Fusion protein of exenatide precursor and use thereof

Abstract

Provided are a fusion protein of an exenatide precursor and a use thereof. The fusion protein comprises an exenatide precursor and a tag protein fused at an N terminus of the exenatide precursor. The exenatide precursor has an amino acid sequence as shown in SEQ ID NO: 1. The tag protein is selected from any one of Fh8 tag protein, Ffu209 tag protein, CBM tag protein, Sumo tag protein, or Trx tag protein. The exenatide precursor is fused with the tag protein, and the exenatide precursor carrying the tag protein exhibits a high expression level, enabling the preparation of large quantities of high-purity exenatide precursors, thereby facilitating industrial-scale production and use of exenatide.

Description

Fusion protein of exenatide precursor and its application

[0001] This application is based on the Chinese application with CN application number 202410229261.4 and application date February 29, 2024, and claims its priority. The disclosed content of the CN application is again introduced as a whole into this application. Technical Field

[0002] The present invention relates to the technical field of protein expression, and in particular to a fusion protein of an exenatide precursor and applications thereof. Background Art

[0003] At present, the precursor of exenatide is mainly obtained through chemical coupling synthesis and recombinant expression. Among them, the chemical coupling synthesis process is relatively complex and impurities are easily generated during the synthesis process. In addition, the chemical reagents are toxic and may produce racemates. The purity and recovery rate are relatively low; the synthesis cycle is long, and the quality control of the product is relatively difficult. Recombinant expression uses genetic engineering technology to introduce target gene expression elements into prokaryotes or eukaryotes. Through microbial fermentation, efficient synthesis of target polypeptides can be achieved, including inclusion body expression and soluble expression. Among them, inclusion body expression requires a large amount of denaturants such as urea or guanidine hydrochloride during the denaturation and renaturation process. The complex purification process results in a very low final yield. As for soluble expression, due to the different types of introduced tag proteins and the enzyme cleavage sites connecting the tag protein and the target peptide, there is a certain impact on the solubility of the obtained fusion protein and the yield of the target peptide.

[0004] For example, patent CN 103911388 B achieves soluble expression by fusing an exenatide precursor with a GB1 tag; an enterokinase cleavage site is introduced, and exenatide precursor is obtained through enterokinase cleavage, with a fermentation yield of 500 mg / L. Patent CN 104894196 A uses hirudin, a small molecular weight fusion partner, and splices the target polypeptide exenatide precursor or its derivative downstream of the hirudin fusion partner for fusion expression, introducing a TEV enzyme cleavage site. Both effectively increase the ratio of the small molecule target polypeptide in the fusion protein by fusing a small molecular weight fusion tag. However, in order to achieve a higher proportion of exenatide precursor, the former selected a relatively small tag, resulting in a complex purification process and the use of expensive IgG filler. It requires ion exchange chromatography-gel filtration chromatography-sandwich chromatography (affinity chromatography, using expensive IgG filler-enzyme cleavage-affinity chromatography). In addition, enterokinase has certain nonspecific defects. The latter uses TEV protease for enzymatic cleavage, but the recognition sequence of this enzyme is ENLYFQG (SEQ ID NO: 15) / ENLYFQGS (SEQ ID NO: 16). This patent uses ENLYFQH (SEQ ID NO: 17) as the recognition sequence, which is not the optimal recognition sequence for this enzyme, resulting in low enzymatic cleavage efficiency. In addition, hirudin itself is a polypeptide drug, and if the purification effect is not good, there is a risk of contamination of other drug polypeptides.

[0005] Summary of the Invention

[0006] The main purpose of the present invention is to provide a fusion protein of an exenatide precursor and its application, so as to solve the problem of low efficiency in preparing an exenatide precursor in the prior art.

[0007] In order to achieve the above-mentioned object, according to the first aspect of the present invention, a fusion protein of exenatide precursor is provided, wherein the fusion protein comprises exenatide precursor and a tag protein fused to the N-terminus of the exenatide precursor; the exenatide precursor has an amino acid sequence as shown in SEQ ID NO: 1; the tag protein is selected from any one of the following: Fh8 tag protein, Ffu209 tag protein, CBM tag protein, Sumo tag protein or Trx tag protein.

[0008] Furthermore, when the tag protein is selected from any one of the following, the exenatide precursor and the tag protein are connected by a connecting peptide: Fh8 tag protein, Ffu209 tag protein, CBM tag protein or Trx tag protein; the connecting peptide is selected from (GGGS)nKR, and n is selected from any integer from 1 to 5.

[0009] Furthermore, the connecting peptide is GGGSGGGSGGGSKR.

[0010] Furthermore, the fusion protein has an amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9.

[0011] To achieve the above object, according to a second aspect of the present invention, a method for preparing an exenatide precursor is provided, the method comprising: preparing the above fusion protein; and removing the tag protein in the fusion protein using an endonuclease to obtain an exenatide precursor.

[0012] Furthermore, the above-mentioned protein endonuclease is selected from Ulp1 enzyme or KEX2 enzyme; the mass ratio of Ulp1 enzyme to fusion protein is 1:20-100; the mass ratio of KEX2 enzyme to fusion protein is 1:40-500.

[0013] Furthermore, after using an endonuclease to remove the tag protein in the fusion protein, the product after the endonuclease treatment is further purified to obtain an exenatide precursor; the purification includes: adjusting the pH value of the enzyme cleavage system to the isoelectric point of the tag protein, adding an organic reagent, and centrifuging. The supernatant is the exenatide precursor.

[0014] In order to achieve the above object, according to the third aspect of the present invention, a DNA molecule is provided, which encodes the above fusion protein.

[0015] Furthermore, the nucleotide sequence of the above DNA molecule is a codon-optimized nucleotide sequence.

[0016] Furthermore, the above DNA molecule has a nucleotide sequence as shown in SEQ ID NO: 4 or 5.

[0017] In order to achieve the above object, according to a fourth aspect of the present invention, a recombinant plasmid is provided, wherein the recombinant plasmid is connected to the above DNA molecule.

[0018] In order to achieve the above object, according to a fifth aspect of the present invention, a host cell is provided, into which the above recombinant plasmid is transformed.

[0019] Furthermore, the host cell is a prokaryotic cell or a yeast cell.

[0020] In order to achieve the above object, according to the sixth aspect of the present invention, there is provided a use of the above fusion protein or the exenatide precursor prepared by the above method in the preparation of exenatide.

[0021] By applying the technical solution of the present invention, the exenatide precursor of the present application is fused with a Sumo or Trx tag protein. The exenatide precursor with the above-mentioned tag protein has a high expression level, and a large amount of high-purity exenatide precursor can be prepared, which is better for the industrial production and application of exenatide. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings, which constitute part of this application, are intended to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are intended to explain the present invention and do not constitute an undue limitation of the present invention. In the accompanying drawings:

[0023] FIG1 shows an electrophoretic diagram of fusion expression of Fh8-exe, Ffu209-exe, and CBM-exe in E. coli in Example 1 of the present invention;

[0024] FIG2 shows an electrophoretic diagram of Trx-exe fusion expression in E. coli in Example 1 of the present invention;

[0025] FIG3 shows an electrophoretic diagram of Sumo-exe fusion expression in E. coli in Example 1 of the present invention;

[0026] FIG4 shows an electrophoretic diagram of the fusion protein Trx-exe obtained after expression in E. coli and purification in Example 2 of the present invention;

[0027] FIG5 shows an electrophoretic diagram of the fusion protein Sumo-exe obtained after expression in E. coli and purification in Example 2 of the present invention;

[0028] FIG6 shows the electrophoresis of the exenatide precursor obtained by acetonitrile precipitation and purification of the fusion protein Trx-exe after enzyme digestion in Example 4 of the present invention;

[0029] FIG7 shows an electrophoretic diagram of the exenatide precursor obtained by acetonitrile precipitation and purification of the fusion protein Sumo-exe after enzyme digestion in Example 4 of the present invention;

[0030] FIG8 shows a schematic diagram of mass spectrometry detection of the exenatide precursor after the fusion protein of Example 5 of the present invention is cleaved and purified. DETAILED DESCRIPTION

[0031] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments in this application can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0032] As mentioned in the background art, existing methods for synthesizing exenatide precursors are unable to efficiently synthesize large quantities of exenatide precursor products, and there are problems such as complex purification operations, a large number of impurities, high costs, and low enzyme cleavage specificity. The present application aims to provide a technical solution with a simpler purification process and a higher yield of exenatide precursors. It utilizes a fusion tag and the highly specific KEX2 enzyme recognition site KR and the Ulp1 enzyme's specific recognition of the Sumo tag tertiary structure to separate the fusion tag and the target polypeptide. By taking advantage of the difference in the isoelectric points of the polypeptides and the fact that the tagged protein is easily precipitated in organic solvents while the polypeptide can be dissolved, a technical solution for efficiently expressing the soluble exenatide precursor is established.

[0033] In a first typical embodiment of the present invention, a fusion protein of exenatide is provided, which includes an exenatide precursor and a tag protein fused to the N-terminus of the exenatide precursor; the exenatide precursor has an amino acid sequence as shown in SEQ ID NO: 1; the tag protein is selected from any one of the following: Fh8 tag protein, Ffu209 tag protein, CBM tag protein, Sumo tag protein or Trx tag protein.

[0034] SEQ ID NO: 1: (Amino acid sequence of exenatide precursor)

[0035] The exenatide precursor with the above-mentioned amino acid sequence is fused with the tag proteins Sumo and Trx with smaller molecular weight, and the tag protein is fused to the N segment of the exenatide precursor. This fusion protein can be efficiently expressed soluble in host cells, providing a basis for subsequent processing to obtain a large amount of exenatide.

[0036] In order to further allow sufficient spatial distance between the two molecules to be fused to maintain their respective spatial configurations and their biological activities, a reasonable selection of existing connecting peptides can be made as needed to connect the two molecules to be fused. In a preferred embodiment, when the tag protein is selected from any of the following, the exenatide precursor and the tag protein are connected by a connecting peptide: Fh8 tag protein, Ffu209 tag protein, CBM tag protein or Trx tag protein; preferably, the connecting peptide is selected from (GGGS) n KR, n is selected from any integer from 1 to 5, preferably n is 3; preferably, the connecting peptide is GGGSGGGSGGGSKR (SEQ ID NO: 12).

[0037] When n=1, the connecting peptide is SEQ ID NO:10: GGGSKR; when n=2, the connecting peptide is SEQ ID NO:11: GGGSGGGSKR; when n=3, the connecting peptide is SEQ ID NO:12: GGGSGGGSGGGSKR; when n=4, the connecting peptide is SEQ ID NO:13: GGGSGGGSGGGSGGGSKR; when n=5, the connecting peptide is SEQ ID NO:14: GGGSGGGSGGGSGGGSGGGSKR.

[0038] In a preferred embodiment, the fusion protein has an amino acid sequence as shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9. The fusion protein of the present application is an N-segment exenatide precursor fused with a tag protein. The underlined portion in the following amino acid sequence is the sequence of the tag protein, and the amino acid sequence at positions 116 to 129 in SEQ ID NO: 3, the amino acid sequence at positions 76 to 89 in SEQ ID NO: 7, the amino acid sequence at positions 164 to 177 in SEQ ID NO: 8, and the amino acid sequence at positions 170 to 184 in SEQ ID NO: 9 are connecting peptide sequences.

[0039] SEQ ID NO: 2: (Amino acid sequence of Sumo-exenatide precursor)

[0040] SEQ ID NO: 3: (amino acid sequence of Trx-(G3S)3-KR-exenatide precursor)

[0041] SEQ ID NO: 7: (Amino acid sequence of Fh8-exenatide precursor)

[0042] SEQ ID NO: 8: (Amino acid sequence of Ffu209-exenatide precursor)

[0043] SEQ ID NO: 9: (Amino acid sequence of CBM-exenatide precursor)

[0044] In a second typical embodiment of the present invention, a method for preparing an exenatide precursor is provided, the method comprising: preparing the above-mentioned fusion protein; using a protein endonuclease to remove the tag protein in the fusion protein to obtain an exenatide precursor. The above-mentioned fusion protein of the present application can be expressed in large quantities in a host cell, preferably Escherichia coli, to obtain an exenatide precursor with a tagged protein. In order to obtain a purified exenatide precursor, the tag protein needs to be removed. After treatment with a protein endonuclease that can specifically recognize a specific tag protein, the exenatide precursor can be obtained, so as to achieve the purpose of efficiently producing a large amount of exenatide precursor.

[0045] The method for preparing the above-mentioned fusion protein includes: homologously ligating the nucleotide sequence of a codon-optimized exenatide precursor carrying a tagged protein with a vector capable of expressing the protein, and obtaining a recombinant plasmid with normal sequencing through positive screening. The correct plasmid is transferred into a suitable host cell for pre-screening, and the expression strain with the best expression level is selected for subsequent protein purification and culture. The expression of the protein is induced using the expression strain with the best expression level, the culture solution is centrifuged to collect the bacteria, resuspended and then disrupted, and the supernatant is purified by step-by-step elution to obtain the above-mentioned fusion protein.

[0046] Different tagged proteins require different types of endonucleases. In a preferred embodiment, the endonuclease is selected from Ulp1 enzyme or KEX2 enzyme, wherein the Ulp1 enzyme can specifically recognize the tertiary structure of the Sumo tag, thereby completely removing the Sumo-tagged protein from the target protein at the GH junction of the Sumo tag and the target protein; KEX2 can recognize the KR site of the connecting peptide and completely remove the Trx-tagged protein and the connecting peptide from the target protein. To further remove the tag protein as cleanly as possible, in a preferred embodiment, the mass ratio of Ulp1 enzyme to fusion protein is 1:20-100, including 1:20, 1:40, 1:50, 1:60, 1:80, and 1:100; the mass ratio of KEX2 enzyme to fusion protein is 1:40-500, including 1:40, 1:80, 1:100, 1:120, 1:200, 1:300, 1:400, and 1:500; preferably, the enzymatic cleavage time is 16-18 hours. Preferably, the mass ratio of Ulp1 enzyme to exenatide precursor fusion protein is 1:40, and the mass ratio of KEX2 enzyme to exenatide precursor fusion protein is 1:200; preferably, the enzymatic cleavage time is 16 hours.

[0047] In order to further obtain a higher purity of exenatide precursor, the product after the protein endonuclease treatment needs to be subjected to protein purification treatment. In a preferred embodiment, after the tag protein in the fusion protein is removed by the protein endonuclease, the product after the protein endonuclease treatment is further purified to obtain the exenatide precursor.

[0048] There are many methods for protein purification, including isoelectric precipitation, salting out, column chromatography, membrane filtration, etc. Any protein purification method that can further separate the exenatide precursor from impurities is applicable to the present application. In a preferred embodiment, purification includes: adjusting the pH value of the enzyme cleavage system to the isoelectric point of the tagged protein, adding an organic reagent, and centrifuging. The supernatant is the exenatide precursor. Preferably, the organic reagent includes methanol or acetonitrile. Among them, the isoelectric point of His-Sumo is 5.6. The tagged protein impurities precipitated by the isoelectric point are removed by precipitation after centrifugation, and finally the purified target product exenatide precursor is obtained in the supernatant. Among them, because the molecular weight of the exenatide precursor is smaller, it is more stable than protein, has good solubility in organic solvents, and is not easily precipitated.

[0049] In a third typical embodiment of the present invention, a DNA molecule is provided, which encodes the above-mentioned fusion protein.

[0050] During the translation process, each host cell for protein expression has a certain preference for codons. In order to obtain a protein product with a higher expression level in a specific host cell, the nucleotide sequence encoding the protein can be codon-optimized for a specific host cell type. In a preferred embodiment, the nucleotide sequence of the DNA molecule is a codon-optimized nucleotide sequence; preferably, the DNA molecule has a nucleotide sequence shown in SEQ ID NO: 4 or 5. The present application performs a codon optimization process with Escherichia coli preference on the nucleotide sequence encoding the exenatide precursor with Sumo or Trx tag protein. The underlined portion in the following nucleotide sequence is the sequence of the tag protein, and the nucleotide sequence at positions 346 to 387 in SEQ ID NO: 5 is a connecting peptide sequence.

[0051] SEQ ID NO: 4: (Nucleotide sequence of Sumo-exenatide precursor)

[0052] SEQ ID NO: 5: (Nucleotide sequence of Trx-(G3S)3-KR-exenatide precursor)

[0053] In a fourth typical embodiment of the present invention, a recombinant plasmid is provided, wherein the recombinant plasmid is connected to the above-mentioned DNA molecule.

[0054] In a fifth typical embodiment of the present invention, a host cell is provided, wherein the recombinant plasmid is transformed into the host cell. The host cell is a prokaryotic cell or a yeast cell, preferably Escherichia coli.

[0055] The above-mentioned host cells can be used to replicate the recombinant plasmid in the host cells, and the DNA molecules carried on the recombinant plasmid can also be transcribed and translated to obtain a large amount of fusion protein. Using existing technologies, the host cells can be disrupted and protein purified or other methods can be used to obtain the fusion protein, which is conducive to the subsequent preparation of exenatide using exenatide precursor.

[0056] In a sixth typical embodiment of the present invention, there is provided a use of the above-mentioned fusion protein or the exenatide precursor prepared by the above-mentioned method in the preparation of exenatide.

[0057] The present application is further described in detail below with reference to specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed in this application.

[0058] Example 1 Construction of pET-28a(+) expression vector

[0059] The nucleotide sequence of the exenatide precursor was fully synthesized by Jin Weizhi and optimized for the codons preferred by Escherichia coli. The sequence is as follows: SEQ ID NO: 6: CATGGCGAAGGCACCTTTACCAGCGATCTGAGCAAACAGATGGAAGAAGAAGCGGTGCGCCTGTTTATTGAATGGCTGAAAAACGGCGGCCCGAGCAGCGGCGCGCCGCCGCCGAGCTAA.

[0060] The synthesized DNA fragments were ligated with the pET-28a-Trx, pET-28a-Sumo, pET-28a-Fh8, pET-28a-Ffu209, and pET-28a-CBM vector backbones by homologous recombination. The ligation products were transformed into BL21 (DE3) competent cells. Single clone sequencing analysis was performed to obtain the correct cloning expression vector pET-28a-Tag-exe (exe is the abbreviation of Exenatide precursor). Three correct clones were picked and activated and inoculated as seeds in 250 ml shake flasks for pre-screening. The best one was selected as the final expression strain. The tag proteins Fh8, Ffu209, CBM and the tag proteins Sumo and Trx all have small molecular weights (7.5-18kDa). Among them, Fh8 is a protein secreted by liver fluke in the early stage of infection, with a molecular weight of 7.5kDa, Ffu209 is a protein derived from Salinarum glutamicum, with a molecular weight of 17.75kDa, CBM is a domain of β-fructosidase, with a molecular weight of 17.96kDa, Sumo (a small molecule ubiquitin-like modified protein, with a molecular weight of 11.4kDa) and Trx (thioredoxin, with a molecular weight of 11.7kDa) are small and the soluble expression levels of the fusion proteins are high.

[0061] 4 mL of the BL21 (DE3) strain containing the recombinant plasmid was inoculated into a 2 L Erlenmeyer flask containing 400 mL of LB medium and cultured at 37°C with shaking at 200 rpm until an OD600 of 1.0 was reached. IPTG was then added at a final concentration of 0.2 mM and induced overnight at 25°C. After induction, the cells were collected by centrifugation. The supernatant was collected by ultrasonic disruption and analyzed by 17% separating gel SDS-PAGE. The SDS-PAGE results of the fusion proteins with Fh8 tags, Ffu209 tags, CBM tags, Sumo tags, and Trx tags are shown in Figures 1 to 3. It can be seen that, except for the fusion proteins with the CBM tag, which were mostly expressed in the precipitate as inclusion bodies, the other fusion proteins were all expressed in a soluble form. Furthermore, the expression levels of the fusion proteins with the Fh8 tags and Ffu209 tags were significantly lower than those of the fusion proteins with the Sumo tags (as shown in Figure 3) and the Trx tags (as shown in Figure 2).

[0062] Example 2 Purification of Sumo-exe and Trx-exe

[0063] The bacterial slurry expressing Fh8-exe, Ffu209-exe, CBM-exe, Sumo-exe and Trx-exe was resuspended at 20% bacterial concentration, ultrasonically disrupted (5s ultrasonication, 5s interval, 30% power), and then centrifuged. The supernatant was filtered through a 0.45μm filter to obtain the crude enzyme solution, which was then purified by affinity chromatography (AKTA system equipped with 5mL HisTrap HP). The specific process is as follows: the filter sample was loaded at a flow rate of 5mL / min, and then washed with binding buffer (50mM Tris-HCl, 200mM NaCl, pH 8.0) until the unbound protein was completely eluted. Then, the impurities were eluted with buffer 50mM Tris-HCl, 200mM NaCl, 50mM imidazole, pH 8.0 for 4 column volumes, and finally the target protein was eluted with elution buffer 50mM Tris-HCl, 200mM NaCl, 300mM imidazole, pH 8.0. 1g of wet cells can obtain 13.7mg of purified Sumo-exe fusion protein (as shown in Figure 5) and 15.5mg of Trx-exe fusion protein (as shown in Figure 4), which are significantly higher than the expression levels of Fh8-lixi, Ffu209-lixi, and CBM-lixi.

[0064] Example 3 Enzyme Digestion

[0065] The Ulp1 digestion reaction was performed at 30°C in 50mM Tris-HCl, 200mM NaCl, 300mM imidazole, pH 8.0, with a 40:1 (mg / mg) ratio of purified Sumo-exe to Ulp1 for 16 hours. SDS-PAGE analysis revealed a cleavage efficiency exceeding 90%. Furthermore, when the ratio of the exenatide precursor fusion protein to Ulp1 was 100:1, the cleavage efficiency reached approximately 83%, and at a ratio of 20:1, the efficiency reached 95%. However, the addition of Ulp1 did not further improve the digestion efficiency.

[0066] The KEX2 digestion reaction was carried out at 25°C using the following procedure: 50mM Tris-HCl, 200mM NaCl, 300mM imidazole, pH 8.0, a mass ratio of 200:1 (mg / mg) of purified Trx-exe and KEX2, digestion for 16 hours, and SDS-PAGE analysis of the digestion efficiency, which was found to be over 90%. Furthermore, when the mass ratio of the exenatide precursor fusion protein to KEX2 was 50:1, the digestion efficiency reached over 95%. However, if the digestion time exceeded 24 hours, non-specific digestion would occur. When the mass ratio was 400:1, the digestion time needed to be extended to 48 hours, and the digestion efficiency still reached over 95%.

[0067] Example 4: Purification of target polypeptide by acetonitrile precipitation

[0068] The product after enzymatic digestion in Example 3 was adjusted to pH 5.6 (isoelectric point of His-sumo) or 5.7 (isoelectric point of His-Trx), and then 60% acetonitrile was added to the reaction system. After mixing, the mixture was shaken at 30° C. for 2 h, and then centrifuged at 12000 rpm to separate the supernatant and precipitate. The purity of the purified product was detected by 17% SDS-PAGE, and whether the target polypeptide was generated was detected (the purified product obtained from the enzymatic digestion product in Example 3 is shown in Figures 6 and 7). The purity of the purified product after treatment is shown in the following table:

[0069] Example 5 Mass spectrometry detection of polypeptide molecular weight

[0070] The molecular weight of the purified product obtained in Example 4 was analyzed using LC-MS.

[0071] The details are as follows: the sample was first separated by HPLC column: Agilent ZORBAX Edipse Plus C18, 4.6*100mm, 3.5μm, mobile phase A: 0.1% trifluoroacetic acid, mobile phase B: 0.1% trifluoroacetic acid in acetonitrile, gradient elution mode: 0min 10% B, 9min 95% B, 12min 100% B, 12.1min 10% B, 15min 10% B, column temperature 50℃, UV detector 210nm, flow rate 0.3ml / mi. The components after HPLC separation were analyzed by a Q Exactive HF combined quadrupole-Orbitrap mass spectrometer using an electrospray ionization source (Dual AJS ESI), positive ion mode detection, sheath gas flow rate of 35 arb, auxiliary gas flow rate of 8 arb, spray voltage of 3800 V, ion transfer tube temperature of 320°C, scan range of 200-3000 m / z, and mass spectrometry data were processed by BioPharma Finder software. The theoretical molecular weight of the exenatide precursor is 4187.6 Da, and the molecular weight of the exenatide precursor analyzed by mass spectrometry is 4186.9 (as shown in Figure 8).

[0072] In summary, it can be explained that the exenatide precursor fused with Sumo or Trx tag protein in the present application, after expression and purification and subsequent enzymatic cleavage of the tag protein, has a molecular weight consistent with that of the standard exenatide precursor. The fusion protein of the present application can be used to efficiently produce exenatide precursor.

[0073] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: the present application obtains a large amount of fusion proteins that can be used for subsequent exenatide preparation by recombinantly expressing Sumo or Trx tag protein with exenatide precursor, and obtains relatively pure exenatide precursor after enzymatic cleavage of the tag protein and purification, thereby achieving efficient synthesis of exenatide precursor.

[0074] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A fusion protein of exenatide precursor, characterized in that: The fusion protein includes an exenatide precursor and a tag protein fused to the N-terminus of the exenatide precursor; The exenatide precursor has an amino acid sequence as shown in SEQ ID NO: 1; The tag protein is selected from any one of the following: Fh8 tag protein, Ffu209 tag protein, CBM tag protein, Sumo tag protein or Trx tag protein.

2. The fusion protein according to claim 1, characterized in that When the tag protein is selected from any one of the following, the exenatide precursor and the tag protein are connected by a connecting peptide: Fh8 tag protein, Ffu209 tag protein, CBM tag protein or Trx tag protein; The connecting peptide is selected from (GGGS) n KR, n is any integer selected from 1-5.

3. The fusion protein according to claim 2, characterized in that The connecting peptide is GGGSGGGSGGGSKR.

4. The fusion protein according to claim 1, characterized in that The fusion protein has the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO:

9.

5. A method for preparing an exenatide precursor, characterized in that: The method comprises: Prepare the fusion protein according to any one of claims 1 to 4; The tag protein in the fusion protein is removed by using an endonuclease to obtain the exenatide precursor.

6. The method according to claim 5, characterized in that The protein endonuclease is selected from Ulp1 enzyme or KEX2 enzyme; The mass ratio of the Ulp1 enzyme to the fusion protein is 1:20-100; The mass ratio of the KEX2 enzyme to the fusion protein is 1:40-500.

7. The method according to claim 5, characterized in that After the tag protein in the fusion protein is removed by using an endonuclease, the product treated with the endonuclease is further purified to obtain the exenatide precursor; The purification comprises: adjusting the pH value of the enzyme cleavage system to the isoelectric point of the tag protein, adding an organic reagent, and centrifuging. The supernatant is the exenatide precursor.

8. A DNA molecule, characterized in that The DNA molecule encodes the fusion protein according to any one of claims 1 to 4.

9. The DNA molecule according to claim 8, characterized in that The nucleotide sequence of the DNA molecule is a codon-optimized nucleotide sequence.

10. The DNA molecule according to claim 9, characterized in that The DNA molecule has a nucleotide sequence as shown in SEQ ID NO: 4 or 5.

11. A recombinant plasmid, characterized in that: The recombinant plasmid is connected to the DNA molecule according to any one of claims 8 to 10.

12. A host cell, characterized in that The host cell is transformed with the recombinant plasmid according to claim 11.

13. The host cell according to claim 12, characterized in that The host cell is a prokaryotic cell or a yeast cell.

14. Use of the fusion protein according to any one of claims 1 to 4 or the exenatide precursor prepared by the method according to any one of claims 5 to 7 in the preparation of exenatide.

Images