Method for determining sequence of nucleic acid aptamer

Abstract

The present invention relates to a method for determining the sequence of a nucleic acid aptamer and making it possible to determine the sequence of the nucleic acid aptamer that binds to a target without being affected by PCR bias. The nucleic acid aptamer capable of binding to the target is collected from a plurality of types of nucleic acid aptamer candidates without PCR amplification. The sequence of the collected nucleic acid aptamer is then determined without PCR amplification.

Description

Method for determining the sequence of a nucleic acid aptamer

[0001] The present invention relates to a method for determining the sequence of a nucleic acid aptamer capable of binding to a target.

[0002] Target capture molecules that can capture specific targets are important in various fields, including medicine and industry. For example, in the medical field, target capture molecules can be used to collect and quantify pathogenic molecules in the blood to clarify the progression of a disease or detect pre-disease symptoms. Some pharmaceuticals administered to treat illnesses also function as target capture molecules, capturing pathogenic factors and inhibiting their function, thereby alleviating symptoms and curing illness. In the industrial field, target capture molecules are also used in processes for purifying synthetic substances and detecting foreign substances.

[0003] In the medical field, antibodies are used as target capture molecules due to their high specificity and strong binding ability. However, antibodies have the drawback of being costly and time-consuming to develop and manufacture. Antibody production requires the cultivation of large quantities of antibody-producing cells, but cell culture media are expensive and cell proliferation is time-consuming. Furthermore, when developing a new antibody to capture a target, multiple antibodies must be developed and manufactured separately, and their binding to the target must be evaluated separately. Furthermore, because antibody targets are usually biological molecules such as proteins, antibodies have primarily been used in biotechnology-related fields.

[0004] Meanwhile, nucleic acid aptamers are known as target capture molecules that can replace antibodies. Nucleic acid aptamers are single-stranded nucleic acids that have the function of capturing targets, and include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and those with chemical modifications or alterations to their backbones or bases. Because nucleic acid aptamers can be chemically synthesized, they can be produced inexpensively and in a short time. Another advantage of developing new nucleic acid aptamers is that, unlike antibodies, there is no need to separately produce and evaluate multiple candidate molecules. Furthermore, because the structural flexibility of nucleic acid aptamers is superior to that of antibodies, nucleic acid aptamers can be used as capture molecules for not only biomolecules but also small molecules. For this reason, nucleic acid aptamers can also be used in industrial fields.

[0005] Systematic Evolution of Ligands by Exponential Enrichment (SELEX) is a well-known method for searching for nucleic acid aptamers that bind to a target. The SELEX method involves 1) selecting nucleic acids capable of binding to a target and 2) determining the sequence of the selected nucleic acids. In the 1) selection step, a nucleic acid library containing a large number of nucleic acids (candidate nucleic acid aptamers) with different base sequences synthesized in one pot is first mixed with the target, and nucleic acids that bind to the target are separated. The separated nucleic acids are then amplified by polymerase chain reaction (PCR), after which they are contacted with the target and separated again. This process is repeated multiple times to enrich for nucleic acids that strongly bind to the target. In the 2) sequencing step, the sequences of the nucleic acids enriched in 1) are determined by next-generation sequencing (NGS) or Sanger sequencing. Again, the nucleic acids are amplified by PCR. For example, Non-Patent Document 1 discloses 1) a method in which the number of times nucleic acid concentration is reduced by performing capillary electrophoresis in the selection step.

[0006] Shingo Saito, et al., "Single-Round DNA Aptamer Selection by Combined Use of Capillary Electrophoresis and Next Generation Sequencing: An Aptaomics Approach for Identifying Unique Functional Protein-Binding DNA Aptamers", Chemistry A European Journal, Vol. 27, pp. 10058-10067.

[0007] It has been reported that the global market size for antibody drugs is estimated to be $126.7 billion (2021), while the global market size for nucleic acid aptamers is estimated to be $151 million (2021). Thus, the global market size for nucleic acid aptamers is much smaller than that of antibody drugs. The present inventors suspected that the small global market size for nucleic acid aptamers may be due to the influence of PCR bias hindering the development of nucleic acid aptamers.

[0008] Depending on the sequence, some nucleic acids are easily amplified by PCR while others are not (PCR bias). It is believed that PCR amplification efficiency is particularly low for base sequences that can form complex three-dimensional structures that can function as nucleic acid aptamers. For this reason, in conventional SELEX methods, at least some nucleic acids that can strongly bind to targets may not be selected in the selection process because they are difficult to amplify by PCR. In the method described in Non-Patent Document 1, nucleic acid aptamer candidates are selected without PCR amplification by performing capillary electrophoresis in the selection process. However, even in the method described in Non-Patent Document 1, the sequencing process involves NGS, which includes PCR, so the influence of PCR bias still remains.

[0009] An object of the present invention is to provide a method for determining the sequence of a nucleic acid aptamer, which is capable of determining the sequence of a nucleic acid aptamer capable of binding to a target without being affected by PCR bias.

[0010] The present invention relates to the following method for determining the sequence of a nucleic acid aptamer.

[0011] [1] A method for determining the sequence of a nucleic acid aptamer capable of binding to a target, comprising the steps of: separating nucleic acid aptamers capable of binding to the target from a plurality of types of nucleic acid aptamer candidates without PCR amplification; and determining the sequence of the separated nucleic acid aptamers without PCR amplification. [2] The method for determining the sequence of a nucleic acid aptamer according to [1], wherein the step of separating the nucleic acid aptamers comprises the steps of contacting the plurality of types of nucleic acid aptamer candidates with the target and separating the nucleic acid aptamers bound to the target. [3] The method for determining the sequence of a nucleic acid aptamer according to [2], wherein the steps of contacting the plurality of types of nucleic acid aptamer candidates with the target and separating the nucleic acid aptamers bound to the target are performed only once. [4] The method for determining the sequence of a nucleic acid aptamer according to any one of [1] to [3], wherein in the step of determining the sequence of the nucleic acid aptamer, the sequence of the nucleic acid aptamer is determined from a change in current value resulting from the sequence of the nucleic acid aptamer. [5] The method for determining the sequence of a nucleic acid aptamer according to any one of [1] to [4], further comprising a step of predicting the sequence of a nucleic acid aptamer capable of binding to the target based on the sequences of multiple types of nucleic acid aptamers capable of binding to the target. [6] The method for determining the sequence of a nucleic acid aptamer according to any one of [1] to [5], wherein the multiple types of candidate nucleic acid aptamers are a nucleic acid library of 10 to 100 bases. [7] The method for determining the sequence of a nucleic acid aptamer according to [6], wherein the nucleic acid library contains unnatural bases.

[0012] According to the present invention, since PCR amplification is not performed in either the nucleic acid aptamer selection process or the sequencing process, it is possible to determine the sequences of nucleic acid aptamers capable of binding to a target without being affected by PCR bias.Furthermore, according to the present invention, it is possible to determine the sequences of nucleic acid aptamers capable of binding to a target not only using a nucleic acid library composed only of natural nucleic acids, but also using a nucleic acid library containing artificial nucleic acids.

[0013] FIGS. 1A and 1B are flowcharts of a method for determining the sequence of a nucleic acid aptamer according to one embodiment of the present invention. FIG. 2 is a flowchart of the selection process. FIG. 3 is a schematic diagram showing an overview of the selection process. FIG. 4 shows examples of nucleic acids contained in a nucleic acid library. FIGS. 5A and 5B show examples of nucleic acids contained in a nucleic acid library. FIGS. 6A-D are schematic diagrams showing how nucleic acid aptamers bound to targets are sorted in a method using target-immobilized beads. FIG. 7 is a schematic diagram showing how nucleic acid aptamers are determined. FIGS. 8A and 8B are diagrams showing examples of barcode DNA. FIG. 9 is a graph showing the ratio of the number of detections of sequence 1 to sequence 2 in samples before and after PCR. FIG. 10 is a graph showing the relationship between KD values ​​and predicted binding values ​​for each nucleic acid aptamer. FIG. 11A is a graph showing current waveforms used as explanatory variables, and FIG. 11B is a table showing a confusion matrix indicating the prediction accuracy of a machine learning model.

[0014] An embodiment of the present invention will be described in detail below with reference to the drawings, although the present invention is not limited thereto.

[0015] As shown in Figure 1A, the method for determining the sequence of a nucleic acid aptamer (hereinafter also referred to as the "determination method") of this embodiment is a method for determining the sequence of a nucleic acid aptamer that can bind to a target, and includes: 1) a step of separating a nucleic acid aptamer that can bind to a target from multiple types of nucleic acid aptamer candidates without PCR amplification (hereinafter also referred to as the "selection step"), and 2) a step of determining the sequence of the separated nucleic acid aptamer without PCR amplification (hereinafter also referred to as the "sequencing step").

[0016] The determination method according to this embodiment may further include other steps. For example, as shown in Figure 1B, in addition to the above-mentioned 1) selection step and 2) sequencing step, the determination method according to this embodiment may include 3) a step of predicting the sequence of a nucleic acid aptamer capable of binding to a target based on the sequences of multiple types of nucleic acid aptamers capable of binding to the target (hereinafter also referred to as a "sequence analysis step").

[0017] As described above, in the determination method according to the present embodiment, PCR amplification is not performed in either the nucleic acid aptamer selection step or the sequencing step. In the determination method according to the present embodiment, if there are other steps such as a sequence analysis step, it is preferable that PCR amplification is not performed in all steps, including the other steps.

[0018] The type of target is not particularly limited and may be, for example, a target used in the medical field or a target used in the industrial field. Examples of targets include biomarkers whose detection or quantification can enable the diagnosis of disease or the detection of pre-disease, biomolecules whose function can be inhibited or enhanced to treat disease or alleviate symptoms, and substances that are desired to be purified or removed in the production of products. The target does not have to be a biomolecule such as a protein. Furthermore, the target does not have to be a single molecule, and may be, for example, a complex in which multiple molecules are bound, a cell, a polymer, or the like.

[0019] For example, the target may be immunoglobulin E (IgE), which plays a central role in allergic reactions. When an allergen such as pollen enters the body, the allergen-bound IgE binds to mast cells, which then release substances that induce allergic symptoms, such as histamine. Therefore, nucleic acid aptamers that can inhibit the binding of IgE to mast cells by binding to IgE may be useful for preventing or treating allergies. By determining the sequence of a nucleic acid aptamer that can bind to IgE using the determination method according to this embodiment, it may be possible to obtain a nucleic acid aptamer that can be used for preventing or treating allergies.

[0020] Each of the above steps 1) to 3) will be explained below.

[0021] 1) Selection Step First, in the selection step, nucleic acid aptamers capable of binding to a target are separated from multiple types of nucleic acid aptamer candidates without PCR amplification. For example, as shown in FIG. 2, the selection step may include a step of contacting multiple types of nucleic acid aptamer candidates with a target (hereinafter also referred to as a "contact step") and a step of separating the nucleic acid aptamers bound to the target (hereinafter also referred to as a "separation step"). In this way, as shown in FIG. 3, nucleic acid aptamers 130 capable of binding to a target 120 can be obtained from multiple types of nucleic acid aptamer candidates 110. The contact step and separation step may be performed alternately multiple times to concentrate the nucleic acid aptamers bound to the target, but it is preferable to perform each step only once.

[0022] In this specification, a collection of multiple types of nucleic acid aptamer candidates is referred to as a "nucleic acid library." A nucleic acid library is, for example, a collection of nucleic acids having different base sequences. In a nucleic acid library, the base sequences of all nucleic acids do not have to be different from each other, and multiple nucleic acids with the same base sequence may be included. The type of nucleic acid library used in the selection process is not particularly limited. For example, the multiple types of nucleic acid aptamer candidates may be a nucleic acid library containing nucleic acids of 10 to 100 bases. Furthermore, this nucleic acid library may be a nucleic acid library containing artificial bases.

[0023] The nucleic acids contained in the nucleic acid library may have any three-dimensional structure. For example, the nucleic acids contained in the nucleic acid aptamer library may be nucleic acids having the structure shown in FIG. 4 (SEQ ID NO: 1), nucleic acids having the structure shown in FIG. 5A (SEQ ID NO: 2), or nucleic acids having the structure shown in FIG. 5B (SEQ ID NO: 3). In these figures, A represents adenine, T represents thymine, G represents guanine, C represents cytosine, and N represents a random base species. The main chain structure of the nucleic acid and the type of base are not particularly limited. Examples of nucleic acid main chain structures include DNA, RNA, cross-linked artificial nucleic acids (LNA), peptide nucleic acids (PNA), and their analogs. A single nucleic acid aptamer may contain one type of main chain structure or multiple types of main chain structures. Examples of bases include natural bases such as adenine, guanine, cytosine, thymine, and uracil, modified natural bases, and natural bases with modified substituents. That is, the nucleic acid library may be a nucleic acid library containing artificial bases, and the nucleic acid aptamer may be an artificial nucleic acid aptamer that contains bases with any chemical modification or has any modified backbone structure to improve structural diversity. Some bases may be substituted with any chemical structure, such as fluorescent molecules. Furthermore, some of the constituent units of the nucleic acid may not have bases. Furthermore, the nucleic acid aptamer may be modified depending on the purpose, such as preventing degradation of the nucleic acid aptamer in vivo.

[0024] The method for contacting multiple types of nucleic acid aptamer candidates with a target and separating the nucleic acid aptamers bound to the target is not particularly limited as long as it does not involve PCR, and can be appropriately selected from known methods. For example, nucleic acid aptamers bound to the target may be separated by the capillary electrophoresis-SELEX method (CE-SELEX method) described in Non-Patent Document 2, the microbead-assisted capillary electrophoresis-SELEX method (MACE-SELEX method) described in Non-Patent Document 3, or a method using target-immobilized beads. The method using target-immobilized beads will be described below. [Non-patent document 2] Shaun D. Mendonsa, et al., "In Vitro Selection of High-Affinity DNA Ligands for Human IgE Using Capillary Electrophoresis", Analytical Chemistry, Vol. 76, pp. 5387-5392. [Non-patent document 3] Koji Wakui, et al., "Rapidly Neutralizable and Highly Anticoagulant "Thrombin-Binding DNA Aptamer Discovered by MACE SELEX", Molecular Therapy: Nucleic Acids, Vol. 16, pp. 348-359.

[0025] (Method using target-immobilized beads) In the method using target-immobilized beads, beads are used to immobilize targets using chemical bonds, biotin-avidin bonds, etc. Figures 6A to 6D are schematic diagrams showing how nucleic acid aptamers bound to targets are sorted in the method using target-immobilized beads.

[0026] First, beads 140 (target-immobilized beads 140) on which targets 120 are immobilized are mixed with a nucleic acid library. As a result, as shown in FIG. 6A , nucleic acid aptamer candidates 110 come into contact with targets 120 on the target-immobilized beads 140. Some of the nucleic acid aptamer candidates 110 bind to the targets 120 and remain on the surface of the target-immobilized beads 140. Next, the target-immobilized beads 140 are allowed to accumulate, and the supernatant is then collected. As shown in FIG. 6B , the nucleic acid aptamer candidates 110 that do not bind to the targets 120 are removed. Next, the target-immobilized beads 140 are suspended in a washing buffer containing salts, surfactants, etc., and the target-immobilized beads 140 are allowed to accumulate again, and the supernatant is then collected. As a result, as shown in FIG. 6C , nucleic acid aptamer candidates 110 nonspecifically adsorbed to beads 140 and the like, as well as nucleic acid aptamer candidates 110 weakly bound to the target 120, are removed. Finally, the target-immobilized beads 140 are heat-treated or suspended in a recovery buffer solution, which is a strongly basic solution containing sodium hydroxide or the like, to separate the nucleic acid aptamer candidates 110 bound to the target 120 (nucleic acid aptamers 130 capable of binding to the target) from the target 120. As a result, as shown in FIG. 6D , the nucleic acid aptamer candidates 110 bound to the target 120 (nucleic acid aptamers 130 capable of binding to the target) are recovered. Through the above procedure, the nucleic acid aptamers bound to the target can be separated.

[0027] 2) Sequencing Step Next, in the sequencing step, the sequences of the nucleic acid aptamers sorted in the selection step are determined without PCR amplification.

[0028] The method for determining the sequence of a nucleic acid aptamer is not particularly limited as long as it does not involve PCR and can be appropriately selected from known methods. However, a method for determining the sequence of a nucleic acid aptamer from changes in current value due to the sequence of the nucleic acid aptamer is preferred. For example, as shown in FIG. 7, 1) DNA to which a helicase has been attached is bound by a ligation reaction to the nucleic acid aptamer isolated in the selection step, and the nucleic acid that has been single-stranded by the helicase is then passed through a through-hole in the membrane while measuring the current value of the membrane. Since the current value of the membrane changes depending on the base present in the through-hole, the sequence of the nucleic acid can be estimated. This estimation may also be performed using machine learning. For example, the above-mentioned sequencing method can be performed using a nanopore sequencer from Oxford Nanopore Technologies and Guppy, a nanopore sequencer software that converts changes in current value into base sequence information. Furthermore, even using Northern Nanopore Instruments' nanopore technology, the sequence of a nucleic acid aptamer can be determined from changes in current value due to the sequence of the nucleic acid aptamer without PCR amplification. As described above, when predicting a nucleic acid sequence from a change in current value, any method such as machine learning may be used.

[0029] In the above-described sequencing method, other DNA sequences such as barcode DNA may be inserted between the nucleic acid aptamer (e.g., SEQ ID NOS: 1 to 3) and the DNA to which the helicase is attached. Examples of barcode DNA include the DNA fragments shown in Figure 8A (SEQ ID NOS: 4 and 5) and Figure 8B (SEQ ID NOS: 6 and 7).

[0030] The determination method according to the present embodiment does not require PCR amplification, and therefore the sequence of the artificial nucleic acid aptamer can be easily determined. In conventional SELEX methods, the sequence of a nucleic acid aptamer is determined by a method that includes PCR amplification, such as next-generation sequencing (NGS) or Sanger sequencing. However, PCR amplification replaces the artificial nucleic acid portion with natural nucleic acid, making it impossible to identify the position or structure of the artificial nucleic acid portion in the artificial nucleic acid aptamer. Furthermore, since the PCR amplification efficiency of the artificial nucleic acid portion is lower than that of natural nucleic acid, it is buried in the efficiently amplified natural nucleic acid and is difficult to detect. Therefore, it has been difficult to determine the sequence of an artificial nucleic acid aptamer using conventional SELEX methods. In contrast, the determination method according to the present embodiment does not require PCR amplification, and therefore the sequence of the artificial nucleic acid aptamer can be easily determined. Therefore, the determination method according to the present embodiment can be used to develop artificial nucleic acid aptamers that can bind to targets.

[0031] 3) Sequence analysis step In the optional sequence analysis step, the sequence of a nucleic acid aptamer capable of binding to a target is predicted based on the sequences of multiple types of nucleic acid aptamers capable of binding to the target, which were separated in the selection step 1) above and whose sequences were determined in the sequencing step 2) above.

[0032] The multiple types of nucleic acid aptamers sorted in the above 1) selection step include various sequences. Therefore, by analyzing the multiple sequences determined in the above 2) sequencing step, it is possible to estimate a sequence that binds strongly to a target. For example, the multiple sequences determined in the above 2) sequencing step can be analyzed by machine learning or the like to extract sequence characteristics of nucleic acid aptamers that bind to a target or predict the optimal sequence of a nucleic acid aptamer that binds strongly to a target. For example, using the similarity between multiple types of nucleic acid aptamers as an explanatory variable, an analysis can be performed to classify similar sequences into each cluster using a Gaussian mixture model (GMM), and further, a sequence that is characteristic of binding to the target can be estimated from the average coordinates of each cluster.

[0033] Any method, such as machine learning, can be used for the analysis. For example, unsupervised learning methods, such as various clustering methods such as K-means, or dimensionality reduction methods such as principal component analysis and variational autoencoder (VAE), may be used. Alternatively, supervised learning methods, such as multiple regression, partial least squares (PLS) regression, Lasso regression, and Boruta, may be used by preparing any objective variable, such as the number of detected sequences of each nucleic acid aptamer. Analysis using deep learning methods, such as CNN and RNN, may also be performed. Any combination of CNNs and RNNs may be used as the intermediate layer of the deep learning model. Similar sequences may also be generated from multiple types of nucleic acid aptamers using a generative model, such as GAN, VAE, FLOW, or a diffusion model.

[0034] Any explanatory variables may be used for machine learning. For example, the predicted results of the three-dimensional structure of each nucleic acid aptamer may be used, or characteristic sequences extracted from the sequences of multiple types of nucleic acid aptamers by aligning the sequences of multiple types of nucleic acid aptamers, training them in a hidden Markov model (HMM), training them in deep learning such as RNN, or dividing them into partial sequences (k-mers) may be used. Furthermore, the explanatory variables or objective variables may be reduced or compressed using any method. Furthermore, these analysis methods may be used in combination.

[0035] It is not necessary to use sequence analysis techniques such as machine learning to predict the sequence of a nucleic acid aptamer that binds strongly to a target. For example, if the number of detected sequences of a specific nucleic acid aptamer is greater than the number of detected sequences of other nucleic acid aptamers, it can be inferred that the aptamer may have stronger binding strength to the target.

[0036] By performing clustering analysis on the sequences of multiple types of nucleic acid aptamers determined in the above-mentioned 2) sequencing step, it is possible to group together groups of similar sequences. The results can be graphed using any method. For example, by compressing the explanatory variables into two dimensions using t-SNE, UMAP, multidimensional scaling (MDS), or the like, it is possible to visualize the clustering state of multiple types of nucleic acid aptamers in a two-dimensional graph. In this case, nucleic acid aptamers that are predicted by calculation to bind strongly to the target may be added to the graph.

[0037] The binding ability of nucleic acid aptamers to their targets can be evaluated using any method, including surface plasmon resonance (SPR), isothermal titration calorimetry (ITC), and enzyme-linked immunosorbent assay (ELISA). Here, we describe a method for measuring binding ability using the Octet system (Sartorius) with biolayer interferometry (BLI). A capture tag such as biotin is pre-attached to the 3' or 5' end of the nucleic acid aptamer. The nucleic acid aptamer is captured on the sensor chip by immersing the sensor chip in a solution of the tagged nucleic acid aptamer. The binding reaction is then analyzed by immersing the sensor chip in a solution containing the target, followed by an analysis of the dissociation reaction by immersing the sensor chip in a solution without the target. By kinetically analyzing the resulting sensorgram, parameters related to binding ability, such as the binding rate, dissociation rate, and dissociation constant, can be obtained.

[0038] (Effects) According to the determination method of this embodiment, PCR amplification is not performed in either the nucleic acid aptamer selection process or the sequencing process, so the sequence of a nucleic acid aptamer capable of binding to a target can be determined without being affected by PCR bias. Furthermore, according to the determination method of this embodiment, the sequence of a nucleic acid aptamer capable of binding to a target can be determined not only using a nucleic acid library composed only of natural nucleic acids, but also using a nucleic acid library containing artificial nucleic acids. Therefore, by using the determination method of this embodiment, nucleic acid aptamers capable of strongly binding to a target can be developed inexpensively and quickly.

[0039] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0040] Example 1 In Example 1, the effect of PCR bias on the selection and sequencing of nucleic acid aptamers was investigated.

[0041] The following DNAs of Sequence 1 (SEQ ID NO: 8) and Sequence 2 (SEQ ID NO: 9) were prepared as candidate nucleic acid aptamers. These two nucleic acids differ in the central 16-base sequence. Sequence 1: 5' GACTACCCGGGTATCTAATCCATCACATGATCCTGCTAGAGCTGCTGCCGCCCGTAGG 3' Sequence 2: 5' GACTACCCGGGTATCTAATCCGCGCGGGCCCCCGCGCAGAGCTGCTGCCGCCCGTAGG 3'

[0042] PCR amplification was carried out using a mixture (1:1) of DNA of Sequence 1 and DNA of Sequence 2 as a template and the following primers (SEQ ID NOs: 10 and 11): Primer sequence F: 5' TTTGAGTCGACTACCCGGGTATCTAATCC 3' Primer sequence R: 5' TAATACGACTCACCTACGGGCGGCAGCAG 3'

[0043] The PCR-amplified DNA was modified with the restriction enzyme HinfI to alter the terminal shape, and then the barcode DNA (SEQ ID NOs: 4 and 5) shown in Figure 8A and DNA containing helicase were ligated. The barcode DNA was added to increase the length of the nucleic acid to improve the purification efficiency. The sequences of these DNAs were determined using a nanopore sequencer and the nanopore sequencer software Guppy (both from Oxford Nanopore Technologies). For comparison, the sequence of the DNA before PCR amplification was also determined using the same procedure.

[0044] Figure 9 shows the ratio of the number of detected sequences of Sequence 1 to Sequence 2 (Sequence 1 / Sequence 2) for samples before and after PCR. As can be seen from this graph, the number of detected sequences of Sequence 1 and Sequence 2 was similar in the samples before PCR, but the number of detected sequences of Sequence 1 was significantly lower than the number of detected sequences of Sequence 2 in the samples after PCR. In other words, PCR bias had occurred. These findings suggest that by selecting and sequencing nucleic acid aptamers without performing PCR, it is possible to develop nucleic acid aptamers that can bind to targets without being affected by bias in the number of nucleic acid aptamers due to PCR bias.

[0045] Example 2 Example 2 shows an example of the development of an artificial nucleic acid aptamer that targets IgE.

[0046] The nucleic acid library used had the design shown in Figure 5A (SEQ ID NO: 2), in which N was randomly inserted with either a natural base such as A, T, G, or C, or Ethynyl dU, whose chemical structure is shown below.

[0047] (Selection Process) IgE (target)-immobilized beads (target-immobilized beads) were mixed with the nucleic acid library, and nucleic acid aptamer candidates were contacted with IgE (see Figure 6A). Next, the target-immobilized beads were allowed to accumulate, and the supernatant was removed to remove nucleic acid aptamer candidates that did not bind to IgE (see Figure 6B). Next, the target-immobilized beads were suspended in a washing buffer containing salts, surfactants, etc., and then the target-immobilized beads were allowed to accumulate again, the supernatant was removed, and the beads were washed (see Figure 6C). Finally, the target-immobilized beads were heat-treated to separate the IgE-bound nucleic acid aptamers from IgE and recover them (see Figure 6D). Through these procedures, multiple types of IgE-bound nucleic acid aptamers were isolated without PCR.

[0048] (Sequencing step) The barcode DNA (SEQ ID NOs: 4 and 5) shown in FIG. 8A and DNA with helicase attached were bound to the separated nucleic acid aptamer (DNA) by a ligation reaction. As mentioned above, the barcode DNA was bound to increase the length of the nucleic acid to some extent in order to improve the purification efficiency of the nucleic acid. The sequences of these DNAs were determined using a nanopore sequencer without PCR. In this case, instead of using the nanopore sequencer software Guppy, a pre-created machine learning model was used to identify base species from the current waveform and determine the sequence.

[0049] A machine learning model for identifying base species from current waveforms was created using the current waveform around the random base N in the designed sequence (SEQ ID NO: 2) shown in FIG. 5A as explanatory variables and the base species as the objective variable. As an example, the second N from the 5' side will be described. FIG. 11A is a graph showing the current waveform used as an explanatory variable. The created machine learning model showed a prediction accuracy of 90%, as can be seen from the confusion matrix shown in FIG. 11B.

[0050] (Sequence analysis step) Information on multiple types of nucleic acid aptamers whose sequences were determined was analyzed to predict aptamer sequences that bind strongly to IgE. Specifically, for each nucleic acid aptamer sequence, it was predicted that sequences that were detected in greater numbers in the fractions after selection would bind more strongly to IgE.

[0051] Based on the above prediction, seven types of nucleic acid aptamers were selected and synthesized, and their terminals were modified with biotin. The binding strength of these nucleic acid aptamers to IgE was measured using the Octet system. The results are shown in Table 1 below.

[0052]

[0053] From Table 1, it was found that sequence No. 2 strongly binds to IgE, but sequence No. 7, which contains an artificial base, binds even more strongly to IgE. In this way, an artificial nucleic acid aptamer that strongly binds to IgE was developed without even performing PCR amplification.

[0054] This application claims priority from Japanese Patent Application No. 2024-17970, filed February 8, 2024. The contents of the specification and drawings of that application are incorporated herein by reference in their entirety.

[0055] The method for determining the sequence of a nucleic acid aptamer according to the present invention is useful for developing nucleic acid aptamers to be used as target capture molecules in various fields such as the medical and industrial fields.

[0056] 110 Nucleic acid aptamer candidate 120 Target 130 Nucleic acid aptamer capable of binding to the target 140 Beads

Claims

1. A method for determining the sequence of a nucleic acid aptamer capable of binding to a target, comprising: a step of separating a nucleic acid aptamer capable of binding to the target from multiple types of nucleic acid aptamer candidates without PCR amplification; and a step of determining the sequence of the separated nucleic acid aptamer without PCR amplification.

2. A method for determining the sequence of a nucleic acid aptamer as described in claim 1, wherein the step of separating the nucleic acid aptamers includes the steps of contacting the multiple types of nucleic acid aptamer candidates with the target, and separating the nucleic acid aptamers bound to the target.

3. A method for determining the sequence of a nucleic acid aptamer as described in claim 2, wherein the steps of contacting the multiple types of nucleic acid aptamer candidates with the target and separating the nucleic acid aptamers bound to the target are performed only once.

4. A method for determining the sequence of a nucleic acid aptamer described in any one of claims 1 to 3, wherein in the step of determining the sequence of the nucleic acid aptamer, the sequence of the nucleic acid aptamer is determined from a change in current value caused by the sequence of the nucleic acid aptamer.

5. A method for determining the sequence of a nucleic acid aptamer described in any one of claims 1 to 4, further comprising a step of predicting the sequence of a nucleic acid aptamer capable of binding to the target based on the sequences of multiple types of nucleic acid aptamers capable of binding to the target.

6. A method for determining the sequence of a nucleic acid aptamer described in any one of claims 1 to 5, wherein the multiple types of nucleic acid aptamer candidates are a nucleic acid library of 10 to 100 bases.

7. A method for determining the sequence of a nucleic acid aptamer according to claim 6, wherein the nucleic acid library is a nucleic acid library containing unnatural bases.

Images