Deletion of the mouse homolog of human FHR1 (FHRE) protects APOE- / - mice from atherosclerosis
By identifying compounds that modulate FHR1 activity or interaction with ox-LDL and ox-ApoB100, the method addresses the inadequacies of current treatments for atherosclerosis and ACVD, effectively reducing lipid oxidation and plaque formation through the use of FHR1 inhibitors.
Patent Information
- Application Number
- PCT/EP2025/052973
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-14
- Filing Date
- 2025-02-05
- Publication Date
- 2025-08-21
AI Technical Summary
Current treatments for atherosclerosis and atherosclerotic cardiovascular disease (ACVD) are inadequate, and there is a need for new strategies to modulate lipid oxidation and inflammation mediated by the protein FHR1, which contributes to plaque formation and cardiovascular events.
A method to identify compounds that modulate the expression, stability, and biological activity of FHR1, or its interaction with ox-LDL and ox-ApoB100, using screening tools and pharmaceutical compositions such as FHR1 antisense oligonucleotides or antibodies to inhibit FHR1 binding, thereby reducing lipid oxidation and plaque formation.
Inhibiting FHR1 binding to ox-LDL and ox-ApoB100 normalizes lipid peroxidation levels, reduces atherosclerotic plaque formation, and decreases inflammation, providing a therapeutic approach to prevent or treat atherosclerosis and ACVD.
Smart Images

Figure EP2025052973_21082025_PF_FP_ABST
Abstract
Description
[0001]DELETION OF THE MOUSE HOMOLOG OF HUMAN FHR1 (FHRE) PROTECTS APOE- / - MICE FROM ATHEROSCLEROSIS The present invention relates to a method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell and in plasma. Further provided is a method for determining the level of lipid peroxidation and / or oxApoB100 in a sample obtained from a mammal, comprising detecting the concentration of FHR1 in the sample or a method for determining the level of ox-LDL and / or oxApoB100 in a sample obtained from a mammal, comprising detecting of binding of FHR1 in the sample to LDL and / or ApoB100. Further provided are pharmaceutical compositions comprising the compound as identified for use in medicine, in particular for use in the prevention or treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or an atherosclerotic cardiovascular disease (ACVD). Background of the invention Inflammation accompanies many diseases and represents an innate immune response to tissue injury as well as metabolic stress which normally is followed by clearance and healing processes. However, when inflammation sustains because of metabolic deposits in arteries, tissues or organs the immune response can lead to serious host inflammatory injury as seen in diseases such as age-related macular degeneration (AMD), C3 glomerulopathy (C3G) or atherosclerosis-associated cardiovascular disease (ACVD). As the major cause of death and morbidity in the industrial world, new treatment options of ACVD are urgently needed and ask for a better understanding of the disease. Recently, the present inventors identified a new player in inflammation mediated by necrotic type surfaces: the human dimeric plasma protein Factor H-related protein 1 (FHR1), a member of the human complement factor H protein family, which consists of complement factor H, a splice variant of factor H (factor H-like-1 (FHL-1)), and five FHR proteins (FHR1-FHR5). In contrast to factor H and FHL-1, FHR1 does not mediate cleavage of C3b by factor I or accelerates the dissociation of C3 convertase. FHR1 binds to complement C3b, C3d and iC3b with a preference for C3d. A new function of FHR1 outside the complement system (non-canonical) was identified by the present inventors. FHR1 binds to necrotic cell surfaces such as damaged kidney tissues of patients with anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV) as well as acellular necrotic cores in plaques of ACVD patients and activates NOD-, LRR-and pyrin domain-containing protein 3 (NLRP3) in monocytes and neutrophils. Upon binding to the G protein-coupled receptor epidermal growth factor (EGF)-like module-containing mucin-like hormone receptor-like 2 (EMR2), FHR1 induces the release of pro-inflammatory cytokines. This function is mediated by bound but not soluble FHR1 and serum concentrations correlated with disease progression. Apolipoprotein E (ApoE) serves as the ligand for clearance of all of the apoB-containing lipoproteins from the blood by the liver except LDL. Thus, knockout of ApoE in mice results in hypercholesterolemia, monocyte proliferation and their infiltration into the intima, oxidative stress and spontaneous atherosclerotic lesion development (Zhang SH, Reddick RL, Piedrahita JA, Maeda N. Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science. 1992 Oct 16;258(5081):468-71. doi: 10.1126 / science.1411543. PMID: 1411543). Atherosclerosis is the leading cause of heart attack and stroke in industrialized countries. The key characteristic of atherosclerosis is the accumulation of LDL cholesterol in artery walls, the subsequent infiltration of monocytes / macrophages and the development of inflammation. Macrophage inflammation results in oxidative stress thereby enhancing endothelial cell activation, immune cell recruitment and foam cell formation. Lowering LDL plasma levels as well as inhibiting inflammation reduces the risk for cardiovascular events. WO 2021 / 224430A1 discloses methods for detecting and determining the level of complement proteins, in particular using mass spectrometry. Also disclosed are methods of identifying subjects having or at risk of developing a complement-related disorder, and methods of treating the same. WO 2022 / 058447A1 discloses methods of identifying subjects having complement-related disorders, or at risk of such disorders. Also disclosed are methods for selecting subjects for treatment with complement-targeted therapies, and methods of treatment of subjects with such therapies. WO 2017 / 109208A1 relates to a polypeptide comprising a C3 convertase effector domain, a C5 convertase effector domain and optionally a terminal complex inhibitory effector domain which is resistant to deregulation by physiologic FHR-Proteins und has a dimerization motif, and to its therapeutic use. WO 2006 / 088950B1 relates to Factor H gene polymorphisms and haplotypes associated with an elevated or a reduced risk of AMD. The invention provides methods and reagents for diagnosis and treatment of AMD. WO 2023 / 175099A1 relates to nucleic acids and other agents are provided for use in treating subjects having complement-related disorders or at risk of such disorders. Also disclosed are methods for selecting subjects for treatment with such agents, and methods of treatment of subjects with such agents. WO 2020 / 060987A8 relates to iRNA, e.g., double-stranded ribonucleic acid (dsRNA), compositions targeting the complement component C5 gene, and methods of using such iRNA, e.g., dsRNA, compositions to inhibit expression of C5 and to treat subjects having a complement component C5-associated disease, e.g., Alzheimer's disease, atherosclerosis, or inflammation of the choroid plexus (ChP). WO 2012 / 095519A1 provides a chimeric recombinant polypeptide representing a potent inhibitor of complement activation. Said recombinant polypeptide is a chimeric recombinant polypeptide comprising at five, three or any other number of the C- terminal fragment of complement factor H (CFH) comprising at least one, two or even five of the short consensus- repeats C15 to C20 of Factor H or of an CFHR protein linked with an inhibitor of the complement allowing inhibition of complement activation. WO 2020 / 035603A1 relates to modulators of the function of factor H related protein 1 (FHR1), and their use in the control and therapy of conditions involving inflammatory processes. New strategies for treating and controlling diseases involving FHR1 and its signal cascade, such as diseases related to levels of lipid oxidation and atherosclerosis, are desirable. It is therefore an object of the present invention to provide such strategies. Other objects and advantages will readily become apparent for the person of skill from studying the following more detailed description and examples. In a first aspect of the present invention, the problem of the present invention is solved by providing a method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell / plasma, comprising the steps of a) contacting at least one of FHR1 or a functional fragment thereof and / or a cell expressing FHR1 or a functional fragment thereof with at least one compound that potentially modulates at least one of the expression, the stability and / or the biological activity of the protein FHR1 in a mammalian cell b) identifying a modulation of at least one of the expression, the amount the stability and / or the biological activity of the protein FHR1 in the presence of said at least one compound, and c) identifying a compound as identified in step b) as specifically modulating lipid oxidation levels and / or atherosclerosis. In view of the results as obtained in the experiments as performed in the context of the present invention, the inventors found that FHR1 exerts several important functions in lipid metabolism and atherosclerosis in vivo. In a second aspect of the present invention, the problem of the present invention is solved by providing a method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of the interaction of FHR1 with ox-LDL and / or ox- ApoB100 comprising the steps of a) contacting at least one of FHR1, an ox-LDL and / or ox- ApoB100 binding fragment of FHR1, a cell expressing FHR1 and / or a cell expressing an ox- LDL and / or ox-ApoB100 binding fragment of FHR, and / or the fluid phase protein or protein complexes in plasma with at least one compound that potentially modulates the interaction of FHR1 with ox-LDL and / or ox-ApoB100 b) identifying a modulation of the interaction of FHR1 or the fragment thereof with ox-LDL and / or ox-ApoB100 in the presence of said at least one compound, and c) identifying a compound as identified in step b) as specifically modulating lipid oxidation levels and / or atherosclerosis. It was found that the plasma protein complement factor H-related 1 (FHR1) binds to necrotic surfaces in cardiovascular plaques and induces inflammation in monocytes / macrophages and neutrophilic granulocytes. Moreover, FHR1 concentration is increased in patients with enhanced atherosclerosis and CFHR1 gene deletion frequency is significantly reduced compared to healthy controls. To investigate the underlying mechanism how FHR1 associates with atherosclerosis the inventors generated a FHRE- / - mouse (murine homolog of FHR1) and crossed this KO mouse with ApoE- / - mouse, the model of atherosclerosis. Notably, deletion of FHRE resulted in normalized cholesterol levels, in reduced inflammation and substantially reduced plaque formation in FHRE- / -ApoE- / - mice compared to ApoE- / - mice expressing FHRE. The data indicate that FHRE directs uptake of ox-LDL by macrophages, supports foam cell formation, plaque development and inflammation and thus represents a key factor in the development of atherosclerosis with following events such as stroke and heart attacks. In a third aspect of the present invention, the problem of the present invention is solved by providing a screening tool for screening for a compound that modulates the expression, the stability, the biological activity and / or the interaction of FHR1 with ox-LDL and / or ox- ApoB100, comprising an isolated cell expressing FHR1, and / or expressing an ox-LDL and / or ox-ApoB100 binding fragment thereof, wherein said cell optionally expresses ApoB100 and / or an FHR1 binding fragment thereof In a fourth aspect of the present invention, the problem of the present invention is solved by providing a method for determining the level of lipid peroxidation and / or oxApoB100 in a sample obtained from a mammal, comprising detecting the concentration of FHR1 in the sample, wherein an increase of the concentration, when compared to a control indicates an increase of lipid peroxidation and / or oxApoB100 in said mammal. Also provided is a method for determining the level of ox-LDL and / or oxApoB100 in a sample obtained from a mammal, comprising detecting of binding of FHR1 in the sample to LDL and / or ApoB100, wherein an increase of the binding, when compared to a control indicates an increase of the level of ox- LDL and / or oxApoB100 in said mammal. In a fifth aspect of the present invention, the problem of the present invention is solved by providing a method for detecting atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) and / or the risk for developing atherosclerosis and / or ACVD in a mammal, comprising performing a method according to the present invention, wherein an increase of lipid peroxidation and / or oxApoB100 and / or an increase of the level of ox-LDL and / or oxApoB100 is indicative for atherosclerosis and / or an increase of the risk to develop ACVD in the mammal. In a sixth aspect of the present invention, the problem of the present invention is solved by providing a method for manufacturing a pharmaceutical composition for treating or preventing a disease or condition selected from atherosclerosis and / or an atherosclerotic cardiovascular disease (ACVD), comprising performing a method according to the present invention as above, and admixing the compound as identified with at least one pharmaceutically carrier. Further provided is a pharmaceutical composition as produced according to the present invention, or a compound as identified with a method according to the present invention, preferably an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100 for use in the prevention or treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD). Preferred is the pharmaceutical composition for use according to the present invention, wherein the composition is for injection, oral and / or nasal application. Further provided is a method for preventing or treating a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) in a subject in need of such prevention and / or treatment, comprising administering to said subject an effective amount of the pharmaceutical composition as produced according to the present invention, or a compound as identified with a method according to the present invention, preferably an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100. In a seventh aspect of the present invention, the problem of the present invention is solved by providing a method for monitoring the treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) in a subject, comprising performing the method according to the present invention on a sample obtained from a subject before and after or during a treatment according to the present invention, and monitoring the treatment of the disease or condition based on the differences as detected between the samples. As mentioned above, in a first aspect of the present invention, the object of the present invention is solved by providing a method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of at least one of the expression, the amount the stability and / or the biological activity of the protein FHR1 in a mammalian cell and in plasma, comprising the steps of a) contacting at least one of FHR1 or a functional fragment thereof and / or a cell expressing FHR1 or a functional fragment thereof with at least one compound that potentially modulates at least one of the expression, the amount the stability and / or the biological activity of the protein FHR1 in a mammalian cell and plasma b) identifying a modulation of at least one of the expression, the stability and / or the biological activity of the protein FHR1 in the presence of said at least one compound, and c) identifying a compound as identified in step b) as specifically modulating lipid oxidation levels and / or atherosclerosis. Preferred is the method according to the present invention, wherein said modulation is selected from a decrease or an increase of said expression, the stability and / or the biological activity of the protein FHR1 in a mammalian cell and plasma, preferably an inhibition of the expression, the stability and / or the biological activity of the protein FHR1, wherein the biological activity is preferably selected from the interaction of FHR1 with ox-LDL and / or ox-ApoB100 Another aspect of the invention provides a method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of the interaction of FHR1 with ox-LDL and / or ox-ApoB100 comprising the steps of a) contacting at least one of FHR1, an ox-LDL and / or ox-ApoB100 binding fragment of FHR1, a cell expressing FHR1 and secreting the molecule into plasma / or a cell releasing LDL and / or ApoB100 which become oxidized in plasma binding fragment of FHR1 with at least one compound that potentially modulates the interaction of FHR1 with ox-LDL and / or ox-ApoB100 b) identifying a modulation of the interaction of FHR1 or the fragment thereof with ox-LDL and / or ox- ApoB100 in the presence of said at least one compound, and c) identifying a compound as identified in step b) as specifically modulating lipid oxidation levels and / or atherosclerosis. Preferred is the method according to the present invention, wherein the interaction is binding of FHR1 or the binding fragment of FHR1 to ox-LDL and / or ox-ApoB100. Further preferred is the method according to the present invention, wherein said modulation is selected from a decrease or an increase of said interaction, preferably an inhibition of the interaction. Irmscher S, et al (in: Factor H-related protein 1 (FHR1) is associated with atherosclerotic cardiovascular disease. Sci Rep.2021 Nov 18;11(1):22511. doi: 10.1038 / s41598-021-02011- w. PMID: 34795372; PMCID: PMC8602345) disclose that atherosclerotic cardiovascular disease (ACVD) is a lipid-driven inflammatory disease and one of the leading causes of death worldwide. Lipid deposits in the arterial wall lead to the formation of plaques that involve lipid oxidation, cellular necrosis, and complement activation, resulting in inflammation and thrombosis. The present study found that homozygous deletion of the CFHR1 gene, which encodes the plasma complement protein factor H-related protein 1 (FHR1), was protective in two cohorts of patients with ACVD, suggesting that FHR1 accelerates inflammation and exacerbates the disease. To test this hypothesis, FHR1 was isolated from human plasma and was found to circulate on extracellular vesicles and to be deposited in atherosclerotic plaques. Surface-bound FHR1 induced the expression of pro-inflammatory cytokines and tissue factor in both monocytes and neutrophils. Notably, plasma concentrations of FHR1, but not of factor H, were significantly (p < 0.001) elevated in patients with ACVD, and correlated with the expression of the inflammation markers C-reactive protein, apolipoprotein serum amyloid protein A, and neopterin. FHR1 expression also significantly correlated with plasma concentrations of low-density lipoprotein (LDL) (p < 0.0001) but not high-density lipoprotein (HDL). Taken together, these findings suggest that FHR1 is associated with ACVD. Thus, a method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell and plasma was designed. The biological activity concerned is preferably selected from the interaction of FHR1 with ox-LDL and / or ox-ApoB100. In a second aspect, a more specific method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of the interaction of FHR1 with ox-LDL and / or ox-ApoB100 was designed. The methods comprise the step of contacting FHR1 or a functional fragment thereof and / or a cell expressing FHR1 or a functional fragment thereof with at least one compound that potentially modulates at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell and in plasma. Identifying a modulation of at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 in the presence of said at least one compound then identifies a compound as specifically modulating lipid oxidation levels and / or atherosclerosis. In this general method, preferably the biological activity is selected from the interaction of FHR1 with ox-LDL and / or ox-ApoB100. For identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of the interaction of FHR1 with ox-LDL and / or ox-ApoB100, a method is provided that comprises the steps of a) contacting at least one of FHR1, an ox-LDL and / or ox- ApoB100 binding fragment of FHR1, a cell expressing FHR1 and / or a cell expressing an ox- LDL and / or ox-ApoB100 binding fragment of FHR1 with at least one compound that potentially modulates the interaction of FHR1 with ox-LDL and / or ox-ApoB100. This first step relates to a binding of the molecule to the targets. In the next step, b) a modulation of the interaction of FHR1 or the fragment thereof with ox- LDL and / or ox-ApoB100 in the presence of said at least one compound is detected. The modulation is selected from a) an increase of said expression, the amount, biological activity and / or interaction (binding), and / or b) a stabilization of said expression, the amount, biological activity and / or interaction (binding), and c) a decrease of the expression, the amount, the biological activity and / or the interaction (binding) of FHR1, of ox-LDL and / or of ox-ApoB100 with each other in the sample or a cell. Preferred is an inhibition of the expression, the amount, the biological activity and / or the interaction (binding) of FHR1, of ox-LDL and / or of ox- ApoB100 with each other in the sample or a cell. Specifically targeted is the binding between FHR1 and ox-LDL or FHR1 and ox-ApoB100 or binding fragments thereof. In a next step, a compound as identified in step b) is further identified as specifically modulating lipid oxidation levels and / or atherosclerosis in the subject (see, for example, experiments and figures). Further preferred is the method according to the present invention, further comprising testing said compound as identified for its activity to induce or reduce inflammatory responses, in particular in the context of atherosclerosis, for example by detecting cytokine IL-1β, IL-6, IL-18, C-reactive protein (CRP), and / or TNF^. Respective assays are also known to the person of skill, and can be taken from the respective literature. Preferred is the method according to the present invention, wherein the interaction is binding of FHR1 or the binding fragment of FHR1 to ox-LDL and / or ox-ApoB100. Further preferred is the method according to the present invention, wherein said modulation is selected from a decrease or an increase of said interaction, preferably an inhibition of the interaction. In the context of the present invention, the term "FHR1" shall be understood as also indicating / representing the mammalian (in particular mouse) ortholog / homolog of the human FHR1 gene and / or protein and / or mRNA. Also, the term shall comprise the complete FHR1 polypeptide or fragment(s) of the FH1 polypeptide. The term also covers FHR1 in its dimeric form, in its form dimerized with FHR2 polypeptide, and in different preparations, such as in the cellular context, purified from the cell. The amino acid sequence of FHR1 (aliases: HFL1, HFL2, CFFIL, FFIR1, H36, Complement Factor FI-Related Protein 1, Complement Factor FI- Related 1, FH36-1, and FH36-2) can be, e.g. found at UNIPROT Q03591. Similarly, the term “ApoB100” shall be understood as also indicating / representing the mammalian (if present, identified) ortholog / homolog of the human ApoB100 gene and / or protein and / or mRNA. Also, the term shall comprise the complete ApoB100 polypeptide or functional fragment(s) as described herein, such as FHR1-binding fragment. The term also covers ApoB100 in different preparations, such as in the cellular context, purified from the cell. The amino acid sequence of ApoB100 (aliases: FLDB, LDLCQ4, apoB-100, apoB-48, apolipoprotein B, and FCHL2) can be, e.g. found at UNIPROT P04114. The term “LDL” shall be understood as indicating the LDL particle containing a single apolipoprotein B-100 molecule along with the additional ancillary proteins. The term “ox-“ in the context of ApoB100 and LDL shall refer to the oxidative modification of LDL lipids and apoB-100 by reactive oxygen species (ROS) (see, for example, Pietzsch J, Lattke P, Julius U. Oxidation of apolipoprotein B-100 in circulating LDL is related to LDL residence time. In vivo insights from stable-isotope studies. Arterioscler Thromb Vasc Biol. 2000 Oct;20(10):E63-7. doi: 10.1161 / 01.atv.20.10.e63. PMID: 11031225; and Ayala A, Cutler RG. The utilization of 5-hydroxyl-2-aminovaleric acid as a specific marker of oxidized arginine and proline residues in proteins. Free Radic Biol Med.1996; 21:65–80, or Masahiko Okada, Sugar chain structure of apolipoprotein B-100 and its role in oxidation. bioRxiv 2022.05.31.494124; doi: https: / / doi.org / 10.1101 / 2022.05.31.494124). In the context of the present invention, the term “functional fragment of FHR1, ApoB100 or LDL”, respectively shall relate to a part of the particle or the amino acid sequences of the above proteins that is truncated at the N- and / or C-terminus of the amino acid sequence, but still performs and / or supports its function as required / desired in the context of the present invention, namely – when expressed, translated and / or administered – may be oxidized, and binds as disclosed herein. The term "contacting" in the present invention means any interaction between the potentially binding substance(s) with FHR1 and / or ox-LDL or ox-ApoB100, whereby any of the components can be independently of each other in a liquid phase, for example in solution, or in suspension or can be bound to a solid phase, for example, in the form of an essentially planar surface or in the form of particles, pearls or the like. In a preferred embodiment a multitude of different potentially binding substances are immobilized on a solid surface like, for example, on a compound library chip, and FHR1 and / or ox-LDL or ox-ApoB100 (or a functional part thereof) or the bound complex thereof are subsequently contacted with such a chip. In the context of the present invention, the term “biological activity” shall preferably include the cellular functions of FHR1, LDL or ApoB100, the complex of FHR1 with ox-LDL or ox- ApoB100, and / or the fragments thereof in the cell / pasma in the process of inflammation, for example their function(s) in the signaling cascade and / or in inducing other factors. One specific preferred example is the dimerization of FHR1, as apparently mediated by the N-terminal region thereof. It was surprisingly found in the context of the present invention, that an inhibition of the binding of FHR1 to ox-LDL and / or ox-ApoB100 caused a normalization of lipid peroxidation levels and a modulation of the formation of atherosclerotic plaques in the mammal. Preferred is therefore a method according to the present invention, wherein the identifying in step c) comprises determining a normalization and / or normalized lipid peroxidation levels (i.e. compared to a non-diseased control) and / or a modulation of the formation of atherosclerotic plaques in the mammal. It was furthermore surprisingly found in the context of the present invention that an inhibition of the binding of FHR1 to ox-LDL and / or ox-ApoB100 caused a change of the composition of lipids in the blood of the mammal towards a regular state (i.e. compared to a non-diseased control). Preferred is therefore a method according to the present invention, wherein the identifying in step c) further comprises determining the composition of lipids in the blood of the mammal, such as, for example, total cholesterol, LDL, and / or triglycerides. See, for example, Figure 4 and 5. Further preferably, said identifying comprises a method selected from rtPCR, immunoprecipitation and measuring the induction or reduction of inflammation in said cell, for example by detecting cytokine IL-1 b. Other cytokines to be detected can be IL-6, IL-18, CRP, and / or TNFơ. Respective assays are also known to the person of skill and are disclosed herein. More preferred is a method according to the present invention, wherein said compound is selected from the group consisting of a peptide library, a combinatory library, a cell extract, a "small molecular drug", an antisense oligonucleotide, an siRNA, and an antibody, in particular an antibody against FHR1 or fragment thereof specifically interfering with the binding of FHR1 to ox-LDL and / or ox-ApoB100, FHR2 or binding fragment thereof. Particularly preferred are antibody fragments or siRNA molecules against FHR1 that reduce atherosclerosis, plaque formation, lipid oxidation and inflammation. The inventors conclude that these F(ab)2- Fragments prevent binding of FHR1 to ox-LDL and / or ox-ApoB100 and therefore protects from an FHR1 induced inflammatory response. Consequently, monoclonal antibodies against FHR1 are a promising therapeutic approach. In the context of the present invention, a "small molecular drug” or “small molecule” is one that has a molecular weight of below 2000 Da, preferably of below 1000 Da, optimally in the range of between 600 and 200 Da. Preferred is a method according to the present invention, wherein said FHR1 and / or said ox- LDL and / or ox-ApoB100 is / are immobilized, such as, for example, on a microtiter plate, beads or a chip, like a glass slide. Further preferred is a method according to the present invention, wherein said FHR1 and / or ox- LDL and / or ox-ApoB100 and / or the fragments thereof are suitably labeled. Measuring of binding of the compound to FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof can be carried out either by measuring a marker that can be attached either to the protein or to the potentially interacting compound. Suitable markers are known to someone of skill in the art and comprise, for example, fluorescence or radioactive markers. The binding of the two components can, however, also be measured by the change of an electrochemical parameter of the binding compound or of the protein, e.g. a change of the redox properties of FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof or the binding compound, upon binding. Suitable methods of detecting such changes comprise, for example, potentiometric methods. Further methods for detecting and / or measuring the binding of the two components to each other are known in the art and can without limitation also be used to measure the binding of the potential interacting compound to FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof. The effect of the binding of the compound or the activity of FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof can also be measured indirectly, for example, by assaying an enzymatic activity of FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof after binding. Even further preferred is a method according to the present invention that further comprises a computational analysis and optimization of the compound based on the structure, in particular the three-dimensional and / or crystal structure of FHR1 and / or LDL and / or ApoB100, or the oxidized forms thereof. According to the invention, said cell is selected from the group of recombinant host cells expressing FHR1 or releasing LDL and / or ApoB100, which become oxidized, binding fragment thereof, wherein said recombinant host cells optionally release LDL and / or ApoB100. The cells may be mammalian, such as human cells, yeast cells, or recombinant bacterial cells. As a further step after measuring the binding of a potentially interacting compound and after having measured at least two different potentially interacting compounds at least one compound can be selected, for example, on grounds of the measured binding activity or on grounds of the detected increase of FHR1 and / or ox-LDL and / or ox-ApoB100 (binding) activity and / or inhibition. The thus selected binding compound can then in a preferred embodiment modified in a further step. Modification can be effected by a variety of methods known in the art, which include without limitation the introduction of novel side chains or the exchange of functional groups like, for example, introduction of halogens, in particular F, Cl or Br, the introduction of lower alkyl groups, preferably having one to five carbon atoms like, for example, methyl, ethyl, n- propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl or iso-pentyl groups, lower alkenyl groups, preferably having two to five carbon atoms, lower alkynyl groups, preferably having two to five carbon atoms or through the introduction of, for example, a group selected from the group consisting of NH2, NO2, OH, SH, NH, CN, aryl, heteroaryl or COOH group. The thus modified binding substances are than individually tested with a method of the present invention, i.e. they are contacted with FHR1, dimeric FHR1, and / or ox-LDL and / or ox- ApoB100 and / or the fragments thereof and subsequently binding of the modified compounds to the FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof is measured. In this step, both the binding per se can be measured and / or the effect of the function of the FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof like, e.g. the binding to FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof and / or the biological activity of the polypeptide(s) can be measured. If needed the steps of selecting the binding compound, modifying the binding compound, contacting the binding compound with FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof and measuring the binding of the modified compounds to the protein(s) can be repeated a third or any given number of times as required. The above described method is also termed "directed evolution" since it involves a multitude of steps including modification and selection, whereby binding compounds are selected in an "evolutionary" process optimizing its capabilities with respect to a particular property, e.g. its binding activity, its ability to activate or modulate, such as inhibit, the activity of the polypeptide(s) of FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof. According to another aspect thereof, the object of the present invention is solved by providing a screening tool for screening for a compound that modulates the expression, the stability, the biological activity and / or the interaction of FHR1 with ox-LDL and / or ox-ApoB100, comprising an isolated cell expressing FHR1, and / or expressing an ox-LDL and / or ox- ApoB100 binding fragment thereof, wherein said cell optionally expresses ApoB100 and / or an FHR1 binding fragment thereof. The cell can be a prokaryotic or eukaryotic cell, and any genetic expression constructs can be present extrachromosomally or integrated into the chromosome. The polypeptides can be expressed in the form of a fusion protein, for example together with an enzymatically active moiety as reporter- construct, in order to be able to detect the expression product. Preferred host cells are derived from cells selected from the skeletal muscle, liver, adipose tissue, heart, pancreas, kidney, breast tissue, ovarian tissue, and / or hypothalamus. Thus, preferred is a screening tool according to the present invention, wherein said cell is selected from necrotic cells, cancer cells; recombinant host cells expressing said FHR1 and / or ApoB100 and / or binding fragments thereof; preferably mammalian, such as human cell, yeast cells; and (recombinant) bacterial cells. Preferred is a screening tool according to the present invention, wherein said FHR1 and / or ox- LDL and / or ox-ApoB100 and / or the fragments thereof are immobilized and / or labeled, as also described above. According to yet another aspect thereof, the present invention relates to the use of the tools according to the present invention as described herein for screening for a compound that modulates the expression, the biological activity and / or the interaction of FFIR1 and / or ox-LDL and / or ox-ApoB100 in a sample or cell as described herein. According to yet another aspect thereof, the present invention relates to a diagnostic method for determining the level of lipid peroxidation (e.g., ox-LDL) and / or ox-ApoB100 in a sample obtained from a mammal, comprising detecting the concentration of FHR1 in the sample, wherein an increase of the concentration, of FHR1 in the sample when compared to a control indicates an increase of lipid peroxidation and / or oxApoB100 in said mammal. It was surprisingly found that elevated human FHR1 concentrations in ACVD patients correlated with ox-LDL. See, for example, Respective method to determine lipid peroxidation and / or ox-ApoB100 are described herein, and are also known to the person of skill, and involve, for example, ELISA. In the context of the present invention, a “sample” can be any suitable biological sample obtained from a mammal suspected of comprising the compounds or targets (e.g. LDL; and / or the proteins FHR1 and / or ApoB100 and / or the oxidized forms thereof). A preferred sample is a blood or serum sample, in particular a human blood or serum sample, or a pooled sample. Furthermore, a sample can be produced, such as a cell culture, cellular preparation or isolated or partially isolated compounds or targets (e.g. LDL; and / or the proteins FHR1 and / or ApoB100 and / or the oxidized forms thereof) as produced or collected. The sample may also comprise compounds to be screened as disclosed herein. According to yet another aspect thereof, the present invention relates to a diagnostic method for determining the level of ox-LDL and / or oxApoB100 in a sample obtained from a mammal, comprising detecting of binding of FHR1 in the sample to LDL and / or ApoB100, wherein an increase of the binding, when compared to a control indicates an increase of the level of ox- LDL and / or oxApoB100 in said mammal, compared to LDL and / or ApoB100 and / or a control (see Figure 5). Respective method to determine the level of ox-LDL and / or oxApoB100 are described herein, and are also known to the person of skill, and involve, for example, ELISA. According to yet another aspect thereof, the present invention relates to a diagnostic method for detecting atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) and / or the risk for developing atherosclerosis and / or ACVD in a mammal, comprising performing a method according to the present invention, wherein an increase of lipid peroxidation and / or oxApoB100 and / or an increase of the level of ox-LDL and / or oxApoB100 is indicative for atherosclerosis and / or an increase of the risk to develop ACVD in the mammal. Atherosclerosis is characterized, amongst others, by lipid peroxidation. Deletion of FHRE in ApoE mice normalized lipid peroxidation levels which underlines an involvement of FHRE in lipid oxidation levels and atherosclerosis. Another aspect of the present invention relates to a method for manufacturing a pharmaceutical composition for treating or preventing a disease or condition selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD), comprising the steps of performing a method according to the present invention, and formulating said compound as identified into a pharmaceutical composition, wherein said compound preferably is an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100. In a further embodiment of the method according to the present invention, the interacting compound identified as outlined above, which may or may not have gone through additional rounds of modification and selection, is admixed with suitable auxiliary substances and / or additives. Such substances comprise pharmacological acceptable substances, which increase the stability, solubility, biocompatibility, or biological half-life of the interacting compound or comprise substances or materials, which have to be included for certain routs of application like, for example, intravenous solution, sprays, band-aids or pills. Carriers, excipients and strategies to formulate a pharmaceutical composition, for example to be administered systemically or topically, by any conventional route, in particular enterally, e.g. orally, e.g. in the form of tablets or capsules, parenterally, e.g. in the form of injectable solutions or suspensions, topically, e.g. in the form of lotions, gels, ointments or creams, or in nasal or a suppository form are well known to the person of skill and described in the respective literature. Another aspect of the present invention relates to a pharmaceutical composition as produced according to the present invention, or a compound as identified with a method according to the present invention, preferably an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox- ApoB100 for use in the prevention or treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD). Preferably, said composition comprises an aqueous formulation. The term "pharmaceutical composition" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein (here, the at least one compound) to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the composition would be administered. A pharmaceutical composition of the present invention can be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and / or mode of administration will vary depending upon the desired results. Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The carrier can be suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Preferred is the pharmaceutical composition according to the present invention, wherein the composition is for injection, oral and / or nasal application. The pharmaceutical compositions according to the present invention may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin. The pharmaceutical compositions according to the present invention may be in liquid, dry or semi-solid form, such as, for example, in the form of a tablet, coated tablet, effervescent tablet, capsule, powder, granulate, sugar-coated tablet, lozenge, pill, ampoule, drop, suppository, emulsion, ointment, gel, tincture, paste, cream, moist compress, gargling solution, plant juice, nasal agent, inhalation mixture, aerosol, mouthwash, mouth spray, nose spray, or room spray. Preferred is an injectable composition. Administration of an agent, e.g., a compound, optionally in the form of a pharmaceutical composition, can be accomplished by any method which allows the agent to reach the target location, e.g. in a cell or blood. These methods include, e.g., injection, deposition, implantation, suppositories, oral ingestion, inhalation, topical administration, or any other method of administration where access to the target cells by the agent is obtained. Injections can be, e.g., intravenous, intradermal, subcutaneous, intramuscular or intraperitoneal. Implantation includes inserting implantable drug delivery systems, e.g., microspheres, hydrogels, polymeric reservoirs, cholesterol matrices, polymeric systems, e.g., matrix erosion and / or diffusion systems and non-polymeric systems, e.g., compressed, fused or partially fused pellets. Suppositories include glycerin suppositories. Oral ingestion doses can be enterically coated. Inhalation includes administering the agent with an aerosol in an inhalator, either alone or attached to a carrier that can be absorbed. The agent can be suspended in liquid, e.g., in dissolved or colloidal form. The liquid can be a solvent, partial solvent or non-solvent. In many cases, water or an organic liquid can be used. Another aspect of the present invention relates to the pharmaceutical composition according to the present invention for use in the prevention or treatment of diseases. Another aspect of the present invention then relates to a method for treating or preventing a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, atherosclerosis and / or an atherosclerotic cardiovascular disease (ACVD) in a subject in need of such prevention and / or treatment, comprising administering to said subject an effective amount of the pharmaceutical composition as produced according to the present invention, or a compound as identified with a method according to the present invention, preferably an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100. In general, the attending physician will base a treatment on the compound as identified, and optionally also on other individual patient data (clinical data, family history, DNA, etc.), and a treatment can also be performed based on the combination of these factors. This method of the present invention for example involves integrating individual diagnostic blood or other data with patient clinical information and general healthcare statistics to enable, for example, the application of personalized medicine to the patient. Significant information about drug effectiveness, drug interactions, and other patient status conditions can be used, too. Preferably, an active agent is administered in form of a pharmaceutical composition as described herein, such as an antibody, nucleotide or an inhibiting binding compound for the FHR1 and / or ox-LDL and / or ox-ApoB100 binding. The ox-LDL and / or ox-ApoB100 or FHR1 or complex binding compound according to the present invention, and optional other therapeutic agents may be administered simultaneously, sequentially or simultaneously. Another aspect of the present invention then relates to a method for monitoring the treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) in a subject, comprising performing the method according to the present invention on a sample obtained from a subject before and after or during a treatment according to the present invention, and monitoring the treatment of the disease or condition based on the differences as detected between the samples. Based on the monitoring, the attending physician can conclude on the success or progress of the treatment or prevention and adjust a further treatment or prevention accordingly. Monitoring may be repeated during the course of a therapy or for a prevention. In the context of the present invention, the term “about” shall mean to include a deviation of + / - 10% of the value as given, if not indicated otherwise. In the context of the present invention, a “subject” relates to a mammal, animal or individual, such as a person or patient that undergoes prevention or treatment according to the invention against a psychiatric disorder or disease. In the context of the present invention, a “mammal” relates to a rodent, cat, dog, sheep, goat, horse, cattle or human, preferably a human. In the context of the present invention, the term “treatment” or “therapy” shall mean the attempted remediation of a health problem as disclosed herein, i.e., atherosclerosis and or associated disease (ACVD) in the subject. Atherosclerosis is the underlying cause of sudden heart attack and stroke. Here, the inventors identified and characterized a key protein within the development process of atherosclerosis: The human plasma complement protein FHR1, which binds to oxidized LDL and directs the lipid to monocytes / macrophages. This leads to foam cell formation, induction of M1 macrophages and pro-inflammation in lesions, the basic events in atherosclerosis. Deletion of the human FHR1 homolog FHRE in atherosclerotic ApoE- / - mice normalized plasma LDL- cholesterol levels, prevented inflammation and substantially reduced atherosclerotic lesions. Moreover, elevated human FHR1 serum concentrations in ACVD patients correlated with ox- LDL and serum oxidation levels, but not with HDL. Thus, FHR1 serves as a key regulator of inflammation via ox-LDL. FHRE- / - mice appear phenotypically similar to WT mice, and do not differ in body weight or expression of complement factors such as factor H or C3, compared to WT. This is in agreement with a recent report, introducing a first FHRE- / - mouse (Li X, Hao Z, Liu X, Li W. Deficiency of Mouse FHR1 Homolog, FHR-E, Accelerates Sepsis, and Acute Kidney Injury Through Enhancing the LPS-Induced Alternative Complement Pathway. Front Immunol. 2020 Jun 19;11:1123. doi: 10.3389 / fimmu.2020.01123. PMID: 32636836; PMCID: PMC7316958). In the inventor’s previous work, the inventors showed that FHR1 (and FHRE) binds to necrotic type of cell surfaces and activates pro-inflammatory genes in monocytes and neutrophils (Irmscher S, Brix SR, Zipfel SLH, Halder LD, Mutlutürk S, Wulf S, Girdauskas E, Reichenspurner H, Stahl RAK, Jungnickel B, Wiech T, Zipfel PF, Skerka C. Serum FHR1 binding to necrotic-type cells activates monocytic inflammasome and marks necrotic sites in vasculopathies. Nat Commun. 2019 Jul 4;10(1):2961. doi: 10.1038 / s41467-019-10766-0. PMID: 31273197; PMCID: PMC6609651). Thus, it was not surprising that 40 weeks old FHRE- / - mice have significantly reduced serum levels of several factors involved in inflammation such as complement C5(C5a) which indicates less complement activation, of IL- 6 which activates B cells, and monocyte colony stimulating factor (MCSF) that drives differentiation of monocytes / macrophages. Also, metallopeptidase inhibitor TIMP-1 is significantly reduced compared to WT mice as well as intracellular migration protein ICAM1 which recruits immune cells for tissue transmigration and stromal cell-derived factor 1 (SDF- 1), a C-X-C motif chemokine (CXCL12) that strongly attracts lymphocytes (Bleul CC, Fuhlbrigge RC, Casasnovas JM, Aiuti A, Springer TA. A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J Exp Med.1996 Sep 1;184(3):1101-9. doi: 10.1084 / jem.184.3.1101. PMID: 9064327; PMCID: PMC2192798). In kidney and liver cells reduced gene expression of IFNβ, TNFơ and CD68 genes and increased anti-inflammatory IL-10 gene expression compared to WT mice confirms the anti-inflammatory background in FHRE- / - mice. This profile is also reflected by isolated macrophages from FHRE- / - mice, expressing less differentiation marker CD11c and CD68 but enhanced ant-inflammatory IL-10 compared to WT mice. The pro-inflammatory function of FHRE becomes much clearer in a mouse model of atherosclerosis (ApoE- / -) when expressing FHRE or lacking expression thereof. Serum of ApoE- / - mice showed increased levels of IL6 and the IL1 antagonist IL1RN as well as M-CSF compared to WT mice. These markers are significantly reduced in double deficient FHRE- / - ApoE- / - mice. Serum levels of MCSF, TIMP1 and SDF-1 are lower in double ko FHRE- / - ApoE- / - mice compared to WT mice. Deletion of FHRE in ApoE- / - mice reduces gene expression of pro-inflammatory cytokines IL1β and TNF^ in liver and heart and normalizes expression of Arginase 1 and chemokine CCL2. In total, FHRE deficiency leads in APOE- / - mice to a normalization of pro-inflammatory gene expression. In peritoneal macrophages FHRE deficiency inhibits expression of differentiation markers CD11c and CD68 but enhances IL6. The in vivo measurements suggested that FHRE regulates inflammation in atherosclerosis and the question was how FHRE is involved in this process. Deletion of the lipid transporter ApoE in ApoE- / - mouse leads to elevated levels of triglycerides (TGs) and cholesterol inducing hypercholesterolemia, spontaneous atherosclerotic lesion development and inflammation (Zhang SH, Reddick RL, Piedrahita JA, Maeda N. Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science.1992 Oct 16;258(5081):468-71. doi: 10.1126 / science.1411543. PMID: 1411543, Plump AS, et al. Severe hypercholesterolemia and atherosclerosis in apolipoprotein E-deficient mice created by homologous recombination in ES cells. Cell.1992 Oct 16;71(2):343-53. doi: 10.1016 / 0092- 8674(92)90362-g. PMID: 1423598). Measuring serum lipid levels in ApoE- / - mice confirmed high levels of TGs and cholesterol. Notably, deletion of FHRE in ApoE- / - mice normalized TG and cholesterol concentrations. This effect was confirmed in liver cells derived from FHRE- / - mice as well as FHRE- / -ApoE- / - mice. The underlying mechanism how FHRE modulates cholesterol and TG levels is unclear and was further analyzed. The majority of circulating lipid in human as well as murine bodies are triglycerides (TGs) and cholesterol. Lipids are transported in form of lipoproteins. These lipoproteins serve all cells and tissues with essential lipids. Cells extract TGs and cholesterol from very low-density lipoproteins (VLDL) thereby generating low density lipoproteins (LDL). LDL is taken up by cells and excess cholesterol is delivered to high density lipoproteins (HDL), which transport cholesterol back to the liver, also known as ‘reverse cholesterol transport’ (Fig. 7E) Subsequently the liver digests cholesterol to bile or forms new VLDLs. Increased phospholipid concentrations due to genetic predisposition or dietary choices combined with lack of exercise are major contributors to cardiovascular diseases. Population studies have shown that especially elevated levels of LDL cholesterol with its structural protein apolipoprotein B 100 (ApoB100) represents a strong atherogenic factor in the vessel wall of atherosclerotic patients. Thereby Infiltration of ApoB100 containing LDL in the artery wall is the critical initiating event of plaque formation. While native LDL is not taken up by macrophages modified LDL promotes foam cell formation. Oxidative modification converts LDL into ox-LDL which initiates inflammatory responses and plaque formation. The inventors demonstrated that FHR1 binds preferentially to ox-LDL as well as oxApoB100, and that FHR1 and oxidation levels are strongly increased in serum of ACVD patients. Moreover, FHR1 levels correlate significantly with total cholesterol, LDL and ApoB100 levels in ACVD patients. Also, FHRE is significantly elevated in serum probes of atherosclerotic ApoE- / - mice. In contrast, double ApoE- / - FHRE- / - mice revealed normal ox-LDL levels. As receptor mediated uptake and accumulation of oxidative modified LDL by macrophages drive development of atherosclerotic lesions the data suggest that FHRE directs ox-LDL to macrophages. These inflammatory M1 phenotype macrophages then exhibit increased oxidative stress, impaired cholesterol efflux and enhanced cytokine / chemokine secretion, leading to amplified LDL / remnant oxidation, endothelial cell activation, monocyte recruitment, and foam cell formation. This process also happens in the heart where they induce inflammatory cardiac fibrosis and reduce microvascular density which can lead to cardiac dysfunction. Accordingly, studies in humans reported that both reduction of LDL levels via statins and inhibition of inflammation attenuates atherosclerosis. Here the inventors identified FHR1 as a new central player in atherosclerosis and that inhibition of binding of FHR1 to ox-LDL could reduce subsequent amplification of oxidation and inflammation in humans. In FHRE- / -ApoE- / - mice LDL cholesterol concentration is very low and likely is reverse transported to the liver, as LDL levels are substantially elevated in single FHRE- / - as well as double FHRE- / -ApoE- / - mice. Similarly, LDL concentrations in human sera from FHR1 deficient individuals are very low. LDL-cholesterol is obviously cleared by the liver in FHRE- / -ApoE- / - mice by enhanced uptake via high expression of LDL receptor in liver cells and subsequently digested to bile acid, indicated by increased Cyp7A1 expression in liver cells of FHRE- / -ApoE- / - mice. According to the normalized LDL concentrations in FHRE- / -ApoE- / - mice, these mice do not present atherosclerotic plaques in the aorta or in tissues. The results also support data described in the inventor’s previous study, reporting a significantly lower frequency of FHR1 deficiency among ACVD patients compared to healthy control individuals (Yao et al.2020). Clearing of elevated LDL concentrations is also of importance in other disease such as cancer, as recent epidemiological studies have demonstrated a link between LDL and ox-LDL in the occurrence and development of cancers, like breast, colorectal, and pancreatic cancers. Thereby, ox-LDL can deliver cholesterol into cancer cells, enhancing inflammation, cell proliferation, and metastasis (Deng et al.2022). Recent studies also report that lowering serum lipid could effectively reverse early ventricular dysfunction and provide heart protection, as serum lipid accumulation in the heart induces oxidative stress and inflammation (Yao et al. 2020). In summary, FHR1 (FHRE) plays an important role in lipid homeostasis. Elevated levels of ox- LDL recruit FHR1 which mediates foam cell formation and inflammation with all the secondary effects in different organs, especially in the heart, giving rise to lipotoxicity. The present invention relates to the following items: Item 1. A method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell / plasma, comprising the steps of a) contacting at least one of FHR1 or a functional fragment thereof and / or a cell expressing FHR1 or a functional fragment thereof with at least one compound that potentially modulates at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell b) identifying a modulation of at least one of the expression, the stability and / or the biological activity of the protein FHR1 in the presence of said at least one compound, and c) identifying a compound as identified in step b) as specifically modulating lipid oxidation levels and / or atherosclerosis. Item 2. The method according to Item 1, wherein said modulation is selected from a decrease or an increase of said expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell, preferably an inhibition of the expression, the amount, the stability and / or the biological activity of the protein FHR1, wherein the biological activity is preferably selected from the interaction of FHR1 with ox-LDL and / or ox-ApoB100. Item 3. A method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of the interaction of FHR1 with ox-LDL and / or ox- ApoB100 comprising the steps of a) contacting at least one of FHR1, an ox-LDL and / or ox- ApoB100 binding fragment of FHR1, a cell expressing FHR1 and / or a cell expressing an ox- LDL and / or ox-ApoB100 binding fragment of FHR1 with at least one compound that potentially modulates the interaction of FHR1 with ox-LDL and / or ox-ApoB100 b) identifying a modulation of the interaction of FHR1 or the fragment thereof with ox-LDL and / or ox- ApoB100 in the presence of said at least one compound, and c) identifying a compound as identified in step b) as specifically modulating lipid oxidation levels and / or atherosclerosis. Item 4. The method according to Item 3, wherein the interaction is binding of FHR1 or the binding fragment of FHR1 to ox-LDL and / or ox-ApoB100. Item 5. The method according to Item 3 or 4, wherein said modulation is selected from a decrease or an increase of said interaction, preferably an inhibition of the interaction. Item 6. The method according to any one of Items 1 to 5, wherein the identifying in step c) comprises determining normalized lipid peroxidation levels and / or a modulation of the formation of atherosclerotic plaques in the mammal. Item 7. The method according to any one of Items 1 to 6, wherein the identifying in step c) further comprises determining the composition of lipids in the blood of the mammal, such as, for example, total cholesterol, LDL, and / or triglycerides. Item 8. The method according to any one of Items 1 to 7, wherein said compound is selected from the group consisting of a peptide library, a combinatory library, a cell extract, a "small molecular drug", an antisense oligonucleotide, an siRNA, and an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100. Item 9. The method according to any one of Items 1 to 8, further comprising a computational analysis of and optimization of said compound based on the structure, in particular the three- dimensional and / or crystal structure of FHR1 and / or ox-LDL and / or ox-ApoB100. Item 10. A screening tool for screening for a compound that modulates the expression, the stability, the biological activity and / or the interaction of FHR1 with ox-LDL and / or ox- ApoB100, comprising an isolated cell expressing FHR1, and / or expressing an ox-LDL and / or ox-ApoB100 binding fragment thereof, wherein said cell optionally expresses ApoB100 and / or an FHR1 binding fragment thereof. Item 11. The screening tool according to Item 10, wherein said FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof are immobilized and / or labeled. Item 12. A method for determining the level of lipid peroxidation and / or oxApoB100 in a sample obtained from a mammal, comprising detecting the concentration of FHR1 in the sample, wherein an increase of the concentration, of FHR1 in the sample when compared to a control indicates an increase of lipid peroxidation and / or oxApoB100 in said mammal. Item 13. A method for determining the level of ox-LDL and / or oxApoB100 in a sample obtained from a mammal, comprising detecting of binding of FHR1 in the sample to LDL and / or ApoB100, wherein an increase of the binding, when compared to a control indicates an increase of the level of ox-LDL and / or oxApoB100 in said mammal. Item 14. A method for detecting atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) and / or the risk for developing atherosclerosis and / or ACVD in a mammal, comprising performing a method according to Item 12 or 13, wherein an increase of lipid peroxidation and / or oxApoB100 and / or an increase of the level of ox-LDL and / or oxApoB100 is indicative for atherosclerosis and / or an increase of the risk to develop ACVD in the mammal. Item 15. A method for manufacturing a pharmaceutical composition for treating or preventing a disease or condition selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD), comprising the steps of performing a method according to any of Items 1 to 9, and formulating said compound as identified into a pharmaceutical composition, wherein said compound preferably is an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox- ApoB100. Item 16. A pharmaceutical composition as produced according to Item 15, or a compound as identified with a method according to any of Items 1 to 9, preferably an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100 for use in the prevention or treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD). Item 17. A method for preventing or treating a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) in a subject in need of such prevention and / or treatment, comprising administering to said subject an effective amount of the pharmaceutical composition as produced according to Item 15, or a compound as identified with a method according to any of Items 1 to 9, preferably an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100. Item 18. A method for monitoring the treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) in a subject, comprising performing the method according to Item 12 or 13 on a sample obtained from a subject before and after or during a treatment according to Item 16 or 17, and monitoring the treatment of the disease or condition based on the differences as detected between the samples. The invention will now be described further in the following examples with reference to the accompanying figures, nevertheless, without being limited thereto. For the purposes of the present invention, all references as cited are incorporated by reference in their entireties. Figure 1 shows the characterization of the FHRE- / - mouse model. (A) A segment comprising about 20 kbp was deleted from the genome of a black 6 mouse using CRISPR-Cas9 technology; this excised the fhrE gene from chromosome 1. (B) Deletion of the fhrE gene was confirmed by Western Blot analysis, which showed the absence of the protein from liver cells. GADPH was used as a control. (C) The body weight of FHRE- / - mice, as well as (D) the weight of different organs, was similar to that in wild-type (WT) animals (unpaired Student’s t test; n=5 / group). (E) There was no difference in serum levels of factor H and (F) complement C3 between FHRE- / - mice and WT mice, as measured by ELISA (unpaired Student’s t test, n=5 / group). Figure 2 shows the expression of pro-inflammatory genes by FHRE- / - mice. (A) Heat map showing cytokine levels in serum from FHRE- / - and WT mice. Proteins are indicated on the left. (B) Pro-inflammatory cytokine expression was lower in FHRE- / - mice than in WT mice (n=4 / group; ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA). (C) Cytokine mRNA profiles in kidney cells confirmed reduced expression of pro-inflammatory gene in FHRE- / - mice (n=4 / group; ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA). Figure 3 shows the expression of pro-inflammatory proteins in FHRE- / -ApoE- / - and FHRE+ / +ApoE- / - mice. (A) FHRE protein levels were significantly higher in FHRE+ / +ApoE- / - mice than in WT mice (n=10 / group; ***p^0.001, unpaired Student’s t test). (B) Heat map showing cytokine levels in serum from FHRE- / -ApoE- / - mice and FHRE+ / +ApoE- / - mice. Proteins are indicated on the left. (C) Pro-inflammatory cytokine levels significantly lower in FHRE- / -ApoE- / - mice than in FHRE+ / +ApoE- / - or WT mice. (n=4 / group, ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA). (D) IL-1^ protein levels in serum from FHRE- / -ApoE- / - mice are significantly lower than those in FHRE+ / +ApoE- / - mice (n=10 / group; ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA). (E) Expression of mRNA encoding IL-1^ and TNF^ in FHRE- / -ApoE- / - mice compared to FHRE+ / +ApoE- / - mice. Expression in WT was set as 1. (F) Expression of pro-inflammatory genes in heart cells from FHRE- / -ApoE- / - mice is significantly lower than that in cells from FHRE+ / +ApoE- / - mice (n=6 group; ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA). (G) Peritoneal macrophages from FHRE- / -ApoE- / - mice express significantly lower levels of differentiation markers CD11c and CD86 than those from FHRE+ / +ApoE- / - mice (n=4 / group; ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA).Expression in WT mice was set as 1. Figure 4 shows that FHRE deficiency normalizes lipid accumulation and oxidation in FHRE+ / +ApoE- / - mice. (A) High lipid oxidation levels in serum from FHRE+ / +APOE- / - mice return to normalized upon deletion of FHRE (n=8 / group; ***p^0.001, p**^0.01, *p^0.05, two- way ANOVA). (B) High cholesterol and (C) triglyceride concentrations in serum from FHRE+ / +APOE- / - mice return to normal upon deletion of FHRE (n=4 / group; ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA). (D) Elevated triglycerides seen in the liver of FHRE+ / +APOE- / - mice are reduced markedly in FHRE- / -APOE- / - mice (n=4 / group; ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA). Figure 5 shows that FHR1 levels correlate with oxLDL levels in ACVD patients. (A) FHR1 concentrations in serum from ACVD patients correlate with total cholesterol (***p = 0.0004, Spearman correlation), (B) LDL cholesterol (***p = 0.0002, Spearman correlation) , (C) serum triglycerides (*p = 0.04, Spearman correlation), with (D) lipid peroxidation levels (MDA (malondialdehyd), **p = 0.002, Spearman correlation), and (G) serum concentrations of ApoB100 (*p = 0.02, Spearman correlation) (E) but not with total protein levels (p = 0.962, Spearman correlation) but, (G) Binding of FHR1 to ApoB100 and LDL is significantly enhanced upon oxidization. No enhancement was detected upon binding to oxidized ApoA1 (***p^0.001, two-way ANOVA). Figure 6 shows efflux of LDL via LDLR and bile acids in the liver. (A) Expression of pro- inflammatory cytokines MCP1, CXCL10, and IL-1^ in HeLa cells increases upon incubation with HDL isolated from normal human sera containing FHR1 and normal human sera not containing FHR-1 (n=4 / group; ***p^0.001, p**^0.01, *p^0.05, two-way ANOVA). (B) Expression of VCAM-1 and (C) SR-B1 in FHRE- / -ApoE- / - mice is significantly lower than that in FHRE+ / +ApoE- / - mice (n=3 / group; two-way ANOVA). (D) Expression of the LDLR gene in FHRE- / - mice and double KO mice is significantly higher than that in FHRE+ / +ApoE- / - and WT mice. CYP7A1 is highly expressed in FHRE- / -ApoE+ / + mice, but not in WT, FHRE- / -ApoE- / -, or FHRE+ / +ApoE- / - mice. HMCGR, ABCG5, and ACAT2 are expressed at low levels in all mouse strains (n=4 / group; two-way ANOVA). (E) Cartoon illustrating the role of FHR1 (FHRE) in atherosclerosis. Examples Materials and Methods Cell culture and treatments THP1 cells were obtained from the American Type Culture Collection (ATCC). THP1 cells were maintained in growth culture medium (RPMI-1640, Lonza, #12-167F) supplemented with 10% of Fetal Bovine Serum (FBS, ThermoFisher Scientific, # NC0959573) 2mM Glutamine (Lonza, #BE-17-605EAJ1) and 25^M Gentamicin (Lonza, #17-518F). THP-1 differentiation was induced by treating confluent cells with 100 ng / ml phorbol 12-myristate 13-acetate (PMA, Sigma, #I1507). After 24 hours of stimulation, the induction medium was removed and a growth medium supplemented with 20% HDL isolated from normal human serum (NHS) or serum deficient for FHR1 / FHR3 was added. After 30 min incubation, cells were treated with 100 ng / ml TNF^ for 5h. Cells were then washed with PBS (Lonza, #17-512F) and harvested for RNA analysis. To isolate peritoneal macrophages, sterile cold PBS was injected according to a procedure previously described (Shim, DW., et al. Deficiency of circadian clock gene Bmal1 exacerbates noncanonical inflammasome-mediated pyroptosis and lethality via Rev-erbα-C / EBPβ-SAA1 axis. Exp Mol Med (2024). https: / / doi.org / 10.1038 / s12276-024-01162-w). Briefly, after mice euthanasia, PBS was injected in the peritoneal area and then collected and incubate at 4°C for 30 minutes and then centrifuged. The cell pellet containing the macrophages was resuspended in DMEM (Corning, #10-013-CV), supplemented with 10% FBS, and 1% pen / strep and plated in 12-well tissue culture plates (17). Cells were cultured in DMEM F-12 (Lonza, #BE04- 687F / U1) medium supplemented 10% of Fetal Bovine Serum 2mM Glutamine and 25^M Gentamicin. Mice The FHR-EKO mouse was generated by Walter and Eliza Hall Institute of Medical Research, 231 Princess Street, KEW, Vic, 3101, Australia. Briefly, the factor H related gene E (FHRE) (NCBI accession no. NC_000067), was deleted by CRISPCas9 technology in Mus musculus strain C57BL / 6J chromosome 1, using 2 sgRNAs of the sequence CTCCATTCTGTAGTTACGTC (SEQ ID NO. 1) and CAATGAGTATTGCATTAGGC (SEQ ID NO. 2). 20,823 bp of genomic sequence was targeted for deletion at position 195471971. ApoE KO mice were purchased from Jackson Laboratories. Mice were housed in the FSU animal facility at 24°C. Mice were exposed to a 12-hour light / 12-hour dark cycle with free access to normal chow food diet and water. FHRE+ / - and ApoE+ / - mice were breed together to generate the FHRE+ / +ApoE+ / + (WT), FHRE+ / +; ApoE- / - (ApoE KO), FHRE- / - ;ApoE+ / + (FHRE KO) and FHRE- / -;ApoE- / - (FHRE / ApoE KO) mice. For all the studies, genotyped 40-week-old male and female mice were weighed and sacrificed to collect blood, macrophages and tissues. All animal procedures used in this study were approved by the Institutional Animal Care and Ethic Committee of Friedrich Schiller University (FSU) Jena, Germany. RNA isolation and RT-PCR analysis Total RNA was obtained from cultured cells and from tissues with TRIzol (Thermofisher, #15596018). High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #4368814) was used to reverse transcribe 1 μg of total RNA into cDNA. RT-PCR analysis was performed using 25 ng of cDNA, 300 nM of primers (listed below) and PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, #A25776) in triplicate, following the manufacturer’s instructions. The inventors used the ΔΔCt method for relative mRNA quantification by normalizing each sample to the average change in cycle threshold value of the GAPDH for mouse genes and ^- actin for human genes, which were used as control. The following primers were utilized for Q-PCR analysis: GAPDH Fwd: TGTGTCCGTCGTGGATCTGA (SEQ ID NO.3); GAPDH Rev: CCTGCTTCACCACCTTCTTGA (SEQ ID NO.4); FHRE Fwd: CATGGTTCTCTACTGCCAAA (SEQ ID NO.5); FHRE Rev: ATC CTGATCTGTGCAAGTG (SEQ ID NO.6); TNF^ Fwd: CCAGACCCTCACACTCAGATC (SEQ ID NO.7); TNF^ Rev: CACTTGGTGTGCTACGAC (SEQ ID NO.8); MCP1 Fwd: AGGTCCCTGTCATGCTTCTG (SEQ ID NO.9); MCP-1 Rev: GCTGCTGGTGATCCTCTTGT (SEQ ID NO.10); IL-6 Fwd: GACAACTTTGGCATTGTGG (SEQ ID NO.11); IL-6 Rev: ATGCAGGGATGATGTTCTG (SEQ ID NO.12); IL-10 Fwd: AGCATGGCCCAGAAATCAAG (SEQ ID NO.13); IL-10 Rev: CGCATCCTGAGGGTCTTCA (SEQ ID NO.14); LDLR Fwd: ACCCCTCAAGACAGATGGTC (SEQ ID NO.15); LDLR Rev: CAGCCCAGCTTTGCTCTTAT (SEQ ID NO.16); HMCGR Fwd: CAACCTCTATATCCGTTTCCAGTCC (SEQ ID NO.17); HMCGR Rev: TTATGGCAGCAGGCTTCTTGTC (SEQ ID NO.18); CYP7A1 Fwd: GCTAAGACGCACCTCGTGAT (SEQ ID NO.19); CYP7A1 Rev: AGGGCTCCTGATCATTTGAA (SEQ ID NO.20); ABCG5 Fwd: ATTATGTGCATCTTAGGCAGCTC (SEQ ID NO.21); ABCG5 Rev: CGTAGGAGAAGCAGTCTTGGAA (SEQ ID NO.22); ACAT2 Fwd: CGATGAGCTAATGGAGGTGC (SEQ ID NO.23); ACAT2 Rev: GAAGAG GAAGTAGAGGTAGC (SEQ ID NO.24); IL-6 Fwd: GACAACTTTGGCATTGTGG (SEQ ID NO.25); IL-6 Rev; ATGCAGGGATGATGTTCTG (SEQ ID NO.26); CD11c Fwd: GCAGGAGTGTCCAAAGCAAGA (SEQ ID NO.27); CD11c Rev: CGTGTGCTAGGTCTCTGAAGC (SEQ ID NO.28); CD68 Fwd: CAAGGTCCAGGGAGGTTGTG (SEQ ID NO.29); CD68 Rev: CGGAATTTCTGGGATTCAGCTTC (SEQ ID NO.30); IL-1^ Fwd: CTCTCACCTCTCCTACTCACTT (SEQ ID NO.31); IL-1^ Rev: TCAGAATGTGGGAGCGAATG (SEQ ID NO.32); Arg1 Fwd: CTCCAAGCCAAAGTCCTTAGAG (SEQ ID NO.33); Arg1 Rev: AGGAGCTGTCATTAGGGACATC (SEQ ID NO.34); hIL-1^ Fwd: CTCTCACCTCTCCTACTCACTT (SEQ ID NO.35); IL-1^ Rev: TCAGAATGTGGGAGCGAATG (SEQ ID NO.36); hCXCL10 Fwd: GTGGCATTCAAGGAGTACCTC (SEQ ID NO.37); hCXCL10 Rev: TGATGGCCTTCGATTCTGGATT (SEQ ID NO.38); hMCP-1 Fwd: AGGTCCCTGTCATGCTTCTG (SEQ ID NO.39) ; hMCP-1 Rev: GCTGCTGGTGATCCTCTTGT (SEQ ID NO.40) ; h^-actin Fwd: GCTAAGTCCTGCCCTCATTT (SEQ ID NO.41); h^-actin Fwd: GTACAGGTCTTTGCGGATGT (SEQ ID NO.42). RNA-sequencing analysis mRNA from liver samples from 3 animals of each genotype were purified and send to Genewiz company for RNA sequencing. Western Blot Analysis Whole cell extracts were obtained from cultured cells and from tissues using RIPA buffer containing 20 mM Tris, 150 mM NaCl, 1% NP-40, supplemented with a cocktail of protease inhibitors (Thermofisher, #88018). 20 µg of protein lysates were run on 10% SDS- polyacrylamide gels and transferred on 0.45 μm nitrocellulose membranes (Thermofisher, #IPVH00010). Membranes were incubated for 1 hour at room temperature with a blocking solution containing 5% non-fat dry milk (w / v) resuspended in TBST 0.1% buffer (50mM Tris- HCl, 150 mM NaCl, pH 7.4, and 0.1% Tween-20) and subsequently incubated with primary antibodies at 4°C overnight in a solution containing 1% BSA in TBST 0.1% buffer (Thermofisher; #BP9703-100). The following antibodies were used at the dilutions indicated: anti-FHRE (generated by DAVIDS Biotechnologies), anti-TNF^ (R&D Systems, # AF-410- SP) and anti-GAPDH (R&D Systems, #AF5718) at 1:1000. After antibody incubation, the membranes were washed three times in TBST 0.1% (v / v) and incubated at room temperature for 1 hour with a 1:2000 dilution of anti-goat (Agilent, #P044901-2) or anti-mouse (Agilent, #P044701-2) IgG horseradish peroxidase-conjugated (BioRad) in TBST 0.1% containing 2% non-fat dry milk (w / v). After four additional washes in TBST 0.1% (v / v), immunoblots were developed, using an enhanced chemiluminescence kit (GE Healthcare, #RPN2108) on Fusion FX imaging system (Velber). Enzyme-linked immunosorbent assay (ELISA) FHR1 binding to ApoB, ApoA1, LDL, ox-ApoB, ox-ApoA1, ox-LDL were determined in a sandwich ELISA as previously described (Irmscher et al., 2019). Briefly, 10^g / ml ApoB, ApoA1, LDL, ox-ApoB, ox-ApoA1 or ox-LDL were immobilized onto ELISA plates. After washing with PBS and blocking with 2% BSA-PBS (v / v), 10^g / ml FHR1 was added to the plate. The mixtures were incubated at 37^C for 1h. Bound FHR1 was detected using JHD 7.10.1, diluted (1:1000) followed by the corresponding anti-mouse secondary antiserum (1:1000). All measurements were performed in triplicate and data for the standard curve were fitted to a logistic plot with the Magellan Data Analysis Software (Tecan). Cytokine array Proteome Profiler Mouse Cytokine Array (R&D Systems, #ARY006) was used following the manufacturer’s instructions on mouse serum. The blots were detected using an enhanced chemiluminescence kit on Fusion FX imaging system. Densitometric analysis of the array image files were performed using Image J software. Data analysis and heatmap were generated using Prism 9 software (GraphPad Software). Histology Dissected tissues were fixed in 4% paraformaldehyde (PFA, Sigma, #158127) and embedded in paraffin, according to standard procedures. Tissue sections of heart aorta of 5 mm thickness were stained with H&E, Oil Red O (Sigma, #O1391) and CD68 (Biorad, #MCA1957) and FHRE immunohistochemistry was performed following manufacturer’s instructions. Serum analysis Serum triglycerides (Sigma, # MAK266), cholesterol (Sigma, # MAK043), ApoB (R&D Systems, #DAPB00) and lipid peroxidation (TBARS Assay, Cayman Chemical #10009055) Factor H (Abcam, #ab252359) and C3 (Abcam, #ab157711) levels were measured as per manufacturer’s instructions in blood obtained from WT, ApoE KO, FHRE KO, and FHRE and ApoE KO mice. Lipase peroxidation (Abcam, #ab11870) ApoB and FHR1 levels were measured in blood obtained from human donors and Atherosclerotic Cardiovascular Disease ACVD patients (Irmscher et al., 2021). All measurements were performed in triplicate and data for the standard curve were fitted to a logistic plot with the Magellan Data Analysis Software. Liver triglyceride analysis 100 mg liver samples were homogenized in phosphate-buffered saline and lipids were extracted using chloroform:methanol (2:1) and 0.1% sulfuric acid. The organic phase was collected, dried and resuspended in isopropanol. The levels of triglycerides in liver samples were determined by using the reagents provided in the triglyceride quantification kit (Sigma cat# MAK266), following the manufacturer’s instructions, and normalized for liver weights. Flow cytometry analysis Peritoneal macrophages were collected from mice and cultured in DMEM F-12 medium supplemented 10% of Fetal Bovine Serum 2mM Glutamine and 25^M Gentamicin. Cells were detached with Tryspin / EDTA (Sigma, #T049) and washed three times with PBS Samples were stained for 30 minutes in 2% BSA, anti-Cd68, anti-Cd86 (Biorad, #MCA2463), anti-F4 / 80 (Biorad, #MCA497), anti-CD206 (Biorad, #MCA2235) and processed on an BD LSR II flow cytometer. Data were acquired on BD software and analysis performed in FlowJo software. Statistical analysis The results obtained are expressed as mean + / - standard error (SE), unless otherwise noted. Student’s t-test, Pearson test or one-way analysis of variance (ANOVA) was used for comparison between groups. p values <0.05 were considered statistically significant. The statistical analyses were performed using the Prism 9 software. Ethics After informed consent was obtained, patient data, blood, and tissue samples were collected according to the guidelines of the local ethics committees (PV5657, Medical University Eppendorf, Hamburg and 5071-02 / 17 and 2023-3006 Friedrich Schiller University, Jena as well as by the Ethics Committee Charité Berlin, Germany), and according to the Guidelines of the World Medical Association Declaration of Helsinki. Deficiency of FHRE reduces preparedness for inflammation Having previously shown that FHR1 promotes inflammation via induction of monocytes / macrophages and granulocytic neutrophils in vitro and that FHR1 is associated with inflammation in atherosclerotic cardiovascular disease (ACVD) the inventors were interested to determine the in vivo function of FHR1. For this purpose, the inventors generated a FHRE (mouse homolog of FHR1) knock-out mouse (FHRE- / -) by CRISPCas9 technology (Fig.1A) and subsequently crossed this mouse strain with the mouse model of atherosclerosis, the ApoE- / - mouse. To confirm that the FHRE gene is deleted in FHRE- / -, FHRE protein expression levels were determined in liver tissues of these mice which demonstrated no FHRE expression compared to WT (Fig. 1B). Initial phenotypical analysis of 40-week-old male and female FHRE- / - mice kept on a normal chow diet demonstrated comparable body and tissue weights like WT mice (Fig.1C and 1D). As FHRE is a complement protein, the inventors also evaluated whether expression levels of complement component C3 and Factor H were altered in FHRE- / - mice. No change was observed for C3 and Factor H levels between WT and FHRE- / - genotypes (Fig. 1E and 1F). Based on previous results that FHR1 induced the NLRP3 inflammasome in monocytes, the inventors first analyzed expression of inflammatory genes in FHRE- / - mice both at RNA and protein levels. Cytokine array with FHRE- / - mouse serum showed most of the pro-inflammatory marker levels; C5a, IL-6, M-CSF, TIMP-1 and CD-54 were significantly less present in FHRE- / - compared to WT mice, which suggested a low level of inflammatory gene expression in the absence of FHRE (Fig.2A). This observation was confirmed by mRNA analyses of kidneys from FHRE- / - mice showing lower levels of pro- inflammatory markers TNFα, CCL2 and CD68 (Fig.2C) compared to WT mice expressing FHRE. In contrast, anti-inflammatory marker IL-10 expression was increased (Fig.2C). All together these data show that FHRE- / - mice are vital and that FHRE influences expression of inflammatory gene expression in vivo. Deletion of FHRE from ApoE- / - mice attenuates inflammatory responses Having shown that FHRE deletion reduces pro-inflammatory gene expression in FHRE- / - mice, the inventors aimed to investigate whether inflammation is affected in a disease mouse model which is associated with inflammation. As FHR1 is highly expressed in ACVD patients, the inventors asked how FHRE in ApoE- / - mice effects inflammation and atherosclerosis. To test this, the inventors crossed the FHRE- / - mouse with the ApoE- / - mouse and generated FHRE- / - ApoE- / - double knock out mice. Beforehand, the inventors tested expression levels of FHRE in ApoE - / - mice. FHRE gene expression was strongly increased in 40 weeks old ApoE- / - mouse liver compared to WT mice (Fig.3A). First, changes in the inflammatory response were assessed in FHRE- / -ApoE- / - mice by cytokine array analysis. Compared to ApoE- / - mice which express FHRE, decreased levels of pro-inflammatory markers, IL6, IL1-F3 and especially macrophage stimulating factor M-CS were identified in the serum of FHRE- / -ApoE- / - double ko mice (Fig. 3B and 3C). Checking the pro-inflammatory cytokine level of IL-1β separately in the serum of the mice revealed significantly reduced levels in the double ko mice compared to ApoE- / - mice (Fig.3D). The same observation was made by mRNA analysis of liver and heart tissues from the double KO mouse. IL-1β and also TNFơ expression were substantially reduced compared to liver from ApoE mice and returned to normal ranges as observed in WT mouse (Fig.3E and Fig 3F). Furthermore, immuno-phenotyping analysis of peritoneal macrophages revealed a decrease of proinflammatory macrophages M1 in FHRE- / -ApoE- / - double ko mice as demonstrated by low levels of CD68 and CD11c (Fig.3G). These data demonstrate that loss of FHRE in this atherosclerosis mouse model decreases inflammation, reduces M1 polarization and dampens the inflammatory response. Deleting FHRE reduces accumulation of lipids and cholesterol Atherosclerosis is an inflammatory disorder characterized by accumulation of LDL cholesterol in artery walls and the subsequent infiltration of monocytes / macrophages combined with lipid peroxidation. To find out how FHRE modulates inflammation in APOE- / - mice the level of lipid oxidation was measured in the serum of all four animal models using the TBARS assay kit. As expected, ApoE- / - mouse serum revealed a high TBARS level (about 80%). In contrast, peroxidation was strongly reduced in serum of FHRE- / -;ApoE- / - mice (Fig.4A) and even significantly lower compared to WT mice. These results demonstrate that deletion of FHRE in ApoE mice normalized lipid peroxidation levels which underlined a potential involvement of FHRE in lipid oxidation levels and atherosclerosis. To further evaluate the role of FHRE in lipid metabolism, other lipids such as cholesterol and triglycerides were measured in the serum of WT, FHRE- / -, ApoE- / - and FHRE- / -ApoE- / - mice. A significant decrease of cholesterol and trigylcerides levels were identified in serum of both FHRE- / - and FHRE- / -ApoE- / - mice compared to ApoE- / - mouse as shown in Fig.4B and 4C. To confirm these results, triglyceride levels were determined also in the liver of the animals. Again, low levels of triglycerides were obtained in liver of FHRE- / - compared to ApoE- / - mice. Notably, liver triglycerides levels in FHRE- / -ApoE- / - mice were restored to those observed in WT mice (Fig.4D). These studies indicate that FHRE determines the composition of lipid in blood. In the inventor’s previous studies, it was shown that high levels of FHR1 correlated with levels of LDL but not HDL in atherosclerotic patients which suggested that FHR1, by binding to both ox-LDL and monocytes, was involved in the formation of the atherosclerotic plaques. Given the new results observed in this study, the inventors hypothesize that by binding to ox-LDL FHR1 disrupts the reverse cholesterol transport to the liver and directs the uptake of ox-LDL by macrophages in the plaques, leading to inflammation. To test this hypothesis, the inventors measured levels of total cholesterol, LDL, and triglycerides and total protein in human serum probes of the inventor’s ACVD patients’ cohort as previously described (Irmscher et al., 2021). Again, FHR1 concentrations significantly correlated with total cholesterol and LDL, but also with triglycerides in the patient’s probes (Fig.5A and 5B and 5C) confirming previous results. No correlation was detected between FHR1 and total protein levels (Fig.5D). The apolipoprotein ApoB100 is necessary for the assembly of VLDL in the liver and also serves as the primary structural and functional ligand of LDL. Testing whether FHR1 also correlates with lipid peroxidation or Apolipoprotein B (ApoB) serum levels these parameters were determined in the sera of ACVD patients. As expected, FHR1 serum concentrations significantly correlated with the level of lipid peroxidation and oxApoB100 (Fig.5D and 5E). Having shown that FHR1 binds to ox-LDL in vitro and that Factor H and FHR4 can bind to apolipoproteins, the inventors then measured binding of FHR1 to ApoB100, ApoA1 (HDL ligand) and LDL, and their oxidized forms by ELISA assay. Binding was observed of FHR1 to ApoB100, which significantly increased upon oxidization of ApoB100 (ox-ApoB100). The same enhanced binding activity was found of FHR1 to LDL versus ox-LDL (Fig. 5F). In contrast, low binding of FHR1 was found to apolipoprotein ApoA1, the structural protein of HDL, and no difference to ApoA1 versus ox-ApoA1 was noted. The data confirmed that FHR1 preferentially binds to ox-ApoB100 and ox-LDL compared to their non-oxidized forms. Previous studies have further provided evidence that HDL reduces inflammation (Bonacina F, Pirillo A, Catapano AL, Norata GD. HDL in Immune-Inflammatory Responses: Implications beyond Cardiovascular Diseases. Cells.2021 Apr 29;10(5):1061. doi: 10.3390 / cells10051061. PMID: 33947039; PMCID: PMC8146776). Based on the inventor’s results showing that FHR1 modulates the LDL / HDL ratio, the inventors assayed the FHR1 effect on the anti-inflammatory activity by HDL. For this, inflammation was induced in HL60 cells with TNFα treatment and cells were subsequently incubated with HDL isolated from human FHR1- / - or mouse FHRE- / - serum. Expression of proinflammatory genes was analyzed. mRNA levels of pro-inflammatory markers such as CXCL10 and MCP-1 were significantly reduced when HL60 cells were incubated in HDL isolated from FHR1 deficient serum, as shown in Fig. 6A. The HDL protective effect was also observed in RNA expression of blood monocyte recruitment receptor VCAM-1 and SR-B1 which were both significantly reduced in FHRE- / -ApoE- / - mice compared to ApoE- / - mice (Fig.6B, C). Altogether, the inventor’s results suggest that FHR1 in atherosclerotic patients binds to ox-LDL and directs ox-LDL to macrophages in lesions. This leads to serum accumulation of ox-LDL and inflammatory plaques. FHRE mediates cholesterol metabolism in the liver Altered cholesterol efflux by the liver is a hallmark of atherosclerosis (Adorni MP, Ronda N, Bernini F, Zimetti F. High Density Lipoprotein Cholesterol Efflux Capacity and Atherosclerosis in Cardiovascular Disease: Pathophysiological Aspects and Pharmacological Perspectives. Cells. 2021 Mar 5;10(3):574. doi: 10.3390 / cells10030574. PMID: 33807918; PMCID: PMC8002038). In order to determine the effect of FHRE on cholesterol uptake in liver the inventors measured expression levels of genes involved in the cholesterol metabolism pathway such as LDL receptor (LDLR). LDLR is involved in LDL uptake while HMCGR (PMC2289486) catalyze synthesis of cholesterol and other lipids. CYP7A1 is involved in synthesis of bile acid out of cholesterol and ABCG5 promotes biliary excretion of sterols. ACATT2 mediates Cholesterol esterification and VLDL generation. QPCR analysis of liver cells revealed that FHRE deficiency in ApoE- / - mice substantially increased the expression of LDLR receptor (One- to twofold compared to WT animals), indicating an increased uptake of cholesterol into the liver. Also, CYP7A1 but not HMCGR, AbCG5 and ACAT2 gene expression was elevated in FHRE deficient animals compared to WT animals indicating that the elevated uptake of cholesterol by the LDLR leads to bile formation and less to VLDL production (Fig. 6D). These data demonstrate that FHRE deficiency in atherosclerosis improved the cholesterol reverse transport thereby reducing inflammation. These results would explain the normal LDL level in FHRE- / -ApoE- / - mice and the protective effect of FHRE deficiency against cardiovascular disease in ApoE- / - mice as well as FHR1 deficiency in humans. References He Y, Liu T. Oxidized low-density lipoprotein regulates macrophage polarization in atherosclerosis. Int Immunopharmacol. 2023 Jul;120:110338. doi: 10.1016 / j.intimp.2023.110338. Epub 2023 May 19. PMID: 37210916. Nakajima K, Nakano T, Tanaka A. The oxidative modification hypothesis of atherosclerosis: the comparison of atherogenic effects on oxidized LDL and remnant lipoproteins in plasma. Clin Chim Acta.2006 May;367(1-2):36-47. doi: 10.1016 / j.cca.2005.12.013. Epub 2006 Jan 30. PMID: 16448638. Khan MA, Mohammad I, Banerjee S, Tomar A, Varughese KI, Mehta JL, Chandele A, Arockiasamy A. Oxidized LDL receptors: a recent update. Curr Opin Lipidol.2023 May 5. doi: 10.1097 / MOL.0000000000000884. Epub ahead of print. PMID: 37171285. Linton MF, et al. The Role of Lipids and Lipoproteins in Atherosclerosis.2019 Jan 3. In: Feingold KR, et al., editors. Endotext [Internet]. South Dartmouth (MA): MDText.com, Inc.; 2000–. PMID: 26844337. Deng CF, et al. Involvement of LDL and ox-LDL in Cancer Development and Its Therapeutical Potential. Front Oncol. 2022 Feb 16;12:803473. doi: 10.3389 / fonc.2022.803473. PMID: 35251975; PMCID: PMC8889620. Berná G, et al. The inventors are what the inventors eat: The role of lipids in metabolic diseases. Adv Food Nutr Res.2023;105:173-219. doi: 10.1016 / bs.afnr.2022.11.004. Epub 2023 Jan 2. PMID: 37516463. Yao, Y.S., Li, T.D. & Zeng, Z.H. Mechanisms underlying direct actions of hyperlipidemia on myocardium: an updated review. Lipids Health Dis 19, 23 (2020). https: / / doi.org / 10.1186 / s12944-019-1171-8 Zhang SH, Reddick RL, Piedrahita JA, Maeda N. Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science.1992 Oct 16;258(5081):468-71. doi: 10.1126 / science.1411543. PMID: 1411543 Plump AS, Smith JD, Hayek T, Aalto-Setälä K, Walsh A, Verstuyft JG, Rubin EM, Breslow JL. Severe hypercholesterolemia and atherosclerosis in apolipoprotein E-deficient mice created by homologous recombination in ES cells. Cell.1992 Oct 16;71(2):343-53. doi: 10.1016 / 0092- 8674(92)90362-g. PMID: 1423598 Ara T, Nakamura Y, Egawa T, Sugiyama T, Abe K, Kishimoto T, Matsui Y, Nagasawa T. Impaired colonization of the gonads by primordial germ cells in mice lacking a chemokine, stromal cell-derived factor-1 (SDF-1). Proc Natl Acad Sci U S A.2003 Apr 29;100(9):5319- 23. doi: 10.1073 / pnas.0730719100. Epub 2003 Apr 8. PMID: 12684531; PMCID: PMC154343. Roitelman J, et al. Immunological evidence for eight spans in the membrane domain of 3- hydroxy-3-methylglutaryl coenzyme A reductase: implications for enzyme degradation in the endoplasmic reticulum. J Cell Biol. 1992 Jun;117(5):959-73. doi: 10.1083 / jcb.117.5.959. PMID: 1374417; PMCID: PMC2289486. Estrada DF, Laurence JS, Scott EE. Cytochrome P45017A1 Interactions with the FMN Domain of Its Reductase as Characterized by NMR. J Biol Chem.2016 Feb 19;291(8):3990-4003. doi: 10.1074 / jbc.M115.677294. Epub 2015 Dec 30. PMID: 26719338; PMCID: PMC4759177. Locke JA, Wasan KM, Nelson CC, Guns ES, Leon CG (Jan 2008). "Androgen-mediated cholesterol metabolism in LNCaP and PC-3 cell lines is regulated through two different isoforms of acyl-coenzyme A:Cholesterol Acyltransferase (ACAT)". The Prostate.68 (1): 20– 33. doi:10.1002 / pros.20674. PMID 18000807. S2CID40860952 Schmitz G, Langmann T, Heimerl S (Oct 2001). "Role of ABCG1 and other ABCG family members in lipid metabolism". Journal of Lipid Research.42 (10): 1513– 20. doi:10.1016 / S0022-2275(20)32205-7. PMID11590207.
Claims
Claims 1. A method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 / FHR1 containing complexes in a mammalian cell or plasma, comprising the steps of a) contacting at least one of FHR1 or a functional fragment thereof and / or a cell expressing FHR1 or a functional fragment thereof with at least one compound that potentially modulates at least one of the expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell / plasma b) identifying a modulation of at least one of the expression, the stability and / or the biological activity of the protein FHR1 in the presence of said at least one compound, and c) identifying a compound as identified in step b) as specifically modulating lipid oxidation levels and / or atherosclerosis.
2. The method according to claim 1, wherein said modulation is selected from a decrease or an increase of said expression, the amount, the stability and / or the biological activity of the protein FHR1 in a mammalian cell / plasma, preferably an inhibition of the expression, the amount, the stability and / or the biological activity of the protein FHR1, wherein the biological activity is preferably selected from the interaction of FHR1 with ox-LDL and / or ox-ApoB100.
3. A method for identifying a compound that modulates lipid oxidation levels and / or atherosclerosis through the modulation of the interaction of FHR1 with ox-LDL and / or ox- ApoB100 comprising the steps of a) contacting at least one of FHR1, an ox-LDL and / or ox- ApoB100 binding fragment of FHR1, a cell expressing FHR1 and / or a cell expressing an ox- LDL and / or ox-ApoB100 binding fragment of FHR1 with at least one compound that potentially modulates the interaction of FHR1 with ox-LDL and / or ox-ApoB100 b) identifying a modulation of the interaction of FHR1 or the fragment thereof with ox-LDL and / or ox- ApoB100 in the presence of said at least one compound, and c) identifying a compound as identified in step b) as specifically modulating lipid oxidation levels and / or atherosclerosis, wherein preferably the interaction is binding of FHR1 or the binding fragment of FHR1 to ox- LDL and / or ox-ApoB100.
4. The method according to claim 3, wherein said modulation is selected from a decrease or an increase of said interaction, preferably an inhibition of the interaction.
5. The method according to any one of claims 1 to 4, wherein the identifying in step c) comprises determining normalized lipid peroxidation levels and / or a modulation of the formation of atherosclerotic plaques in the mammal.
6. The method according to any one of claims 1 to 5, wherein the identifying in step c) further comprises determining the composition of lipids in the blood of the mammal, such as, for example, total cholesterol, LDL, and / or triglycerides.
7. The method according to any one of claims 1 to 6, wherein said compound is selected from the group consisting of a peptide library, a combinatory library, a cell extract, a "small molecular drug", an antisense oligonucleotide, an siRNA, and an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100.
8. The method according to any one of claims 1 to 7, further comprising a computational analysis of and optimization of said compound based on the structure, in particular the three- dimensional and / or crystal structure of FHR1 and / or ox-LDL and / or ox-ApoB100.
9. Use of a screening tool for screening for a compound that modulates the expression, the stability, the biological activity and / or the interaction of FHR1 with ox-LDL and / or ox- ApoB100 according to a method according to any one of claims 1 to 8, comprising an isolated cell expressing FHR1, and / or expressing an ox-LDL and / or ox-ApoB100 binding fragment thereof, wherein said cell optionally expresses ApoB100 and / or an FHR1 binding fragment thereof, wherein preferably said FHR1 and / or ox-LDL and / or ox-ApoB100 and / or the fragments thereof are immobilized and / or labeled.
10. A method for determining the level of lipid peroxidation and / or oxApoB100 in a sample obtained from a mammal, comprising detecting the concentration of FHR1 in the sample, wherein an increase of the concentration, of FHR1 in the sample when compared to a control indicates an increase of lipid peroxidation and / or oxApoB100 in said mammal.
11. A method for determining the level of ox-LDL and / or oxApoB100 in a sample obtained from a mammal, comprising detecting of binding of FHR1 in the sample to LDL and / orApoB100, wherein an increase of the binding, when compared to a control indicates an increase of the level of ox-LDL and / or oxApoB100 in said mammal.
12. A method for detecting atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) and / or the risk for developing atherosclerosis and / or ACVD in a mammal, comprising performing a method according to claim 10 or 11, wherein an increase of lipid peroxidation and / or oxApoB100 and / or an increase of the level of ox-LDL and / or oxApoB100 is indicative for atherosclerosis and / or an increase of the risk to develop ACVD in the mammal.
13. A method for manufacturing a pharmaceutical composition for treating or preventing a disease or condition selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD), comprising the steps of performing a method according to any of claims 1 to 8, and formulating said compound as identified into a pharmaceutical composition, wherein said compound preferably is an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox- ApoB100.
14. A pharmaceutical composition as produced according to claim 13, or a compound as identified with a method according to any of claims 1 to 8, preferably an FHR1 antisense oligonucleotide, an siRNA, or an antibody, in particular an antibody against FHR1 or fragment thereof, e.g. a F(ab)2-fragment, specifically interfering with the binding of FHR1 or the binding fragment thereof to ox-LDL and / or ox-ApoB100 for use in the prevention or treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD).
15. A method for monitoring the treatment of a disease or condition caused by increased lipid peroxidation and / or increased oxApoB100, such as, for example, selected from atherosclerosis and / or a atherosclerotic cardiovascular disease (ACVD) in a subject, comprising performing the method according to claim 10 or 11 on a sample obtained from a subject before and after or during a treatment according to claim 14, and monitoring the treatment of the disease or condition based on the differences as detected between the samples.
Citation Information
Patent Citations
Methods and reagents for treatment and diagnosis of age-related macular degeneration
WO2006088950B1
Potent inhibitors of complement activation
WO2012095519A1
Polypeptides for inhibiting complement activation
WO2017109208A1
Complement component c5 irna compositions and methods of use
WO2020060987A1
Detection of complement proteins
WO2021224430A1