Novel serine hydroxymethyltransferase variant and method for producing purine nucleotide or glycine using same

Abstract

The present disclosure relates to: a variant having serine hydroxymethyltransferase activity; a microorganism comprising same; a composition comprising the microorganism for producing a purine nucleotide and / or glycine; and a method for producing a purine nucleotide and / or glycine, the method comprising a step of culturing the microorganism.

Description

Novel serine hydroxymethyltransferase variant and method for producing purine nucleotide or glycine using the same

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Korean Patent Application No. 10-2024-0009486, filed January 22, 2024, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a mutant having serine hydroxymethyltransferase activity, a microorganism comprising the same, a composition for producing purine nucleotides and / or glycine comprising the microorganism, and a method for producing purine nucleotides and / or glycine comprising a step of culturing the microorganism.

[0004] Purine nucleotides are intermediate substances in the nucleic acid biosynthesis metabolic system, play physiologically important roles in the body, and are widely used in foods, medicines, etc. The purine nucleotides include 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), and 5'-guanosine monophosphate (GMP).

[0005] To produce purine nucleotides such as the above IMP, XMP, and GMP, various studies are being conducted to develop high-efficiency production microorganisms and fermentation process technologies. For example, target substance-specific approaches such as increasing the expression of genes encoding enzymes involved in the biosynthesis of IMP, XMP, and GMP or removing genes unnecessary for biosynthesis are mainly utilized (US 2020-0347346 A1).

[0006] However, when the purine nucleotide is produced through aerobic fermentation from a microorganism that produces it, there is a problem that productivity decreases due to an imbalance in substrate supply in the latter half of the fermentation when the cultivation continues for a long time.

[0007] When examining the biosynthetic steps for producing purine nucleotides from microorganisms, the carbon source is supplied from various substrates such as phosphoribosyl pyrophosphate (PRPP), glycine, and formyl-tetrahydrofolate in the biosynthetic pathway. Among these, glycine is a major substrate for producing N1-(5-phospho-β-D-ribosyl)glycinamide (GAR) by phosphoribosylamine-glycine ligase (purD), one of the purine nucleotide biosynthetic pathways. Since it is also used in the production of formyl-tetrahydrofolate, which is used as another substrate, a smooth supply of glycine is a key factor in the production of purine nucleotides.

[0008] Glycine can be produced from serine, threonine, and glycoxylate as precursors during microbial metabolic processes.

[0009] Among these, when serine is used as a precursor, it is produced from D-3-phosphoglycerate in the pathway through the steps of D-3-phosphoglycerate dehydrogenase (SerA), phosphoserine aminotransferase (SerC), phosphoserine phosphatase (SerB), and serine hydroxymethyltransferase (GlyA), which converts serine to glycine.

[0010] One object of the present disclosure is to provide a polypeptide having serine hydroxymethyltransferase activity.

[0011] Another object of the present disclosure is to provide a polynucleotide encoding the polypeptide.

[0012] Another object of the present disclosure is to provide a recombinant vector comprising the polynucleotide.

[0013] Another object of the present disclosure is to provide a microorganism producing purine nucleotides and / or glycine, having enhanced activity of serine hydroxymethyltransferase.

[0014] Another object of the present disclosure is to provide a microorganism comprising at least one member selected from the group consisting of a polypeptide having the serine hydroxymethyltransferase activity, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

[0015] Another object of the present disclosure is to provide a method for producing purine nucleotides and / or glycine, comprising a step of culturing the microorganism in a medium.

[0016] Another object of the present disclosure is to provide a composition for producing purine nucleotides and / or glycine, comprising the microorganism.

[0017] Another object of the present disclosure is to provide a use of the microorganism for the production of purine nucleotides and / or glycine.

[0018] Another object of the present disclosure is to provide a use of the microorganism for the preparation of a composition for producing purine nucleotides and / or glycine.

[0019] This is specifically explained as follows. Meanwhile, each description and embodiment disclosed in this disclosure can also be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this disclosure. The disclosure contents of the cited papers and patent documents are incorporated into this disclosure in their entirety by reference to more clearly explain the level of the technical field to which this disclosure belongs and the contents of this disclosure.

[0020]

[0021] One example of the present disclosure provides a polypeptide having serine hydroxymethyltransferase activity. The polypeptide may be a variant of serine hydroxymethyltransferase derived from a microorganism of the genus Corynebacterium, and may be a variant that enhances the activity of the serine hydroxymethyltransferase. In one example, the polypeptide may include an amino acid sequence having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 31, in which the amino acid corresponding to the 388th residue from the N-terminus is replaced with a different amino acid, the amino acid corresponding to the 409th residue is replaced with a different amino acid, the amino acid corresponding to the 412th residue is replaced with a different amino acid, or a combination thereof.

[0022] In one specific example, the polypeptide may comprise an amino acid sequence in which the amino acid corresponding to the 388th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 31 is replaced with another amino acid, the amino acid corresponding to the 409th residue is replaced with another amino acid, the amino acid corresponding to the 412th residue is replaced with another amino acid, or a combination thereof.

[0023] In one example, the polypeptide may include an amino acid sequence having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 41, in which the amino acid corresponding to the 389th residue from the N-terminus is replaced with another amino acid, the amino acid corresponding to the 410th residue is replaced with another amino acid, the amino acid corresponding to the 413th residue is replaced with another amino acid, or a combination thereof.

[0024] In one specific example, the polypeptide may comprise an amino acid sequence in which the amino acid corresponding to the 389th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 41 is replaced with another amino acid, the amino acid corresponding to the 410th residue is replaced with another amino acid, the amino acid corresponding to the 413th residue is replaced with another amino acid, or a combination thereof.

[0025] In one specific example, the polypeptide may include an amino acid in which the amino acid corresponding to the 388th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 31 is substituted with cysteine, or an amino acid corresponding to the 409th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 31 is substituted with arginine, or an amino acid corresponding to the 412th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 31 is substituted with valine, or a combination thereof, and the polypeptide may include an amino acid in which the amino acid corresponding to the 389th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 41 is substituted with cysteine, or an amino acid corresponding to the 410th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 41 is substituted with arginine, or an amino acid corresponding to the 413th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 41 is substituted with valine, or a combination thereof.

[0026] As mentioned above, counting amino acids from the N-terminus in the amino acid sequence may mean counting with methionine (Met, M) translated from the start codon as the first amino acid.

[0027] In the present disclosure, the term "serine hydroxymethyltransferase" is an enzyme having an activity that catalyzes the chemical reaction of [5,10-methylenetetrahydrofolate + glycine + H2O = tetrahydrofolate + L-serine]. For the purpose of the present application, the enzyme refers to a protein involved in producing purine nucleotides or glycine. Specifically, in the present application, "serine hydroxymethyltransferase" may be used interchangeably with the terms "SHMT" and "GlyA protein." The sequence of the serine hydroxymethyltransferase in the present application can be obtained from the known database, NCBI's GenBank (e.g., WP_066795134.1), but is not limited thereto.

[0028] The protein to be subjected to mutation in the present application may be a wild-type protein having serine hydroxymethyltransferase activity. Specifically, the serine hydroxymethyltransferase to be subjected to mutation may have an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 31, and more specifically, may include, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 41, but is not limited thereto. That is, meaningless sequence additions before or after the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 41, mutations that may occur naturally, or silent mutations thereof are not excluded, and if it has the same or corresponding activity as a protein including the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 41, it may be a protein to be subjected to mutation in the present application. For example, the protein that is the target of mutation introduction in the present application may be a protein composed of an amino acid sequence that has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.3%, 99.5%, 99.7%, or 99.9% or more, but less than 100% sequence homology or identity with the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 41. In addition, a protein that has an amino acid sequence in which some sequences are deleted, modified, substituted, or added may also be included within the scope of the protein that is the target of mutation in the present disclosure, as long as it has such homology or identity and exhibits an effect corresponding to the protein.

[0029] In the present disclosure, the serine hydroxymethyltransferase may be derived from a microorganism of the genus Corynebacterium, specifically, but not limited to, Corynebacterium stationenis (Corynebacterium ammoniagenes) or Corynebacterium glutamicum.

[0030]

[0031] An example of the present disclosure provides a polypeptide comprising a mutation at position 388 and / or position 409 and / or position 412 from the N-terminus in the amino acid sequence of SEQ ID NO: 31. The polypeptide may be a variant of serine hydroxymethyltransferase. The variant of serine hydroxymethyltransferase may increase the activity of serine hydroxymethyltransferase and / or the ability to produce purine nucleotides and / or glycine. The above serine hydroxymethyltransferase variant means a variant in which the 388th amino acid and / or the 409th amino acid and / or the 412th amino acid from the N-terminus are mutated in the above-described SEQ ID NO: 31 and / or an amino acid having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the above SEQ ID NO: 31. The variant may be derived from Corynebacterium stationensis, but is not limited thereto.

[0032] For example, the variant of the serine hydroxymethyltransferase may be composed of a polypeptide comprising an amino acid sequence in which, from the N-terminus of the amino acid sequence of SEQ ID NO: 31, i) the amino acid corresponding to the 388th residue is substituted with cysteine ​​(Cysteine, Cys, C), ii) the amino acid corresponding to the 409th residue is substituted with arginine (Arg, R), iii) the amino acid corresponding to the 412th residue is substituted with valine (Valine, Val, V), or iv) the amino acid corresponding to the 388th residue is substituted with cysteine, the amino acid corresponding to the 409th residue is substituted with arginine, and the amino acid corresponding to the 412th residue is substituted with valine. In addition, the variant of the serine hydroxymethyltransferase of the present application may include a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to an amino acid sequence in which the 388th amino acid from the N-terminus is substituted with cysteine ​​and / or the 409th amino acid is substituted with arginine and / or the 412th amino acid is substituted with valine in the amino acid sequence of SEQ ID NO: 31. In addition, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added in addition to the amino acid sequence at the 388th, 409th, and / or 412th positions, as long as it has such homology or identity and exhibits an activity corresponding to the protein, is also included within the scope of the present disclosure.

[0033] Another example of the present disclosure provides a polypeptide comprising a mutation at position 389 and / or position 410 and / or position 413 from the N-terminus in the amino acid sequence of SEQ ID NO: 41. The polypeptide may be a variant of serine hydroxymethyltransferase. The variant of serine hydroxymethyltransferase may increase the activity of serine hydroxymethyltransferase and / or the ability to produce purine nucleotides and / or glycine. The above serine hydroxymethyltransferase variant means a variant in which the 389th amino acid and / or the 410th amino acid and / or the 413th amino acid from the N-terminus are mutated in the above-described SEQ ID NO: 41 and / or amino acids having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the above SEQ ID NO: 41. The variant may be derived from Corynebacterium glutamicum, but is not limited thereto.

[0034] For example, the variant of the serine hydroxymethyltransferase may be composed of a polypeptide comprising an amino acid sequence in which, from the N-terminus of the amino acid sequence of SEQ ID NO: 41, i) the amino acid corresponding to the 389th residue is substituted with cysteine ​​(Cysteine, Cys, C), ii) the amino acid corresponding to the 410th residue is substituted with arginine (Arg, R), iii) the amino acid corresponding to the 413th residue is substituted with valine (Valine, Val, V), or iv) the amino acid corresponding to the 389th residue is substituted with cysteine, the amino acid corresponding to the 410th residue is substituted with arginine, and the amino acid corresponding to the 413th residue is substituted with valine. In addition, the variant of the serine hydroxymethyltransferase of the present application may include a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to an amino acid sequence in which the 389th amino acid from the N-terminus is substituted with cysteine ​​and / or the 410th amino acid is substituted with arginine and / or the 413th amino acid is substituted with valine in the amino acid sequence of SEQ ID NO: 41. In addition, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added in addition to the amino acid sequence at the 389th, 410th, and / or 413th positions, as long as it has such homology or identity and exhibits an activity corresponding to the protein, is also included within the scope of the present application.

[0035] In one specific example, the variant of the serine hydroxymethyltransferase has an amino acid sequence of any one of the sequence numbers selected from the group consisting of SEQ ID NOs: 32 to 35 that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 96.3%, at least 96.5%, at least 96.7%, at least 96.9%, at least 97%, at least 97.1%, at least 97.2%, at least 97.4%, at least 97.6%, at least 97.8%, at least 98%, at least 98.2%, at least 98.4%, at least 98.6%, at least 98.9%, at least 99%, at least 99.1%, at least 99.3%, at least 99.5%, at least 99.7% or It may comprise or consist of an amino acid sequence having 99.9% or more homology or identity.

[0036] In one specific example, the variant of the serine hydroxymethyltransferase has an amino acid sequence selected from the group consisting of SEQ ID NOs: 42 to 45 that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 96.3%, at least 96.5%, at least 96.7%, at least 96.9%, at least 97%, at least 97.1%, at least 97.2%, at least 97.4%, at least 97.6%, at least 97.8%, at least 98%, at least 98.2%, at least 98.4%, at least 98.6%, at least 98.9%, at least 99%, at least 99.1%, at least 99.3%, at least 99.5%, at least 99.7% or It may comprise or consist of an amino acid sequence having 99.9% or more homology or identity.

[0037] In addition, if it is a polypeptide that has such homology or identity and exhibits an activity corresponding to the variant of the serine hydroxymethyltransferase, it may be included in the variant of the present application even if it has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, and / or added. For example, it may be the case that the amino acid sequence of the variant of the serine hydroxymethyltransferase of the present application has an addition or deletion of a sequence, a naturally occurring mutation, a silent mutation, or a conservative substitution that does not alter the activity of the variant at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0038] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid with similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0039] In one example, the amino acid corresponding to the 388th residue in the amino acid sequence of SEQ ID NO: 31 may be phenylalanine (Phe, F), the amino acid corresponding to the 409th residue may be lysine (Lys, K), and the amino acid corresponding to the 412th residue may be alanine (Ala, A), but is not limited thereto.

[0040] In one example, the amino acid corresponding to the 389th residue in the amino acid sequence of SEQ ID NO: 41 may be phenylalanine (Phe, F), the amino acid corresponding to the 410th residue may be serine (Serine, S), and the amino acid corresponding to the 413th residue may be glycine (Gly, G), but is not limited thereto.

[0041] The variants of the serine hydroxymethyltransferase of the present disclosure may have properties that result in increased purine nucleotide and / or glycine production compared to a wild-type polypeptide having serine hydroxymethyltransferase activity.

[0042] In the present disclosure, the term "purine nucleotide" may specifically be at least one nucleotide selected from the group consisting of 5'-inosine monophosphate (hereinafter referred to as IMP), 5'-xanthosine monophosphate (hereinafter referred to as XMP), and 5'-guanosine monophosphate (hereinafter referred to as GMP). The IMP is a compound in which adenine is deaminated and refers to a nucleotide composed of one molecule each of hypoxanthine, ribose, and phosphate. It can be biosynthesized from 5'-phosphoribosyl-1-pyrophosphate (PRPP), and specifically, it can be formed by replacing the pyrophosphate group bonded to carbon 1 of PRPP with a nitrogen atom, and forming an imidazole ring and a pyrimidine ring over nine steps. The XMP refers to a nucleotide dehydrogenated from IMP. It can be synthesized from IMP by 5'-inosine-5'-monophosphate dehydrogenase. The GMP refers to a nucleotide having a structure in which a phosphate group forms an ester bond with the ribose portion of a guanosine molecule. The GMP can be synthesized by adding an ammonia molecule to XMP by 5'-guanine acid biosynthetic enzyme (GMP synthase). The method for producing GMP from XMP and / or the means used in the method can be selected from known techniques.

[0043] In this disclosure, the term “glycine” means an amino acid that is a colorless crystalline amino acid with a sweet taste, also named glycine, and has the chemical formula “C2H5NO2”.

[0044] In the present disclosure, the term “productivity” means the ability to produce purine nucleotides and / or glycine, and may be used interchangeably with “productivity,” and can be confirmed by measuring the concentration of purine nucleotides and / or glycine contained in a culture solution after culturing a strain that produces purine nucleotides and / or glycine.

[0045] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Additionally, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term "variant" may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto if the term is used in the meaning of mutation.For the purpose of the present application, the variant may be a polypeptide having serine hydroxymethyltransferase activity in which the amino acid corresponding to the 388th residue in the amino acid sequence of SEQ ID NO: 31 is substituted with cysteine, the amino acid corresponding to the 409th residue is substituted with arginine, the amino acid corresponding to the 412th residue is substituted with valine, or a combination thereof, and may be a polypeptide having serine hydroxymethyltransferase activity in which the amino acid corresponding to the 389th residue in the amino acid sequence of SEQ ID NO: 41 is substituted with cysteine, the amino acid corresponding to the 410th residue is substituted with arginine, the amino acid corresponding to the 413th residue is substituted with valine, or a combination thereof.

[0046] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0047] In one example, the variant may be encoded by a polynucleotide comprising / consisting of a nucleic acid sequence selected from any one of SEQ ID NO: 37 to SEQ ID NO: 40, and SEQ ID NO: 47 to SEQ ID NO: 50.

[0048]

[0049] Another example of the present disclosure provides a polynucleotide encoding a polypeptide having the serine hydroxymethyltransferase activity (e.g., a variant of serine hydroxymethyltransferase).

[0050] In the present disclosure, the term "polynucleotide" means a DNA or RNA strand of a certain length or longer, which is a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain.

[0051] The polynucleotide encoding a polypeptide having serine hydroxymethyltransferase activity (e.g., a variant of serine hydroxymethyltransferase) of the present disclosure may include, without limitation, any polynucleotide sequence encoding a polypeptide having serine hydroxymethyltransferase activity. In the present application, the gene encoding the amino acid sequence of serine hydroxymethyltransferase is the glyA gene, and may be derived from a microorganism of the genus Corynebacterium, specifically, may be derived from Corynebacterium stationanis or Corynebacterium glutamicum, but is not limited thereto.

[0052] In one example, the polynucleotide may comprise a nucleic acid sequence (base sequence) set forth in any one of SEQ ID NOs: 37 to 40, and SEQ ID NOs: 47 to 50, or may consist of, or consist essentially of, a nucleic acid sequence of any one of SEQ ID NOs: 37 to 40, and SEQ ID NOs: 47 to 50.

[0053] A polynucleotide composed of or including any one of the nucleic acid sequences selected from the group consisting of SEQ ID NOs: 37 to 40 and SEQ ID NOs: 47 to 50 may encode an amino acid sequence described by any one of the sequence numbers selected from the group consisting of SEQ ID NOs: 32 to 35 and SEQ ID NOs: 42 to 45, respectively.

[0054] The polynucleotide of the present disclosure may have various modifications made to the coding region within a range that does not change the amino acid sequence of the variant of the present disclosure, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present disclosure. Specifically, the polynucleotide of the present application has or includes a base sequence having a homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more homology or identity with any one sequence selected from the group consisting of SEQ ID NOs: 37 to 40, and SEQ ID NOs: 47 to 50, It may consist of, or consist essentially of, a base sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, but is not limited thereto.

[0055] The polynucleotide of the present disclosure may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term “stringent conditions” refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or washing conditions of typical southern hybridization, such as 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% Conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS can be listed.

[0056] Hybridization requires that two nucleotide sequences be complementary, but hybridized polynucleotides may contain some mismatches between bases, depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0057] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present disclosure can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0058] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0059] In the present disclosure, the phrase "a polynucleotide (which may be used interchangeably with a "gene") or a polypeptide (which may be used interchangeably with a "protein") "comprises, consists of, or is represented by a specific nucleic acid sequence or amino acid sequence" may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence or amino acid sequence, and may be interpreted as including (or not excluding) a "substantially equivalent sequence" in which a non-significant mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence or amino acid sequence to the extent that the original function and / or the desired function of the polynucleotide or polypeptide is maintained.

[0060] As used herein, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0061] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0062] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information database.

[0063] Homology, or identity, of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a coding sequence matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0064] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0065] For example, any amino acid sequence can be aligned with SEQ ID NO: 31, and each amino acid residue in the amino acid sequence can be numbered based on the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 31. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0066] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0067]

[0068] Another example of the present disclosure provides a vector comprising a polynucleotide encoding a polypeptide having serine hydroxymethyltransferase activity (e.g., a variant of serine hydroxymethyltransferase). The vector may be an insertion vector or an expression vector.

[0069] As used herein, the term "vector" refers to a DNA construct for delivering a target polynucleotide into a suitable host or host cell. For example, it may comprise, but is not limited to, a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host cell. The expression control sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence for regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may remain independent of the genome (genome) of the host cell, or may be integrated into the genome of the host cell. For example, the target polynucleotide may be integrated into a chromosome via an insertion vector. Insertion of the above polynucleotide into a chromosome can be accomplished by any method known in the art, for example, but not limited to, homologous recombination.

[0070] The vector usable in the present disclosure is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as a phage vector or a cosmid vector, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc., can be used as a plasmid vector. Specifically, examples include, but are not limited to, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pDC24 vectors.

[0071] The above vector may further comprise a selection marker to determine whether the vector has been introduced into a transformed cell or has been integrated into the genome of the transformed cell. The selection marker is used to determine whether the vector-transformed cell or the polynucleotide has been integrated, and may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or surface protein expression. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling the selection of transformed cells.

[0072] Expression of the above polypeptide (variant) in a microorganism can be performed by introducing a polynucleotide encoding the variant, or a vector containing the same, into a host cell and culturing a recombinant cell (e.g., a microorganism) containing the same.

[0073] The introduction of a polynucleotide encoding the polypeptide (variant) or a vector containing the same into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. As used herein, the term "transformation" refers to changing the genetic characteristics of a host cell (microorganism) by introducing a target polynucleotide or a vector containing the same into the host cell (microorganism). The transformed polynucleotide may be positioned by being inserted into the chromosome of the host cell or may be positioned extrachromosomally. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal, which are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of autonomous replication. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as used herein may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so that transcriptional regulation (e.g., transcription initiation) of the polynucleotide can be performed. Operable linkage can be performed using genetic recombination techniques known in the art.

[0074] The method for transforming the above polynucleotide into a host cell can be performed by any method for introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0075]

[0076] Another example of the present disclosure provides a microorganism having enhanced serine hydroxymethyltransferase activity.

[0077] The above microorganism may be a microorganism comprising at least one (e.g., at least one, at least two, or one, two, or three) selected from the group consisting of a polypeptide (variant) having the serine hydroxymethyltransferase activity described above, a polynucleotide encoding (or coding) the polypeptide, and a vector comprising the polynucleotide.

[0078] As used herein, the term “enhancement” of polypeptide activity (e.g., serine hydroxymethyltransferase activity) means that the activity of the polypeptide within a host cell (microorganism) is increased compared to the intrinsic activity. The term “enhancement” may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an enhanced activity compared to the intrinsic activity or the activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or an unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of a particular polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0079] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0080] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0081] Specifically, the enhancement of the polypeptide of the present application is

[0082] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0083] 2) Replacing the gene expression control region on the chromosome that codes for a polypeptide with a highly active sequence;

[0084] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0085] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0086] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0087] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0088] 7) Codon optimization of polynucleotides encoding polypeptides;

[0089] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0090] 9) Control of cellular localization of proteins (polypeptides); or

[0091] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.

[0092] More specifically,

[0093] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0094] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0095] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0096] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0097] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred. The selection marker is as described above.

[0098] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0099] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0100] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0101] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, it may target the protein (polypeptide) to the periplasm or cytoplasm by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.

[0102] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microorganism, or an increase in the amount of a product produced from the polypeptide.

[0103]

[0104] As used herein, the term "microorganism (or strain)" may encompass both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. The microorganism may be a microorganism whose specific mechanism has been enhanced or weakened, such as by the insertion of an external gene or the enhancement or weakening of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product (e.g., purine nucleotides and / or glycine). The terms "microorganism," "strain," "host," and "host cell" may be used interchangeably in this application.

[0105] The microorganism (or strain, recombinant cell) of the present disclosure may be a microorganism having enhanced activity of serine hydroxymethyltransferase, having the ability to produce (or produce) purine nucleotides and / or glycine, or having improved (or increased) ability to produce purine nucleotides and / or glycine.

[0106] For example, the microorganism of the present disclosure may be a microorganism that naturally lacks the ability to produce purine nucleotides and / or glycine, or a microorganism that has the ability to produce purine nucleotides and / or glycine, and is thus provided with, or improved, the ability to produce purine nucleotides by introducing a polypeptide (variant) having serine hydroxymethyltransferase activity of the present disclosure or a polynucleotide encoding the same, but is not limited thereto.

[0107] In the present disclosure, the term “microorganism having enhanced serine hydroxymethyltransferase activity” may mean a microorganism that has been engineered (mutated) to express a polypeptide (variant) having the serine hydroxymethyltransferase activity described above, thereby allowing a microorganism that had no purine nucleotide and / or glycine production ability to have purine nucleotide and / or glycine production ability, or having a purine nucleotide and / or glycine production ability higher than its original purine nucleotide and / or glycine production ability.

[0108] In the present disclosure, the term "unmodified microorganism" does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by a genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain into which a polypeptide (variant) having serine hydroxymethyltransferase activity of the present application or a polynucleotide encoding the polypeptide (variant) having serine hydroxymethyltransferase activity is not introduced, or before it is introduced. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmodified strain," "unmodified microorganism," or "reference microorganism."

[0109] In the present disclosure, the reference microorganism may be a wild-type microorganism known to produce purine nucleotides, for example, Corynebacterium stationenis ATCC6872. Alternatively, the reference microorganism may be a microorganism known to produce purine nucleotides, for example, but not limited to, Corynebacterium stationenis KCCM12151P (US 2023-0192780 A1). In addition, the reference microorganism may be a wild-type microorganism known to produce glycine, for example, but not limited to, Corynebacterium glutamicum ATCC13032.

[0110] The microorganism producing purine nucleotides and / or glycine of the present disclosure is not particularly limited as long as it can produce purine nucleotides and / or glycine, but may be a microorganism of the genus Corynebacterium. The above-mentioned Corynebacterium genus microorganisms are Corynebacterium stationis, Corynebacterium thermoaminogenes, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium singulare, and Corynebacterium It may be at least one microorganism selected from the group consisting of, but is not limited to, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, and Corynebacterium flavescens.Specifically, the microorganism of the genus Corynebacterium may be, but is not limited to, Corynebacterium stationis or Corynebacterium glutamicum.

[0111]

[0112] Another example of the present disclosure provides a method for producing purine nucleotides and / or glycine, comprising the step of culturing a microorganism having enhanced activity of serine hydroxymethyltransferase in a medium. Specifically, another example of the present disclosure provides a method for producing purine nucleotides or glycine, comprising the step of culturing a microorganism as described above, wherein the microorganism comprises at least one selected from the group consisting of the polypeptide as described above, a polynucleotide encoding the polypeptide as described above, and a vector comprising the polynucleotide as described above.

[0113] The above-described polypeptide, the above-described polynucleotide and the above-described vector, the microorganism with enhanced activity of the serine hydroxymethyltransferase, the purine nucleotide and the glycine are as described above.

[0114] In the present disclosure, "cultivation" refers to growing a microorganism, such as a Corynebacterium genus microorganism, into which a polypeptide having serine hydroxymethyltransferase activity of the present disclosure or a gene encoding the same has been introduced or whose activity has been enhanced, under appropriately controlled environmental conditions. The culturing process of the present application can be performed using a suitable medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0115] In the present disclosure, "medium" means a substance containing as a main component a nutrient required for culturing a microorganism, such as a microorganism of the genus Corynebacterium, into which a polypeptide having serine hydroxymethyltransferase activity of the present disclosure or a gene encoding the same has been introduced or whose activity has been enhanced, and which supplies water essential for survival and growth, as well as nutrients and growth factors. Specifically, the medium and other culture conditions used for culturing the microorganism of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin, etc.

[0116] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses (e.g., blackstrap molasses), rice bran, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0117] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0118] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0119] Additionally, during the cultivation of the microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. Furthermore, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Furthermore, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or to maintain anaerobic and microaerobic states, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0120] In the culture of the present disclosure, the culture temperature can be maintained at 20 to 45°C, or 25 to 37°C, specifically 25 to 37°C, and the culture can be performed for about 10 to 160 hours, or about 20 to 120 hours, but is not limited thereto.

[0121] Purine nucleotides and / or glycine produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0122] The method for producing purine nucleotides of the present disclosure may include a step of adding an enzyme to a medium or a step of adding a microorganism expressing the enzyme. For example, the method may further include a step of adding an enzyme that converts XMP to GMP or a microorganism expressing the enzyme and / or a step of culturing the microorganism after the step of culturing a microorganism producing XMP.

[0123] The method for producing purine nucleotides and / or glycine of the present disclosure may further include a step of recovering purine nucleotides and / or glycine from the cultured microorganism (e.g., a microorganism of the genus Corynebacterium), the culture medium (the medium in which the culture is performed), or both. The recovering step may be additionally included after the culturing step.

[0124] The above recovery may be performed by collecting the desired purine nucleotides and / or glycine using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired purine nucleotides and / or glycine may be recovered from the medium or microorganism using a suitable method known in the art.

[0125] Additionally, the method for producing purine nucleotides and / or glycine of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the method for producing purine nucleotides and / or glycine of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0126]

[0127] Another example of the present disclosure provides a composition for producing purine nucleotides and / or glycine, comprising a microorganism having enhanced activity of serine hydroxymethyltransferase, a medium in which the microorganism is cultured, or a combination thereof.

[0128] The microorganisms with enhanced activity of the above serine hydroxymethyltransferase, purine nucleotides and glycine are as described above.

[0129] Another example provides the use of the above microorganism for the production of purine nucleotides and / or glycine.

[0130] Another example provides the use of the microorganism for the preparation of a composition for producing purine nucleotides and / or glycine.

[0131] The composition of the present disclosure may further comprise any suitable excipient commonly used in compositions for producing purine nucleotides and / or glycine, including but not limited to preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0132]

[0133] The present application relates to a mutant having serine hydroxymethyltransferase activity, a microorganism comprising the same, a composition for producing purine nucleotides and / or glycine comprising the microorganism, and a method for producing purine nucleotides and / or glycine comprising a step of culturing the microorganism. By culturing a Corynebacterium microorganism into which the serine hydroxymethyltransferase mutant of the present application has been introduced, high yields of purine nucleotides and / or glycine can be produced.

[0134]

[0135] The present disclosure is described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present disclosure and are therefore not intended to limit the scope of the present disclosure. Furthermore, technical details not described in this disclosure can be readily understood and implemented by those skilled in the technical field of the present disclosure or similar technical fields.

[0136]

[0137] Example 1: Discovery of serine hydroxymetaltransferase-enhanced mutants.

[0138] In order to improve the production of purine nucleotides through a smooth supply of glycine, one of the main substrates of purine nucleotides, a mutant library of glyA, a gene encoding serine hydroxymethyltransferase, was created to enhance the activity of serine hydroxymethyltransferase, and enhanced mutants that increase IMP production were discovered.

[0139]

[0140] Example 1-1: Construction of a vector containing glyA

[0141] To construct the glyA library, a recombinant vector containing glyA was first constructed. The plasmid pCR™2.1 vector (Invitrogne, K202020), which allows for the insertion and replacement of genes within the Corynebacterium chromosome, was used as the parent vector. To enhance the activity of serine hydroxymethyltransferase, a plasmid was constructed to additionally insert the glyA gene using the Pcj7 promoter (US Patent No. US 7662943 B2).

[0142] The chromosomal genes of the wild-type Corynebacterium stationensis ATCC6872 strain were isolated using the G-spin Total DNA extraction mini kit (Cat. No. 17045) from Intron according to the protocol provided in the kit, and the glyA gene fragment was obtained through polymerase chain reaction using the primer pair of SEQ ID NO: 1 and SEQ ID NO: 2. In addition, to secure the Pcj7 promoter, the Pcj7 gene fragment was obtained through polymerase chain reaction using the primer pair of SEQ ID NO: 3 and SEQ ID NO: 4 using p117-cj7-gfp (US registered patent US 7662943 B2) as a template. The PCR conditions were denaturation at 9℃ for 5 minutes, followed by 20 cycles of denaturation at 95℃ for 30 seconds, annealing at 55℃ for 30 seconds, and polymerization at 72℃ for 2 minutes, and then polymerization at 72℃ for 5 minutes.

[0143] The gene fragment obtained above was cloned into linear pCR2.1 digested with BamHI restriction enzyme using the Gibson assembly (NEB) method to obtain pCR2.1-Pcj7_glyA. The Gibson assembly reaction (based on 20 μl) was performed by mixing 1 μl of linearized pCR2.1 vector, 1 μl of Pcj7 PCR DNA, 3 μl of glyA PCR DNA, 10 μl of Gibson assembly mater mix, and 5 μl of PCR grade water and incubating at 50°C for 30 minutes.

[0144] The sequences of the primers used in Example 1-1 are shown in Table 1 below.

[0145] Name Sequence (5'->3') Sequence number glyA_FCCCAACGAAAGGAAACACTCCATATGACTACCCAGAATTCTTCCSequence number 1 glyA-RACTGGCGGCCGTTACTAGTGGGATCCTTAGACGATCTTCCAGTCTTCCSequence number 2 Pcj7_FCAAGCTTGGTACCGAGCTCGCATCACCACGAGTTCCTTCAGGCTASequence number 3 Pcj7-RGAAGAATTCTGGGTAGTCATATGGAGTGTTTCCTTTCGTTGGGTACGSequence number 4

[0146] Example 1-2: Construction of a glyA mutant library

[0147] Based on the vector produced in Example 1-1 above, a glyA mutant library was produced using the following method.

[0148] Specifically, the Error-Prone PCR technique was used to introduce random mutations into glyA. The reaction was performed using pCR2.1-Pcj7_glyA produced in Example 1-1 as a PCR template and a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and the PCR buffer conditions were set to introduce 4.6 bp mutations per 1 kb, and the reaction was performed referring to the supplier's manual (Diversify PCR Random Mutagenesis Kit, TAKARA). Error-prone PCR reaction (based on 50 μl) was performed with the composition of 36 μl of PCR grade water, 5 μl of 10X TITANIUM Taq buffer, 4 μl of 8 mM MnSO4, 1 μl of 2 mM dGTP, 1 μl of 50X Diversify dNTP Mix, 1 μl of Primer mix, 1 μl of Template DNA, and 1 μl of TITANIUM Taq polymerase. The PCR conditions were denaturation at 94°C for 30 seconds, followed by 25 cycles of denaturation at 94°C for 30 seconds and polymerization at 68°C for 2 minutes, and then polymerization at 68°C for 1 minute. The glyA gene fragment, which was expected to have introduced random mutations, was cloned into linear pCR2.1-Pcj7 digested with NdeI and BamHI restriction enzymes using the Gibson assembly (NEB) method, obtaining pCR2.1-Pcj7_glyA(Mut).

[0149]

[0150] Example 1-3: Construction of a Corynebacterium stationaris strain library containing a glyA mutant vector library.

[0151] Using the pCR2.1-Pcj7_glyA(Mut) mutant vector library constructed in Example 1-2, Corynebacterium stationis KCCM12151P (US 2023-0192780 A1) was transformed by electroporation, and then plated on a selection medium containing 25 mg / L of kanamycin to secure 10,000 colonies of strains with inserted mutant genes, which were selected as the primary candidate group. The selected strain libraries were named KCCM12151P_glyA(library_1) to KCCM12151P_glyA(library_10,000), respectively.

[0152] Additionally, the pCR2.1-Pcj7_glyA vector was introduced into Corynebacterium stationensis KCCM12151P using the same method to be used as a control group in the experiment and named KCCM12151P_glyA(WT).

[0153]

[0154] Example 1-4: Evaluation of glyA library and selection of strains

[0155] Each of the 10,000 colonies obtained in the above Examples 1-3 was inoculated into 350 μl of autoclaved seed medium and cultured in a 96-deep well plate using an incubator shaker (INFORS) at 30°C and 1200 rpm for 96 hours to be used as a seed culture. 290 μl of the autoclaved fermentation medium was dispensed into a 96-deep well plate, and 50 μl of the seed culture was inoculated into each plate, followed by shaking culture for 112 hours under the same conditions as above.

[0156] To analyze the production of 5'-inosinic acid produced in the culture medium, 100 μl of the culture supernatant was transferred to a 96-well black microplate after the culture was completed. Next, the absorbance was measured using a near-infrared spectrometer, and 22 colonies of mutant strains showing an absorbance increased by 5% or more compared to the absorbance of the KCCM12151P_glyA (WT) strain were selected. The other colonies showed similar or decreased absorbance compared to the control.

[0157] The 22 selected strains were repeatedly tested for 5'-inosinic acid production through absorbance measurement using the same method as above, and one strain, KCCM12151P_glyA (library_3371), was selected, which had significantly improved 5'-inosinic acid production compared to the KCCM12151P_glyA (WT) strain.

[0158]

[0159] Example 1-5: Confirmation of glyA mutation through gene sequencing

[0160] In order to confirm the genetic mutation of the mutant strain selected in the above Example 1-4, PCR was performed on the KCCM12151P_glyA (library_3371) strain using the primer pair of SEQ ID NO. 5 and SEQ ID NO. 6, and sequencing was performed to compare the glyA gene with that of the KCCM12151P strain.

[0161] As a result, it was confirmed that the KCCM12151P_glyA (library_3371) strain contained three amino acid mutations in the glyA gene. Specifically, the KCCM12151P_glyA (library_3371) strain was confirmed to have mutations in which the 388th phenylalanine was substituted with cysteine, the 409th lysine was substituted with arginine, and the 412th alanine was substituted with valine (F388C, K409R, A412V) in the glyA amino acid sequence represented by SEQ ID NO: 31.

[0162] The sequences of the primers used in Examples 1-5 are shown in Table 2 below.

[0163] Name sequence (5'->3') Sequence number glyA-lib_CFGAATACTGTGAACTTGCTGG Sequence number 5 glyA-lib_CRTTCCGCTAGGGACTTCTCCA Sequence number 6

[0164] Example 2: Production of a strain introducing a glyA mutation and evaluation of 5'-inosinic acid production.

[0165] Example 2-1: Construction of a recombinant vector introducing the glyA mutation

[0166] In order to confirm whether the three mutations of glyA, F388V, K409R, and A412V, identified in the above Examples 1-5, can lead to increased IMP productivity, a vector introducing each mutation into the endogenous glyA gene of the Corynebacterium stationary strain was constructed.

[0167] Specifically, a vector was constructed as follows using plasmid pDC24 (SEQ ID NO: 51, Korean Patent Publication No. 10-2024-0167588A) for insertion and replacement of genes in the chromosome of Corynebacterium stationensis strain.

[0168] PCR was performed using the gDNA (genomic DNA) of wild type Corynebacterium stationensis ATCC6872 as a template, with a pair of primers of SEQ ID NOs. 7 and 8 and a pair of primers of SEQ ID NOs. 9 and 10, respectively. PCR was performed at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and then 72°C for 5 minutes. The pDC24 vector was treated with SmaI, and the PCR product obtained above was fusion cloned using the In-Fusion® HD cloning kit (Clontech). The plasmid obtained as a result of the cloning was named pDC24-glyA (F388C).

[0169] In addition, PCR and cloning were performed in the same manner using primer pairs of SEQ ID NO: 7 and SEQ ID NO: 11 and primer pairs of SEQ ID NO: 12 and SEQ ID NO: 10. The plasmid obtained as a result of the cloning was named pDC24-glyA (K409R).

[0170] In addition, PCR and cloning were performed in the same manner using primer pairs of SEQ ID NO: 7 and SEQ ID NO: 13 and primer pairs of SEQ ID NO: 14 and SEQ ID NO: 10. The plasmid obtained as a result of the cloning was named pDC24-glyA (A412V).

[0171] Finally, PCR and cloning were performed in the same manner using primer pairs of SEQ ID NO: 7 and SEQ ID NO: 8, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 15, and primer pairs of SEQ ID NO: 16 and SEQ ID NO: 10. The plasmid obtained as a result of the cloning was named pDC24-glyA (F388C, K409R, A412V).

[0172] The sequences of the primers used in Example 2-1 are shown in Table 3 below.

[0173] Name Sequence (5'->3') Sequence number glyA (M3) _LFAATTCGAGCTCGGTACCCACTACGGTGGATGTGAGCAC Sequence number 7 glyA (F388C) _RGGTGcATGCTTCTGCATCCAGGCCGCGGGTAGCCA Sequence number 8 glyA (F388C) _FCTGGATGCAGAAGCATgCACCGAGGTGGCAGACAT Sequence number 9 glyA (M3) _RRCGACTCTAGAGGATCCCCCGTCAGCATCGATGGTTTCC Sequence number 10 glyA (K409R) _RGCGTGCGCGCAGCcTCTGGGTATCGGCGTTCTTGC Sequence number 11 glyA (K409R) _FCGCCGATACCCAGAgGCTGCGCGCACGCGTGGACA Sequence number 12glyA(A412V)_RAAGCTTGTCCACGCGTaCGCGCAGCTTCTGGGTATSEQ ID NO: 13glyA(A412V)_FAAGCTGCGCGtACGCGTGGACAAGCTTGCTGAGCASEQ ID NO: 14glyA(K409R, A412V)_RTGTCCACGCGTaCGCGCAGCcTCTGGGTATCGGCGSEQ ID NO: 15glyA(K409R, A412V)_FCAGAgGCTGCGCGtACGCGTGGACAAGCTTGCTGASEQ ID NO: 16

[0174] Example 2-2: Production of a 5'-inosinic acid producing strain with a glyA mutation introduced

[0175] In order to confirm the effect of the mutations F388C, K409R, A412V, or a combination thereof of glyA discovered in the above Example 1-5 on IMP production ability, four strains were prepared and evaluated by introducing each mutation into the endogenous glyA gene of Corynebacterium stationanis strain.

[0176] The vectors pDC24-glyA(F388C), pDC24-glyA(K409R), pDC24-glyA(A412V), and pDC24-glyA(F388C, K409R, A412V) constructed in Example 2-1 were transformed into Corynebacterium stationanis KCCM12151P, a strain capable of producing 5'-inosinic acid, by electroporation, and then strains in which the mutant gene and vector were inserted together on the chromosome were selected as primary candidates on a selection medium containing 25 mg / L of kanamycin. Thereafter, in the strains in which homologous recombination occurred, the strains in which each mutation of the target gene was introduced were finally selected through gene sequence analysis using PCR using the primer pairs of SEQ ID NOs: 17 and 18. The final selected strains were named CJI-3416(KCCM12151P_glyA(F388C), CJI-3417(KCCM12151P_glyA(K409R), CJI-3418(KCCM12151P_glyA(A412V), CJI-3419(KCCM12151P_glyA(F388C, K409R, A412V), respectively.

[0177] The sequences of the primers used in Example 2-2 are shown in Table 4 below.

[0178] Name sequence (5'->3') Sequence number glyA_seq_FGCGGACCTGCGCAATTCTGA Sequence number 17 glyA_seq_RCAGAGGATGCGGATAAGCAG Sequence number 18

[0179] Example 2-3: Evaluation of 5'-inosinic acid production ability of 5'-inosinic acid producing strain with glyA mutation introduced

[0180] In order to measure the 5'-inosinic acid production ability of the CJI-3416(KCCM12151P_glyA(F388C), CJI-3417(KCCM12151P_glyA(K409R), CJI-3418(KCCM12151P_glyA(A412V), CJI-3419(KCCM12151P_glyA(F388C, K409R, A412V) strains produced in the above Example 2-2, a flask titer evaluation was performed using the following method.

[0181] Specifically, Corynebacterium stationensis KCCM12151P, CJI-3416, CJI-3417, CJI-3418, and CJI-3419 were inoculated into a 14 ml tube containing 2.5 ml of the following seed medium and cultured with shaking at 170 rpm at 30°C for 24 hours. Then, 2 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 29 ml of the following production medium (24 ml of main medium + 5 ml of starch medium) and cultured with shaking at 170 rpm at 30°C for 72 hours. After completion of the culture, the production amount of 5'-inosinic acid was measured using HPLC (UC11-SIMAZU) using the following method, and the OD value was measured using the following method.

[0182] Specifically, inosine-5-monophsphate disodium salt hydrate (Aldrich, 57510-5G) was used as a standard reagent for HPLC at a concentration of 1 g / L. The mobile phase for analysis was 5 L of distilled water, containing 10 g of 0.2%-Ammonium Dihydrogenphosphate, 1 g of 0.02%-Tetrabutylammonium phosphate monobasic, and 108 ml of 2.1% ACETONITRILE, adjusted to pH 2.4 with H3PO4. The column temperature was 40°C, the flow rate was 1.0 ml / min, and 2 μl of a 20-fold diluted cultured sample was injected to measure the production of IMP. In addition, the cultured sample was diluted 100-fold with DW, and the OD (Optical Density) was measured at a wavelength of 562 nm using a spectrophotometer (Eppendorf).

[0183]

[0184] <IMP 생산을 위한 종배지>

[0185] Glucose 1%, peptone 1%, meat juice 1%, yeast extract 1%, sodium chloride 0.25%, adenine 100 mg / L, guanine 100 mg / L, pH 7.2

[0186]

[0187] <IMP 생산을 위한 생산배지(본배지)>

[0188] Monosodium glutamate 0.1%, ammonium chloride 1%, magnesium sulfate 1.2%, calcium chloride 0.01%, iron sulfate 20 mg / L, manganese sulfate 20 mg / L, zinc sulfate 20 mg / L, copper sulfate 5 mg / L, L-cysteine ​​23 mg / L, beta-alanine 24 mg / L, nicotinic acid 8 mg / L, biotin 45 μg / L, thiamine hydrochloride 5 mg / L, adenine 30 mg / L, phosphoric acid (85%) 1.9%, glucose 4.2%, fructose 2.4%

[0189]

[0190] <IMP 생산을 위한 생산배지(별도살균배지)>

[0191] Phosphoric acid (85%) 23.3 g / L, ammonia (28%) 16.25 g / L, potassium hydroxide 25.5 g / L

[0192]

[0193] The culture results following the introduction of the glyA mutation in the IMP-producing strain Corynebacterium stationensis KCCM12151P are shown in Table 5 below. The above experiment was repeated three times, and the average value of the analysis results is shown. The residual sugar concentration is the result of measuring the residual glucose amount at 48 hours out of the total culture time of 72 hours based on the initial glucose of 40 g.

[0194] glyA Confirmation of 5'-inosinic acid production by introduction of genetic mutation Name of strain Introduction type OD Residual sugar concentration (g / L) 5'-inosinic acid (g / L) KCCM12151P Control 41.218.24.9 CJI-3416glyA (F388C) 41.117.15.1 CJI-3417glyA (K409R) 42.117.55.2 CJI-3418glyA (A412V) 40.917.35.0 CJI-3419glyA (F388C, K409R, A412V) 42.215.15.6

[0195] As a result, as shown in Table 5, the CJI-3416, CJI-3417, and CJI-3418 strains, into which the F388C, K409R, or A412V mutations of glyA were introduced, showed improved sugar consumption with a 6%, 4%, and 5% decrease in residual sugar content, respectively, compared to the control strain, and an increase in IMP production by 4%, 6%, and 2%, respectively. In the case of CJI-3419, a strain into which all three mutations were introduced, the residual sugar content was reduced by 17% and IMP production was improved by 14%, confirming that including all F388C, K409R, and A412V mutations had the greatest effect on improving IMP concentration.

[0196]

[0197] Example 3: Production of glyA-introduced strain and evaluation of glycine production capacity

[0198] Example 3-1: Construction of a recombinant vector introducing glyA library mutations

[0199] To determine whether the three mutations of glyA, F388C, K409R, and A412V, discovered in Example 1, could lead to increased glycine productivity in a Corynebacterium strain, mutations were introduced into the endogenous glyA gene of a Corynebacterium glutamicum strain. A total of four vectors were constructed to determine the effects of individual mutations and the combined effects of the three mutations.

[0200] Specifically, it was constructed as follows using plasmid pDC24 for insertion and replacement of genes in the Corynebacterium chromosome.

[0201] PCR was performed using the gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template, with a pair of primers of SEQ ID NOs: 19 and 20 and a pair of primers of SEQ ID NOs: 21 and 22, respectively. The PCR was performed by denaturing at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and then 72°C for 5 minutes. The pDC24 vector was treated with SmaI, and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting plasmid was named pDC24-glyA (F389C).

[0202] In addition, PCR and cloning were performed in the same manner using primer pairs of sequences of SEQ ID NOs: 19 and 23 and primer pairs of sequences of SEQ ID NOs: 22 and 24. The resulting plasmid was named pDC24-glyA (S410R).

[0203] In addition, PCR and cloning were performed in the same manner using primer pairs of sequences of SEQ ID NOs: 19 and 25 and primer pairs of sequences of SEQ ID NOs: 22 and 26. The resulting plasmid was named pDC24-glyA (G413V).

[0204] Finally, PCR and cloning were performed in the same manner using primer pairs of sequences 19 and 20, primer pairs of sequences 21 and 27, and primer pairs of sequences 22 and 28. The resulting plasmid was named pDC24-glyA (F389C, S410R, G413V).

[0205] The sequences of the primers used in Example 3-1 above are shown in Table 6 below.

[0206] Name Sequence (5'->3') Sequence number glyA (M3) _LFAATTCGAGCTCGGTACCCGATGATCGCGTCTGAGAACTTSequence number 19 glyA (F389C) _RTGCAACCTCAGTGcATGCAGGAATATCGAASEQ number 20 glyA (F389C) _FTTCGATATTCCTGCATgCACTGAGGTTGCASEQ number 21 glyA (M3) _RRCGACTCTAGAGGATCCCCCTTTAAGCTCATAACCAACGTSEQ number 22 glyA (S410R) _RTACACGGCCACGCAGAcgCTCAATGTCTGCGGASEQ number 23 glyA (S410R) _FTCCGCAGACATTGAGcgTCTGCGTGGCCGTGTASEQ number 24glyA(G413V)_RAGCTTTGCTACACGGaCACGCAGAGACTCAASeq number 25glyA(G413V)_FTTGAGTCTCTGCGTGtCCGTGTAGCAAAGCTSEQ number 26glyA(S410R, G413V)_RGCTTTGCTACACGGaCACGCAGAcgCTCAATGTCTGCSEQ number 27glyA(S410R, G413V)_FGCAGACATTGAGcgTCTGCGTGtCCGTGTAGCAAAGCSEQ number 28

[0207] Example 3-2: Production of a glycine-producing strain with glyA library mutations introduced

[0208] In order to confirm the effects of the glyAF388C, K409R, and A412V mutations discovered in Example 1 above on glycine production ability, four strains in which mutations were introduced into the endogenous glyA gene of Corynebacterium glutamicum strains were produced and evaluated.

[0209] The vectors pDC24-glyA(F389C), pDC24-glyA(S410R), pDC24-glyA(G413V), and pDC24-glyA(F389C, S410R, G413V) constructed in Example 3-1 were electroporated into Corynebacterium glutamicum ATCC13032, a strain capable of producing glycine, and then strains in which the mutant gene and vector were co-inserted on the chromosome were selected as primary candidates in a selection medium containing 25 mg / L of kanamycin. Afterwards, the gene sequence was finally confirmed through PCR using the primer pair of SEQ ID NO: 29 and SEQ ID NO: 30 in the strain in which homologous recombination occurred. The selected strains were named CJ-2005(Cgl13032_glyA(F389C), CJ-2006(Cgl13032_glyA(S410R), CJ-2007(Cgl13032_glyA(G413V), CJ-2008(Cgl13032_glyA(F389C, S410R, G413V), respectively.

[0210] The sequences of the primers used for gene sequence analysis in Example 3-2 above are shown in Table 7 below.

[0211] Name sequence (5'->3') Sequence number glyA_seq_FCCCAGGTCAGCAGGGTGG Sequence number 29 glyA_seq_RCTCAATGACGCCTGCACA Sequence number 30

[0212] Example 3-3: Evaluation of glycine production ability of strains into which the glyA mutant gene has been introduced

[0213] In order to measure the glycine production ability of the CJ-2005, CJ-2006, CJ-2007, and CJ-2008 strains produced in Example 3-2 above, they were cultured using the following method.

[0214] The parent strain, Corynebacterium glutamicum ATCC13032, and the four mutant strains were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium, and the mixture was cultured with shaking at 200 rpm at 30°C for 20 hours to obtain a seed culture. Thereafter, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, and cultured at 30°C for 72 hours at 200 rpm to produce glycine.

[0215] The composition of the above-mentioned seed medium and fermentation medium is as follows.

[0216]

[0217] Activation Badge

[0218] Beef extract 5 g / L, Polypeptone 10 g / L, Yeast extract 5 g / L, Urea 2 g / L, NaCl 2.5 g / L, Agar 20 g / L, Glucose 10 g / L, 10N NaOH 100 ㎕ / L

[0219] <Jongbaeji>

[0220] Glucose (anhydrous glucose) 20 g / L, Polypeptone 10 g / L, Yeast extract 10 g / L, (NH4)2SO410 g / L, Urea 1.5 g / L, KH2PO45.2 g / L, K2HPO410.7 g / L, d-Biotin 1.8 mg / L, Thiamine-HCl 9 mg / L, CAPA 9 mg / L, NCA 60 mg / L, MgSO40.5 g / L

[0221] <Production medium>

[0222] CaCO330 g / L, Sucrose 50 g / L, MgSO40.6 g / L, (NH4)2SO420 g / L, KH2PO41 g / L, Yeast extract 5 g / L, d-Biotin 0.05 mg / L, Thiamine-HCl 0.1 mg / L, MnSO418 μg / L, FeSO418 μg / L, ZnSO40.9 μg / L, CuSO40.9 μg / L

[0223]

[0224] After the culture was completed, the amount of glycine produced was measured using liquid high-performance chromatography, and the glycine concentration in the culture medium for each strain tested is shown in Table 8 below.

[0225] glyA Confirmation of glycine production by introduction of genetic mutation Strain name Introduction type OD Glycine concentration (mg / L) ATCC 13032 Control 72.0 1 10.0 CJ-2005 glyA (F389C) 68.8 1 21.0 CJ-2006 glyA (S410R) 64.4 1 26.5 CJ-2007 glyA (G413V) 66.2 1 16.6 CJ-2008 glyA (F389C, S410R, G413V) 66.3 1 32.0

[0226] As shown in Table 8 above, the Corynebacterium glutamicum CJ-2005, CJ-2006, and CJ-2007 strains, each of which introduced F389C, S410R, or G413V, which are mutations of glyA corresponding to F388C, K409R, and A412V of glyA discovered in Example 1, respectively, showed an increase in glycine production by 10%, 15%, and 6%, respectively, compared to the control strain, Corynebacterium glutamicum ATCC13032. In the case of CJ-2008, a strain into which all three mutations were introduced, glycine production was improved by 20%, confirming that including all of the F389C, S410R, and G413V mutations had the greatest effect on improving glycine concentration.

[0227]

[0228] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A polypeptide having serine hydroxymethyltransferase activity, wherein the amino acid corresponding to the 388th residue in an amino acid sequence having 80% or more sequence identity with the amino acid sequence of SEQ ID NO: 31 is replaced with another amino acid, the amino acid corresponding to the 409th residue is replaced with another amino acid, the amino acid corresponding to the 412th residue is replaced with another amino acid, or a combination thereof.

2. In the first paragraph, the polypeptide is a polypeptide in which the amino acid corresponding to the 388th residue in the amino acid sequence of SEQ ID NO: 31 is replaced with another amino acid, the amino acid corresponding to the 409th residue is replaced with another amino acid, the amino acid corresponding to the 412th residue is replaced with another amino acid, or a combination thereof.

3. In the first paragraph, the polypeptide is a polypeptide in which the amino acid corresponding to the 389th residue in the amino acid sequence of SEQ ID NO: 41 is replaced with another amino acid, the amino acid corresponding to the 410th residue is replaced with another amino acid, the amino acid corresponding to the 413th residue is replaced with another amino acid, or a combination thereof.

4. A polypeptide in the first paragraph, wherein the amino acid corresponding to the 388th residue in the amino acid sequence having a sequence identity of 80% or more with the amino acid sequence of SEQ ID NO: 31 is phenylalanine, the amino acid corresponding to the 409th residue is lysine or serine, and the amino acid corresponding to the 412th residue is alanine or glycine.

5. A polypeptide in which, in the amino acid sequence having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 31, the amino acid corresponding to the 388th residue is substituted with cysteine; the amino acid corresponding to the 409th residue is substituted with arginine; or the amino acid corresponding to the 412th residue is substituted with valine.

6. A polypeptide according to claim 1, wherein the polypeptide comprises an amino acid sequence of any one of the sequence numbers selected from the group consisting of SEQ ID NO: 32 to SEQ ID NO: 35 and SEQ ID NO: 42 to SEQ ID NO:

45.

7. A polynucleotide encoding a polypeptide according to any one of claims 1 to 6.

8. In the 7th paragraph, the polynucleotide comprises a nucleic acid sequence of any one sequence number selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: 40 and SEQ ID NO: 47 to SEQ ID NO:

50.

9. A recombinant vector comprising the polynucleotide of Article 7.

10. A microorganism comprising at least one member selected from the group consisting of a polypeptide according to any one of claims 1 to 6, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

11. In the 10th paragraph, the microorganism is a microorganism having increased purine nucleotide or glycine production ability.

12. A microorganism in claim 11, wherein the purine nucleotide is at least one selected from the group consisting of 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), and 5'-guanosine monophosphate (GMP).

13. In paragraph 10, the microorganism is a microorganism of the genus Corynebacterium.

14. A microorganism according to claim 13, wherein the microorganism is Corynebacterium stationis or Corynebacterium glutamicum.

15. A method for producing purine nucleotides or glycine, comprising the step of culturing a microorganism comprising at least one selected from the group consisting of a polypeptide according to any one of claims 1 to 6, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

16. A method for producing purine nucleotides or glycine, further comprising a step of recovering purine nucleotides or glycine from the cultured microorganism, medium, or both of the above-described 15th paragraph.

17. A method for producing a purine nucleotide or glycine in claim 15, wherein the purine nucleotide is at least one selected from the group consisting of 5'-inosinic acid, 5'-xanthrylic acid, and 5'-guanine acid.

18. A composition for producing purine nucleotides or glycine, comprising a microorganism comprising at least one member selected from the group consisting of a polypeptide according to any one of claims 1 to 6, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.