattatcgtttcagacccacctcccaaccccgaggggacccaga gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttg actgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaa ttatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtgg aaaggaccaccgNNNNNNNNNNNNNNNNNNNNgtttAagagctaTGCTGGANNNNNNAACAGCAtagcaagttTaaat aaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaagcttggcgtaaGaattcctagate ttgagacactgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactag ggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctg gtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgtatagtagttcatgtcatctta ttattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatggtt acaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaac tcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccgcccctaactccgcccag ttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagct attccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtattacgcg cgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacat ccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggc gaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgcc agcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctcta aatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggt tcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactc ttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcc tattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttaggtg gcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatga gacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccSEQ ID NO: 27- CD-90 Vector-2CROPseq_Opti_EGFP_T2A_CD90_UMI_gRNA ggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattga tccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggt gggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggta agtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctgg ctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttegaggeettgcgcttaaggagcc ccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagat agtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcg tcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggc cggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcacca gttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagag cgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtac cgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttat gcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaa tttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcag gtgtcgtgacgtacggc caeca tggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctg gacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctg aagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgc ttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgc accatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgc at egage tgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccac aacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggc agcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactac ctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgcc gccgggatcactctcggcatggacgagctgtacaaggagggcagaggaagtctgctaacatgcggtgacgtegaggag aatcctggcccaatgaacccagccatcagcgtcgctctcctgctctcagtcttgcaggtgtcccgagggcagaaggtg accagcctgacagcctgcctggtgaaccaaaaccttegeetggactgccgccatgagaataacaccaaggataactee atccagcatgagttcagcctgacccgagagaagaggaagcacgtgctctcaggcacccttgggatacccgagcacacg taccgctcccgcgtcaccctctccaaccagccctatatcaaggtccttaccctagccaacttcaccaccaaggatgag ggcgactacttttgtgagcttcgcGTAtcgggcgcgaatcccatgagctccaataaaagtatcagtgtgtatagagac aagctggtcaagtgtggcggcataagcctgctggttcagaacacatcctggatgctgctgctgctgctttccctctcc ctcctccaagccctggacttcatttctctgtgattaagtcgacaatcaacctctggattacaaaatttgtgaaagatt gactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgc ttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgt caggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagct cctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggac aggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctegeetg tgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccg cggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgc ctccccgcgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaagggggga ctggaagggctaattcactcccaacgaagacaagatttcaccattatcgtttcagacccacctcccaaccccgagggg acccagagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaat taatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagt tttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatat c t tgtggaaagga cgaaacac cgNNNNNNNNNNNNNNNNNNNNgt 1 t Aagagc t aTGCTGGANNNNNNAACAGCAt ag caagttTaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaagcttggcgtaaGa attcctagatcttgagacactgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctc tggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgtatagtagttc atgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagc ttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtgg tttgtccaaacteatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccgccccta actccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcg gcctctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagt cgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgcc ttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgca gcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccg ctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttcccc gtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatt agggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttcttta atagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgc cgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgctta caatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgta tccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccg tgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaaga tgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcg ccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgg gcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatct tacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttct gacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttg ggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcg caaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgc aggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcg cggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaac tatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagttta ctcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatct catgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttg agatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccgga tcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgta gccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggc tgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcggg ctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagct atgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcg cacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcg atttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggcctt ttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacg caaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcag tgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtat gttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtcttgcaacatg gtaacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtac gatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagat attgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctctctggc taactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgt gactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggact tgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgagg ggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagta ttaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaac atatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagac aaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccc tctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaa gtaagaccaccgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaa ttatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagaga gaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtca atgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgag gcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatac ctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgct agttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattac acaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagat aaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtagga ggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcg tttcagaatcttgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcagg ggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattt tcgggtttattacagggacagcagagatccactttggcgccggctcgagggggcccgggtgcaaagatggataaagtt ttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgggaatt

Claims

CLAIMSWhat is claimed is:

1. A composition comprising: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: an EF-1 alpha (a) promoter; a first sequence downstream of the EF-la promoter that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; and a barcode.

2. The composition of claim 1, comprising the nucleic acid, wherein the nucleic acid further comprises a sequence encoding a self-cleaving peptide.

3. The composition of claim 2, wherein the sequence encoding the self-cleaving peptide is upstream to the first sequence and downstream to the EF-la promoter.

4. The composition of claim 2, wherein the sequence encoding the self-cleaving peptide is downstream to the first sequence.

5. The composition of claim 2, wherein the self-cleaving peptide comprises a 2A peptide or a variant thereof.

6. The composition of claim 2, comprising the sequence encoding the self-cleaving peptide, wherein the sequence comprises a sequence that is at least 95% identical to SEQ ID NO: 5.

7. The composition of claim 1 , wherein the EF-la promoter comprises a sequence that is at least 95% identical to SEQ ID NO: 6.

8. The composition of claim 1, comprising the nucleic acid, wherein the nucleic acid further comprises a second sequence encoding for a guide ribonucleic acid (gRNA).

9. The composition of claim 8, wherein the second sequence encoding for the gRNA is:(a) downstream of the first sequence; or(b) downstream of a sequence encoding a self-cleaving peptide.

10. The composition of claim 1, comprising the nucleic acid, wherein the nucleic acid further comprises a sequence coding for an additional barcode.

11. The composition of claim 1, wherein the barcode is:(a) downstream of the first sequence;(b) downstream of a sequence encoding a self-cleaving peptide; or(c) downstream a sequence encoding for a guide ribonucleic acid (gRNA).

12. The composition of claim 1, wherein the barcode comprises a random set of nucleotides.

13. The composition of claim 1, wherein the barcode comprises a predetermined set of nucleotides.

14. The composition of claim 1, wherein the first sequence downstream of the EF-la promoter is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

15. The composition of claim 1, wherein the first sequence downstream of the EF-la promoter is at least 95% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

16. The composition of claim 1, wherein the first sequence downstream of the EF-la promoter is at least 99% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

17. The composition of claim 1, wherein the first sequence downstream of the EF-la promoter is 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

18. A composition comprising : a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence that is independently at least 85% identical to SEQ ID NO:1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; and a second sequence downstream of the second sequence encoding a self- cleaving peptide; and a third sequence comprising a barcode19. The composition of claim 18, comprising the nucleic acid, wherein the first sequence further comprises a promoter upstream of the first sequence.

20. The composition of claim 19, wherein the promoter is an EF-la promoter, a U6 promoter, an AMP promoter, a Lac promoter, a T3 promoter, or an RSV promoter.

21. The composition of claim 20, wherein the EF-la promoter comprises a sequence that is at least 95% identical to SEQ ID NO: 6.

22. The composition of claim 18, comprising the nucleic acid, wherein the nucleic acid further comprises a fourth sequence encoding for a guide ribonucleic acid (gRNA).

23. The composition of claim 22, wherein the fourth sequence encoding for the gRNA is:(a) downstream of the first sequence; or(b) downstream of a sequence encoding a self-cleaving peptide.

24. The composition of claim 18, comprising the nucleic acid, wherein the nucleic acid further comprises a sequence coding for an additional barcode.

25. The composition of claim 18, wherein the barcode is:(a) downstream of the first sequence;(b) downstream of the second sequence; or(c) downstream a sequence encoding for a guide ribonucleic acid (gRNA).

26. The composition of claim 18, wherein the barcode comprises a random set of nucleotides.

27. The composition of claim 18, wherein the barcode comprises a predetermined set of nucleotides.

28. The composition of claim 18, wherein the self-cleaving peptide comprises a 2A self-cleaving peptide or a variant thereof.

29. The composition of claim 18, wherein the second sequence comprises a sequence that is at least 95% identical to SEQ ID NO: 5.

30. The composition of claim 18, wherein the first sequence downstream is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

31. The composition of claim 18, wherein the first sequence is at least 95% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

32. The composition of claim 18, wherein the first sequence downstream is at least 99% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

33. The composition of claim 18, wherein the first sequence is 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

34. A composition comprising: a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence encoding a self-cleaving peptide; a second sequence downstream to the first sequence that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; and a third sequence comprising a barcode.

35. The composition of claim 34, comprising the nucleic acid, wherein the nucleic acid further comprises a fourth sequence encoding for a guide ribonucleic acid (gRNA).

36. The composition of claim 35, wherein the fourth sequence encoding for the gRNA is:(a) downstream of the second sequence; or(b) downstream of a sequence encoding a self-cleaving peptide.

37. The composition of claim 34, comprising the nucleic acid, wherein the nucleic acid further comprises a sequence coding for an additional barcode.

38. The composition of claim 34, wherein the barcode is:(a) downstream of the first sequence;(b) downstream of the second sequence; or(c) downstream a sequence encoding for a guide ribonucleic acid (gRNA).

39. The composition of claim 34, wherein the barcode comprises a random set of nucleotides.

40. The composition of claim 34, wherein the barcode comprises a predetermined set of nucleotides.

41. The composition of claim 34, wherein the self-cleaving peptide comprises a 2A self-cleaving peptide or a variant thereof.

42. The composition of claim 34, wherein the first sequence comprises a sequence that is at least 95% identical to SEQ ID NO: 5.

43. The composition of claim 34, wherein the second sequence is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

44. The composition of claim 34, wherein the second sequence is at least 95% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

45. The composition of claim 34, wherein the second sequence is at least 99% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

46. The composition of claim 34, wherein the second sequence is 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2.

47. A composition comprising a vector, wherein the vector comprises a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 3 or SEQ ID NO: 22, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

48. The composition of claim 47, wherein the composition further comprises a gene editing system enzyme, an endonuclease, a transcriptional activator, a transcriptional repressor, or any combination thereof, or a polynucleotide having a sequence encoding any of the forgoing.

49. The composition of claim 47, wherein the composition further comprises a catalytically inactive Cas protein fused to a repressor protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the repressor protein.

50. The composition of claim 47, wherein the composition further comprises a catalytically inactive Cas protein fused to a transcriptional activator protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the transcriptional activator protein.

51. The composition of claim 47, wherein the nucleic acid sequence is at least 90% identical to SEQ ID NO: 3, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

52. The composition of claim 47, wherein the nucleic acid sequence is at least 95% identical to SEQ ID NO: 3, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

53. The composition of claim 47, wherein the nucleic acid sequence is at least 99% identical to SEQ ID NO: 3, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

54. The composition of claim 47, wherein the nucleic acid sequence is 100% identical to SEQ ID NO: 3, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

55. The composition of claim 47, wherein the nucleic acid sequence is at least 90% identical to SEQ ID NO: 22, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

56. The composition of claim 47, wherein the nucleic acid sequence is at least 95% identical to SEQ ID NO: 22, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

57. The composition of claim 47, wherein the nucleic acid sequence is at least 99% identical to SEQ ID NO: 22, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

58. The composition of claim 47, wherein the nucleic acid sequence is 100% identical to SEQ ID NO: 22, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

59. A composition comprising a vector, wherein the vector comprises a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 4 or SEQ ID NO: 23, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

60. The composition of claim 59, wherein the composition further comprises a gene editing system enzyme, an endonuclease, a transcriptional activator, a transcriptional repressor, or any combination thereof, or a polynucleotide having a sequence encoding any of the forgoing.

61. The composition of claim 59, wherein the composition further comprises a catalytically inactive Cas protein fused to a repressor protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the repressor protein.

62. The composition of claim 59, wherein the composition further comprises a catalytically inactive Cas protein fused to a transcriptional activator protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the transcriptional activator protein.

63. The composition of claim 59, wherein the nucleic acid sequence is at least 90% identical to SEQ ID NO: 4, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

64. The composition of claim 59, wherein the nucleic acid sequence is at least 95% identical to SEQ ID NO: 4, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

65. The composition of claim 59, wherein the nucleic acid sequence is at least 99% identical to SEQ ID NO: 4, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

66. The composition of claim 59, wherein the nucleic acid sequence is 100% identical to SEQ ID NO: 4, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

67. The composition of claim 59, wherein the nucleic acid sequence is at least 90% identical to SEQ ID NO: 23, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

68. The composition of claim 59, wherein the nucleic acid sequence is at least 95% identical to SEQ ID NO: 23, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

69. The composition of claim 59, wherein the nucleic acid sequence is at least 99% identical to SEQ ID NO: 23, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

70. The composition of claim 59, wherein the nucleic acid sequence is 100% identical to SEQ ID NO: 23, wherein N is independently any nucleotide and wherein x is a number from 1 to 50.

71. The composition of any one of claims 1 , 18, or 34, wherein the composition further comprises a gene editing system enzyme, an endonuclease, a transcriptional activator, a transcriptional repressor, or any combination thereof, or a polynucleotide having a sequence encoding any of the forgoing.

72. The composition of any one of claims 1, 18, or 34, wherein the composition further comprises a catalytically inactive Cas protein fused to a repressor protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the repressor protein.

73. The composition of any one of claims 1 , 18, or 34, wherein the composition further comprises a catalytically inactive Cas protein fused to a transcriptional activator protein or a polynucleotide having a sequence encoding the catalytically inactive Cas protein fused to the transcriptional activator protein.

74. The composition of any one of claims 59 to 73, further comprising a barcode.

75. The composition of any one of claims 59 to 74, further comprising a guide nucleic acid.

76. A gene editing system comprising: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: an EF-1 alpha (a) promoter; and a sequence downstream of the EF-la promoter that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2.

77. A gene editing system comprising: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2; and a second sequence downstream the first sequence encoding a self-cleaving peptide.

78. A gene editing system comprising: an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises: a first sequence encoding a self-cleaving peptide; and a second sequence downstream the first sequence that is independently at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 1 and SEQ ID NO: 2.

79. The gene editing system of any one of claims 76 to 78, wherein the gene editing system further comprises a sequence encoding for a barcode; and / or a sequence encoding for a guide nucleic acid.

80. A kit comprising the composition of claim 1, reagents, materials and instructions therefor.

81. A kit comprising the composition of claim 18, reagents, materials and instructions therefor.

82. A kit comprising the composition of claim 34, reagents, materials and instructions therefor.

83. A kit comprising the composition of claim 47, reagents, materials and instructions therefor.

84. A kit comprising the composition of claim 59, reagents, materials and instructions therefor.

85. A kit comprising the gene editing system of any one of claims 76-79, reagents, materials and instructions therefor.

86. A method of modifying expression of a transcriptional product in a cell, the method comprising: contacting the cell with a composition or a gene editing system of any one of claims 76 to 79, thereby modifying the expression of the transcriptional product in the cell, wherein the transcriptional product is an RNA or a protein.

87. A method of tagging a population of cells for isolation, the method comprising: contacting a population of cells with a composition of any one of claims 1 to 75; and isolating the population of cells that comprise a CD-4 or a CD-90 sequence.

88. The method of claim 87, wherein the method further comprises isolating a population of cells comprising one or more barcodes.

89. The method of claim 88, wherein the one or more barcodes are unique to a subset of cells within the population of cells.

90. The method of claim 87, wherein the method further comprises: contacting the population of cells with a gene editing system enzyme or a sequence encoding the gene editing system enzyme.

91. The method of claim 90, wherein the gene editing system enzyme comprises an endonuclease.

92. The method of claim 91, wherein the endonuclease comprises a Cas enzyme.

93. The method of claim 90, wherein the gene editing system enzyme comprises a deactivated Cas enzyme fused to a transcriptional repressor.

94. The method of claim 90, wherein the gene editing system enzyme comprises a deactivated Cas enzyme fused to a transcriptional activator.

95. A composition comprising: a gene editing system comprising:(a) an endonuclease or a polynucleotide having a sequence encoding the endonuclease; and(b) a lentiviral vector comprising a nucleic acid, wherein the nucleic acid comprises:(i) a sequence that encodes for a protein that is expressed on the surface of a cancer cell;(ii) a guide nucleic acid; and(iii) a barcode.

96. The composition of claim 95, wherein the cancer cell is a glioblastoma cell.

97. The composition of claim 95, wherein the protein is CD-4, CD-90, or a fragment thereof, wherein the fragment comprises SEQ ID NO: 1 or SEQ ID NO: 2.

98. The composition of claim 95, wherein the endonuclease is a Cas endonuclease.

99. The composition of claim 95, wherein the guide nucleic acid comprises a guide RNA.

100. The composition of claim 95, wherein the lentiviral vector further comprises a sequence that encodes for: a self-cleaving peptide, an EF-1 alpha (EF-la) promoter, a bacterial resistance gene, a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), Rev Response Element (RRE), a CAP binding site, a lac promoter, a lac operator, an M13 rev site, a T3 promoter, an RSV promoter, an HIV-1 Psi element, central polypurine tract / central termination sequence (cPPT / CTS), a fluorescent protein, a U6 promoter, an SV-40 polyA signal, a restriction enzyme site, a Kozak sequence, a cell marker sequence, a cell-type specific promoter sequence, an additional barcode, or combinations thereof.

101. A cell comprising the composition of any one of claims 1 to 75.

102. A cell comprising the gene editing system of any one of claims 76 to 79.

103. A cell comprising the composition of claim 95.

Images