Novel ribose phosphate diphosphokinase variant and l-amino acid production method using same
A ribose phosphate diphosphokinase variant polypeptide, with an altered amino acid at position 239, improves L-tryptophan and L-histidine production in Corynebacterium microorganisms, addressing inefficiencies in current fermentation methods and enabling higher yields for industrial use.
Patent Information
- Application Number
- PCT/KR2025/000948
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-26
- Filing Date
- 2025-01-16
- Publication Date
- 2025-07-31
AI Technical Summary
Current methods for producing L-tryptophan and L-histidine through microbial fermentation are inefficient and have not achieved large-scale industrialization, with tryptophan biosynthesis requiring high energy and histidine production facing low efficiency and environmental pollution issues.
A ribose phosphate diphosphokinase variant polypeptide is developed, where the amino acid at position 239 of the wild-type sequence is substituted with another amino acid, and this variant is introduced into Corynebacterium microorganisms to enhance PRPP supply, thereby increasing the production of L-tryptophan and L-histidine.
The variant polypeptide enhances L-tryptophan and L-histidine production capacities, achieving higher yields compared to unmodified microorganisms, facilitating large-scale industrial application.
Abstract
Description
Novel ribose phosphate diphosphokinase variant and method for producing L-amino acids using the same
[0001] The present application relates to a novel ribose phosphate diphosphokinase variant polypeptide; a polynucleotide encoding the variant polypeptide; a microorganism comprising the variant polypeptide or a polynucleotide encoding the variant polypeptide; and a method for producing L-amino acids, comprising the step of culturing the microorganism in a medium.
[0002] The process of producing target substances (e.g., amino acids) from microorganisms has been extensively studied as an environmentally friendly and safe production method. Among these, ongoing research has focused on producing large quantities of target substances from microorganisms of the genus Corynebacterium. Microorganisms of the genus Corynebacterium (Corynebacterium sp.), particularly Corynebacterium glutamicum, are Gram-positive microorganisms widely used for the production of L-amino acids and other useful substances.
[0003] L-amino acids, the basic building blocks of proteins, are essential raw materials for pharmaceuticals, food additives, animal feed, nutritional supplements, pesticides, and disinfectants. To produce L-amino acids and other useful substances, various research efforts are being conducted to develop high-efficiency production microorganisms and fermentation process technologies. For example, target-substance-specific approaches, such as increasing the expression of genes encoding enzymes involved in L-lysine biosynthesis or deleting genes unnecessary for biosynthesis, are primarily being utilized (US 8048650 B2).
[0004] L-tryptophan is an essential amino acid and has been widely used as a feed additive, pharmaceutical raw material for fluids, and health food material. It can be produced through chemical synthesis, enzymatic reaction, and fermentation, but currently, direct fermentation using microorganisms is mainly used. According to previous studies, it has been proven through actual quantitative analysis in cells that tryptophan biosynthesis requires the highest level of energy among the 20 amino acids (Proc. Natl. Acad. Sci. USA, (2002) V99, pp3695-3700). Therefore, research is needed to effectively increase L-tryptophan production.
[0005] L-histidine, one of the 20 standard amino acids, is classified as an essential amino acid for growing children. L-histidine participates in important physiological processes, including antioxidant activity and immune regulation, and is used in the medical industry as a raw material for gastrointestinal ulcer treatments, circulatory system treatments, and amino acid rehydration solutions. Histidine is particularly abundant in hemoglobin, so it is primarily produced through protein hydrolysis extraction using blood meal. However, this process has drawbacks such as low efficiency and environmental pollution. While L-histidine can be produced through microbial fermentation, large-scale industrialization has not yet been achieved. Therefore, research to effectively increase L-histidine production is still necessary.
[0006] Meanwhile, phosphoribosyl pyrophosphate (PRPP) is one of the precursors required for tryptophan and histidine biosynthesis, and is essential for enhancing tryptophan or histidine production. Previous studies have reported that when ribose phosphate diphosphokinase was overexpressed, histidine biosynthesis increased as the supply of PRPP increased (EP 1529839 A1).
[0007] The problem to be solved by the present application is to provide a ribose phosphate diphosphokinase variant polypeptide, in which the amino acid corresponding to position 239 of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid; a polynucleotide encoding the variant polypeptide; a microorganism comprising the variant polypeptide or the polynucleotide encoding the variant polypeptide; a method for producing L-amino acids, comprising the step of culturing the microorganism in a medium; and a use of the polypeptide, polynucleotide, or microorganism for producing L-amino acids.
[0008]
[0009] One aspect of the present application provides a ribose phosphate diphosphokinase variant polypeptide, wherein the amino acid corresponding to position 239 of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.
[0010] In one specific example, the variant polypeptide may have an amino acid corresponding to position 239 of the amino acid sequence of SEQ ID NO: 1 substituted with valine, proline, asparagine, methionine, glycine, or tyrosine.
[0011] In another specific embodiment, the variant polypeptide may be comprised of any one amino acid sequence selected from SEQ ID NOs: 15 to 20.
[0012] Another aspect of the present application provides a polynucleotide encoding the ribose phosphate diphosphokinase variant polypeptide.
[0013] Another aspect of the present application provides a microorganism comprising the ribose phosphate diphosphokinase variant polypeptide or a polynucleotide encoding the variant polypeptide.
[0014] In one specific example, the microorganism may have increased L-amino acid production capacity compared to a non-modified microorganism.
[0015] A microorganism according to any one of the preceding specific examples, wherein the microorganism may be a microorganism of the genus Corynebacterium.
[0016] As a microorganism according to any one of the preceding specific examples, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.
[0017] As a microorganism according to any one of the preceding specific examples, the L-amino acid may be at least one selected from the group consisting of L-tryptophan and L-histidine.
[0018] Another aspect of the present application provides a method for producing L-amino acid, comprising the step of culturing the microorganism in a medium.
[0019] In one specific example, the method may additionally include a step of recovering a target substance from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium.
[0020] Another aspect of the present application provides a composition for producing L-amino acids, comprising: the ribose phosphate diphosphokinase variant polypeptide; a polynucleotide encoding the variant polypeptide; a microorganism comprising the variant polypeptide or a polynucleotide encoding the variant polypeptide; a culture of the microorganism; or a combination of two or more thereof.
[0021] Another aspect of the present application provides a use for producing L-amino acids, comprising: the ribose phosphate diphosphokinase variant polypeptide; a polynucleotide encoding the variant polypeptide; a microorganism comprising the variant polypeptide or the polynucleotide encoding the variant polypeptide; or a culture of the microorganism.
[0022]
[0023] When culturing a microorganism comprising the ribose phosphate diphosphokinase variant polypeptide of the present application, high yields of L-amino acids can be produced compared to unmodified microorganisms.
[0024]
[0025] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.
[0026]
[0027] definition
[0028]
[0029] As used in the specification and appended claims of this application, the singular articles "a," "an," and "the" include plural referents unless otherwise stated. Furthermore, unless otherwise stated, singular terms include plurals, and plural terms include the singular. Furthermore, in the specification and appended claims of this application, unless otherwise stated, the use of "or" is intended to include "and / or."
[0030]
[0031] In this application, the term "about" may be used before a specific numerical value. As used herein, the term "about" encompasses not only the exact number described after the term, but also a range that is or is nearly that number. Whether a number is or is nearly the specific number described can be determined based on the context in which it is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. In another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, this is not a limitation.
[0032]
[0033] In this application, the terms "first, second, third," "i), ii), iii),," or "(a), (b), (c), (d),," may be used to distinguish each component. When the terms are used in connection with steps of a method, use, or analysis, these terms do not imply that they are performed consecutively or in order, for example, there may be no time interval between these steps, they may be performed simultaneously, or they may be performed sequentially, in reverse order, or randomly, with intervals of seconds, minutes, hours, days, or months.
[0034]
[0035] In this application, the term "consisting of" means that the proportion of a specific feature, step, component, or other component(s) described below the term totals 100%. The features, steps, components, or other components described below the term "consisting of" may be essential or mandatory. For example, other than the features, steps, components, or other components described below "consisting of," any other feature, step, component, or other component, or any non-essential feature, step, component, or other component may be excluded.
[0036] In this application, the term "consisting essentially of" means that the presence of one or more unspecified features, steps, components, or other components of the subject matter claimed in this application is not substantially affected by the presence of the unspecified one or more features, steps, components, or other components.
[0037] In this application, the term "comprising" means the presence of a feature, step, component, or other component described below the term, and does not exclude the presence of one or more additional features, steps, components, or other components. The features, steps, components, or other components described below "comprising" in this application may be essential or mandatory, but in some embodiments, other optional or non-essential features, steps, components, or other components may be further included.
[0038]
[0039] proteins, polypeptides, and variant polypeptides
[0040]
[0041] In this application, the term "protein" or "polypeptide" refers to a polymer or oligomer of consecutive amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably.
[0042]
[0043] In this application, the term "mature polypeptide or mature protein" refers to a polypeptide or protein in a form that lacks a signal sequence or a propeptide sequence. A mature polypeptide or mature protein may be a functional form of a polypeptide or protein. A mature polypeptide or mature protein refers to a polypeptide in its final form after translation and / or after posttranslational modification. For example, examples of such posttranslational modifications may include, but are not limited to, N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, and leader sequence removal.
[0044]
[0045] In this application, the term "wild type" means a naturally occurring polypeptide that does not have an artificial modification. When the term "wild type" is used in relation to a polypeptide, it means a naturally occurring polypeptide that does not have an artificial modification (such as a substitution, addition, or deletion) at one or more amino acid positions. Similarly, when the term "wild type" is used in relation to a polynucleotide, it means a naturally occurring polynucleotide that does not have an artificial modification (such as a substitution, addition, or deletion) at one or more nucleotide positions. However, a polynucleotide encoding a wild type polypeptide is not limited to a naturally occurring polynucleotide, and also includes a sequence encoding any wild type polypeptide.
[0046]
[0047] In the present application, the parent sequence or backbone refers to a reference sequence into which modifications are to be introduced for producing a mutant polypeptide. That is, the parent sequence may be a starting sequence into which mutations such as substitutions, additions, and / or deletions are to be introduced. The parent sequence may be a naturally occurring or wild type, or a variant in which one or more substitutions, additions, or deletions have occurred in the natural or wild type, or may be an artificially synthesized sequence.
[0048]
[0049] In the present application, the term "reference sequence" refers to a sequence that serves as a reference for specifying the Nth position in a specific amino acid sequence. For example, when a specific amino acid sequence and a reference sequence are aligned through a sequence alignment known in the art, and each amino acid residue of the specific amino acid sequence is numbered based on the alignment with reference to the amino acid residue position of the reference sequence, the position of the amino acid corresponding to the Nth position of the reference sequence within the specific amino acid sequence can be determined.
[0050]
[0051] In the present application, the term "Nth position" in an amino acid sequence may refer to an amino acid position corresponding to the Nth position, in addition to the Nth position. Specifically, it may include an amino acid position corresponding to any amino acid residue in a mature polypeptide disclosed in a specific amino acid sequence. The specific amino acid sequence may be the amino acid sequence of a reference sequence.
[0052]
[0053] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a specific sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in the amino acid sequence of a related protein or a reference sequence.
[0054] In the present application, the amino acid sequence of SEQ ID NO. 1 can be used as a reference sequence to determine the position of an amino acid in any amino acid sequence.
[0055] That is, the amino acid sequence of SEQ ID NO. 1 disclosed in the present application can be used to determine the corresponding amino acid residue in any polypeptide, and unless otherwise specified in the present application, residues of a particular amino acid sequence are numbered based on the amino acid sequence of SEQ ID NO. 1.
[0056] For example, any amino acid sequence can be aligned with the amino acid sequence of SEQ ID NO: 1, and based on this, each amino acid residue of the arbitrary amino acid sequence can be numbered by referring to the corresponding amino acid residue position of SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, addition, or deletion occurs, by comparing it with a query sequence (also referred to as a “reference sequence”).
[0057] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.
[0058] Multiple sequence alignment can also be used to identify corresponding amino acid residues in other polypeptides. Examples of multiple sequence alignment programs known in the art include MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS using ClustalW. EMMA (1.83 or higher; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), etc., and the default parameters of each of the above programs can be used, but are not limited thereto.
[0059] Additionally, if polypeptides diverged from the mature polypeptide of SEQ ID NO: 1 and their relationships cannot be detected by conventional sequence-based comparison, other pairwise sequence comparison algorithms can be used (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Higher sensitivity can be achieved in sequence-based searches by using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and can detect remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has more than one representation in a protein structure database. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use information from a variety of sources, such as PSI-BLAST, secondary structure predictions, structural alignment profiles, and solvation potentials, as input to a neural network that predicts the structural folding of a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919 can be used to align an unknown sequence with superfamily models available in the SCOP database. These alignments can in turn be used to build homology models for the polypeptide, and these models can be evaluated for accuracy using a variety of tools developed for this purpose.
[0060] For proteins with known structures, several tools and resources are available for searching and generating structural alignments. For example, the SCOP superfamily of proteins is structurally aligned, and these alignments are accessible and downloadable. Two or more protein structures can be aligned using various algorithms, such as distance alignment matrix alignment (Holm and Sander, 1998, Proteins 33: 88-96) or Combinatorial extension (CE) (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747). Implementations of these algorithms can additionally be used to query structural databases containing the target structure to discover possible structural homologues (Holm and Park, 2000, Bioinformatics 16: 566-567).
[0061] The above methods are examples and are not limiting.
[0062]
[0063] In the present application, with respect to an amino acid sequence, it is obvious that a polypeptide or protein “comprising” an amino acid sequence set forth in a specific sequence number, a polypeptide or protein “consisting of” an amino acid sequence set forth in a specific sequence number, or a polypeptide or protein “having” an amino acid sequence set forth in a specific sequence number may also include a polypeptide or protein in which some amino acid(s) are deleted, modified, substituted, or added, as long as it has the same or corresponding activity as a polypeptide or protein consisting of the amino acid sequence of the corresponding sequence number. For example, the polypeptide or protein may also include a polypeptide or protein having an amino acid(s) addition or deletion, a naturally occurring mutation, a silent mutation, or a conservative substitution within or before or after the polypeptide or protein (N-terminal or C-terminal), which does not alter the function of the protein, as long as it has the same or corresponding activity.
[0064] Also, for example, a polypeptide or protein conjugated with an N-terminal signal (or leader) sequence that is involved in translocation of a protein (polypeptide) co-translationally or post-translationally, or a polypeptide or protein conjugated with another sequence or linker so that the polypeptide or protein can be identified, purified, or synthesized, may also be included in the scope of the polypeptide or protein having the amino acid sequence set forth in the specific sequence number.
[0065] In this application, the term "conservative substitution" refers to the replacement of an amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; Amino acids with polar or hydrophilic side chains (polar amino acids) include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, amino acids with charged side chains include arginine, lysine, histidine, glutamic acid, and aspartic acid, while amino acids with uncharged side chains (also called neutral amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids.As another example, the 20 amino acids can be classified into five groups based on size: glycine, alanine, and serine; cysteine, proline, threonine, aspartic acid, and asparagine; valine, histidine, glutamic acid, and glutamine; isoleucine, leucine, methionine, lysine, and arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups. Typically, conservative substitutions may have little or no effect on the activity of a polypeptide or protein.
[0066] In this application, the term "other amino acid" is not limited to an amino acid different from the amino acid prior to substitution. Furthermore, when this application states that "a specific amino acid has been substituted," it is self-evident that the amino acid has been substituted with an amino acid different from the amino acid prior to substitution, even if it is not specifically stated that it has been substituted with another amino acid.
[0067]
[0068] In this application, "mutating / modifying" means changing or altering. This may be a change from a naturally occurring sequence. For example, a polypeptide may be modified in a way that causes the polypeptide to be altered from its parent sequence or reference sequence.
[0069] In the present application, the modified polypeptide may be a polypeptide that does not exist in nature itself, i.e., a non-naturally occurring polypeptide.
[0070] As used herein, the term "modified" means, for example, altered from a naturally occurring form. Modified polypeptides of the present application include non-naturally occurring polypeptides or naturally occurring variants. For example, modified polypeptides of the present application are modified polypeptides not found in nature. For example, modified polypeptides of the present application may be, but are not limited to, those that do not occur spontaneously.
[0071] When the term "modification" is used in relation to an amino acid / nucleic acid (nucleic acid) sequence in this application, it may include substitution of a parent amino acid / nucleotide with a different amino acid / nucleotide at one or more positions of the amino acid / nucleotide (nucleic acid) parent sequence, deletion of an amino acid / nucleotide (or a series of amino acids / nucleotides) at one or more positions of the amino acid / nucleotide (nucleic acid) parent sequence, insertion of an amino acid / nucleotide (or a series of amino acids / nucleotides) at one or more positions of the amino acid / nucleotide (nucleic acid) parent sequence, or any combination thereof. As an example, the deletion may include, but is not limited to, truncation of the N-terminal and / or C-terminal amino acid(s) or 5' and / or 3' nucleotide(s).
[0072]
[0073] As used herein, the term "variant" or "variant polypeptide" refers to a polypeptide that differs from the parent sequence by having one or more amino acids in the parent sequence by conservative substitution and / or modification (such as substitution, addition, or deletion). The functions or properties of such variant polypeptides may be increased, unchanged, or decreased compared to the native polypeptide. For example, some variant polypeptides may include variant polypeptides in which one or more regions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Furthermore, for example, other variant polypeptides may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term "variant polypeptide" may be used interchangeably with terms such as variant, modified, mutated protein, mutation, and variant (in English, modification, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto if the term is used in the meaning of variant.
[0074] Additionally, the variant polypeptide may contain deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the polypeptide N-terminus that is involved in co-translational or post-translational protein translocation. The polypeptide may also be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis of the polypeptide.
[0075]
[0076] The variant polypeptide of the present application may be in isolated form.
[0077] As used herein, the term "isolated" refers to a substance that exists in an environment where it does not occur naturally, or in a form that does not occur naturally. This includes the substance (sequence or nucleic acid) being at least substantially free from at least one other component with which it is naturally associated and found in nature, such as a sequence or nucleic acid.
[0078] For example, the isolated sequences or nucleic acids provided in the present application may be provided in a form substantially free of one or more contaminants.
[0079] Examples of isolated substances may include, but are not limited to, i) any non-naturally occurring substance, ii) any substance from which one, more, or all naturally occurring components associated with it in nature have been removed (e.g., an enzyme, variant, nucleic acid, protein, peptide, or cofactor), iii) any substance found in nature that has been artificially modified, or iv) a substance that has been modified to alter the amount of that substance relative to other naturally associated components (e.g., increasing the number of copies of a gene encoding the substance; modifying a promoter naturally associated with a gene encoding the substance to a more active promoter, etc.).
[0080] The variant polypeptide of the present application may comprise biologically active fragments of the variant polypeptide.
[0081] In the present application, with respect to amino acid or base (nucleic acid) sequences, the term "biologically active fragments or fragments" may refer to "functional fragments." A "functional fragment," which may also be referred to as an active fragment, refers to a polypeptide that contains fewer amino acids than a full-length protein but possesses at least one biological activity of the corresponding full-length protein. For example, a functional fragment of an enzyme may include the catalytic site of the enzyme.
[0082] Biologically active fragments of the variant polypeptides of the present invention may comprise a portion of the full length of the native polypeptide. For example, they may comprise at least about 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 98% of the full length of the native polypeptide; and less than 100% of the amino acids, but are not limited thereto.
[0083]
[0084] Throughout this application, the conventional one-letter and three-letter codes for naturally occurring amino acids are used. Furthermore, amino acids referred to by abbreviations in this application are described according to the IUPAC-IUB nomenclature.
[0085]
[0086] Alanine Ala, A Arginine Arg, R
[0087] Asparagine Asn, N Aspartic acid Asp, D
[0088] Cysteine Cys, C Glutamic acid Glu, E
[0089] Glutamine Gln, Q Glycine Gly, G
[0090] Histidine His, H Isoleucine Ile, I
[0091] Leucine Leu, L Lysine Lys, K
[0092] Methionine Met, M Phenylalanine Phe, F
[0093] Proline Pro, P Serine Ser, S
[0094] Threonine Thr, T Tryptophan Trp, W
[0095] Tyrosine Tyr, Y Valine Val, V
[0096]
[0097] Meanwhile, any amino acid can be written as Xaa, X.
[0098] Additionally, the generally accepted three-letter codes for other amino acids, such as Aib (2-Aminoisobutyric acid), Sar (N-methylglycine), and α-methyl-glutamic acid, may be used, as well as for naturally occurring amino acids.
[0099]
[0100] Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of their residues.
[0101] Examples of these classifications include positively charged (basic) amino acids such as arginine, lysine, and histidine; negatively charged (acidic) amino acids such as glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) such as glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; and amino acids with polar or hydrophilic side chains (polar amino acids) such as serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, amino acids with charged side chains (electrically charged amino acids) include arginine, lysine, histidine, glutamic acid, and aspartic acid; and amino acids with uncharged side chains (also called neutral amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids. As another example, the 20 amino acids can be classified by size into five groups: glycine, alanine, and serine; cysteine, proline, threonine, aspartic acid, and asparagine; valine, histidine, glutamic acid, and glutamine; isoleucine, leucine, methionine, lysine, and arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups.
[0102]
[0103] To describe the variants provided in this application, the following nomenclature is used.
[0104] In this application, reference to a specific position in an amino acid sequence may include reference to an amino acid present or substituted at that position. Reference to an amino acid at a specific position may be described in various ways. For example, "position 003" may be described as "position 3," "amino acid 3," or "the third amino acid." Furthermore, for example, if the amino acid at position 3 is serine (S), it may be described as "S3" or "Ser3."
[0105] Amino acid substitutions can be expressed by listing the amino acid before substitution, the position, and the amino acid being replaced. These amino acids can be expressed using conventional one-letter and three-letter codes. For example, if alanine, the amino acid at position 6 of a specific sequence, is replaced with valine, it can be written as "A8V" or "Ala8Val."
[0106] Any amino acid at a particular position can be designated as "X". For example, X6 refers to any amino acid at position 6. Also, when a substituted amino acid is designated as X, it means that it is replaced with an amino acid different from the amino acid present before the substitution. For example, "V6X" indicates that V is replaced with any amino acid other than V at position 6.
[0107]
[0108] genes, polynucleotides
[0109]
[0110] In this application, the term "gene" narrowly refers to a polynucleotide encoding a functional molecule, and broadly refers to a polynucleotide comprising a polynucleotide encoding the functional molecule and regions preceding and following the polynucleotide. In one specific example, the functional molecule may be RNA or a protein, and the gene may have a sequence (intron) inserted between each coding region (exon).
[0111]
[0112] In this application, the terms "polynucleotide," "nucleic acid," or "nucleic acid molecule" refer to a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, and mean a strand of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) of a certain length or longer. In this application, "polynucleotide," "nucleic acid," and "nucleic acid molecule" may be used interchangeably.
[0113]
[0114] identity, homology
[0115]
[0116] In this application, the terms "identity" or "homology" refer to the degree of similarity between two given amino acid or base sequences, which may be expressed as a percentage. In this application, "homology" and "identity" may often be used interchangeably.
[0117] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, which may be used in conjunction with default gap penalties established by the program being used.
[0118] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) or the GAP computer program such as the Smith-Waterman algorithm (Smith and Waterman, Adv. Appl. Math (1981) 2:482) can be determined by comparing the sequence information (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information database.
[0119]
[0120] Additionally, whether any two polynucleotide sequences have homology, similarity or identity can be determined by a Southern hybridization experiment under appropriate hybridization conditions, which can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto. For example, homologous or identical polynucleotide sequences can generally hybridize along the entire sequence or at least about 50%, 60%, 70%, 80% or 90% of the entire length under stringent conditions.
[0121] In this application, the term "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, it may be a condition in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or a condition in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS, which is a washing condition of a typical southern hybridization.
[0122] The above hybridization can occur between nucleotides having complementary base sequences; however, the hybridized polynucleotides may contain some mismatches between bases, depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar base sequences.
[0123] For example, a polynucleotide having homology or identity with the polynucleotide of the present application can be hybridized and detected at a Tm value of 55°C. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art.
[0124] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).
[0125]
[0126] Nucleic acid structures, vectors, and transformation
[0127]
[0128] As used herein, the term "nucleic acid construct" refers to an artificially designed single- or double-stranded nucleic acid molecule contained within a vector that can be used to integrate a target genetic material into a suitable host or host cell. For example, the nucleic acid construct may comprise a transgene delivered via a transformation vector that allows the inserted sequence to be replicated and / or expressed in the host cell. For example, the transgene may be cloned from an existing sequence or artificially synthesized.
[0129]
[0130] The term "vector" as used in this application means a DNA preparation for delivering a desired polynucleotide into a suitable host or host cell.
[0131] For example, a vector may comprise a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. After being transformed into a suitable host cell (microorganism), the vector may replicate or function independently of the host genome, or may be integrated into the genome itself to replicate or function.
[0132] Additionally, as an example, the vector of the present application may include a sequence for inserting a target polynucleotide into a chromosome. Insertion of the polynucleotide into the chromosome using the vector may be accomplished by any method known in the art, such as, but not limited to, homologous recombination.
[0133] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pDC series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. For example, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.
[0134] The above vector may further include a selection marker to determine whether the vector is transformed into a host cell or further, whether the vector is integrated into the host cell chromosome. The selection marker is used to select cells transformed with the vector or to determine whether the target polynucleotide is integrated into the chromosome. Markers that confer selectable phenotypes such as drug resistance, nutrient requirement, cytotoxic agent resistance, or surface polypeptide expression may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic characteristics, thereby enabling selection of transformed cells.
[0135] In this application, the term "transformation" refers to changing the genetic characteristics of a host cell (microorganism) by introducing a target polynucleotide, or a vector containing the same, into the host cell (microorganism). The transformed polynucleotide may be inserted into the chromosome of the host cell (microorganism) or located extrachromosomally. In addition, the polynucleotide may comprise DNA or RNA. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, a polynucleotide for expressing a target polypeptide may be introduced into a host cell (microorganism) in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the coding sequence of the target polypeptide. The expression cassette may be in the form of an expression vector capable of self-replication. Additionally, the polynucleotide may be introduced into a host cell (microorganism) in its own form and operably linked to a sequence necessary for expression in the host cell (microorganism), but is not limited thereto.
[0136] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately so that the regulatory sequence controls the expression of a coding sequence. Accordingly, "operably linked" includes a regulatory region of a functional domain with a known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, attached or linked to a target (gene or polypeptide) so that the expression, secretion, or function of the target can be controlled according to the known or desired activity. For example, it may mean that a promoter sequence that initiates and mediates the transcription of a polynucleotide encoding a polypeptide is functionally linked to the polynucleotide sequence.
[0137] As used herein, the term “expression” includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0138] As used herein, the term "expression vector" refers to a linear or circular nucleic acid molecule comprising a target polynucleotide sequence and a regulatory sequence operably linked thereto for expression thereof. For example, it may comprise the base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression regulatory region (or expression regulatory sequence) so as to enable expression of the target polypeptide in a suitable host.
[0139] In this application, the term "regulatory sequence" refers to a polynucleotide sequence necessary for controlling the expression of a target polynucleotide sequence. Each regulatory sequence may be a natural sequence (having the same origin) or a foreign sequence (derived from another gene) relative to the coding sequence, or a mutant sequence thereof, or another artificial sequence. Examples of the regulatory sequence include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that controls transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.
[0140]
[0141] In this application, the term "genetic recombination" means a natural or artificial process in which elements that make up genes, such as DNA or RNA, are changed from their original sequence during the disassembly and reassembly process.
[0142] As used herein, the term "recombinant gene" refers to a gene with a novel genetic structure resulting from genetic recombination, such as chemical synthesis or genetic engineering techniques. The terms "recombinant gene," "recombinant DNA," and "recombinant polynucleotide" may be used interchangeably in this application. For example, the recombinant gene may include an artificial combination of nucleic acid fragments, such as regulatory sequences, that are not found together in nature.
[0143] In this application, the term “recombinant protein” means a protein produced as a result of genetic recombination.
[0144]
[0145] microorganism
[0146]
[0147] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and prokaryotic or eukaryotic microorganisms that have undergone genetic modification, either naturally or artificially. It may be a microorganism that has a specific mechanism weakened or increased due to a cause such as the insertion of an external gene or the increased or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, the terms "microorganism," "strain," "host," and "host cell" may be used interchangeably.
[0148] As used herein, the term "recombinant microorganism" refers to a microorganism that has been genetically modified to exhibit a different genotype and / or phenotype compared to a naturally occurring microorganism (e.g., when the genetic modification affects the coding base (nucleic acid) sequence of the microorganism), and may include all progeny or potential progeny of the microorganism. The terms "recombinant microorganism," "genetically modified microorganism," "recombinant host cell," "recombinant cell," and "recombinant strain" may be used interchangeably in this application. The recombinant microorganism may, for example, express a gene not found in its native (non-recombinant) form; may not express a gene expressed in its native form; or may express a native gene in a manner different from that in which it is expressed in its native form.
[0149] For example, the microorganism of the present application may be, but is not limited to, a microorganism comprising at least one of a variant polypeptide of the present application, a polynucleotide of the present application, and a vector comprising a polynucleotide of the present application; a microorganism modified to express a variant polypeptide of the present application or a polynucleotide of the present application; a recombinant microorganism expressing a variant polypeptide of the present application or a polynucleotide of the present application; or a recombinant microorganism having the activity of a variant polypeptide of the present application.
[0150] In the present application, the term "microorganism having L-amino acid production ability" refers to a prokaryotic or eukaryotic microorganism capable of producing L-amino acids within the organism, and the microorganism may include not only a microorganism that inherently has L-amino acid production ability, but also a microorganism that does not inherently have L-amino acid production ability but has been endowed with L-amino acid production ability. The L-amino acid production ability may be endowed or enhanced by expression of the variant polypeptide of the present application or by species improvement.
[0151] In this application, the term "unmodified microorganism (strain)" does not exclude a microorganism (strain) that contains a mutation that can occur naturally, and may refer to a wild-type microorganism (strain) or a natural microorganism (strain) itself, or a microorganism (strain) before its phenotype is changed by a genetic mutation caused by natural or artificial factors. In this application, the term "unmodified microorganism (strain)" may be used interchangeably with "pre-modified microorganism (strain)", "unmodified microorganism (strain)", "parent microorganism", "parent strain", "wild-type microorganism (strain)", "reference microorganism (strain)", or "reference microorganism (strain)". In this application, an unmodified microorganism may refer to a microorganism (strain) into which a variant polypeptide of the present application is not introduced or before it is introduced; or a microorganism (strain) containing a wild-type polypeptide, but is not limited thereto. Additionally, in the present application, the unmodified microorganism may be a microorganism comprising a polypeptide consisting of SEQ ID NO: 1 or a polynucleotide consisting of SEQ ID NO: 2, but is not limited thereto.
[0152]
[0153] Increased protein (polypeptide) activity
[0154]
[0155] In this application, the term "increase" of protein (polypeptide) activity means that the activity of the protein (polypeptide) within a host cell (microorganism) is increased compared to its intrinsic activity. The increase may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement. The host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.
[0156] The increase in the above protein (polypeptide) activity may include the display of a protein (polypeptide) activity that the host cell (microorganism) did not inherently possess, or the display of an enhanced protein (polypeptide) activity compared to the inherent activity or activity before modification.
[0157] For example, the above “exhibiting a protein (polypeptide) activity that was not inherently present” or “exhibiting an improved protein (polypeptide) activity” may be due to, but is not limited to, “introduction of a protein (polypeptide).”
[0158] In this application, the term "introduction" of a protein (polypeptide) means that a gene that a microorganism did not originally possess is expressed within the microorganism, thereby causing the activity of a specific protein to be exhibited, or that the activity of the polypeptide is strengthened, increased, or improved compared to the intrinsic activity of the protein or the activity before modification. For example, this may be due to the introduction of a gene encoding the protein (polypeptide) into a host cell (microorganism). For example, a polynucleotide encoding a specific protein (polypeptide) may be introduced into the chromosome of a host cell (microorganism), or a vector containing a polynucleotide encoding a specific protein (polypeptide) may be introduced into the host cell (microorganism), thereby causing the activity of the protein (polypeptide) to be exhibited or improved.
[0159] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by a host cell (microorganism) or an untransformed host cell (microorganism) before transformation, when the trait changes due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before transformation."
[0160] An increase in the activity of a protein (polypeptide) compared to the intrinsic activity means that the activity and / or concentration (expression amount) of the protein (polypeptide) of the host cell (microorganism) is enhanced compared to the activity and / or concentration (expression amount) of the protein (polypeptide) originally present in the host cell (microorganism) before transformation or in the non-transformed host cell (microorganism).
[0161] For example, the increase may be, but is not limited to, an increase in the activity or concentration of the corresponding protein (polypeptide) from a previous state, or an increase in the activity or concentration thereof, typically by at least about 1%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 100%, at least about 150%, at least about 200%, at least about 300%, at least about 400%, or at least about 500%, up to at least about 1000% or at least about 2000%, relative to the activity or concentration in the host cell (microorganism) before transformation or in the untransformed host cell (microorganism).
[0162] An increase in the activity of the above protein (polypeptide) can be achieved by introducing an exogenous protein (polypeptide) or by increasing the activity of an endogenous protein (polypeptide). Whether the activity of the above protein (polypeptide) has increased can be confirmed by an increase in the activity level of the protein (polypeptide), the expression level, or the amount of a product resulting from the activity of the protein (polypeptide).
[0163] The increase in the activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited as long as the activity of the target protein (polypeptide) can be increased compared to the host cell (microorganism) before transformation. Specifically, it may be, but is not limited to, genetic engineering and / or protein engineering well known to those skilled in the art as routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0164] Specifically, the increase in activity of the protein (polypeptide) of the present application is
[0165] 1) Increase in the intracellular copy number of a polynucleotide encoding a protein (polypeptide);
[0166] 2) Modification of the gene expression control region on the chromosome that codes for a protein (polypeptide) (e.g., introduction of a mutation in the expression control region, replacement with a sequence having stronger activity, or insertion of a sequence having stronger activity);
[0167] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a protein (polypeptide);
[0168] 4) Modification of the amino acid sequence of the protein (polypeptide) so as to increase the activity of the protein (polypeptide);
[0169] 5) Modification of a polynucleotide sequence encoding a protein (polypeptide) such that the activity of the protein (polypeptide) is increased (e.g., modification of a polynucleotide sequence of a protein (polypeptide) encoding gene such that the protein (polypeptide) is modified such that the activity of the protein (polypeptide) is increased);
[0170] 6) Introduction of a foreign protein (polypeptide) that exhibits the activity of a protein (polypeptide) or a foreign polynucleotide encoding the same;
[0171] 7) Codon optimization of polynucleotides encoding proteins (polypeptides);
[0172] 8) Analyze the tertiary structure of the protein (polypeptide) and select the exposed area to modify or chemically modify it.
[0173] 9) Control of cellular localization of proteins (polypeptides); or
[0174] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.
[0175] for example,
[0176] The increase in the intracellular copy number of the polynucleotide encoding the protein (polypeptide) described above 1) may be caused by introducing a vector containing a polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence into a host cell (microorganism). Alternatively, one copy or two or more copies of the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence may be introduced into a chromosome within the host cell (microorganism). The introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome within the host cell (microorganism), but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural sequence (same in origin) or a foreign sequence (derived from another gene) to the polynucleotide sequence it encodes, or a mutant sequence thereof, or another artificial sequence, and may induce expression of the polynucleotide within the host cell (microorganism).
[0177] 2) The replacement of the gene expression control region (or expression control sequence) on the chromosome encoding the protein (polypeptide) with a sequence having strong activity may be, for example, introducing a mutation in the sequence by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a strong promoter, but is not limited thereto.
[0178] Examples of known strong promoters include, but are not limited to, the cj1 to cj7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.
[0179] The above 3) modification of the base sequence of the region encoding the initiation codon or 5'-UTR of the gene encoding the protein (polypeptide) may be, for example, a modification that encodes another initiation codon having a higher protein (polypeptide) expression rate than the endogenous initiation codon, or an RBS sequence having a higher protein (polypeptide) expression rate than the endogenous RBS (ribosome binding site) sequence, but is not limited thereto.
[0180] The modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) of the above 4) and 5) may be, but is not limited to, introducing a sequence mutation by deletion, insertion, substitution, or a combination thereof in the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) so as to increase the activity of the protein (polypeptide), or replacing it with an amino acid sequence or polynucleotide sequence modified to increase the activity. The replacement may be performed, for example, by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
[0181] The introduction of the foreign polynucleotide exhibiting the activity of the above 6) protein (polypeptide) may be the introduction into the host cell (microorganism) of a foreign polynucleotide encoding a protein (polypeptide) exhibiting the same / similar activity as the protein (polypeptide). The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the protein (polypeptide). The method used for the above introduction can be performed by a person skilled in the art appropriately selecting a known transformation method, and the protein (polypeptide) can be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.
[0182] The above 7) codon optimization of a polynucleotide encoding a protein (polypeptide) may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell (microorganism), or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell (microorganism).
[0183] The above 8) analyzing the tertiary structure of a protein (polypeptide) and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the protein (polypeptide) to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.
[0184] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.
[0185] Such an increase in protein (polypeptide) activity may be, but is not limited to, an increase in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild type or pre-transformed host cell (microorganism), or an increase in the amount of a product resulting from the activity of the corresponding protein (polypeptide).
[0186]
[0187] Modification of part or all of the polynucleotide in the host cell (microorganism) of the present application may be induced by, but is not limited to, (a) a method using homologous recombination using a vector for chromosomal insertion or genome editing using genetic scissors (engineered nuclease, e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation.
[0188]
[0189] culture
[0190]
[0191] In this application, the term "cultivation" refers to the growth of microorganisms under appropriately controlled environmental conditions. The cultivation process can be conducted using appropriate media and culture conditions known in the art. This cultivation process can be easily adjusted and used by those skilled in the art depending on the selected microorganism. Specifically, the cultivation process may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0192] In this application, the term "medium" refers to a material containing nutrients necessary for culturing microorganisms as its main component, and supplies nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of this application may be any medium used for culturing conventional microorganisms without particular limitation. For example, the microorganisms of this application may be cultured under aerobic conditions by controlling temperature, pH, etc. in a conventional medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins. For example, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].
[0193] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
[0194] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
[0195] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.
[0196] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.
[0197] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.
[0198] In the present application, the term "culture" means a culture solution, concentrated culture solution, dried product of culture solution, culture filtrate, concentrated culture filtrate, or dried product of culture filtrate obtained by culturing a specific microorganism in a culture medium, wherein the culture solution means that it contains a specific microorganism, and the culture filtrate means that it does not substantially contain a specific microorganism (here, substantially means that a specific microorganism separated by filtration or the like is excluded, but does not mean that the filtrate is completely free of microorganisms). The culture is not limited in its formulation, and may be, for example, a liquid, an emulsion, or a solid.
[0199] In this application, the term "fermentation" refers to a process in which microorganisms use their enzymes to decompose organic matter, but not to a putrefaction reaction. While fermentation and putrefaction occur through similar processes, if the resulting decomposition produces useful substances, it is called fermentation. If the resulting decomposition produces foul-smelling or harmful substances, it is called putrefaction.
[0200] In the present application, the method for obtaining a fermented product from the microorganism is not particularly limited, and the product can be obtained according to a method commonly used in the relevant technical field or a similar field.
[0201] In the present application, the term "fermentation" includes all kinds of substances including a fermentation product produced from the microorganism, such as not only the fermented substance itself, but also a substance containing a fermented microorganism, a culture produced from the fermented microorganism, a fermentation product of the culture, a concentrated fermentation product, a dried product of the fermentation product, a filtrate of the fermentation product, a concentrated filtrate of the fermentation product, or a dried product of the fermentation product filtrate, an extract of the fermentation product, or a dilution of the fermentation product.
[0202]
[0203] Specific description of this application
[0204]
[0205] Hereinafter, specific examples of the present application will be described in more detail as follows.
[0206]
[0207] One aspect of the present application provides a ribose phosphate diphosphokinase variant polypeptide, wherein the amino acid corresponding to position 239 of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.
[0208] In this application, the term "ribose-phosphate diphosphokinase (PRSA)" refers to an enzyme that converts ribose 5-phosphate into phosphoribosyl pyrophosphate. The ribose-phosphate diphosphokinase of this application may be used interchangeably with PRSA.
[0209] Specifically, the ribose phosphate diphosphokinase protein of the present application may be a protein having ribose phosphate diphosphokinase activity encoded by the prsA gene, but is not particularly limited in type as long as it has an activity corresponding to ribose phosphate diphosphokinase. The ribose phosphate diphosphokinase protein encoded by the prsA gene is known in the art, and the amino acid and polynucleotide sequences of the ribose phosphate diphosphokinase protein can be obtained from known databases, such as, but not limited to, NCBI's GenBank.
[0210]
[0211] For example, the ribose phosphate diphosphokinase protein that is the target of mutation introduction in the present application may include the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has ribose phosphate diphosphokinase activity. Specifically, even if it includes a sequence in which some sequences are deleted, modified, substituted or added in the amino acid sequence of SEQ ID NO: 1, as long as it is a protein that exhibits an effect corresponding to the ribose phosphate diphosphokinase, it may be included in the ribose phosphate diphosphokinase protein. Additionally, any protein having, including, consisting of, or essentially consisting of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of the above sequence number 1, and exhibiting an effect corresponding to the above ribose phosphate diphosphokinase, may be included in the above ribose phosphate diphosphokinase protein.
[0212]
[0213] In addition, the sequence of a polynucleotide encoding a ribose phosphate diphosphokinase protein having the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 60% or more homology or identity therewith can be obtained, for example, based on codon information known in the art. For example, the ribose phosphate diphosphokinase protein may be encoded by a polynucleotide having or including a sequence of SEQ ID NO: 2 or a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO: 2, or consisting of or consisting essentially of the base sequence, but is not limited thereto. In addition, the base sequence of the above sequence number 2 can be obtained from a known database, such as, but not limited to, NCBI's GenBank.
[0214] In the present application, the polynucleotide (gene) including the base sequence of SEQ ID NO: 2 may be used interchangeably with a polynucleotide (gene) having the base sequence of SEQ ID NO: 2, a polynucleotide (gene) consisting of the base sequence of SEQ ID NO: 2, or prsA.
[0215]
[0216] The ribose phosphate diphosphokinase variant polypeptide of the present application may be a variant polypeptide in which the amino acid corresponding to position 239 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
[0217] The ribose phosphate diphosphokinase variant polypeptide of the present application may include an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% homology or identity with the amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 1, wherein the amino acid corresponding to the 239th position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. In addition, it is obvious that a variant having an amino acid sequence in which a part of the sequence is deleted, substituted, conservatively substituted or added is also included within the scope of the present application, as long as it includes the amino acid substitution and has the homology or identity as described above and exhibits an effect corresponding to the variant of the present application.
[0218] The above "other amino acid" is not limited to an amino acid different from the amino acid prior to substitution. Furthermore, when the present application states that "a specific amino acid has been substituted," it is self-evident that the amino acid has been substituted with an amino acid different from the amino acid prior to substitution, even if it is not specifically stated that it has been substituted with another amino acid.
[0219] In the present application, when it is described that “the amino acid corresponding to the 239th position of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid,” it may mean that it is replaced with glutamate, phenylalanine, glycine, arginine, aspartate, cysteine, asparagine, glutamine, histidine, proline, serine, tyrosine, isoleucine, lysine, tryptophan, valine, methionine, threonine or leucine, excluding alanine, but is not limited thereto.
[0220] In any one of the above-described embodiments, the ribose phosphate diphosphokinase variant polypeptide provided in the present application may be one in which the amino acid corresponding to the 239th position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with any one amino acid selected from among glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine, which are amino acids having an uncharged side chain.
[0221] In any one of the embodiments described above, the ribose phosphate diphosphokinase variant polypeptide of the present application may be one in which the amino acid corresponding to position 239 of the amino acid sequence of SEQ ID NO: 1 is substituted with valine, proline, asparagine, methionine, glycine or tyrosine.
[0222] For example, the ribose phosphate diphosphokinase variant polypeptide of the present application may include an amino acid sequence in which the amino acid corresponding to position 239 in the amino acid sequence set forth in SEQ ID NO: 1, namely valine, proline, asparagine, methionine, glycine or tyrosine, is fixed and has at least 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, or 98% or more; and less than 100% homology or identity with SEQ ID NO: 1. In addition, it is obvious that a ribose phosphate diphosphokinase variant polypeptide having an amino acid sequence in which some of the sequences are deleted, modified, substituted, conservatively substituted or added is also included within the scope of the present application, provided that the amino acid sequence has such homology or identity and exhibits an effect corresponding to that of the ribose phosphate diphosphokinase variant polypeptide of the present application.
[0223]
[0224] In another specific embodiment, the variant polypeptide may be comprised of any one amino acid sequence selected from SEQ ID NOs: 15 to 20.
[0225] Specifically, the variant polypeptide of the present application may have, comprise, consist of, or consist essentially of an amino acid sequence selected from any one of SEQ ID NOs: 15 to 20 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with any one of SEQ ID NOs: 15 to 20.
[0226]
[0227] Another aspect of the present application provides a polynucleotide encoding the ribose phosphate diphosphokinase variant polypeptide.
[0228] The polynucleotide encoding the ribose phosphate diphosphokinase variant polypeptide of the present application may include, without limitation, any polynucleotide sequence encoding the variant polypeptide of the present application. The polynucleotide may be prepared based on codon information known in the art, but is not limited thereto. For example, the polynucleotide may have, include, consist of, or consist essentially of any one base sequence selected from SEQ ID NOs: 47 to 52.
[0229] The polynucleotide of the present application may undergo various modifications in the coding region without altering the amino acid sequence of the variant polypeptide of the present application due to codon degeneracy or in consideration of the codons preferred by the organism to which the variant polypeptide of the present application is to be expressed. Therefore, it is obvious that the polynucleotide of the present application may also include a polynucleotide that can be translated into a polypeptide consisting of the amino acid sequence of the variant polypeptide of the present application or a polypeptide having homology or identity therewith due to codon degeneracy. For example, the polynucleotide of the present application may be any one base sequence selected from SEQ ID NOs: 47 to 52 or a degenerated sequence thereof.
[0230] As another example, the polynucleotide of the present application may have, comprise, consist of, or consist essentially of any one of the base sequences selected from SEQ ID NOs: 47 to 52 or a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity therewith, but is not limited thereto. As an example, the polynucleotide of the present application may include a base sequence in which a codon encoding an amino acid corresponding to position 239 of one of SEQ ID NOs: 15 to 20 is fixed as one of the codons encoding valine, proline, asparagine, methionine, glycine, or tyrosine.
[0231] Additionally, the polynucleotide of the present application can be prepared from a known genetic sequence, for example, a probe capable of hybridizing under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application, and may include, without limitation, a sequence encoding a variant polypeptide of the present application. Stringent conditions are as described above.
[0232]
[0233] Another aspect of the present application provides a vector comprising the polynucleotide. The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a microorganism.
[0234]
[0235] Another aspect of the present application provides a microorganism comprising the ribose phosphate diphosphokinase variant polypeptide or a polynucleotide encoding the variant polypeptide.
[0236] In one specific example, the microorganism of the present application may be a microorganism having L-amino acid production ability.
[0237] In the present application, the L-amino acid may be specifically at least one selected from the group consisting of L-tryptophan and L-histidine.
[0238] The microorganism of the present application includes, but is not limited to, a microorganism in which a chromosomal gene encoding the ribose phosphate diphosphokinase polypeptide of the present application is mutated and thus comprises a ribose phosphate diphosphokinase variant polypeptide sequence of the present application; and / or a microorganism in which a polynucleotide encoding the ribose phosphate diphosphokinase variant polypeptide of the present application or a vector comprising the same is introduced to comprise the ribose phosphate diphosphokinase variant polypeptide of the present application.
[0239] For the purposes of the present application, the microorganism of the present application may include any microorganism that comprises the ribose phosphate diphosphokinase variant polypeptide of the present application and is capable of producing a desired L-amino acid. For example, the microorganism of the present application may be a microorganism that has increased L-amino acid production ability by being transformed with a vector comprising a polynucleotide encoding the ribose phosphate diphosphokinase variant polypeptide of the present application, thereby expressing the variant polypeptide of the present application, but is not limited thereto. For another example, the microorganism of the present application may be a microorganism that has increased L-amino acid production ability by introducing a polynucleotide encoding the ribose phosphate diphosphokinase variant polypeptide of the present application into a natural wild-type microorganism or a microorganism that produces L-amino acids, thereby expressing the variant polypeptide of the present application, but is not limited thereto. The microorganism with increased L-amino acid productivity may be a genetically engineered microorganism or a recombinant microorganism, and the microorganism with increased L-amino acid productivity may be a microorganism with increased L-amino acid productivity compared to a natural wild-type microorganism or an unmodified microorganism (e.g., a microorganism expressing a wild-type polypeptide or a polypeptide including a parent sequence; or a microorganism that does not express the ribose phosphate diphosphokinase variant polypeptide of the present application), but is not limited thereto.
[0240] For example, the microorganism having the ability to produce L-amino acids of the present application may include any microorganism that is transformed with a vector to express the ribose phosphate diphosphokinase variant polypeptide of the present application and produce L-amino acids.
[0241] The microorganism of the present application may include any microorganism capable of expressing the ribose phosphate diphosphokinase variant polypeptide of the present application by various known methods in addition to the introduction of the polynucleotide or vector.
[0242] For example, the microorganism with increased L-amino acid production ability of the present application may be a microorganism with increased L-amino acid production ability compared to a parent microorganism (parent strain) before mutation or an unmodified microorganism (e.g., a wild-type polypeptide, a polypeptide including a parent sequence; or a microorganism expressing a polypeptide of SEQ ID NO: 1; or a microorganism that does not express a ribose phosphate diphosphokinase variant polypeptide of the present application), but is not limited thereto. For example, the parent microorganism (parent strain) or non-mutated microorganism to be compared for the increase in L-amino acid production ability may be, but is not limited to, CM05-9157 (Republic of Korea Patent No. 10-2278000), CA14-0809 (KCCM12489P, Republic of Korea Patent Application No. 10-2019-0046934), CM05-9157β or CA14-0809βprsA (B.su) strains.
[0243] For example, the microorganism with increased L-amino acid productivity has an L-amino acid productivity of about 1% or more, specifically, about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 10.5% or more, about 11% or more, about 11.5% or more, about 12% or more, about 12.5% or more, about 13% or more, about 13.5% or more, about 14% or more, about 14.5% or more, about 15% or more, or about 15.5% or more (the upper limit is not particularly limited, and for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% It may be increased by about 35% or less, about 30% or less, or about 25% or less), but is not limited thereto, as long as it has a positive increase compared to the productivity of the parent microorganism (parent strain) before mutation or the non-mutated microorganism. In another example, the recombinant microorganism with increased L-amino acid productivity may have an L-amino acid productivity increased by about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, about 1.14 times or more, or about 1.15 times or more (the upper limit is not particularly limited, and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, about 1.45 times or less, about 1.4 times or less, about 1.35 times or less, about 1.3 times or less, or about 1.25 times or less) compared to the parent microorganism (parent strain) before mutation or the unmodified microorganism, but is not limited thereto.
[0244]
[0245] For example, the microorganism having the ability to produce L-amino acids may be either a prokaryotic cell or a eukaryotic cell, but may specifically be a prokaryotic cell. The prokaryotic cell may include, but is not limited to, a microorganism belonging to the genus Escherichia sp., Erwinia sp., Serratia sp., Providencia sp., Corynebacteria sp., Pseudomonas sp., Leptospirasp., Salmonella sp., Brevibacteria sp., Hypomononas sp., Chromobacterium sp., or Norcardia sp. Specifically, it may be a microorganism of the genus Escherichia or the genus Corynebacterium. More specifically, it may be a microorganism of the genus Corynebacterium.
[0246] The above Corynebacterium genus microorganisms include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, and Corynebacterium. It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. Specifically, the microorganism of the present application may be, but is not limited to, Corynebacterium glutamicum.
[0247] Meanwhile, although it has already been known that microorganisms of the genus Corynebacterium can produce L-amino acids, neither the genes nor the mechanism underlying the production have been fully elucidated. Therefore, the Corynebacterium microorganism having L-amino acid production ability of the present application may include a natural wild-type microorganism itself, a Corynebacterium microorganism having enhanced L-amino acid production ability by strengthening or weakening the activity of genes related to the L-amino acid production mechanism, or a Corynebacterium microorganism having enhanced L-amino acid production ability by introducing or strengthening the activity of an external gene.
[0248]
[0249] Another aspect of the present application provides a method for producing L-amino acids, comprising the step of culturing a microorganism comprising a ribose phosphate diphosphokinase variant polypeptide in which the amino acid corresponding to position 239 of the amino acid sequence of SEQ ID NO: 1 of the present application is substituted with another amino acid, or a polynucleotide encoding the variant polypeptide, in a medium.
[0250] In the method of the present application, the ribose phosphate diphosphokinase variant polypeptide, polynucleotide, microorganism, L-amino acid, etc. are as described in the other embodiments above.
[0251] In the method of the present application, any culture conditions and methods known in the art can be used to cultivate microorganisms. Those skilled in the art can easily adjust and use these culture processes depending on the selected microorganism.
[0252] L-amino acids produced by the culture of the present invention may be secreted into the medium or remain within the cells.
[0253]
[0254] In one specific example, the method for producing L-amino acids of the present application may further include a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.
[0255] The L-amino acid production method of the present application may further include a step of recovering a target substance, specifically an L-amino acid, from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium. The recovering step may be additionally included after the culturing step.
[0256] The above recovery may be performed by collecting the target L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target substance, specifically, the L-amino acid, may be recovered from the medium or microorganism using a suitable method known in the art.
[0257] Additionally, the L-amino acid production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the L-amino acid production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.
[0258]
[0259] Another aspect of the present application provides a composition for producing L-amino acids, comprising: a ribose phosphate diphosphokinase variant polypeptide of the present application; a polynucleotide encoding the variant polypeptide; a microorganism comprising the variant polypeptide or a polynucleotide encoding the variant polypeptide; a culture of the microorganism; or a combination of two or more thereof.
[0260] In the composition of the present application, the ribose phosphate diphosphokinase variant polypeptide, polynucleotide, microorganism, culture, and L-amino acid are as described in the other embodiments above.
[0261] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing L-amino acids, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.
[0262] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount, or an amount that can be suitably present in the composition for production.
[0263]
[0264] Another aspect of the present application provides a use of a ribose phosphate diphosphokinase variant polypeptide of the present application; or a microorganism comprising the variant polypeptide or a polynucleotide encoding the variant polypeptide; or a culture of the microorganism for producing L-amino acids.
[0265] In the purposes of the present application, the ribose phosphate diphosphokinase variant polypeptide, microorganism, L-amino acid, etc. are as described in the other embodiments above.
[0266]
[0267] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.
[0268]
[0269] Example 1. Production of L-tryptophan-producing microorganisms with ribose phosphate diphosphokinase derived from Bacillus subtilis
[0270]
[0271] Example 1-1. Production of vectors for gene insertion
[0272] To insert a gene into the Corynebacterium chromosome, plasmid pDCM2 (Korean Patent No. 10-2278000) was used as a parent vector, and to enhance the activity of ribose phosphate diphosphokinase, a plasmid was constructed to additionally insert the prsA gene using the Pcj7 promoter (Korean Patent No. 10-0620092).
[0273] Specifically, using the wild-type Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template, the upstream region where homologous recombination occurs on the chromosome was amplified using the primer pair of SEQ ID NO: 3 and SEQ ID NO: 4, and the downstream region was amplified using the primer pair of SEQ ID NO: 5 and SEQ ID NO: 6, and then each gene fragment was obtained. The primer sequences used are as shown in Table 1 below.
[0274] Sequence number Primer name Sequence (5'→3') 3HL1 FaacgacggccagtgaattcTCGTTGGCCATTACCTCAT 4HL1 RctgtttAGTACTaaaccggaagggccTTATCTGCCACACCCACAA 5HR1 FcggtttAGTACTaaacaggaagagccTAAAAACGGAAGAGCCACT 6HR1 RttgcatgcctgcaggtcgacGGAAGACTATCCAAGGTGG
[0275] PCR was performed to obtain the above fragments. SolgTM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification was performed under the following conditions: denaturation at 95°C for 4 minutes, followed by 27 cycles of denaturation at 95°C for 2 seconds, annealing at 55°C for 2 seconds, and polymerization at 72°C for 2 seconds, followed by polymerization at 72°C for 5 minutes.
[0276] The upstream fragment and downstream fragment of the region where homologous recombination on the chromosome occurs, obtained through the above process, and the chromosomal transformation vector pDCM2 cut with EcoRI and SalI restriction enzymes were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2-ΔTn.
[0277]
[0278] Example 1-2. Vector construction for introducing ribose phosphate diphosphokinase derived from Bacillus subtilis.
[0279]
[0280] First, to secure the Pcj7 promoter, PCR was performed using p117-cj7-gfp (US 7662943 B2) as a template and primers of sequence numbers 7 and 8 in Table 2 below. The polymerase was Solg TMPfu-X DNA polymerase (SolGent co.) was used, and the PCR amplification conditions were as follows: denaturation at 95°C for 2 minutes, followed by 27 cycles of denaturation at 95°C, annealing at 55°C, and polymerization at 72°C, followed by polymerization at 72°C for 5 minutes.
[0281] Ribose phosphate diphosphokinase from Bacillus subtilis has an amino acid sequence represented by SEQ ID NO: 1. Information on the gene encoding ribose phosphate diphosphokinase and the surrounding base sequence (accession number NC_000964.3, SEQ ID NO: 2) was obtained from the National Institutes of Health (NIH) GenBank. Based on the obtained base sequence, primers for inserting the Bacillus subtilis-derived gene into Corynebacterium glutamicum genomic DNA were synthesized.
[0282] The ribose phosphate diphosphokinase gene of Bacillus subtilis was synthesized using the gene synthesis service of Bionics Co., Ltd., and PCR was performed using primers of sequence numbers 9 and 10 in Table 2 below. The polymerase was Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were as follows: denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 55°C for 2 seconds, polymerization at 72°C for 1 minute, repeated 27 times, and then polymerization reaction at 72°C for 5 minutes.
[0283] Sequence number Primer name Sequence (5'→3') 7P_Pcj7_ref-FtaaggcccttccggtttagtAGAAACATCCCAGCGCTACT 8P_Pcj7(B. su)_ref-RtctccgtattgattagacatGAGTGTTTCCTTTCGTTGGG 9G_prs(B. su)-FcccaacgaaaggaaacactcATGTCTAATCAATACGGAGA 10G_prs(B. su)-RttaggctcttcctgtttagtTTAGCTGAACAGATAGCTGA
[0284] Next, the amplified Pcj7 promoter region, the Bacillus subtilis-derived gene fragment, and the chromosomal transformation vector pDCM2-△Tn digested with ScaI restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2-β. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and storing it at 50℃ for 1 hour.
[0285]
[0286] Example 1-3. Production of L-tryptophan-producing microorganisms with ribose phosphate diphosphokinase derived from Bacillus subtilis
[0287]
[0288] The pDCM2-β vector constructed in Example 1-2 was transformed into the L-tryptophan producing strain CM05-9157 (Korean Patent No. 10-2278000) by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a second crossing over process was performed to obtain a strain in which one copy of the Pcj7-prsA (B.su) gene was inserted between transposon genes on the chromosome. Thereafter, the genetic manipulation was confirmed through PCR using primers of SEQ ID NOs: 13 and 14 in Table 3 below, which can amplify the external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, and genome sequencing.
[0289] Sequence number name sequence (5' → 3') 13Confirm-Pcj7-prs-FGTTCGGCTTGGATTATGG 14Confirm-Pcj7-prs-RCATCAACAACAGCCTTCA
[0290] The strain obtained by the above method was named CM05-9157β.
[0291]
[0292] Example 2. Evaluation of L-tryptophan production ability of L-tryptophan-producing microorganisms introduced with ribose phosphate diphosphokinase derived from Bacillus subtilis.
[0293]
[0294] In order to confirm the L-tryptophan production ability of the CM05-9157β strain and the parent strain CM05-9157 produced in Example 1-3, the strains were cultured using the following method and medium composition.
[0295] First, each strain was inoculated into a 250-mL corner-baffle flask containing 25 mL of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 mL of the seed culture was inoculated into a 250-mL corner-baffle flask containing 25 mL of production medium and cultured at 30°C for 24 hours with shaking at 200 rpm. After completion of culture, the production amount of L-tryptophan was measured by HPLC.
[0296]
[0297] <Seed medium (pH 7.0)>
[0298] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg (based on 1 liter of distilled water)
[0299]
[0300] <Production medium (pH 7.0)>
[0301] Glucose 30 g, (NH4)2SO4 15 g, MgSO4·7H2O 1.2 g, KH2PO4 1 g, yeast extract 5 g, biotin 900 μg, thiamine hydrochloride 4500 μg, calcium-pantothenic acid 4500 μg, CaCO3 30 g (based on 1 liter of distilled water).
[0302]
[0303] As a result of the experiment, the L-tryptophan production of each strain was shown in Table 4 below.
[0304] Strain OD562 Tryptophan production (g / L) Tryptophan yield (*100 g / g, %) CM05-9157 56.31.886.37 CM05-9157 β53.12.297.74
[0305] The CM05-9157β strain, into which the ribose phosphate diphosphokinase gene from Bacillus subtilis was introduced, produced a final L-tryptophan content of 2.29 g / L in flask culture, which was a fermentation yield that was approximately 21% higher than that of the control strain, CM05-9157. This suggests that the L-tryptophan production capacity of a Corynebacterium glutamicum strain can be significantly increased by introducing the ribose phosphate diphosphokinase gene from Bacillus subtilis.
[0306]
[0307] Example 3. Production of an L-tryptophan-producing microorganism with a mutant in which the 239th amino acid of wild-type ribose phosphate diphosphokinase from Bacillus subtilis is substituted.
[0308]
[0309] To further enhance the activity of ribose phosphate diphosphokinase derived from Bacillus subtilis, a mutant was constructed in which the 239th amino acid, alanine (hereinafter referred to as alanine 239 or alanine 239), was substituted with another amino acid. To introduce mutations to amino acids other than alanine, site-directed mutagenesis was used using pDCM2-β of Example 1 as a template. Site-directed mutagenesis was performed according to the PCR composition and PCR cycles shown in Tables 5 and 6 below.
[0310] Site-Direction Mutagenesis PCR composition unit (ul)10X pfu-
[0311] CycleTemperatureTime195 ℃1 min1895 ℃50 sec60 ℃50 sec68 ℃8 min168 ℃7 min
[0312] In order to replace the 239th amino acid alanine in the prsA (B.su) amino acid sequence with other amino acids such as valine (V) (SEQ ID NO: 15), proline (P) (SEQ ID NO: 16), asparagine (N) (SEQ ID NO: 17), methionine (M) (SEQ ID NO: 18), glycine (G) (SEQ ID NO: 19), and tyrosine (Y) (SEQ ID NO: 20), each mutagenic primer set listed in Table 7 was used to prepare a PCR mixture as shown in Table 5, and PCR was performed with the cycles listed in Table 6. After PCR was completed, 1 ㎕ of DpnI restriction enzyme was added, followed by treatment at 37℃ for 1 hour. 3 ㎕ of DpnI-treated DNA was transformed into DH5a competent cells to obtain the pDCM2-β mutant plasmid, and it was confirmed through sequencing that it had been replaced with each mutation listed in Table 7.
[0313] Mutant prsA (B.su) plasmid sequence number sequence (5'-3') pDCM2-βA239V21cttgctgctaatgtgctcgttgaaaacggagcgaa22ctccgttttcaacgagcacattagcagcaagtgtapDCM2-βA239P23cttgctgctaatccactcgttgaaaacggagcgaa24ctccgttttcaacgagtggattagcagcaagtgtapDCM2-βA239N25cttgctgctaataacctcgttgaaaacggagcgaa26ctccgttttcaacgaggttattagca gcaagtgtapDCM2-βA239M27cttgctgctaatatgctcgttgaaaacggagcgaa28ctccgttttcaacgagcatattagcagcaagtgtapDCM2-βA239G29cttgctgctaatggcctcgttgaa aacggagcgaa30ctccgttttcaacgaggccattagcagcaagtgtapDCM2-βA239Y31cttgctgctaattacctcgttgaaaacggagcgaa32ctccgttttcaacgaggtaattagcagcaagtgta
[0314] The vectors pDCM2-βA239V, pDCM2-βA239P, pDCM2-βA239N, pDCM2-βA239M, pDCM2-βA239G, and pDCM2-βA239Y constructed as shown in Table 7 above were transformed into the L-tryptophan-producing strain CM05-9157 constructed in Example 1-3 by electroporation, and then six strains with the mutant prsA (B.su) gene inserted on the chromosome were obtained through a secondary crossing process. The genetic manipulation was confirmed through PCR using primers of SEQ ID NOs: 33 and 34 that can amplify the external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, respectively, and genome sequencing.
[0315] The transformed strains thus obtained were named CM05-9157βprsA(B.su) A239V), CM05-9157βprsA(B.su) A239P), CM05-9157βprsA(B.su) A239N), CM05-9157βprsA(B.su) A239M), CM05-9157βprsA(B.su) A239G), CM05-9157βprsA(B.su) A239Y, respectively.
[0316]
[0317] Example 4. Evaluation of L-tryptophan production ability of L-tryptophan-producing microorganisms with a mutant in which the 239th amino acid of wild-type ribose phosphate diphosphokinase from Bacillus subtilis is substituted.
[0318]
[0319] In order to compare the L-tryptophan production of the six strains produced in Example 3 and CM05-9157β, they were cultured using the same method as in Example 2. After the culture was completed, the production of L-tryptophan was measured using HPLC.
[0320] As a result of the experiment, as shown in Table 8 below, the L-tryptophan production of the CM05-0157β strain into which the prsA (B.su) A239V mutation was introduced was 8.98 g / L, which was confirmed to be an approximately 15.6% increase in yield compared to the control CM05-9157β strain into which the wild-type prsA (B.su) protein was introduced. In addition, it was confirmed that the CM05-9157βprsA(B.su) A239P) strain improved yield by about 14.3%, the CM05-9157βprsA(B.su) A239N) strain improved yield by about 13.9%, the CM05-9157βprsA(B.su) A239M) strain improved yield by about 12.6%, the CM05-9157βprsA(B.su) A239G) strain improved yield by about 11.7%, and the CM05-9157βprsA(B.su) A239Y) strain improved yield by about 10.4%.
[0321] Strain OD562 Tryptophan production (g / L) Tryptophan yield (*100 g / g, %) CM05-9157β52.92.307.79CM05-9157β53.42.668.98CM05-9157β53.02.638.89CM05-9157β53.12.628.86CM05-9157β52.12.598.77CM05-9157β52.72.578.70CM05-9157β52.02.548.58
[0322] The above results imply that the L-tryptophan production ability of a Corynebacterium glutamicum strain can be further increased by introducing a 239th amino acid mutant of ribose phosphate diphosphokinase derived from Bacillus subtilis.
[0323]
[0324] Example 5. Production of L-histidine-producing microorganisms with ribose phosphate diphosphokinase derived from Bacillus subtilis
[0325]
[0326] Example 5-1. Production of vectors for gene insertion
[0327]
[0328] To insert a gene into the Corynebacterium chromosome, plasmid pDCM2 (Korean Patent No. 10-2278000) was used as a parent vector, and to enhance the activity of ribose phosphate diphosphokinase, a plasmid was constructed to additionally insert the prsA gene using the Pm4ddh promoter (Korean Patent No. 10-0987281).
[0329] Specifically, using the wild-type Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template, the upstream region where homologous recombination occurs on the chromosome was amplified using the primer pair of SEQ ID NO: 35 and SEQ ID NO: 36, and the downstream region was amplified using the primer pair of SEQ ID NO: 37 and SEQ ID NO: 38, and then each gene fragment was obtained. The primer sequences used here are as shown in Table 9 below.
[0330] Sequence number Primer name Sequence (5'→3') 35HL-F2GAATTCGAGCTCGGTACCCGACACATCCGCACCGGAC 36HL-R2GACTTTTCTTCTTACGCTGCTGAGTACTGCTTGCTTAGAGTCCTG 37HR-F2ATCAGGACTCTAAGCAAGCAGTACTCAGCAGCGTAAGAAGAAAAG 38HR-R2TGCAGGTCGACTCTAGAGGATCCCCTTGATGACTCTTAGGGCTAG
[0331] PCR was performed to obtain the above fragments. SolgTM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification was performed under the following conditions: denaturation at 95°C for 4 minutes, followed by 27 cycles of denaturation at 95°C for 2 seconds, annealing at 55°C for 2 seconds, and polymerization at 72°C for 2 seconds, followed by polymerization at 72°C for 5 minutes.
[0332] The upstream fragment and downstream fragment of the region where homologous recombination on the chromosome occurs, obtained through the above process, and the chromosomal transformation vector pDCM2 cut with the SmaI restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2-β.
[0333]
[0334] Example 5-2. Vector construction for introducing ribose phosphate diphosphokinase derived from Bacillus subtilis.
[0335]
[0336] First, to secure the ddhP1 promoter, PCR was performed using pDZ-ddhP1 (Korean Patent No. 10-0987281) as a template and primers of SEQ ID NO: 41 and SEQ ID NO: 42 in Table 10 below. The polymerase was Solg TM Pfu-X DNA polymerase (SolGent co.) was used, and the PCR amplification conditions were as follows: denaturation at 95°C for 2 minutes, followed by 27 cycles of denaturation at 95°C, annealing at 55°C, and polymerization at 72°C, followed by polymerization at 72°C for 5 minutes.
[0337] Ribose phosphate diphosphokinase from Bacillus subtilis has an amino acid sequence represented by SEQ ID NO: 1. Information on the gene encoding ribose phosphate diphosphokinase and the surrounding base sequence (accession number NC_000964.3, SEQ ID NO: 2) was obtained from the National Institutes of Health (NIH) GenBank. Based on the obtained base sequence, primers for inserting the Bacillus subtilis-derived gene into Corynebacterium glutamicum genomic DNA were synthesized.
[0338] To amplify the Bacillus subtilis-derived gene, the ribose phosphate diphosphokinase gene of the Bacillus subtilis strain was synthesized using the gene synthesis service of Bionics Co., Ltd., and PCR was performed using the primers of sequence numbers 39 and 40 in Table 10 below. The polymerase was Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were as follows: denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 55°C for 2 seconds, polymerization at 72°C for 1 minute, repeated 27 times, and then polymerization reaction at 72°C for 5 minutes.
[0339] SEQ ID NO: Primer name sequence (5'→3')39G_prs(B. su)-F2CACAATTTTGGAGGATTACAAGAACATGTCTAATCAATACGGAGATAAGA40G_prs(B. su)-R2ATTGACTTTTCTTCTTACGCTGCTGAGTTTAGCTGAACAGATAGCTGACT41P_ddhP1-FGAATCAGGACTCTAAGCAAGCAGTGCCGTGCGTGGGCGAGT42P_ddhP1-RTCTTATCTCCGTATTGATTAGACATGTTCTTGTAATCCTCCAAAATTGTG
[0340] Next, the amplified Pcj7 promoter region, the Bacillus subtilis-derived gene fragment, and the chromosomal transformation vector pDCM2-△Tn2 cut with the ScaI restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDCM2-β. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and storing it at 50°C for 1 hour.
[0341]
[0342] Example 5-3. Production of L-histidine-producing microorganisms with ribose phosphate diphosphokinase derived from Bacillus subtilis
[0343]
[0344] In Example 5-2, the pDCM2-β vector constructed was transformed into the L-histidine-producing strain CA14-0809 (KCCM12489P, Republic of Korea Patent Publication No. 10-2019-0065984) by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a second crossing-over process was performed to obtain a strain in which one copy of the ddhP1_prsA (B.su) gene was inserted between transposon genes on the chromosome. The genetic manipulation of the strain was confirmed through PCR using primers of SEQ ID NO: 43 and SEQ ID NO: 44 in Table 11 below, which can amplify the external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, and genome sequencing.
[0345] Sequence number name sequence (5' → 3') 43Confirm-ddhP1-prs-FACATCCTTCTTATTCAGCTCAG 44Confirm-ddhP1-prs-RTGGTTTTAGTCCGATCGAGG
[0346] The strain obtained in this way was named CA14-0809 β.
[0347]
[0348] Example 6. Evaluation of L-histidine production ability of L-histidine producing strain with ribose phosphate diphosphokinase derived from Bacillus subtilis introduced.
[0349]
[0350] In order to confirm the L-histidine production ability of the CA14-0809β strain, into which the ribose phosphate diphosphokinase derived from Bacillus subtilis was introduced, produced in Example 5-3, the histidine-producing strain CA14-0809, which is the parent strain, was used as a control and cultured using the following method.
[0351] First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured at 30°C for 24 hours with shaking at 200 rpm. The composition of the medium used in this example is as follows, and the production amount of L-histidine was measured using HPLC after the culture was completed.
[0352]
[0353] <Seed medium (pH 7.0)>
[0354] Glucose 5%, Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4%, pH 7.2
[0355]
[0356] <Production medium (pH 7.0)>
[0357] Glucose 5%, ammonium sulfate 2%, monobasic potassium phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, CSL (corn steep liquor) 2.0%, biotin 200 μg / L, calcium carbonate 30 g / L, pH 7.2
[0358]
[0359] As a result of the experiment, the L-histidine production of each strain was shown in Table 12 below.
[0360] Strain OD562 Histidine production (g / L) Histidine yield (*100 g / g, %) CA14-0809 85.3 5.1 10.2 CA14-0809 β 84.15 11.4
[0361] The CA14-0809β strain, into which the ribose phosphate diphosphokinase gene from Bacillus subtilis was introduced, produced a final 5.7 g / L of L-histidine in flask culture, which was an approximately 12% improvement in fermentation yield compared to the control strain, CA14-0809. This suggests that the L-histidine production capacity of a Corynebacterium glutamicum strain can be significantly increased by introducing the ribose phosphate diphosphokinase gene from Bacillus subtilis.
[0362]
[0363] Example 7. Production of an L-histidine-producing microorganism with a mutant having a substitution at position 239 of the wild-type ribose phosphate diphosphokinase derived from Bacillus subtilis.
[0364]
[0365] In order to further increase the activity of ribose phosphate diphosphokinase derived from Bacillus subtilis, the A239V mutant, which most significantly increased L-tryptophan production in Example 4, was introduced to increase L-histidine production.
[0366] To mutate alanine to valine, site-directed mutagenesis was performed using pDCM2-β used in Example 5-2 as a template. The site-directed mutagenesis method was performed according to the PCR composition and PCR cycles shown in Tables 13 and 14 below.
[0367] Site-Direction Mutagenesis PCR composition unit (ul)10X pfu-
[0368] CycleTemperatureTime195 ℃1 min1895 ℃50 sec60 ℃50 sec68 ℃8 min168 ℃7 min
[0369] In order to substitute the 239th amino acid alanine in the prsA (B.su) amino acid sequence with another amino acid, valine (V) (SEQ ID NO: 15), a PCR mixture as shown in Table 13 was created using each mutagenic primer set listed in Table 15, and PCR was performed with the cycles listed in Table 14. After PCR was completed, 1 ㎕ of DpnI restriction enzyme was added and treated at 37℃ for 1 hour. 3 ㎕ of DpnI-treated DNA was transformed into DH5a competent cells to obtain the pDCM2-β mutant plasmid, and sequencing confirmed that it had been replaced with each mutation listed in Table 15 in the same manner as in Example 4.
[0370] Mutant prsA (B.su) plasmid sequence number (5'-3') pDCM2-βA239V45cttgctgctaatgtgctcgttgaaaacggagcgaa46ctccgttttcaacgagcacattagcagcaagtgta
[0371] As shown in Table 15, the pDCM2-βA239V vector constructed above was transformed into the L-histidine-producing strain CA14-0809 (KCCM12489P, Republic of Korea Patent Application No. 10-2019-0046934) by electroporation, and then a strain with a mutant prsA (B.su) gene inserted into the chromosome was obtained through a second crossing process. The genetic manipulation was confirmed through PCR using primers of SEQ ID NOs: 43 and 44 in Table 11, which can amplify the external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, and genome sequencing. The transformed strain thus obtained was named CA14-0809βprsA (B.su) A239V.
[0372]
[0373] Example 8. Evaluation of L-histidine production ability of L-histidine-producing microorganisms with a mutant in which the 239th amino acid of wild-type ribose phosphate diphosphokinase from Bacillus subtilis is substituted.
[0374]
[0375] In order to compare the histidine production of the CA14-0809βprsA(B.su)A239V strain produced in Example 7 and the CA14-0809βprsA(B.su) strain, they were cultured using the same method as in Example 6. After the culture was completed, the production of L-histidine was measured using HPLC.
[0376] As a result of the experiment, as shown in Table 16 below, the L-histidine production of the CA14-0809βprsA(B.su)A239V strain into which the prsA(B.su) A239V mutation was introduced was 6.2 g / L, which was confirmed to be an approximately 12.7% increase in yield compared to the control CA14-0809βprsA(B.su) strain into which the wild-type prsA(B.su) protein was introduced.
[0377] Strain OD562 Histidine production (g / L) Histidine yield (*100 g / g, %) CA14-0809βprsA(B.su)85.65.511.0 CA14-0809βprsA(B.su)A239V84.26.212.4
[0378] The above results imply that the L-histidine production ability of a Corynebacterium glutamicum strain can be further increased by introducing a 239th amino acid mutant of ribose phosphate diphosphokinase derived from Bacillus subtilis.
[0379]
[0380] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.
Claims
1. A ribose phosphate diphosphokinase variant polypeptide in which the amino acid corresponding to position 239 of the amino acid sequence of sequence number 1 is replaced with another amino acid.
2. In the first paragraph, the mutant polypeptide is a mutant polypeptide in which the amino acid corresponding to position 239 of the amino acid sequence of SEQ ID NO: 1 is substituted with valine, proline, asparagine, methionine, glycine, or tyrosine.
3. A variant polypeptide according to claim 1, wherein the variant polypeptide comprises any one amino acid sequence selected from SEQ ID NOs: 15 to 20.
4. A polynucleotide encoding a ribose phosphate diphosphokinase variant polypeptide of any one of claims 1 to 3.
5. A microorganism comprising a ribose phosphate diphosphokinase variant polypeptide of any one of claims 1 to 3, or a polynucleotide encoding the variant polypeptide.
6. In the fifth paragraph, the microorganism has an increased L-amino acid production ability compared to a non-modified microorganism.
7. In paragraph 5, the microorganism is a microorganism of the genus Corynebacterium.
8. A microorganism according to claim 7, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
9. A microorganism in claim 6, wherein the L-amino acid is at least one selected from the group consisting of L-tryptophan and L-histidine.
10. A method for producing L-amino acid, comprising a step of culturing the microorganism of clause 5 in a medium.
11. A method for producing L-amino acid, further comprising a step of recovering a target substance from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium in accordance with paragraph 10.
12. A composition for producing L-amino acids, comprising a ribose phosphate diphosphokinase variant polypeptide of any one of claims 1 to 3; a polynucleotide encoding the variant polypeptide; a microorganism comprising the variant polypeptide or a polynucleotide encoding the variant polypeptide; a culture of the microorganism; or a combination of two or more thereof.
13. Use of a ribose phosphate diphosphokinase variant polypeptide of any one of claims 1 to 3; a polynucleotide encoding the variant polypeptide; a microorganism comprising the variant polypeptide or a polynucleotide encoding the variant polypeptide; or a culture of the microorganism for producing L-amino acids.
Citation Information
Patent Citations
Mutant phosphoribosylpyrophosphate synthetase and method for producing L-histidine
EP1529839A1
Novel promoter nucleic acid derived from corynebacterium genus bacteria, expression cassette comprising the promoter and vector comprising the cassette, host cell comprising the vector and method for expressing a gene using the cell
KR100620092B1
Enhanced promoter and method for producing L-lysine using the same
KR100987281B1
Microorganisms with enhanced ability to produce L-histidine and methods for producing L-histidine using the same
KR1020190065984A
3D Motion Bodily Sensation Type Chair, Chair Bundle, and Operating Method Therefor
KR1020190067140A