Allele of rice HPS1 gene, molecular marker, primer pair, and use
By providing alleles of the rice HPS1 gene and their molecular markers and primer pairs, the problem of rapid reduction of rice resistance in the prior art is solved, efficient disease resistance identification and breeding of rice varieties is achieved, and the resistance of rice to various diseases is enhanced.
Patent Information
- Application Number
- PCT/CN2025/075698
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-26
- Filing Date
- 2025-02-05
- Publication Date
- 2025-09-04
AI Technical Summary
It is difficult for the prior art to effectively identify and utilize natural excellent alleles of rice to enhance the resistance of rice to different pathogens, resulting in the rapid reduction or loss of resistance to cultured disease-resistant varieties.
Alleles of rice HPS1 gene and their molecular markers and primer pairs were provided. The HPS1 gene promoter variants containing 192bp deletion were identified through PCR detection, and rice varieties with stronger resistance were screened to enhance their resistance to diseases such as rice blast, striat blight and white leaf blight.
Effectively identify and screen rice varieties with stronger resistance, enhance resistance to multiple diseases without affecting plant growth and yield, providing new genetic resources for rice breeding.
Smart Images

Figure CN2025075698_04092025_PF_FP_ABST
Abstract
Description
Allele, molecular marker, primer pair and application of rice HPS1 gene Technical Field
[0001] The present invention relates to the field of crop breeding, and in particular to an allele of a rice HPS1 gene, a molecular marker, a primer pair and applications thereof. Background Art
[0002] Rice is the world's most important food crop and the primary staple food for the Chinese people. Therefore, stable rice yields are crucial for ensuring food security. Natural diseases, such as rice blast, pose a serious threat to rice production. Discovering disease-resistant rice resources and resistance-related genes, coupled with breeding for disease resistance, is the most effective and environmentally friendly approach to combating rice diseases. Researchers at home and abroad have conducted extensive research on the mechanisms of rice disease resistance and pathogenicity, establishing a preliminary theoretical framework for rice-pathogen interactions. Guided by these theories, breeders have developed a number of disease-resistant rice varieties, alleviating the threat of disease to a certain extent. However, the dominant pathogenic populations of various pathogens, including rice blast, can rapidly change and frequently replace each other, leading to the rapid weakening or even loss of resistance in cultivated disease-resistant varieties. Different alleles may have distinct functions. Discovering disease-resistant alleles can uncover naturally occurring resistance alleles, and these genes can be directly applied to crop production without relying on genetic engineering. Therefore, rice breeding currently urgently needs effective technologies to identify more excellent alleles to enhance rice resistance to different pathogens. Summary of the Invention
[0003] The present invention aims to provide a rice HPS1 gene allele, molecular marker, primer pair, and application thereof to address the aforementioned problems of the prior art. The present invention provides a rice HPS1 gene allele that can be used to identify and cultivate disease-resistant rice varieties, thereby advancing rice breeding and providing a new genetic resource for rice germplasm improvement.
[0004] To achieve the above object, the present invention provides the following solutions:
[0005] The present invention provides an application of an allele of a rice HPS1 gene in breeding disease-resistant rice varieties. The nucleotide sequence of the allele is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0006] The present invention provides a primer pair for detecting an allele of the rice HPS1 gene, comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.6 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.7; the nucleotide sequence of the allele is shown in SEQ ID NO.2.
[0007] The present invention provides application of the primer pair in identifying disease resistance of rice.
[0008] Preferably, the disease resistance includes the ability to resist diseases caused by fungi and the ability to resist diseases caused by bacteria.
[0009] Preferably, the fungi include pathogens that cause rice blast and / or pathogens that cause sheath blight;
[0010] The bacteria include pathogenic bacteria that cause bacterial blight.
[0011] The present invention provides a molecular marker related to rice disease resistance. The molecular marker is shown as SEQ ID NO.3, and has a 192 bp deletion starting from the 86th position.
[0012] Preferably, the disease resistance includes the ability to resist diseases caused by fungi and the ability to resist diseases caused by bacteria.
[0013] Preferably, the fungi include pathogens that cause rice blast and / or pathogens that cause sheath blight;
[0014] The bacteria include pathogens that cause bacterial blight.
[0015] The present invention provides a primer pair for detecting the above-mentioned molecular marker, comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.4 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.5.
[0016] The present invention provides the use of the above-mentioned molecular marker or the above-mentioned primer pair in one or more of the following:
[0017] (1) Identification of rice disease resistance;
[0018] (2) Screening disease-resistant rice varieties;
[0019] (3) Improve rice germplasm resources;
[0020] (4) Assisted rice breeding.
[0021] The present invention provides a method for identifying disease resistance of rice, which is characterized by comprising the following steps: using genomic DNA of a sample to be tested as a template DNA, mixing with the above primer pair, and then performing PCR amplification; if the PCR product has one DNA band at 200bp-300bp and no DNA band at 400-500bp, it indicates that the sample to be tested is a rice variety with high disease resistance; if there is one DNA band at 400-500bp and no DNA band at 200bp-300bp, it indicates that the sample to be tested is a rice variety with low disease resistance.
[0022] The present invention discloses the following technical effects:
[0023] The present invention provides an allele of the hydrogen peroxide sensor 1 (HPS1) gene of rice, which is a natural superior allele of the HPS1 gene and can enhance the resistance of rice to multiple diseases. In the specific implementation of the present invention, in order to explore the application value of the HPS1 gene in rice assisted breeding, the inventors analyzed the high-quality assembled genomes of 33 rice varieties and found a structural variation of 192bp missing on the HPS1 gene promoter in 8 varieties with excellent agronomic traits (such as 93-11) among the 33 rice varieties. The present invention found that this structural variation makes the HPS1 gene promoter have stronger activity and can appropriately increase the expression level of the HPS1 gene in rice. The present invention further found that the natural superior allele of the HPS1 gene containing structural variation can give rice stronger resistance to diseases caused by various fungal and bacterial pathogens such as rice blast, sheath blight and bacterial blight. Furthermore, naturally occurring superior alleles of the HPS1 gene do not affect plant growth or yield. In specific examples of the present invention, rice plants harboring the structurally variant HPS1 gene promoter and those without the structurally variant HPS1 gene promoter showed no significant differences in key growth and yield traits, such as plant height, number of tillers per plant, 1000-grain weight, number of grains per panicle, and seed set rate. Therefore, naturally occurring superior alleles of the HPS1 gene do not adversely affect plant growth or yield, and are therefore of great value in breeding high-yield rice varieties with enhanced disease resistance.
[0024] Furthermore, the present invention identified a natural structural variation in the HPS1 gene from rice resources with excellent agronomic traits, such as the 93-11 variety, containing a 192bp deletion in the promoter of an allele. Based on this, a molecular marker primer was developed to assist in breeding, used to screen for rice varieties containing superior alleles of the HPS1 gene with this natural structural variation. Using this molecular marker, the present invention further discovered that superior alleles of the HPS1 gene containing this natural structural variation can appropriately achieve high levels of HPS1 gene expression and enhance rice resistance to various fungal and bacterial pathogens, including rice blast, sheath blight, and bacterial blight. Since the number of identified superior alleles that confer resistance to multiple pathogens is relatively small, the present invention provides a molecular marker that can be directly used for breeding high-yield crops with enhanced resistance to multiple diseases through screening natural resources. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0026] Figure 1 shows the identification of alleles of the rice HPS1 gene; A is a schematic diagram showing the genomic location and sequence comparison of structural variations in the HPS1 gene promoter in different rice varieties. The red box indicates the structural variation of the 192 bp deletion, and the black arrow indicates the genomic location of the primers designed for specific detection of the 192 bp deletion by PCR. Y3551 represents Yihui3551, and YX1 represents Yixiang1. B is the molecular marker detection results of the HPS1 structural variation in different rice varieties. Smaller DNA fragments indicate that the HPS1 in this variety has a natural structural variation of the 192 bp deletion.
[0027] Figure 2 shows the effect of SV on the activity of HPS1; A shows the detection of HPS1 activity in different rice varieties by luciferase activity assay (mean ± sd, n = 3 replicates); B shows the expression level of HPS1 gene in 3-week-old NIP, 93-11 and their recombinant inbred lines (RILs) (mean ± sd, n = 3 replicates); "+" indicates SV-type HPS1, and "-" indicates non-SV-type HPS1. The lanes in the electrophoresis diagram in B are 93-11, NIP, RIL-4, RIL-5, RIL-8 and RIL-10 from left to right.
[0028] Figure 3 shows the identification of the regulatory effect of HPS1 SV on rice disease resistance. A is a representative photo of lesions and statistics of lesion length (mean ± sd, n = 15 lesions) on three-week-old NIP, 93-11 and their RILs plants 7 days after inoculation with rice blast fungus (physiological race CD27). B is a representative photo of lesions and statistics of lesion length on tillering-stage NIP, 93-11 and their RILs plants 2 days after inoculation with sheath blight fungus (physiological race AG-1-IA). A is the statistics of lesion length (mean ± sd, n = 10 lesions), C is the representative lesion photos and lesion length statistics of three-week-old NIP and 93-11 RILs plants 14 days after inoculation with bacterial blight (physiological race PXO99A) (mean ± sd, n = 15 lesions), different letters above the bars indicate significant differences (P < 0.01), scale bar is 1 cm, "+" indicates SV type HPS1, "-" indicates non-SV type HPS1;
[0029] Figure 4 shows the identification of the effects of SV on rice growth and yield traits of HPS1. A, B, C, and D are plant height (A), number of tillers per plant (B), 1000-grain weight (C), number of grains per panicle (D), and seed setting rate (E) at maturity in NIP, 93-11, and their RILs. Data in the figure are mean ± SD, n = 20 replicates. Different letters above the bars indicate significant differences (P < 0.01). "+" indicates SV-type HPS1, and "-" indicates non-SV-type HPS1.
[0030] Figure 5 is a schematic diagram of the mechanism by which the superior allele of HPS1 improves rice disease resistance. The allele of the HPS1 gene with a natural structural variation of 192bp deletion causes the HPS1 gene in rice to be appropriately overexpressed, thereby enhancing rice resistance to multiple diseases. DETAILED DESCRIPTION
[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.
[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0036] The commercially available pGreenII-0800 vector and the published rice blast fungus (physiological race CD27), sheath blight fungus (physiological race AG-1-IA), bacterial leaf blight fungus (physiological race PXO99A), and rice materials (Nipponbare, 93-11, and the recombinant inbred line obtained by hybridizing Nipponbare and 93-11) used in the following examples were provided and preserved by the State Key Laboratory of Southwest Gene Resources Exploration and Utilization, Sichuan Agricultural University.
[0037] Example 1 Discovery of Natural Superior Alleles of the HPS1 Gene
[0038] In order to explore the application value of the HPS1 gene (gene number Os01g0196300) in rice breeding, the inventors searched and analyzed 34 high-quality assembled rice genomes (method and genome reference P. Qin et al., Pan-genome analysis of 33 genetically diverse rice accessions reveals hidden genomic variations. Cell, 184(13): 3542-3558, 2021) and the published Nipponbare genome. The results showed that in eight of the 34 rice varieties with excellent agronomic traits (93-11, D62, Wushansimiao, Tumba, Shuhui548, J4155, Guang8, and Y58S), a structural variation (SV) of 192 bp (-1203 to -1394 bp) was found in the promoter of HPS1 (HPS1) within the first 1500 bp of the coding region. However, no significant variation was found in the basic domain region (1233 to 1322 bp) (Figure 1, A). This suggests that the HPS1 promoter has two distinct nucleotide sequences in rice materials: a structurally intact type and a structurally variant type.
[0039] The 1500 bp genomic sequence of the non-SVtype HPS1 gene in Nipponbare (NIP), Zhonghua 11 (ZH11), Yixiang1, Yihui3551, Tsipala Menahar, R527, Shuhui498, Nam Roo, Nagina22, Lijiang Xintuan Hei Gu, Lemont, Kongyu131, Koshihikari, IR64, Gui630, Gang46, FS32, Fuhui838, Daohuaxiang2hao, Digu, Chuannong1, Basmati1, 2428, MSU, II32, and MALAGKIT is as follows (SEQ ID NO. 1):
[0040] >NC_029256.1:5202088-5200589 Oryza sativa Japonica Group cultivar Nipponbare chromosome 1,IRGSP-1.0:
[0041] The 1500 bp genomic sequence of the structural variant (SV-type) HPS1 in 93-11, D62, Wushansimiao, Tumba, Shuhui548, J4155, Guang8, and Y58S (SEQ ID NO. 2) is shown. The missing 192 bp sequence is indicated by a dotted line.
[0042] The eight rice varieties with SV-type HPS1 are well-known varieties with excellent agronomic traits and are widely used in rice breeding in China.
[0043] Example 2 Development of molecular markers for the natural superior allele of the HPS1 gene
[0044] The nucleotide sequence of the molecular marker is specifically CGTCATGTAACGACTTGCACAACAAACTCATTTCTAATTTGCTCTCTCTTTGTTTTGCCGCCGCCCACGCAATGTATATATCTACTGCAGATTCCTTCCATGCATGCATCTTAATTAACTTCTCCGAATTCATGGATTCCAAATGAATAATGAATAAGATGCTAAGCTAGGTTTACCAATTAATTGGCTAATTGGCAACCAAATGGCTAATCATCATCACCATCATGGCATCATCATCAAATTTTCTAAACGTTGCACCGGAAAATCAACCTAGACTGGAATTCCTTCCAATCCTTCGCTATAGCTAGCTAGCTACCACAACGATCCAAAAGTTTTGTCAAATATTTAGAACGGGGATAGCTAGGCAGTGTCGACGAAGATGTGATGTGATCTCTGAATATCTGAACCGTCGTCTGATCCACAAAAAGCTTCCCGGCTC (SEQ ID NO. 3), and there is a 192 bp deletion starting from position 86;
[0045] In order to develop a molecular marker capable of detecting the natural structural variation of the 192 bp deletion in the HPS1 gene, the inventors designed specific primers on the HPS1 gene (the specific primers are shown in Table 1).
[0046] Table 1 Molecular marker primer sequences developed based on HPS1 structural variation
[0047] After extracting the genomes of 93-11, D62, NIP, and ZH11 rice materials, PCR experiments were performed (the PCR system is shown in Table 2):
[0048] Table 2 PCR reaction system
[0049] After mixing and centrifuging the above samples, PCR reaction was performed. PCR amplification was performed using touchdown PCR. The reaction procedure is as follows:
[0050] Table 3 PCR reaction procedure
[0051] Electrophoresis was then performed, and the results are shown in Figure 1B. In this example, using the primers in Table 1, the fragment amplified from rice accessions 93-11 and D62 was 247 bp in size, while the fragment amplified from rice accessions NIP and ZH11 was 439 bp in size. This result indicates that the HPS1 gene in accessions 93-11 and D62 represents the genomic sequence of the structural variant (SV-type) HPS1 (SEQ ID NO. 2), which contains a 192 bp deletion compared to the non-SV HPS1 gene, demonstrating the effectiveness and accuracy of this molecular marker.
[0052] Example 3 Identification of the regulatory effect of natural superior alleles of the HPS1 gene on promoter activity
[0053] The activity of the promoter controls the transcription of genes, and the structural variation on the promoter may affect its activity. In order to identify the impact of the deletion (SV) of 192bp on the activity of the HPS1 gene, the inventors chose to express the pGreenII-0800 plasmid carrying different rice varieties HPS1 genes in rice protoplasts. The functional principle of the pGreenII-0800 binary vector is that it can overexpress Renilla luciferase (Renilla luciferase, RLUC) gene as an internal reference by the 35S promoter on the one hand, and can express luciferase (Luciferase, LUC) gene by custom insertion promoter on the one hand. By comparing the relative ratio of LUC and RLUC, the relative activity of the custom insertion promoter can be understood.
[0054] The inventors used the primers in Table 4 to construct pGreenII-0800 plasmids inserted with different HPS1 genes from 93-11, D62, NIP, and ZH11 rice varieties, and then transferred these plasmids into the prepared rice protoplasts for expression for 24 h (refer to He F. et al., Rice protoplast isolation and its application for transient expression analysis, Curr. Protoc. Plant Biol. 1(2): 373-383, 2016), and measured the relative activity ratio of LUC to RLUC.
[0055] Table 4 Primer sequences related to HPS1 gene
[0056] The results are shown in Figure 2A. The relative activity of SV-type HPS1 (allele of the HPS1 gene) in rice varieties 93-11 and D62 was significantly higher than that of nonSV-type HPS1 (HPS1 gene) in varieties NIP and ZH11, indicating that the presence of a 192bp deletion structural variation (SV) in the promoter of the HPS1 gene can enhance the activity of the HPS1 gene.
[0057] Example 4 Identification of the regulatory effect of natural superior alleles of the HPS1 gene on HPS1 gene expression
[0058] To further verify the function of SV, the inventors hybridized NIP with 93-11 and obtained a series of recombinant inbred lines (RILs). The inventors then used developed molecular markers to successfully identify RILs containing different types of HPS1 genes (RIL-4 and RIL-5 were plants containing SV-type HPS1, and RIL-6 and RIL-10 were plants containing SV-type HPS1). The expression levels of the HPS1 gene in 93-11, NIP / RIL-4, RIL-5, RIL-6, and RIL-10 plants were detected. Quantitative PCR experiments were performed using the primers in Table 4. The results are shown in Figure 2B. The expression level of the HPS1 gene in the inbred lines containing SV-type HPS1 was higher than that in the inbred lines containing non-SV-type HPS1 (Figure 2B). These results indicate that SV-type HPS1 has stronger activity than nonSV-type HPS1 and can moderately increase HPS1 gene expression in rice. The HPS1 promoter without the 192 bp deletion drives the expression of downstream genes at a lower level, while the HPS1 promoter with the 192 bp deletion drives the expression of downstream genes at a higher level.
[0059] Example 5 Identification of the role of the natural allele of the HPS1 gene in regulating rice resistance to rice blast
[0060] Next, the inventors tested the regulatory role of the HPS1 gene on rice disease resistance. The inventors first punctured the leaves of three-week-old 93-11, NIP, RIL-4, RIL-5, RIL-8, and RIL-10 rice seedlings and inoculated them with 5 μL of a spore suspension of Magnaporthe grisea (physiological race CD27) (5×10 5Spores / mL) were added and incubated at 28°C for 7 days, and the lesion size was counted. As shown in Figure 3A, the lesion length of RIL-4 and RIL-5 containing SV-type HPS1 was significantly shorter than that of RILs (RIL-8 and RIL-10) containing non-SV-type HPS1.
[0061] Example 6 Identification of the role of the natural allele of the HPS1 gene in regulating rice resistance to sheath blight
[0062] The inventors placed uniformly sized mycelial masses of the physiological race AG-1-IA strain of Rhizoctonia solani (cultured on PDA medium for 2 days) on rice leaves of 93-11, NIP, RIL-4, RIL-5, RIL-8, and RIL-10 plants at the tillering stage. Lesion sizes were counted after incubation at 28°C for 2 days. As shown in Figure 3B , the lesions on leaves of RIL-4 and RIL-5 containing SV-type HPS1 were significantly shorter than those on leaves of RIL-8 and RIL-10 without SV-type HPS1 (Figure 3B ).
[0063] Example 7 Identification of the role of the natural allele of the HPS1 gene in regulating rice resistance to bacterial blight
[0064] The inventors cut rice leaves from 93-11, NIP, RIL-4, RIL-5, RIL-8 and RIL-10 plants at the tillering stage, cutting the leaves about 1 cm from the leaf tip. The scissors used in the experiment were pre-soaked in the physiological subspecies PXO99A (OD 600 = 0.6) (cultured on PDA medium for 2 days). Therefore, the cut leaf wounds were infected with Xanthoceras and naturally developed disease. After the disease was fully developed, the lesion size was counted. The experimental results are shown in Figure 3, C. 14 days after inoculation with Xanthoceras, the lesion length of RIL-4 and RIL-5 containing SV-type HPS1 was significantly shorter than that of RIL-8 and RIL-10 containing non-SV-type HPS1.
[0065] The results of Examples 5 to 7 indicate that rice plants containing the natural allele of SV-type HPS1 have enhanced resistance to various diseases, including fungal and bacterial diseases.
[0066] Example 8 Identification of the Effects of Natural Alleles of the HPS1 Gene on Rice Growth and Yield Regulation
[0067] Agronomic traits of 93-11, NIP, RIL-4, RIL-5, RIL-8, and RIL-10 plants were investigated. The results are shown in Figure 4. The results showed that there were no significant differences between SV-type HPS1 RIL-4 and RIL-5 and nonSV-type HPS1 RIL-8 and RIL-10 in important rice growth and yield traits, including plant height (Figure 4, A), tiller number (Figure 4, B), number of grains per panicle (Figure 4, C), seed set rate (Figure 4, D), and 1000-grain weight (Figure 4, E). These results indicate that SV-type HPS1 has no significant effect on plant growth and yield.
[0068] In summary, the present invention discovered that SV-type HPS1, while conferring enhanced resistance to multiple diseases in crops, does not adversely affect plant growth and yield, possessing significant application value for breeding crop varieties with varying disease resistance. Specifically, rice plants harboring SV-type HPS1 (structurally variant promoter) exhibit strong disease resistance, while rice plants harboring nonSV-type HPS1 (promoter without structural variant) exhibit mild disease resistance (Figure 5). Furthermore, the molecular markers and primer pairs used to detect them demonstrate excellent efficacy and accuracy, and can be used for identifying rice disease resistance, screening disease-resistant rice varieties, improving rice germplasm resources, and supporting rice breeding.
[0069] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. The use of an allele of the rice HPS1 gene in breeding disease-resistant rice varieties, characterized in that: The nucleotide sequence of the allele is shown in SEQ ID NO.2; the disease-resistant rice varieties are blast-resistant rice, sheath blight-resistant rice and bacterial blight-resistant rice.
2. A molecular marker associated with rice disease resistance, characterized in that: The molecular marker is a sequence shown in SEQ ID NO.3 with a 192 bp deletion starting from position 86; the disease resistance is resistance to rice blast, sheath blight and bacterial blight.
3. A primer pair for detecting the molecular marker according to claim 2, characterized in that: It includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.4 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.
5.
4. Use of the primer pair according to claim 3 in one or more of the following: (1) Identification of rice disease resistance; (2) Screening disease-resistant rice varieties; (3) Improve disease-resistant rice germplasm resources; (4) Assisted breeding of disease-resistant rice; The disease resistance is rice blast resistance, sheath blight resistance and bacterial blight resistance; the disease-resistant rice is rice blast-resistant rice, sheath blight-resistant rice and bacterial blight-resistant rice.
5. A method for identifying disease resistance of rice, characterized in that: The method comprises the following steps: using the genomic DNA of the sample to be tested as the template DNA, mixing it with the primer pair according to claim 3, and then performing PCR amplification; if the PCR product has one DNA band at 200 bp-300 bp and no DNA band at 400-500 bp, it indicates that the sample to be tested is a rice variety with high disease resistance; If there is one DNA band at 400-500bp and no DNA band at 200bp-300bp, it indicates that the sample to be tested is a rice variety with low disease resistance; the disease resistance is resistance to rice blast, sheath blight and bacterial blight.
Citation Information
Patent Citations
Abiotic stress response related protein, and encoding gene and application thereof
CN104610439A
Allele of rice HPS1 gene, molecular marker, primer pair and application thereof
CN117821658A
Means and methods for regulating secondary metabolite production in plants
US20170009249A1