Novel cap analogs and methods of use thereof

Abstract

Described herein are novel cap analogs and methods of making and using the same. Also described herein is an oligonucleotide comprising a 5'-cap, wherein the 5'-cap includes a cap analog as described herein. (I) wherein Ring A is a substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted, or unsubstituted arylene, or substituted or unsubstituted heteroarylene.

Description

Attorney Ref.01355-0007-00PCT NOVEL CAP ANALOGS AND METHODS OF USE THEREOF CROSS-REFERENCE TO PRIORITY APPLICATION

[0001] This application claims priority to U.S. Provisional Application No.63 / 558,004, filed February 26, 2024, the contents of which are incorporated herein by reference in its entirety. TECHNICAL FIELD

[0002] The field of this invention relates to novel cap analogs and methods of making and using the same. Additionally, the invention relates to using the cap analogs for preparing 5’- capped oligonucleotides. BACKGROUND

[0003] In vitro transcribed messenger RNAs (mRNAs) have numerous in vivo applications, such as vaccination, where mRNA encoding specific antigen(s) is administered to elicit protective immunity in a patient; cell therapy, where mRNA is transfected into cells ex vivo to alter cell phenotype or function prior to delivery of these altered cells to a patient; or replacement therapy, where mRNA encoding a therapeutic protein is administered to the patient.

[0004] A primary structural element of an mRNA molecule that is utilized in in vivo applications is a Cap structure on the 5’-end of the mRNA. Naturally occurring Cap structures include a 7-methylguanosine (7mG orm7G) linked through a 5’- to 5’-triphosphate chain at the 5’- end of the mRNA molecule. The Cap must be present for the mRNA to retain template activity for protein synthesis. The chemical structure of the Cap can modulate translation efficiency in a cell. Therefore, effective Cap structures are necessary.

[0005] Although long RNAs, that are longer than about two hundred oligonucleotides, can only be synthesized using intracellular transcription, shorter RNAs, up to 100 nucleotides, can also be synthesized via solid-phase synthesis using phosphoramidite chemistry. Direct chemical synthesis allows for incorporation of chemical modifications that increase the chemical stability of the RNA, decrease its immunogenicity, and reduce potential off-target effects (i.e., cleaving genomic DNA at undesired locations). One limitation of the chemical synthesis is the length of the desired single-strand RNA, which, for gRNAs, are typically about 60 to 100 nucleotides. Complete isolation of the full-length product from the remaining side products formed from incompleteAttorney Ref.01355-0007-00PCT coupling (truncation products) and deprotection (including uncapped oligonucleotides) is not currently achievable for RNA molecules (or oligonucleotides) with lengths on the order of 100 nucleotides by standard purification methods (e.g., chromatography).

[0006] Thus, there exists an unmet need for improved purification methods to enable the purification of long oligonucleotides. Described herein are novel cap structures, which can be used for preparing 5’-capped oligonucleotides and which can be easily separated from the uncapped and truncated oligonucleotides using HPLC methods, provide other benefits, or at least provide the public with a useful choice. BRIEF SUMMARY OF THE INVENTION

[0007] In an aspect, provided herein is a compound of formula (I):, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein: each B1and B2is independently a natural, modified, or unnatural nucleoside base; Ring A is a substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; each Q is independently a bond, -O-, -C(R6R8)-, -S-, or -N(R9)-; each X1is independently -O-, -CH2-, -CX2-, -CHX-, -N(R101)-, -BH-, or -S-; each Y1is independently O, S, or Se; each Z1is independently -OH, -SH, -BH3, substituted or unsubstituted -O-alkyl, substitutedAttorney Ref.01355-0007-00PCT or unsubstituted alkyl, substituted or unsubstituted aryl, or substituted or unsubstituted -O-aryl; R1is hydrogen, –C(O)R1A, –C(O)OR1A, –OR1A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; R2is hydrogen, –C(O)R2A, –C(O)OR2A, –OR2A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R1and R2together with the nitrogen atom to which they are connected form a substituted or unsubstituted heteroaryl or a substituted or unsubstituted heterocyclyl; R3is hydrogen, –C(O)R3A, –C(O)OR3A, –OR3A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R4is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR4A, -NR4AR4B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R5is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR5A, -NR5AR5B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or an R4and R5attached to the same ring, together with the carbon atoms to which they are connected form a substituted or unsubstituted cycloalkylene or substituted or unsubstituted heterocycloalkylene;Attorney Ref.01355-0007-00PCT each R1A, R2A, R3A, R4A, R4B, R5A, and R5Bare independently hydrogen, -CX3, -CHX2, -CH2X, -C(O)OH, -C(O)NH2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)OH, -NHOH, -OCX3, -OCHX2, -OCH2X, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R4Aand R4Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; R5Aand R5Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; each R6, R8, R9, and R101are independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OH, -NH2,-COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2,-OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; n is an integer from 0 to 3; m is an integer from 0 to 8; and X is -Cl, -Br, -I or –F.

[0008] In an aspect, provided herein is an oligonucleotide of formula (Ib):,Attorney Ref.01355-0007-00PCT or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein: oligonucleotide is one or more nucleotides; each B1and B2is independently a natural, modified, or unnatural nucleoside base; Ring A is a substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; each Q is independently a bond, -O-, -C(R6R8)-, -S-, or -N(R9)-; each X1is independently -O-, -CH2-, -CX2-, -CHX-, -N(R101)-, -BH-, or -S-; each Y1is independently O, S, or Se; each Z1is independently -OH, -SH, -BH3, substituted or unsubstituted -O-alkyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, or substituted or unsubstituted -O-aryl; R1is hydrogen, –C(O)R1A, –C(O)OR1A, –OR1A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; R2is hydrogen, –C(O)R2A, –C(O)OR2A, –OR2A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R1and R2together with the nitrogen atom to which they are connected form a substituted or unsubstituted heteroaryl or a substituted or unsubstituted heterocyclyl; R3is hydrogen, –C(O)R3A, –C(O)OR3A, –OR3A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R4is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR4A, -NR4AR4B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstitutedAttorney Ref.01355-0007-00PCT cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R5is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR5A, -NR5AR5B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or an R4and R5attached to the same ring, together with the carbon atoms to which they are connected form a substituted or unsubstituted cycloalkylene or substituted or unsubstituted heterocycloalkylene; each R1A, R2A, R3A, R4A, R4B, R5A, and R5Bare independently hydrogen, -CX3, -CHX2, -CH2X, -C(O)OH, -C(O)NH2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)OH, -NHOH, -OCX3, -OCHX2, -OCH2X, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R4Aand R4Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; R5Aand R5Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; each R6, R8, R9, and R101are independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OH, -NH2,-COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2,-OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; n is an integer from 0 to 3; m is an integer from 0 to 8; andAttorney Ref.01355-0007-00PCT X is -Cl, -Br, -I or –F.

[0009] In embodiments, the salt is a pharmaceutically acceptable salt. In embodiments, the salt is a sodium salt, a lithium salt, or a potassium salt. In embodiments, the salt is a sodium salt.

[0010] In embodiments, the structure of formula (I) or (Ib) comprises one or more removable purification handle(s).

[0011] In embodiments, Ring A is a substituted or unsubstituted heterocycloalkylene. In embodiments, Ring A is a substituted or unsubstituted ribose ring. In embodiments, Ring A is a substituted or unsubstituted morpholino ring.

[0012] In embodiments, each Q is independently a bond or -NR9-. In embodiments, each Q is independently a bond. In embodiments, each Q is independently -NH- or -N(CH3)-. In embodiments, each Q is independently -NH-.

[0013] In embodiments, each X1is independently -O-, -CH2-, -CX2-, -N(R101)-, or -BH-. In embodiments, each X1is independently -O-, -CH2-, -CF2-, -NH-, or -BH-. In embodiments, each X1is independently -O-.

[0014] In embodiments, each Y1is independently O or S. In embodiments, each Y1is independently O.

[0015] In embodiments, each Z1is independently -OH.

[0016] In embodiments, m is 0 or 1. In embodiments, n is 1 or 2. In embodiments, n is 1.

[0017] In embodiments, R1is hydrogen, silyl, –C(O)OR1A, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted aryl. In embodiments, R1is hydrogen, silyl, or substituted or unsubstituted alkyl. In embodiments, R1is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, benzyl, t-butyldimethyl silyl (TBDMS), t- butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’-isopropylmethylmethoxytrityl, or 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, R1is hydrogen or 4, 4’, 4’’-dimethylmethoxytrityl.

[0018] In embodiments, R2is hydrogen, silyl, –C(O)OR2A, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted aryl. In embodiments, R2is hydrogen, silyl, or substituted or unsubstituted alkyl. In embodiments, R2is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, benzyl, t-butyldimethyl silyl (TBDMS), t- butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’-isopropylmethylmethoxytrityl, or 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, R2is hydrogen or 4, 4’, 4’’-dimethylmethoxytrityl.

[0019] In embodiments, R3is hydrogen, silyl, substituted or unsubstituted alkyl, orAttorney Ref.01355-0007-00PCT substituted or unsubstituted aryl. In embodiments, R3is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, hexyl, phenyl, benzyl, 4-chlorobenzyl, t-butyldimethyl silyl (TBDMS), t-butyldiphenyl silyl (TBDPS), dimethoxytrityl (DMT), trimethoxytrityl (TMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’-isopropylmethylmethoxytrityl, or 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, R3is methyl.

[0020] In embodiments, each R4is independently hydrogen. In embodiments, each R5is independently hydrogen, halogen, or -OR5A. In embodiments, each R5is independently hydroxy, methoxy, ethoxy, propoxy, butoxy, or t-butoxy. In embodiments, each R5is independently methoxy. In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a locked nucleic acid (LNA).

[0021] In embodiments, each B2is independently a natural nucleoside base. In embodiments, each B2is independently adenine, N6-methyladenine, guanine, uracil, or cytosine.

[0022] In embodiments, B1is adenine, N6-methyladenine, guanine, uracil, cytosine,or each R10is independently hydrogen, –C(O)R1A, –C(O)OR1A,1A–OR , silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0023] In embodiments, R1, and / or R2, and / or R3comprise the one or more removable purification handle(s), and / or the one or more removable purification handle(s) are attached to Ring A, and / or nucleobase B1of the structure of formula (I) or (Ib). In embodiments, the one or more removable purification handle(s) are attached to nucleobase B1of the structure of formula (I) or (Ib). In embodiments, the one or more removable purification handle(s) are attached to Ring A of the structure of formula (I) or (Ib). In embodiments, R1, and / or R2, and / or R3comprise the one or more removable purification handle(s).Attorney Ref.01355-0007-00PCT

[0024] In embodiments, each removable purification handle is independently silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. In embodiments, each removable purification handle is independently trityl, ethyl ethers, fluorenylmethyloxycarbonyl (Fmoc), t-butyldimethyl silyl (TBDMS), t-butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), 4, 4’, 4’’-dimethylmethoxytrityl, 4, 4’, 4’’- isopropylmethylmethoxytrityl, or a modified trityl. In embodiments, at least one removable purification handle is 4, 4’, 4’’-dimethylmethoxytrityl. In embodiments, R1and / or R2comprise the one or more removable purification handle(s). In embodiments, R1and / or R2is or comprises 4, 4’, 4’’-dimethylmethoxytrityl. In embodiments, the removable purification handle is not a photocleavable purification handle.

[0025] In an aspect, provided herein is a compound of the following structure: O, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof.

[0026] In an aspect, provided herein is a compound of the following structure: O, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, aAttorney Ref.01355-0007-00PCT mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof.

[0027] In an aspect, provided herein is an oligonucleotide comprising the compound A-1, stereoisomer, or a salt thereof, wherein the oligonucleotide has the structure of formula A-1b:, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein oligonucleotide is one or more nucleotides.

[0028] In an aspect, provided herein is an oligonucleotide comprising the compound A-2, stereoisomer, or a salt thereof, wherein the oligonucleotide has the structure of formula A-2b:, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein oligonucleotide is one or more nucleotides.

[0029] In embodiments, the ribose moiety of the compounds or oligonucleotides described herein is a D-ribose moiety and one or both 2’-methoxyribose moieties are 2’-methoxy-D-riboseAttorney Ref.01355-0007-00PCT moieties.

[0030] In an aspect, provided herein is a pharmaceutical composition comprising a compound or an oligonucleotide of any one of the compounds or oligonucleotides described herein, and a pharmaceutically acceptable excipient.

[0031] In an aspect, provided herein is an initiating capped oligonucleotide primer of the following formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppA2’OMepG, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a salt, solvate, or hydrate thereof. In an aspect, provided herein is an initiating capped oligonucleotide primer of the following formula:N2-enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a salt, solvate, or hydrate thereof.

[0032] In an aspect, provided herein is an oligonucleotide comprising an initiating capped oligonucleotide primer, or a stereoisomer or salt thereof, wherein the initiating capped oligonucleotide primer has the formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppA2’OMepG.an aspect, provided herein is an oligonucleotide comprising an initiating capped oligonucleotide primer, or a stereoisomer or salt thereof, wherein the initiating capped oligonucleotide primer has the formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppGpG.

[0033] In embodiments, the salt of the initiating capped oligonucleotide primer or oligonucleotide comprising the initiating capped oligonucleotide primer described herein, is a sodium salt, a lithium salt, or a potassium salt. In embodiments, the salt of the initiating capped oligonucleotide primer or oligonucleotide comprising the initiating capped oligonucleotide primer described herein, is a sodium salt.

[0034] In an aspect, provided herein is a pharmaceutical composition comprising the initiating capped oligonucleotide primer or oligonucleotide comprising the initiating capped oligonucleotide primer, or stereoisomer or salt thereof, as described herein, and a pharmaceutically acceptable excipient.

[0035] In an aspect, provided herein is a method of inducing a therapeutic effect in a subject, comprising administering to the subject any one of the oligonucleotides or pharmaceutical compositions described herein.

[0036] In an aspect, provided herein is a method of inducing a therapeutic effect in a subject, comprising removing the removable purification handle from any one of the oligonucleotides described herein, thereby providing a product oligonucleotide, and administeringAttorney Ref.01355-0007-00PCT to the subject the product oligonucleotide or a pharmaceutical composition comprising the product oligonucleotide.

[0037] In an aspect, provided herein is a method of expressing a transgene in a subject, comprising administering to the subject any one of the oligonucleotides or pharmaceutical compositions described herein, wherein the oligonucleotide comprises a sequence encoding the transgene.

[0038] In an aspect, provided herein is a method of expressing a transgene in a subject, comprising removing the removable purification handle from any one of the oligonucleotides described herein, wherein the oligonucleotide comprises a sequence encoding the transgene, thereby providing a product oligonucleotide, and administering to the subject the product oligonucleotide or a pharmaceutical composition comprising the product oligonucleotide.

[0039] In an aspect, provided herein is a method for purifying the oligonucleotides described herein, wherein the purification method is a chromatographic method which separates the capped oligonucleotides from uncapped oligonucleotides. In embodiments, the chromatographic method is an HPLC method.

[0040] In embodiments, the oligonucleotide comprises a removable purification handle, and the removable purification handle is removed after the separation of the capped oligonucleotides from uncapped oligonucleotides. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] FIG.1A-B show IP-RP HPLC chromatograms of 10mer oligonucleotide (SEQ ID NO:3) capped withN2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3’OMepp (Oligonucleotide A-3, FIG.1A) orm7G3’OMepp (Oligonucleotide A-3a, FIG 1B).

[0042] FIG.2A-B show IP-RP HPLC chromatograms of 10mer oligonucleotide (SEQ ID NO:3) capped withN2-(5-(chlorodiphenylmethyl)benzo[d][1,3]dioxole, m7G3’OMepp (Oligonucleotide A-3b, FIG. 2A) orm7G3’OMepp (Oligonucleotide A-3a, FIG 2B).

[0043] FIG.3 shows AX HPLC chromatograms of compound 7N2-(4, 4’, 4’’-isopropylmethylmethoxytrityl), m7G3’OMepp immediately after treatment with 2% dichloroacetic acid (FIG.3A), 5 minutes after treatment with 2% dichloroacetic acid (FIG.3B), 10 minutes after treatment with 2% dichloroacetic acid (FIG.3C), and 30 minutes after treatment with 2% dichloroacetic acid (FIG.3D).

[0044] FIG.4A-B show LCMS chromatograms of 10mer oligonucleotide (SEQ ID NO:3) capped withm7, N2-MMTG3'OMepp (FIG.4A) orm7G3’OMepp (FIG.4B).Attorney Ref.01355-0007-00PCT DETAILED DESCRIPTION OF THE INVENTION Definitions:

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this invention belongs. All patents, applications, published applications and other publications referred to herein are incorporated by reference in their entireties. If a definition set forth in this section is contrary to or otherwise inconsistent with a definition set forth in a patent, application, or other publication that is herein incorporated by reference, the definition set forth in this section prevails over the definition incorporated herein by reference. Section headings are provided solely for the convenience of the reader and do not limit the scope of the disclosure.

[0046] The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.

[0047] As used herein, “a” or “an” means “at least one” or “one or more”. For example, reference to “a transcript” may include a plurality of transcripts.

[0048] “Or” is used in the inclusive sense, i.e., equivalent to “and / or”, unless the context clearly indicates otherwise.

[0049] The use of any and all examples or exemplary language (e.g., “such as”) provided herein, is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed.

[0050] The terms “may,” “may be,” “can,” and “can be,” and related terms are intended to convey that the subject matter involved is optional (that is, the subject matter is present in some examples and is not present in other examples), not a reference to a capability of the subject matter or to a probability, unless the context clearly indicates otherwise.

[0051] The terms “optional” and “optionally” mean that the subsequently described event, circumstance, or material may or may not occur or be present, and that the description includes instances where the event, circumstance, or material occurs or is present as well as instances where it does not occur or is not present.

[0052] As used herein, the term "about” means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, about means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to + / - 10% of the specifiedAttorney Ref.01355-0007-00PCT value. In embodiments, about includes the specified value. Ranges can be expressed herein as from one particular value, and / or to another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range from the one particular value and / or to the other particular value unless the context specifically indicates otherwise. It should be understood that all of the individual values and sub-ranges of values contained within an explicitly disclosed range are also specifically contemplated and should be considered disclosed unless the context specifically indicates otherwise. Further, it should be understood that all ranges refer both to the recited range as a range and as a collection of individual numbers from and including the first endpoint to and including the second endpoint. In the latter case, it should be understood that any of the individual numbers can be selected as one form of the quantity, value, or feature to which the range refers. In this way, a range describes a set of numbers or values from and including the first endpoint to and including the second endpoint from which a single member of the set (i.e., a single number) can be selected as the quantity, value, or feature to which the range refers.

[0053] Ranges include the endpoints of the range. For example, “between 0 and 2” includes 0, 1, 2, and (unless the context requires otherwise) fractional values greater than 0 and less than 2.

[0054] Where substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents that would result from writing the structure from right to left, e.g., -CH2O- is equivalent to -OCH2-.

[0055] The term “alkyl,” by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which may be fully saturated, mono- or polyunsaturated and can include mono-, di- and multivalent radicals. The alkyl may include a designated number of carbons (e.g., C1-C10means one to ten carbons). Alkyl is an uncyclized chain. Examples of saturated hydrocarbon radicals include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec- butyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. An unsaturated alkyl group is one having one or more double bonds or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2- (butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and the higher homologs and isomers. An alkoxy, also referred to as -O-alkyl, is an alkyl attached to the remainder of the molecule via an oxygen linker (-O-). An alkyl moiety may be an alkenyl moiety. An alkyl moiety may be an alkynyl moiety. An alkyl moiety may be fully saturated. An alkenyl may include more than one double bond and / or one or more triple bonds in addition to the one orAttorney Ref.01355-0007-00PCT more double bonds. An alkynyl may include more than one triple bond and / or one or more double bonds in addition to the one or more triple bonds.

[0056] The term “alkylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkyl, as exemplified, but not limited by, - CH2CH2CH2CH2-. Typically, an alkyl (or alkylene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred herein. A “lower alkyl” or “lower alkylene” is a shorter chain alkyl or alkylene group, generally having eight or fewer carbon atoms. The term “alkenylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkene.

[0057] The term “heteroalkyl,” by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or combinations thereof, including at least one carbon atom and at least one heteroatom (e.g., O, N, P, Si, and S), and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized. The heteroatom(s) (e.g., O, N, S, Si, or P) may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Heteroalkyl is an uncyclized chain. Examples include, but are not limited to: -CH2-CH2- O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -CH2-S-CH2, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -Si(CH3)3, -CH2-CH=N-OCH3, -CH=CH-N(CH3)-CH3, - O-CH3, -O-CH2-CH3, and -CN. Up to two or three heteroatoms may be consecutive, such as, for example, -CH2-NH-OCH3and -CH2-O-Si(CH3)3. A heteroalkyl moiety may include one heteroatom (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include two optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include three optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include four optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include five optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include up to 8 optionally different heteroatoms (e.g., O, N, S, Si, or P). The term “heteroalkenyl,” by itself or in combination with another term, means, unless otherwise stated, a heteroalkyl including at least one double bond. A heteroalkenyl may optionally include more than one double bond and / or one or more triple bonds in additional to the one or more double bonds. The term “heteroalkynyl,” by itself or in combination with another term, means, unless otherwise stated, a heteroalkyl including at least one triple bond. A heteroalkynyl may optionally include more than one triple bond and / or one or more double bonds in additional to the one or more triple bonds.

[0058] Similarly, the term “heteroalkylene,” by itself or as part of another substituent,Attorney Ref.01355-0007-00PCT means, unless otherwise stated, a divalent radical derived from heteroalkyl, as exemplified, but not limited by, -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula -C(O)2R'- represents both -C(O)2R'- and - R'C(O)2-. As described above, heteroalkyl groups, as used herein, include those groups that are attached to the remainder of the molecule through a heteroatom, such as -C(O)R', -C(O)NR', - NR'R'', -OR', -SR', and / or -SO2R'. Where “heteroalkyl” is recited, followed by recitations of specific heteroalkyl groups, such as -NR'R'' or the like, it will be understood that the terms heteroalkyl and -NR'R'' are not redundant or mutually exclusive. Rather, the specific heteroalkyl groups are recited to add clarity. Thus, the term “heteroalkyl” should not be interpreted herein as excluding specific heteroalkyl groups, such as -NR'R'' or the like.

[0059] The terms “cycloalkyl” and “heterocycloalkyl,” by themselves or in combination with other terms, mean, unless otherwise stated, cyclic versions of “alkyl” and “heteroalkyl,” respectively. Cycloalkyl and heterocycloalkyl are not aromatic. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2- piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3- yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, 2-piperazinyl, and the like. A “cycloalkylene” and a “heterocycloalkylene,” alone or as part of another substituent, means a divalent radical derived from a cycloalkyl and heterocycloalkyl, respectively.

[0060] In embodiments, the term “cycloalkyl” means a monocyclic, bicyclic, or a multicyclic cycloalkyl ring system. In embodiments, monocyclic ring systems are cyclic hydrocarbon groups containing from 3 to 8 carbon atoms, where such groups can be saturated or unsaturated, but not aromatic. In embodiments, cycloalkyl groups are fully saturated. Examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, and cyclooctyl. Bicyclic cycloalkyl ring systems are bridged monocyclic rings or fused bicyclic rings. In embodiments, bridged monocyclic rings contain a monocyclic cycloalkyl ring where two non adjacent carbon atoms of the monocyclic ring are linked by an alkylene bridge of between one and three additional carbon atoms (i.e., a bridging group ofAttorney Ref.01355-0007-00PCT the form (CH2)w , where w is 1, 2, or 3). Representative examples of bicyclic ring systems include, but are not limited to, bicyclo[3.1.1]heptane, bicyclo[2.2.1]heptane, bicyclo[2.2.2]octane, bicyclo[3.2.2]nonane, bicyclo[3.3.1]nonane, and bicyclo[4.2.1]nonane. In embodiments, fused bicyclic cycloalkyl ring systems contain a monocyclic cycloalkyl ring fused to either a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocyclyl, or a monocyclic heteroaryl. In embodiments, the bridged or fused bicyclic cycloalkyl is attached to the parent molecular moiety through any carbon atom contained within the monocyclic cycloalkyl ring. In embodiments, cycloalkyl groups are optionally substituted with one or two groups which are independently oxo or thia. In embodiments, the fused bicyclic cycloalkyl is a 5 or 6 membered monocyclic cycloalkyl ring fused to either a phenyl ring, a 5 or 6 membered monocyclic cycloalkyl, a 5 or 6 membered monocyclic cycloalkenyl, a 5 or 6 membered monocyclic heterocyclyl, or a 5 or 6 membered monocyclic heteroaryl, wherein the fused bicyclic cycloalkyl is optionally substituted by one or two groups which are independently oxo or thia. In embodiments, multicyclic cycloalkyl ring systems are a monocyclic cycloalkyl ring (base ring) fused to either (i) one ring system selected from the group consisting of a bicyclic aryl, a bicyclic heteroaryl, a bicyclic cycloalkyl, a bicyclic cycloalkenyl, and a bicyclic heterocyclyl; or (ii) two other ring systems independently selected from the group consisting of a phenyl, a bicyclic aryl, a monocyclic or bicyclic heteroaryl, a monocyclic or bicyclic cycloalkyl, a monocyclic or bicyclic cycloalkenyl, and a monocyclic or bicyclic heterocyclyl. In embodiments, the multicyclic cycloalkyl is attached to the parent molecular moiety through any carbon atom contained within the base ring. In embodiments, multicyclic cycloalkyl ring systems are a monocyclic cycloalkyl ring (base ring) fused to either (i) one ring system selected from the group consisting of a bicyclic aryl, a bicyclic heteroaryl, a bicyclic cycloalkyl, a bicyclic cycloalkenyl, and a bicyclic heterocyclyl; or (ii) two other ring systems independently selected from the group consisting of a phenyl, a monocyclic heteroaryl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, and a monocyclic heterocyclyl. Examples of multicyclic cycloalkyl groups include, but are not limited to tetradecahydrophenanthrenyl, perhydrophenothiazin-1-yl, and perhydrophenoxazin-1-yl.

[0061] In embodiments, a cycloalkyl is a cycloalkenyl. The term “cycloalkenyl” is used in accordance with its plain ordinary meaning. In embodiments, a cycloalkenyl is a monocyclic, bicyclic, or a multicyclic cycloalkenyl ring system. In embodiments, monocyclic cycloalkenyl ring systems are cyclic hydrocarbon groups containing from 3 to 8 carbon atoms, where such groups are unsaturated (i.e., containing at least one annular carbon carbon double bond), but not aromatic. Examples of monocyclic cycloalkenyl ring systems include cyclopentenyl and cyclohexenyl. InAttorney Ref.01355-0007-00PCT embodiments, bicyclic cycloalkenyl rings are bridged monocyclic rings or a fused bicyclic rings. In embodiments, bridged monocyclic rings contain a monocyclic cycloalkenyl ring where two non adjacent carbon atoms of the monocyclic ring are linked by an alkylene bridge of between one and three additional carbon atoms (i.e., a bridging group of the form (CH2)w, where w is 1, 2, or 3). Representative examples of bicyclic cycloalkenyls include, but are not limited to, norbornenyl and bicyclo[2.2.2]oct 2 enyl. In embodiments, fused bicyclic cycloalkenyl ring systems contain a monocyclic cycloalkenyl ring fused to either a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocyclyl, or a monocyclic heteroaryl. In embodiments, the bridged or fused bicyclic cycloalkenyl is attached to the parent molecular moiety through any carbon atom contained within the monocyclic cycloalkenyl ring. In embodiments, cycloalkenyl groups are optionally substituted with one or two groups which are independently oxo or thia. In embodiments, multicyclic cycloalkenyl rings contain a monocyclic cycloalkenyl ring (base ring) fused to either (i) one ring system selected from the group consisting of a bicyclic aryl, a bicyclic heteroaryl, a bicyclic cycloalkyl, a bicyclic cycloalkenyl, and a bicyclic heterocyclyl; or (ii) two ring systems independently selected from the group consisting of a phenyl, a bicyclic aryl, a monocyclic or bicyclic heteroaryl, a monocyclic or bicyclic cycloalkyl, a monocyclic or bicyclic cycloalkenyl, and a monocyclic or bicyclic heterocyclyl. In embodiments, the multicyclic cycloalkenyl is attached to the parent molecular moiety through any carbon atom contained within the base ring. In embodiments, multicyclic cycloalkenyl rings contain a monocyclic cycloalkenyl ring (base ring) fused to either (i) one ring system selected from the group consisting of a bicyclic aryl, a bicyclic heteroaryl, a bicyclic cycloalkyl, a bicyclic cycloalkenyl, and a bicyclic heterocyclyl; or (ii) two ring systems independently selected from the group consisting of a phenyl, a monocyclic heteroaryl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, and a monocyclic heterocyclyl.

[0062] In embodiments, a heterocycloalkyl is a heterocyclyl. The term “heterocyclyl” as used herein, means a monocyclic, bicyclic, or multicyclic heterocycle. The heterocyclyl monocyclic heterocycle is a 3, 4, 5, 6 or 7 membered ring containing at least one heteroatom independently selected from the group consisting of O, N, P, and S where the ring is saturated or unsaturated, but not aromatic. The 3 or 4 membered ring contains 1 heteroatom selected from the group consisting of O, N, P, and S. The 5 membered ring can contain zero or one double bond and one, two or three heteroatoms selected from the group consisting of O, N, P, and S. The 6 or 7 membered ring contains zero, one or two double bonds and one, two or three heteroatoms selected from the group consisting of O, N, P, and S. The heterocyclyl monocyclic heterocycle is connectedAttorney Ref.01355-0007-00PCT to the parent molecular moiety through any carbon atom or any nitrogen atom contained within the heterocyclyl monocyclic heterocycle. Representative examples of heterocyclyl monocyclic heterocycles include, but are not limited to, azetidinyl, azepanyl, aziridinyl, diazepanyl, 1,3- dioxanyl, 1,3-dioxolanyl, 1,3-dithiolanyl, 1,3-dithianyl, imidazolinyl, imidazolidinyl, isothiazolinyl, isothiazolidinyl, isoxazolinyl, isoxazolidinyl, morpholinyl, oxadiazolinyl, oxadiazolidinyl, oxazolinyl, oxazolidinyl, piperazinyl, piperidinyl, pyranyl, pyrazolinyl, pyrazolidinyl, pyrrolinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl, thiadiazolinyl, thiadiazolidinyl, thiazolinyl, thiazolidinyl, thiomorpholinyl, 1,1-dioxidothiomorpholinyl (thiomorpholine sulfone), thiopyranyl, and trithianyl. The heterocyclyl bicyclic heterocycle is a monocyclic heterocycle fused to either a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocycle, or a monocyclic heteroaryl. The heterocyclyl bicyclic heterocycle is connected to the parent molecular moiety through any carbon atom or any nitrogen atom contained within the monocyclic heterocycle portion of the bicyclic ring system. Representative examples of bicyclic heterocyclyls include, but are not limited to, 2,3- dihydrobenzofuran-2-yl, 2,3-dihydrobenzofuran-3-yl, indolin-1-yl, indolin-2-yl, indolin-3-yl, 2,3- dihydrobenzothien-2-yl, decahydroquinolinyl, decahydroisoquinolinyl, octahydro-1H-indolyl, and octahydrobenzofuranyl. In embodiments, heterocyclyl groups are optionally substituted with one or two groups which are independently oxo or thia. In certain embodiments, the bicyclic heterocyclyl is a 5 or 6 membered monocyclic heterocyclyl ring fused to a phenyl ring, a 5 or 6 membered monocyclic cycloalkyl, a 5 or 6 membered monocyclic cycloalkenyl, a 5 or 6 membered monocyclic heterocyclyl, or a 5 or 6 membered monocyclic heteroaryl, wherein the bicyclic heterocyclyl is optionally substituted by one or two groups which are independently oxo or thia. Multicyclic heterocyclyl ring systems are a monocyclic heterocyclyl ring (base ring) fused to either (i) one ring system selected from the group consisting of a bicyclic aryl, a bicyclic heteroaryl, a bicyclic cycloalkyl, a bicyclic cycloalkenyl, and a bicyclic heterocyclyl; or (ii) two other ring systems independently selected from the group consisting of a phenyl, a bicyclic aryl, a monocyclic or bicyclic heteroaryl, a monocyclic or bicyclic cycloalkyl, a monocyclic or bicyclic cycloalkenyl, and a monocyclic or bicyclic heterocyclyl. The multicyclic heterocyclyl is attached to the parent molecular moiety through any carbon atom or nitrogen atom contained within the base ring. In embodiments, multicyclic heterocyclyl ring systems are a monocyclic heterocyclyl ring (base ring) fused to either (i) one ring system selected from the group consisting of a bicyclic aryl, a bicyclic heteroaryl, a bicyclic cycloalkyl, a bicyclic cycloalkenyl, and a bicyclic heterocyclyl; or (ii) two other ring systems independently selected from the group consisting of a phenyl, a monocyclicAttorney Ref.01355-0007-00PCT heteroaryl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, and a monocyclic heterocyclyl. Examples of multicyclic heterocyclyl groups include, but are not limited to 10H-phenothiazin-10- yl, 9,10-dihydroacridin-9-yl, 9,10-dihydroacridin-10-yl, 10H-phenoxazin-10-yl, 10,11-dihydro- 5H-dibenzo[b,f]azepin-5-yl, 1,2,3,4-tetrahydropyrido[4,3-g]isoquinolin-2-yl, 12H- benzo[b]phenoxazin-12-yl, and dodecahydro-1H-carbazol-9-yl.

[0063] The terms “halo” or “halogen,” by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as “haloalkyl” are meant to include monohaloalkyl and polyhaloalkyl. For example, the term “halo(C1-C4)alkyl” includes, but is not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like.

[0064] The term “acyl” means, unless otherwise stated, -C(O)R where R is a substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0065] The term “aryl” means, unless otherwise stated, a polyunsaturated, aromatic, hydrocarbon substituent, which can be a single ring or multiple rings (preferably from 1 to 3 rings) that are fused together (i.e., a fused ring aryl) or linked covalently. A fused ring aryl refers to multiple rings fused together wherein at least one of the fused rings is an aryl ring. The term “heteroaryl” refers to aryl groups (or rings) that contain at least one heteroatom such as N, O, or S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. Thus, the term “heteroaryl” includes fused ring heteroaryl groups (i.e., multiple rings fused together wherein at least one of the fused rings is a heteroaromatic ring). A 5,6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 5 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. Likewise, a 6,6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. And a 6,5- fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 5 members, and wherein at least one ring is a heteroaryl ring. A heteroaryl group can be attached to the remainder of the molecule through a carbon or heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, naphthyl, pyrrolyl, pyrazolyl, pyridazinyl, triazinyl, pyrimidinyl, imidazolyl, pyrazinyl, purinyl, oxazolyl, isoxazolyl, thiazolyl, furyl, thienyl, pyridyl, pyrimidyl, benzothiazolyl, benzoxazoyl benzimidazolyl, benzofuran, isobenzofuranyl, indolyl, isoindolyl, benzothiophenyl, isoquinolyl, quinoxalinyl, quinolyl, 1-naphthyl, 2-naphthyl, 4-Attorney Ref.01355-0007-00PCT biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2- oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2- thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4- pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1- isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below. An “arylene” and a “heteroarylene,” alone or as part of another substituent, mean a divalent radical derived from an aryl and heteroaryl, respectively. A heteroaryl group substituent may be -O- bonded to a ring heteroatom nitrogen.

[0066] A fused ring heterocyloalkyl-aryl is an aryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-heteroaryl is a heteroaryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-cycloalkyl is a heterocycloalkyl fused to a cycloalkyl. A fused ring heterocycloalkyl-heterocycloalkyl is a heterocycloalkyl fused to another heterocycloalkyl. Fused ring heterocycloalkyl-aryl, fused ring heterocycloalkyl-heteroaryl, fused ring heterocycloalkyl- cycloalkyl, or fused ring heterocycloalkyl-heterocycloalkyl may each independently be unsubstituted or substituted with one or more of the substitutents described herein.

[0067] Spirocyclic rings are two or more rings wherein adjacent rings are attached through a single atom. The individual rings within spirocyclic rings may be identical or different. Individual rings in spirocyclic rings may be substituted or unsubstituted and may have different substituents from other individual rings within a set of spirocyclic rings. Possible substituents for individual rings within spirocyclic rings are the possible substituents for the same ring when not part of spirocyclic rings (e.g. substituents for cycloalkyl or heterocycloalkyl rings). Spirocylic rings may be substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heterocycloalkylene and individual rings within a spirocyclic ring group may be any of the immediately previous list, including having all rings of one type (e.g. all rings being substituted heterocycloalkylene wherein each ring may be the same or different substituted heterocycloalkylene). When referring to a spirocyclic ring system, heterocyclic spirocyclic rings means a spirocyclic rings wherein at least one ring is a heterocyclic ring and wherein each ring may be a different ring. When referring to a spirocyclic ring system, substituted spirocyclic rings means that at least one ring is substituted and each substituent may optionally be different.

[0068] The symbol “” denotes the point of attachment of a chemical moiety to theremainder of a molecule or chemical formula.Attorney Ref.01355-0007-00PCT

[0069] The term “oxo,” as used herein, means an oxygen that is double bonded to a carbon atom.

[0070] The term “alkylsulfonyl,” as used herein, means a moiety having the formula -S(O2)-R', where R' is a substituted or unsubstituted alkyl group as defined above. R' may have a specified number of carbons (e.g., “C1-C4 alkylsulfonyl”).

[0071] The term “alkylarylene” as an arylene moiety covalently bonded to an alkylene moiety (also referred to herein as an alkylene linker). In embodiments, the alkylarylene group has the formula:.

[0072] An alkylarylene moiety may be substituted (e.g. with a substituent group) on the alkylene moiety or the arylene linker (e.g. at carbons 2, 3, 4, or 6) with halogen, oxo, -N3, -CF3, - CCl3, -CBr3, -CI3, -CN, -CHO, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO2CH3-SO3H, , - OSO3H, -SO2NH2, −NHNH2, −ONH2, −NHC(O)NHNH2, substituted or unsubstituted C1-C5 alkyl or substituted or unsubstituted 2 to 5 membered heteroalkyl). In embodiments, the alkylarylene is unsubstituted.

[0073] Each of the above terms (e.g., “alkyl,” “heteroalkyl,” “cycloalkyl,” “heterocycloalkyl,” “aryl,” and “heteroaryl”) includes both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below.

[0074] Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) can be one or more of a variety of groups selected from, but not limited to, -OR', =O, =NR', =N-OR', -NR'R'', -SR', -halogen, -SiR'R''R''', - OC(O)R', -C(O)R', -CO2R', -CONR'R'', -OC(O)NR'R'', -NR''C(O)R', -NR'-C(O)NR''R''', - NR''C(O)2R', -NR-C(NR'R''R''')=NR'''', -NR-C(NR'R'')=NR''', -S(O)R', -S(O)2R', -S(O)2NR'R'', - NRSO2R', −NR'NR''R''', −ONR'R'', −NR'C(O)NR''NR'''R'''', -CN, -NO2, -NR'SO2R'', -NR'C(O)R'', - NR'C(O)-OR'', -NR'OR'', in a number ranging from zero to (2m'+1), where m' is the total number of carbon atoms in such radical. R, R', R'', R''', and R'''' each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl (e.g., aryl substituted with 1-3 halogens), substituted or unsubstituted heteroaryl, substituted or unsubstituted alkyl, alkoxy, or thioalkoxy groups, or arylalkyl groups. When a compound described herein includes more than one R group, for example, each of the R groups is independently selected as are each R',Attorney Ref.01355-0007-00PCT R'', R''', and R'''' group when more than one of these groups is present. When R' and R'' are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 4-, 5-, 6-, or 7- membered ring. For example, -NR'R'' includes, but is not limited to, 1-pyrrolidinyl and 4- morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term “alkyl” is meant to include groups including carbon atoms bound to groups other than hydrogen groups, such as haloalkyl (e.g., -CF3and -CH2CF3) and acyl (e.g., -C(O)CH3, -C(O)CF3, -C(O)CH2OCH3, and the like).

[0075] Similar to the substituents described for the alkyl radical, substituents for the aryl and heteroaryl groups are varied and are selected from, for example: -OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -CO2R', -CONR'R'', -OC(O)NR'R'', -NR''C(O)R', -NR'- C(O)NR''R''', -NR''C(O)2R', -NR-C(NR'R''R''')=NR'''', -NR-C(NR'R'')=NR''', -S(O)R', -S(O)2R', - S(O)2NR'R'', -NRSO2R', −NR'NR''R''', −ONR'R'', −NR'C(O)NR''NR'''R'''', -CN, -NO2, -R', -N3, - CH(Ph)2, fluoro(C1-C4)alkoxy, and fluoro(C1-C4)alkyl, -NR'SO2R'', -NR'C(O)R'', -NR'C(O)-OR'', - NR'OR'', in a number ranging from zero to the total number of open valences on the aromatic ring system; and where R', R'', R''', and R'''' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. When a compound described herein includes more than one R group, for example, each of the R groups is independently selected as are each R', R'', R''', and R'''' groups when more than one of these groups is present.

[0076] Substituents for rings (e.g. cycloalkyl, heterocycloalkyl, aryl, heteroaryl, cycloalkylene, heterocycloalkylene, arylene, or heteroarylene) may be depicted as substituents on the ring rather than on a specific atom of a ring (commonly referred to as a floating substituent). In such a case, the substituent may be attached to any of the ring atoms (obeying the rules of chemical valency) and in the case of fused rings or spirocyclic rings, a substituent depicted as associated with one member of the fused rings or spirocyclic rings (a floating substituent on a single ring), may be a substituent on any of the fused rings or spirocyclic rings (a floating substituent on multiple rings). When a substituent is attached to a ring, but not a specific atom (a floating substituent), and a subscript for the substituent is an integer greater than one, the multiple substituents may be on the same atom, same ring, different atoms, different fused rings, different spirocyclic rings, and each substituent may optionally be different. Where a point of attachment of a ring to the remainder of a molecule is not limited to a single atom (a floating substituent), the attachment point may be any atom of the ring and in the case of a fused ring or spirocyclic ring,Attorney Ref.01355-0007-00PCT any atom of any of the fused rings or spirocyclic rings while obeying the rules of chemical valency. Where a ring, fused rings, or spirocyclic rings contain one or more ring heteroatoms and the ring, fused rings, or spirocyclic rings are shown with one more floating substituents (including, but not limited to, points of attachment to the remainder of the molecule), the floating substituents may be bonded to the heteroatoms. Where the ring heteroatoms are shown bound to one or more hydrogens (e.g. a ring nitrogen with two bonds to ring atoms and a third bond to a hydrogen) in the structure or formula with the floating substituent, when the heteroatom is bonded to the floating substituent, the substituent will be understood to replace the hydrogen, while obeying the rules of chemical valency.

[0077] Two or more substituents may optionally be joined to form aryl, heteroaryl, cycloalkyl, or heterocycloalkyl groups. Such so-called ring-forming substituents are typically, though not necessarily, found attached to a cyclic base structure. In one embodiment, the ring- forming substituents are attached to adjacent members of the base structure. For example, two ring- forming substituents attached to adjacent members of a cyclic base structure create a fused ring structure. In another embodiment, the ring-forming substituents are attached to a single member of the base structure. For example, two ring-forming substituents attached to a single member of a cyclic base structure create a spirocyclic structure. In yet another embodiment, the ring-forming substituents are attached to non-adjacent members of the base structure.

[0078] Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally form a ring of the formula -T-C(O)-(CRR')q-U-, wherein T and U are independently - NR-, -O-, -CRR'-, or a single bond, and q is an integer of from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -A-(CH2)r-B-, wherein A and B are independently -CRR'-, -O-, -NR-, -S- , -S(O) -, -S(O)2-, -S(O)2NR'-, or a single bond, and r is an integer of from 1 to 4. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -(CRR')s-X'- (C''R''R''')d-, where s and d are independently integers of from 0 to 3, and X' is -O-, -NR'-, -S-, -S(O)-, -S(O)2-, or -S(O)2NR'-. The substituents R, R', R'', and R''' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

[0079] As used herein, the terms “heteroatom” or “ring heteroatom” are meant to includeAttorney Ref.01355-0007-00PCT oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), and silicon (Si).

[0080] A “substituent group,” as used herein, means a group selected from the following moieties: (A) oxo, halogen, -CCl3, -CBr3, -CF3, -CI3, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CHCl2, -CHBr2, -CHF2, -CHI2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, −NHNH2, −ONH2, −NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3,-OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -N3, unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl), and (B) alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl), substituted with at least one substituent selected from: (i) oxo, halogen, -CCl3, -CBr3, -CF3, -CI3, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CHCl2, -CHBr2, -CHF2, -CHI2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, −NHNH2, −ONH2, −NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3,-OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -N3, unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl), and (ii) alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), heteroalkyl (e.g., 2 to 8Attorney Ref.01355-0007-00PCT membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl), substituted with at least one substituent selected from: (a) oxo, halogen, -CCl3, -CBr3, -CF3, -CI3, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CHCl2, -CHBr2, -CHF2, -CHI2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, −NHNH2, −ONH2, −NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -N3, unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4 alkyl), unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3- C6cycloalkyl, or C5-C6cycloalkyl), unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl), and (b) alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl), substituted with at least one substituent selected from: oxo, halogen, -CCl3, -CBr3, -CF3, -CI3, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CHCl2, -CHBr2, -CHF2, -CHI2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -S O3H, -SO4H, -SO2NH2, −NHNH2, −ONH2, −NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3,-OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -N3, unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), or unsubstitutedAttorney Ref.01355-0007-00PCT heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0081] A “size-limited substituent” or “ size-limited substituent group,” as used herein, means a group selected from all of the substituents described above for a “substituent group,” wherein each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C20 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 20 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C8 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 8 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C6-C10aryl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 10 membered heteroaryl.

[0082] A “lower substituent” or “ lower substituent group,” as used herein, means a group selected from all of the substituents described above for a “substituent group,” wherein each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C8 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 8 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C7cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 7 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted phenyl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 6 membered heteroaryl.

[0083] In some embodiments, each substituted group described in the compounds herein is substituted with at least one substituent group. More specifically, in some embodiments, each substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene described in the compounds herein are substituted with at least one substituent group. In other embodiments, at least one or all of these groups are substituted with at least one size- limited substituent group. In other embodiments, at least one or all of these groups are substituted with at least one lower substituent group.

[0084] In other embodiments of the compounds herein, each substituted or unsubstituted alkyl may be a substituted or unsubstituted C1-C20 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 20 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C8cycloalkyl, each substituted orAttorney Ref.01355-0007-00PCT unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 8 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C6-C10 aryl, and / or each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 10 membered heteroaryl. In some embodiments of the compounds herein, each substituted or unsubstituted alkylene is a substituted or unsubstituted C1-C20 alkylene, each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 2 to 20 membered heteroalkylene, each substituted or unsubstituted cycloalkylene is a substituted or unsubstituted C3-C8 cycloalkylene, each substituted or unsubstituted heterocycloalkylene is a substituted or unsubstituted 3 to 8 membered heterocycloalkylene, each substituted or unsubstituted arylene is a substituted or unsubstituted C6- C10arylene, and / or each substituted or unsubstituted heteroarylene is a substituted or unsubstituted 5 to 10 membered heteroarylene.

[0085] In some embodiments, each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C8alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 8 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C7 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 7 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C6-C10 aryl, and / or each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 9 membered heteroaryl. In some embodiments, each substituted or unsubstituted alkylene is a substituted or unsubstituted C1-C8alkylene, each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 2 to 8 membered heteroalkylene, each substituted or unsubstituted cycloalkylene is a substituted or unsubstituted C3- C7 cycloalkylene, each substituted or unsubstituted heterocycloalkylene is a substituted or unsubstituted 3 to 7 membered heterocycloalkylene, each substituted or unsubstituted arylene is a substituted or unsubstituted C6-C10 arylene, and / or each substituted or unsubstituted heteroarylene is a substituted or unsubstituted 5 to 9 membered heteroarylene. In some embodiments, the compound is a chemical species set forth in the Examples section, figures, or tables below.

[0086] In embodiments, a substituted or unsubstituted moiety (e.g., substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, and / or substituted or unsubstituted heteroarylene) is unsubstituted (e.g., is an unsubstituted alkyl, unsubstitutedAttorney Ref.01355-0007-00PCT heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, unsubstituted alkylene, unsubstituted heteroalkylene, unsubstituted cycloalkylene, unsubstituted heterocycloalkylene, unsubstituted arylene, and / or unsubstituted heteroarylene, respectively). In embodiments, a substituted or unsubstituted moiety (e.g., substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, and / or substituted or unsubstituted heteroarylene) is substituted (e.g., is a substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene, respectively).

[0087] In embodiments, a substituted moiety (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene) is substituted with at least one substituent group, wherein if the substituted moiety is substituted with a plurality of substituent groups, each substituent group may optionally be different. In embodiments, if the substituted moiety is substituted with a plurality of substituent groups, each substituent group is different.

[0088] In embodiments, a substituted moiety (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene) is substituted with at least one size-limited substituent group, wherein if the substituted moiety is substituted with a plurality of size-limited substituent groups, each size-limited substituent group may optionally be different. In embodiments, if the substituted moiety is substituted with a plurality of size-limited substituent groups, each size-limited substituent group is different.

[0089] In embodiments, a substituted moiety (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene) is substituted with atAttorney Ref.01355-0007-00PCT least one lower substituent group, wherein if the substituted moiety is substituted with a plurality of lower substituent groups, each lower substituent group may optionally be different. In embodiments, if the substituted moiety is substituted with a plurality of lower substituent groups, each lower substituent group is different.

[0090] In embodiments, a substituted moiety (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted moiety is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, if the substituted moiety is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group is different.

[0091] Certain compounds of the present disclosure possess asymmetric carbon atoms (optical or chiral centers) or double bonds; the enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisometric forms that may be defined, in terms of absolute stereochemistry, as (R)-or (S)- or, as (D)- or (L)- for amino acids, and individual isomers are encompassed within the scope of the present disclosure. The compounds of the present disclosure do not include those that are known in art to be too unstable to synthesize and / or isolate. The present disclosure is meant to include compounds in racemic and optically pure forms. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers. In certain embodiments, “optically active” and “enantiomerically active” refer to a collection of molecules, which has an enantiomeric excess of no less than about 50%, no less than about 70%, no less than about 80%, no less than about 90%, no less than about 91%, no less than about 92%, no less than about 93%, no less than about 94%, no less than about 95%, no less than about 96%, no less than about 97%, no less than about 98%, no less than about 99%, no less than about 99.5%, or no less than about 99.8%. In certain embodiments, the compound comprises about 95% or more of one enantiomer and about 5% or less of the other enantiomer based on the total weight of the racemate in question.Attorney Ref.01355-0007-00PCT

[0092] As used herein, the term “isomers” refers to compounds having the same number and kind of atoms, and hence the same molecular weight, but differing in respect to the structural arrangement or configuration of the atoms.

[0093] The term “tautomer,” as used herein, refers to one of two or more structural isomers which exist in equilibrium and which are readily converted from one isomeric form to another.

[0094] It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure.

[0095] Unless otherwise stated, structures depicted herein are also meant to include all stereochemical forms of the structure; i.e., the R and S configurations for each asymmetric center. Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope of the disclosure.

[0096] Unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures except for the replacement of a hydrogen by a deuterium or tritium, or the replacement of a carbon by13C- or14C-enriched carbon are within the scope of this disclosure.

[0097] The compounds of the present disclosure may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I), or carbon-14 (14C). All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are encompassed within the scope of the present disclosure.

[0098] It should be noted that throughout the application that alternatives are written in Markush groups, for example, each nucleoside base position that contains more than one possible nucleoside base. It is specifically contemplated that each member of the Markush group should be considered separately, thereby comprising another embodiment, and the Markush group is not to be read as a single unit.

[0099] As to any of the groups disclosed herein which contain one or more substituents, it is understood, of course, that such groups do not contain any substitution or substitution patterns which are sterically impractical and / or synthetically non-feasible. In addition, the subject compounds include all stereochemical isomers arising from the substitution of these compounds.

[0100] The term “solvate” refers to a complex or aggregate formed by one or more molecules of a solute, e.g., a compound provided herein, and one or more molecules of a solvent,Attorney Ref.01355-0007-00PCT which present in stoichiometric or non-stoichiometric amount. Suitable solvents include, but are not limited to, water, methanol, ethanol, n-propanol, isopropanol, and acetic acid. In certain embodiments, the solvent is pharmaceutically acceptable. In one embodiment, the complex or aggregate is in a crystalline form. In another embodiment, the complex or aggregate is in a noncrystalline form. Where the solvent is water, the solvate is a hydrate. Examples of hydrates include, but are not limited to, a hemihydrate, monohydrate, dihydrate, trihydrate, tetrahydrate, and pentahydrate.

[0101] The term “salt thereof” means a compound formed when a proton of an acid is replaced by a cation, such as a metal cation or an organic cation and the like. Where applicable, the salt is a pharmaceutically acceptable salt, although this is not required for salts of intermediate compounds that are not intended for administration to a patient. By way of example, salts of the present compounds include those wherein the compound is protonated by an inorganic or organic acid to form a cation, with the conjugate base of the inorganic or organic acid as the anionic component of the salt.

[0102] The term “pharmaceutically acceptable salt” means a salt which is acceptable for administration to a patient, such as a mammal, such as human (salts with counterions having acceptable mammalian safety for a given dosage regime). Such salts can be derived from pharmaceutically acceptable inorganic or organic bases and from pharmaceutically acceptable inorganic or organic acids. “Pharmaceutically acceptable salt” refers to pharmaceutically acceptable salts of a compound, which salts are derived from a variety of organic and inorganic counter ions well known in the art and when the molecule contains a basic functionality, salts of organic or inorganic acids. The pharmaceutically acceptable salts of the compounds described herein are suitable for use in contact with the tissues of subjects without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, and effective for their intended use, as well as the zwitterionic forms, where possible, of the compounds described herein. These salts can be prepared in situ during the isolation and purification of the compounds or by separately reacting the purified compound in its free base form with a suitable organic or inorganic acid and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate mesylate, glucoheptonate, lactobionate, methane sulphonate, and laurylsulphonate salts, and the like. Salts may include cations based on the alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium,Attorney Ref.01355-0007-00PCT quaternary ammonium, and amine cations including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. (See S.M. Barge et al., J. Pharm. Sci. (1977) 66, 1; and Remington: The Science and Practice of Pharmacy, 23d Edition, Adejare et al. eds., Academic Press (2020); which are incorporated herein by reference in their entireties.)

[0103] As used herein, the term “cap analog” means a structural derivative of the natural RNA cap. The term “cap” refers to trinucleotide, tetranucleotide or longer structures that facilitate / improve translation and / or prevents degradation of the mRNA transcript (the oligonucleotide) when incorporated at the 5’ end of the mRNA transcript (oligonucleotide). A "natural 5'-cap" refers to a cap structure found on the 5'-end of an mRNA molecule and generally consists of a guanosine 5'-triphosphate (Gppp) which is connected via its triphosphate moiety to the 5'-end of the next nucleotide of the mRNA (i.e., the guanosine is connected via a 5' to 5' triphosphate linkage to the rest of the mRNA). The guanosine may be methylated at position N7(resulting in the cap structure m7Gppp).

[0104] As used herein, the terms “capped RNA molecule” or “capped oligonucleotide” mean an RNA molecule or an oligonucleotide with a cap structure on the 5’-end. The cap structure can be a “natural 5’-cap” or a “cap analog” as described herein.

[0105] As used herein, the terms “uncapped RNA molecule” or “uncapped oligonucleotide” mean an RNA molecule or oligonucleotide without the cap structure on the 5’-end. An RNA molecule or oligonucleotide that has triphosphate at the 5’-end.

[0106] As used herein, the term “complement,” “complementary,” or “complementarity” refers to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are, generally, A and T (or A and U), and G and C. Complementarity, for example, between a capped oligonucleotide primer and a single stranded DNA template or one strand of dsDNA template, may be “complete” or "total" where all of the nucleotide bases of two nucleic acid strands are matched according to recognized base pairing rules, it may be “partial” in which only some of the nucleotide bases of an initiating capped oligonucleotide primer and a DNA template are matched according to recognized base pairing rules, or it may be “absent” where none of the nucleotide bases of two nucleic acid strands are matched according to recognized base pairing rules. Complementarity can also be “substantial complementarity” where the nucleotide bases of two nucleic acids are matched according to recognized base pairing rules, but include one or more mismatches (e.g., 1, 2, 3, 4) from total complementarity.

[0107] As used herein, a “deoxyribonuclease (DNase)” is an enzyme that catalyzes theAttorney Ref.01355-0007-00PCT hydrolytic cleavage of phosphodiester linkages in the DNA backbone, thus degrading DNA.

[0108] As used herein, the term “hybridize” or “specifically hybridize” refers to a process where initiating trinucleotide primer anneals to a DNA template under appropriately stringent conditions during a transcription reaction. Hybridizations to DNA are conducted with an initiating capped oligonucleotide primer which, in certain embodiments, is 3-10 nucleotides in length including the 5’-5’ inverted cap structure. Nucleic acid hybridization techniques are well known in the art (e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.(1989); Ausubel, F.M., et al., Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. (1994)).

[0109] “Inorganic pyrophosphatase” refers to an enzyme that catalyzes the conversion of one ion of pyrophosphate to two phosphate ions, thus inhibiting aggregation and in some instances preventing interaction of pyrophosphate with magnesium ions during T7 transcription reactions.

[0110] As used herein, the term “internucleotide linkage” refers to the bond or bonds that connect two nucleosides of an oligonucleotide or nucleic acid and may be a natural phosphodiester linkage or modified linkage.

[0111] As used herein, the term “in vitro” refers to a process that takes place outside a living organism (e.g., a multi-cellular organism, such as a human or a non-human animal), for example, in a test tube, culture dish, or elsewhere outside a living organism.

[0112] As used herein, the term “in vivo” refers to events that occur within a living organism.

[0113] As used herein the term “in vivo assays” refer to methods used to detect and / or measure capacity of one or more of the compounds or molecules including the compounds (e.g., oligonucleotides in, for example, a therapeutic dose) to increase or decrease a property relative to a control (e.g., biomarker levels). Optionally, in vivo assays as described herein can be used to determine a subject’s tolerability levels to a given compound or molecule. Exemplary measurements for assessing tolerability include one or more of body weight, organ weight, aspartate aminotransferase (AST) levels, alanine transaminase (ALT) levels, C-reactive protein (CRP) levels, procalcitonin (PCT) levels, interleukin-6 (IL-6) levels, erythrocyte sedimentation rate (ESR), serum amyloid A levels, and serum ferritin levels.

[0114] As used herein, “locked nucleic acid” (LNA) means at least one ribonucleotide having a bridge between the 2’O and 4’C methylene bicyclonucleotide monomers. An LNA moiety can have the following structure:Attorney Ref.01355-0007-00PCT

[0115] As used herein, “messenger RNA transcript,” or “mRNA transcript,” is a transcript transcribed from a DNA template encoding a desired polypeptide. The mRNA transcript may contain coding and non-coding regions. For example, the DNA template can comprise an RNA polymerase promoter sequence, a 5’ UTR sequence, an open reading frame, and a 3’ UTR sequence. In some examples, the DNA template also comprises a nucleic acid sequence encoding a poly(A) tail.

[0116] As used herein, the term “nucleoside” refers to a nucleobase linked to a 5 or 6- carbon sugar (e.g., ribose, deoxyribose, morpholino). The term includes all nucleosides, including all forms of nucleobases and suitable sugar moieties, such as for example furanoses. The term “natural nucleoside” refers to adenosine, guanosine, cytidine, uridine and thymidine.

[0117] According to Aduri et al (Aduri, R. et al., AMBER force field parameters for the naturally occurring modified nucleotides in RNA. Journal of Chemical Theory and Computation. 2006.3(4):1464-75) there are 107 naturally occurring nucleosides, including 1-methyladenosine, 2- methylthio-N6-hydroxynorvalyl carbamoyladenosine, 2-methyladenosine, 2-O-ribosylphosphate adenosine, N6-methyl-N6-threonylcarbamoyladenosine, N6-acetyladenosine, N6- glycinylcarbamoyladenosine, N6-isopentenyladenosine, N6-methyladenosine, N6- threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxynorvalylcarbamoyladenosine, 1,2-O-dimethyladenosine, N6,2-O-dimethyladenosine, 2- O-methyladenosine, N6,N6,O-2-trimethyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6-isopentenyladenosine, 2- methylthio-N6-threonyl carbamoyladenosine, 2-thiocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, lysidine, N4- acetyl-2-O-methylcytidine, 5-formyl-2-O-methylcytidine, 5,2-O-dimethylcytidine, 2-O- methylcytidine, N4,2-O-dimethylcytidine, N4,N4,2-O-trimethylcytidine, 1-methylguanosine, N2,7- dimethylguanosine, N2-methylguanosine, 2-O-ribosylphosphate guanosine, 7-methylguanosine, under modified hydroxywybutosine, 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, N2,N2-dimethylguanosine, 4-demethylwyosine, epoxyqueuosine, hydroxywybutosine, isowyosine, N2,7,2-O-trimethylguanosine, N2,2-O-dimethylguanosine, 1,2-O-dimethylguanosine, 2-O- methylguanosine, N2,N2,2-O-trimethylguanosine, N2,N2,7-trimethylguanosine,Attorney Ref.01355-0007-00PCT peroxywybutosine, galactosyl-queuosine, mannosyl-queuosine, queuosine, archaeosine, wybutosine, methylwyosine, wyosine, 2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine, 3- methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5-methylaminomethyluridine, 5- carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5-hydroxyuridine, 5-methyluridine, 5-taurinomethyluridine, 5-carbamoylmethyluridine, 5-(carboxyhydroxymethyl)uridine methyl ester, dihydrouridine, 5-methyldihydrouridine, 5-methylaminomethyl-2-thiouridine, 5- (carboxyhydroxymethyl)uridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)- 2-thiouridine, 3,2-O-dimethyluridine, 5-carboxymethylaminomethyl-2-O-methyluridine, 5- carbamoylmethyl-2-O-methyluridine, 5-methoxycarbonylmethyl-2-O-methyluridine, 5- (isopentenylaminomethyl)-2-O-methyluridine, 5,2-O-dimethyluridine, 2-O-methyluridine, 2-thio- 2-O-methyluridine, uridine 5-oxyacetic acid, 5-methoxycarbonylmethyluridine, uridine 5-oxyacetic acid methyl ester, 5-methoxyuridine, 5-aminomethyl-2-thiouridine, 5-carboxymethylaminomethyl- 2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-methoxycarbonylmethyl-2-thiouridine, 5- taurinomethyl-2-thiouridine, pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 1-methylpseudouridine, 3-methylpseudouridine, 2-O-methylpseudouridine, inosine, 1- methylinosine, 1,2-O-dimethylinosine and 2-O-methylinosine. Each of these or the modified nucleobase thereof may be components of nucleic acids of the present invention.

[0118] All other nucleosides (not including the ones described above as natural nucleosides or modified natural nucleosides) are unnatural nucleosides.

[0119] As used herein, the term “nucleoside base” refers to a nucleobase, such as a nitrogenous base or unnatural base. A “natural nucleoside base” includes purine and pyrimidine rings. Purine rings include, for example, adenine and guanine. Pyrimidine rings include, for example, cytosine, thymine, and uracil.

[0120] As used herein, the term “modified nucleoside base” describes natural modified nucleoside bases, including but is not limited to, for example, pseudouracil, 5-methylcytosine, N6- methyladenine, hypoxanthine, 5-hydroxymethylcytosine, 5-carboxylcytosine, N4-acetylcytosine, N4-methylcytosine, N1-methyladenine, N2, N2-dimethylguanine and the like. Also, see naturally occurring modified nucleosides above.

[0121] As used herein, the term “unnatural nucleoside base” refers to all nucleoside bases that are not natural (whether modified or not; see naturally occurring modified nucleosides above) including but is not limited to, for example, N1-methylpseudouracil, 7-deazaadenine, 2- aminoadenine, 5-methylisocytosine, 5-fluorouracil, 5-bromouracil, 5-iodouracil, 2- methylthioadenine, 2-thio-5-methyluracil, 2-amino-6-methylthiopurine and the like. NaturalAttorney Ref.01355-0007-00PCT nucleosides are described above.

[0122] As used herein, the terms “nucleoside analogs,” “modified nucleosides,” or “nucleoside derivatives” include synthetic nucleosides as described herein. Nucleoside derivatives also include nucleosides having modified base or / and sugar moieties, with or without protecting groups and include, for example, 2’-deoxy-2’-fluorouridine, 5-fluorouridine and the like. The compounds and methods provided herein include such base rings and synthetic analogs thereof, as well as unnatural heterocycle-substituted base sugars, and acyclic substituted base sugars. Other nucleoside derivatives that may be utilized with the present disclosure include, for example, LNA nucleosides, halogen-substituted purines (e.g., 6-fluoropurine), halogen-substituted pyrimidines, N6-ethyladenine, N4-(alkyl)-cytosines, 5-ethylcytosine, and the like (U.S. Patent No.6,762,298).

[0123] As used herein, the term “nucleoside triphosphate,” “nucleoside 5’ triphosphate” or “NTP” refers to a nucleoside linked to three phosphate groups. The term encompasses natural NTPs (for example, adenosine triphosphate (ATP), uridine triphosphate (UTP), guanine triphosphate (GTP), and cytosine triphosphate (CTP)) as well as modified NTPs.

[0124] As used herein, the term “modified NTP” refers to a nucleoside 5’-triphosphate having a chemical moiety group bound at any position or substituted at any position, including the sugar, base, triphosphate chain, or any combination of these three locations. Optionally, the chemical moiety group may be a group of any nature compatible with the process of transcription. Examples of such NTPs include inosine triphosphate, dihydrouridine triphosphate, 2’-fluoro-2’- deoxycytidine triphosphate, pseudouridine triphosphate, N1-methylpseudouridine triphosphate, and 5-methyluridine triphosphate, and can be found, for example in “Nucleoside Triphosphates and Their Analogs: Chemistry, Biotechnology and Biological Applications,” Vaghefi, M., ed., Taylor and Francis, Boca Raton (2005).

[0125] As used herein, the term “modified oligonucleotide” or “modified trinucleotide” includes, for example, an oligonucleotide containing a modified nucleoside, a modified internucleotide linkage, or having any combination of modified nucleosides and internucleotide linkages. Non-limiting examples of internucleotide linkage modifications include, but are not limited to, phosphorothioate, phosphotriester and methylphosphonate derivatives (Stec, W.J., et al., Chem. Int. Ed. Engl., 33:709-722 (1994); Lebedev, A.V., et al., E., Perspect. Drug Discov. Des., 4:17-40 (1996); and Zon, et al., U.S. Patent Application No.20070281308). Other examples of internucleotide linkage modifications may be found in Waldner, et al., Bioorg. Med. Chem. Letters 6:2363-2366 (1996).

[0126] As used herein, “phosphorothioate linkage” refers to a linkage between nucleosidesAttorney Ref.01355-0007-00PCT in which the phosphorodiester linkage is modified by replacing one of the oxygen atoms, connected to a phosphorus atom, with a sulfur atom.

[0127] As used herein, “oligo dT purification” is an affinity chromatography method for purification of mRNA comprising or including a poly-A tail.

[0128] A “primary RNA” or “primary RNA transcript” means the RNA molecule that is newly synthesized by an RNA polymerase in vitro and which RNA molecule has a triphosphate on the 5′-end.

[0129] As used herein, the term “prematurely aborted RNA transcript” refers to incomplete products of an in vitro transcription reaction. Prematurely aborted RNA sequences may be any length that is less than the intended length of the desired transcriptional product. These RNA sequences are also referred to as truncated RNAs.

[0130] The term “promoter” as used herein refers to a nucleotide sequence in a DNA template that directs and controls the initiation of transcription of a particular DNA sequence. Promoters are typically immediately adjacent to (or partially overlap with) the DNA sequence to be transcribed. Promoter sequences are typically located directly upstream or at the 5' end of the transcription initiation site. Nucleotide positions in the promoter are designated relative to the transcriptional start site, where transcription of DNA begins (position +1).

[0131] As used herein, the term “purified” or “purify” refers to separating a substance from at least some of the components (e.g., impurities or contaminants) with which it was associated when initially produced. For example, RNA transcripts are purified by removal of contaminating proteins or other undesired nucleic acid species (e.g., double-stranded RNA, DNA, and / or incomplete or aborted RNA transcripts). Purified substances (e.g., capped mRNA transcripts) can be separated from 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more than 99% of the other components with which they were initially associated.

[0132] As used herein, the term “impurities” refers to substances which differ from the chemical composition of the target material (e.g., mRNA transcripts). Impurities are also referred to as contaminants.

[0133] As used herein, the term “substantially free” refers to a state in which relatively little or no amount of an undesired substance (e.g., prematurely aborted RNA sequences, DNA, and / or double-stranded RNA) is present in a sample. “Substantially free of impurities” means impurities are present at a level less than approximately 5%, 4%, 3%, 2%, 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less (w / w) in a sample. For example, “substantially free ofAttorney Ref.01355-0007-00PCT double-stranded RNA” means double-stranded RNA is present at a level less than approximately 5%, 4%, 3%, 2%, 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less (w / w) in a sample.

[0134] As used herein, the term “RNase inhibitor” or “ribonuclease inhibitor” refers to a protein that inhibits RNAse activity for example, during an in vitro transcription reaction.

[0135] As used herein, the term “RNA polymerase” refers to an enzyme that synthesizes RNA using a DNA template. For in vitro transcription methods, single subunit phage RNA polymerases derived from T7, T3, SP6, K1-5, K1E, K1F or K11 bacteriophages, or variants thereof, are typically used. This family of polymerases has simple, minimal promoter sequences of about 17 nucleotides which require no accessory proteins and have minimal constraints of the initiating nucleotide sequence.

[0136] As used herein, “self-amplifying RNA,” or “saRNA,” is a linear, single-stranded RNA molecule that encodes a gene of interest. saRNA is a type of mRNA, but also includes non- structural proteins that encode a viral replicase. The viral replicase enables the RNA to self- replicate once delivered into the cell. Viral replicases include engineered and otherwise modified (e.g., mutated) viral replicases that can catalyze self-replication of an RNA.

[0137] As used herein, the term “specific” when used in reference to an initiating trinucleotide primer sequence and its ability to hybridize to a DNA template is a sequence that has at least 50% sequence identity with a portion of the DNA template when the initiating trinucleotide primer and DNA strand are aligned. Higher levels of sequence identity include at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, and optionally 100% sequence identity.

[0138] As used herein, “tangential flow filtration (TFF)” is a type of filtration wherein the material to be filtered is passed tangentially across a filter rather than through it. In TFF, undesired permeate passes through the filter, while the desired retentate passes along the filter and is collected downstream. In TFF, the desired material is typically contained in the retentate, which is the opposite of what is encountered when performing traditional membrane or dead-end filtration.

[0139] As used herein, the term “transcription” refers to enzymatically making or synthesizing RNA that is complementary to a noncoding strand of the DNA template, thereby producing a number of RNA copies of a DNA sequence. The RNA molecule synthesized in a transcription reaction is an “RNA transcript,” “primary transcript,” or “transcript.” Transcription reactions involving the compositions and methods provided herein employ initiating capped oligonucleotide primers described herein. Transcription of a DNA template may be exponential,Attorney Ref.01355-0007-00PCT nonlinear or linear. A DNA template may be a double-stranded linear DNA, a partially double- stranded linear DNA, circular double-stranded DNA, DNA plasmid, PCR amplified product, or a modified nucleic acid template that is compatible with RNA polymerase.

[0140] As used herein, the terms “universal base,” “degenerate base,” “universal base analog” and “degenerate base analog” include, for example, a nucleoside analog with an artificial base which is, in certain embodiments, recognizable by RNA polymerase as a substitute for one of the natural NTPs (e.g., ATP, UTP, CTP and GTP) or other specific NTP. Universal bases or degenerate bases are disclosed in Loakes, D., Nucleic Acids Res., 29:2437-2447 (2001); Crey- Desbiolles, C., et. al., Nucleic Acids Res., 33:1532–1543 (2005); Kincaid, K., et. al., Nucleic Acids Res., 33:2620-2628 (2005); Preparata, FP, Oliver, JS, J. Comput. Biol.753-765 (2004); and Hill, F., et. al., Proc Natl Acad. Sci. U S A, 95:4258-4263 (1998)).

[0141] As used herein, the term “unsubstituted” or “unmodified” in the context of the initiating capped oligonucleotide primer and NTPs refers to an initiating capped oligonucleotide primer and NTPs that have not been modified.

[0142] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed. Thus, in a compound containing 2 parts by weight of component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound.

[0143] A weight percent (wt. %) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.

[0144] As used herein, the term “subject” or “patient” can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. In one aspect, the subject is a mammal. A patient refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects.

[0145] The term "immunization" or "vaccination" describes the process of treating a subject with an immunogenic or antigen-binding substance for therapeutic or prophylactic reasons.

[0146] The terms "effective amount", “therapeutically effective amount” or “effectiveAttorney Ref.01355-0007-00PCT dose” or related terms may be used interchangeably and refer to an amount of the therapeutic agent that when administered to a subject, is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects. Therapeutically effective amounts of the therapeutic agents provided herein, will vary depending upon the relative activity of the therapeutic agent, and depending upon the subject and disease condition being treated, the weight and age and sex of the subject, the severity of the disease condition in the subject, the manner of administration, drugs used in combination or coincidental with the specific compound employed and the like, which can readily be determined by one of ordinary skill in the art. In one embodiment, a therapeutically effective amount will depend on certain aspects of the subject to be treated and the disorder to be treated and may be ascertained by one skilled in the art using known techniques. In addition, as is known in the art, adjustments for age as well as the body weight, general health, sex, diet, time of administration, drug interaction, and the severity of the disease may be necessary. For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease or condition.

[0147] As used herein, “dosage form” means a pharmacologically active material in a medium, carrier, vehicle, or device suitable for administration to a subject. A dosage forms can comprise inventive a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, in combination with a pharmaceutically acceptable excipient, such as a preservative, buffer, saline, or phosphate buffered saline. Dosage forms can be made using conventional pharmaceutical manufacturing and compounding techniques. Dosage forms can comprise inorganic or organic buffers (e.g., sodium or potassium salts of phosphate, carbonate, acetate, or citrate) and pH adjustment agents (e.g., hydrochloric acid, sodium or potassium hydroxide, salts of citrate or acetate, amino acids and their salts) antioxidants (e.g., ascorbic acid, alpha- tocopherol), surfactants (e.g., polysorbate 20, polysorbate 80, polyoxyethylene9-10 nonyl phenol,Attorney Ref.01355-0007-00PCT sodium deoxycholate), solution and / or cryo / lyo stabilizers (e.g., sucrose, lactose, mannitol, trehalose), osmotic adjustment agents (e.g., salts or sugars), antibacterial agents (e.g., benzoic acid, phenol, gentamicin), antifoaming agents (e.g., polydimethylsilozone), preservatives (e.g., thimerosal, 2-phenoxyethanol, EDTA), polymeric stabilizers and viscosity-adjustment agents (e.g., polyvinylpyrrolidone, poloxamer 488, carboxymethylcellulose) and co-solvents (e.g., glycerol, polyethylene glycol, ethanol). A dosage form formulated for injectable use can have a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, suspended in sterile saline solution for injection together with a preservative.

[0148] As used herein, “kit” means a collection of at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose. Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation.

[0149] The term “administering”, “administered” and grammatical variants refers to the physical introduction of a therapeutic agent to a subject, using any of the various methods and delivery systems known to those skilled in the art. Exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, for example by injection or infusion. The phrase “parenteral administration” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation. In one embodiment, the formulation is administered via a non-parenteral route, e.g., orally. Other non-parenteral routes include a topical, epidermal or mucosal route of administration, for example, intranasally, vaginally, rectally, sublingually or topically. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods. Administration can be continuous or intermittent. In various aspects, a preparation can be administered therapeutically; that is, administered to treat an existing disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.Attorney Ref.01355-0007-00PCT

[0150] “Treating” is to be understood broadly and encompasses any beneficial effect, including, e.g., delaying, slowing, or arresting the worsening of symptoms associated with a viral disease or remedying such symptoms, at least in part. The term is intended to include the cure or elimination of the disease, disorder or condition. In various aspects, the term covers any treatment of a subject, including a mammal (e.g., a human), and includes: (i) preventing the disease from occurring in a subject that can be predisposed to the disease but has not yet been diagnosed as having it; (ii) inhibiting the disease, i.e., arresting its development; or (iii) relieving the disease, i.e., causing regression of the disease. In one aspect, the subject is a mammal such as a primate, and, in a further aspect, the subject is a human.

[0151] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.

[0152] As used herein, the term “therapeutic agent” includes any synthetic or naturally occurring biologically active compound or composition of matter which, when administered to an organism (human or nonhuman animal), induces a desired pharmacologic, immunogenic, and / or physiologic effect by local and / or systemic action. The term therefore encompasses those compounds or chemicals traditionally regarded as drugs, vaccines, and biopharmaceuticals including molecules such as proteins, peptides, hormones, nucleic acids, gene constructs and the like. Examples of therapeutic agents are described in well-known literature references such as the Merck Index (14thedition), the Physicians' Desk Reference (64thedition), and The Pharmacological Basis of Therapeutics (12thedition), and they include, without limitation, medicaments; vitamins; mineral supplements; substances used for the treatment, prevention, diagnosis, cure or mitigation of a disease or illness; substances that affect the structure or function of the body, or pro-drugs, which become biologically active or more active after they have been placed in a physiological environment. For example, the term “therapeutic agent” includes compounds or compositions for use in all of the major therapeutic areas including, but not limited to, adjuvants; anti-infectives such as antibiotics and antiviral agents; analgesics and analgesic combinations, anorexics, anti- inflammatory agents, anti-epileptics, local and general anesthetics, hypnotics, sedatives, antipsychotic agents, neuroleptic agents, antidepressants, anxiolytics, antagonists, neuron blocking agents, anticholinergic and cholinomimetic agents, antimuscarinic and muscarinic agents, antiadrenergics, antiarrhythmics, antihypertensive agents, hormones, and nutrients, antiarthritics, antiasthmatic agents, anticonvulsants, antihistamines, antinauseants, antineoplastics, antipruritics,Attorney Ref.01355-0007-00PCT antipyretics; antispasmodics, cardiovascular preparations (including calcium channel blockers, beta-blockers, beta-agonists and antiarrythmics), antihypertensives, diuretics, vasodilators; central nervous system stimulants; cough and cold preparations; decongestants; diagnostics; hormones; bone growth stimulants and bone resorption inhibitors; immunosuppressives; muscle relaxants; psychostimulants; sedatives; tranquilizers; proteins, peptides, and fragments thereof (whether naturally occurring, chemically synthesized or recombinantly produced); and nucleic acid molecules (polymeric forms of two or more nucleotides, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) including both double- and single-stranded molecules, gene constructs, expression vectors, antisense molecules and the like), small molecules (e.g., doxorubicin) and other biologically active macromolecules such as, for example, proteins and enzymes. The agent may be a biologically active agent used in medical, including veterinary, applications and in agriculture, such as with plants, as well as other areas. The term "therapeutic agent" also includes without limitation, medicaments; vitamins; mineral supplements; substances used for the treatment, prevention, diagnosis, cure or mitigation of disease or illness; or substances which affect the structure or function of the body; or pro- drugs, which become biologically active or more active after they have been placed in a predetermined physiological environment.

[0153] As used herein, the term “derivative” refers to a compound having a structure derived from the structure of a parent compound (e.g., a compound disclosed herein) and whose structure is sufficiently similar to those disclosed herein and based upon that similarity, would be expected by one skilled in the art to exhibit the same or similar activities and utilities as the claimed compounds, or to induce, as a precursor, the same or similar activities and utilities as the claimed compounds. Exemplary derivatives include salts, esters, amides, salts of esters or amides, and N-oxides of a parent compound.

[0154] “Analog,” or “analogue” is used in accordance with its plain ordinary meaning within Chemistry and Biology and refers to a chemical compound that is structurally similar to another compound (i.e., a so-called “reference” compound) but differs in composition, e.g., in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or the replacement of one functional group by another functional group, or the absolute stereochemistry of one or more chiral centers of the reference compound. Accordingly, an analog is a compound that is similar or comparable in function and appearance but not in structure or origin to a reference compound.

[0155] “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” refer to a substance that aids the administration of an active agent to and absorption by a subjectAttorney Ref.01355-0007-00PCT and can be included in the compositions of the present disclosure without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer’s, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and / or aromatic substances and the like that do not deleteriously react with the compounds of the disclosure. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present disclosure.

[0156] The term a “sub-therapeutic amount” of an agent or therapy is an amount less than the effective amount for that agent or therapy as a single agent, but when combined with an effective or sub-therapeutic amount of another agent or therapy can produce a result desired by the physician, due to, for example, synergy in the resulting efficacious effects, or reduced side effects.

[0157] Combination therapy or “in combination with” refer to the use of more than one therapeutic agent to treat a particular disorder or condition. By “in combination with,” it is not intended to imply that the therapeutic agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope of this disclosure. A therapeutic agent can be administered concurrently with, prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 12 weeks, or 16 weeks before), or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 12 weeks, or 16 weeks after), one or more other additional agents. The therapeutic agents in a combination therapy can also be administered on an alternating dosing schedule, with or without a resting period (e.g., no therapeutic agent is administered on certain days of the schedule). The administration of a therapeutic agent “in combination with” another therapeutic agent includes, but is not limited to, sequential administration and concomitant administration of the two agents. In general, each therapeutic agent is administered at a dose and / or on a time schedule determined for that particular agent.

[0158] In this disclosure, “comprises,” “comprising,” “containing” and “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “ includes,”Attorney Ref.01355-0007-00PCT “including,” and the like. “Consisting essentially of or “consists essentially” likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

[0159] As used herein, the terms “removable purification handle” or “cleavable purification handle” may be used interchangeably and refer to a chemical group which is covalently linked to the 5’-capped oligonucleotide or mRNA. The removable purification handle allows for HPLC separation of 5’-capped oligonucleotides comprising a covalently linked removable purification handle, from uncapped oligonucleotides and other prematurely aborted oligonucleotides. Typically, removable purification handles are hydrophobic groups. The removable purification handle may be, for example, substituted or unsubstituted saturated alkyl groups C3-C20 or longer (including for example, modified trityls), cycloalkyl rings, aryl rings, silyls, modified and unmodified Fmoc compounds and the like, which can be chemically or thermally removed from the 5’-capped oligonucleotide using mild conditions. In embodiments, such chemical group(s) can be removed under mild acidic conditions, with pH no lower than about 5 (at room temperature for 1 hour). In embodiments, such chemical group(s) can be removed under mild basic conditions, with a pH no higher than about 9 (at room temperature for 1 hour). In embodiments, such chemical group(s) can be removed by mild heating, at no higher than about 65oC for 1 hour. In embodiments, such chemical group(s) can be removed by reductive amination. In embodiments, such chemical group(s) can be removed by desilylation. In embodiments, such chemical group(s) can be removed by oxidation. In embodiments, such chemical group(s) can be removed by photolysis. In embodiments, these terms exclude photocleavable (photolabile) groups. In embodiments, a purification handle is considered “cleavable” or “removable” if it can be removed under conditions wherein 5’-capped oligonucleotide is not damaged. In embodiments, a purification handle is considered “cleavable” or “removable” if it can be removed under conditions wherein 5’-capped RNA is not denatured. In embodiments, once these purification handle(s) are removed, highly pure and readily translatable 5’-capped oligonucleotide is generated.

[0160] Some non-limiting examples of silyls include, but are not limited to:Attorney Ref.01355-0007-00PCT.

[0161] Some non-limiting examples of modified trityls include, but are not limited to: OMe ..

[0162] As used herein, the terms “photocleavable group” or “photolabile group” may be used interchangeably and refer to chemical groups such as for example nitrobenzyls, nitrobenzyl derivatives, phenacyls, benzyls, and the like, which can be removed by irradiation with light of certain frequency.Attorney Ref.01355-0007-00PCT Compounds and Oligonucleotides

[0163] Described herein are novel cap analogs and compositions, and methods of using the same. Also described herein are oligonucleotides comprising a 5’-cap, wherein the 5’-cap includes a cap analog as described herein and wherein said 5’-cap allows for purification of said oligonucleotides, enabling the separation of capped oligonucleotides from uncapped or truncated oligonucleotides using HPLC. In embodiments, the cap analogs are trinucleotide cap analogs. Methods of inducing a therapeutic effect in a subject are also described herein, the methods including a step of administering to the subject a cap analog or oligonucleotide including the cap analog.

[0164] In an aspect, provided herein is a compound of formula (I):, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein: each B1and B2is independently a natural, modified, or unnatural nucleoside base; Ring A is a substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; each Q is independently a bond, -O-, -C(R6R8)-, -S-, or -N(R9)-; each X1is independently -O-, -CH2-, -CX2-, -CHX-, -N(R101)-, -BH-, or -S-; each Y1is independently O, S, or Se; each Z1is independently -OH, -SH, -BH3, substituted or unsubstituted -O-alkyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, or substituted or unsubstituted -O-aryl;Attorney Ref.01355-0007-00PCT R1is hydrogen, –C(O)R1A, –C(O)OR1A, –OR1A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; R2is hydrogen, –C(O)R2A, –C(O)OR2A, –OR2A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R1and R2together with the nitrogen atom to which they are connected form a substituted or unsubstituted heteroaryl or a substituted or unsubstituted heterocyclyl; R3is hydrogen, –C(O)R3A, –C(O)OR3A, –OR3A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R4is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR4A, -NR4AR4B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R5is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR5A, -NR5AR5B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or an R4and R5attached to the same ring, together with the carbon atoms to which they are connected form a substituted or unsubstituted cycloalkylene or substituted or unsubstituted heterocycloalkylene;Attorney Ref.01355-0007-00PCT each R1A, R2A, R3A, R4A, R4B, R5A, and R5Bare independently hydrogen, -CX3, -CHX2, -CH2X, -C(O)OH, -C(O)NH2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)OH, -NHOH, -OCX3, -OCHX2, -OCH2X, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R4Aand R4Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; R5Aand R5Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; each R6, R8, R9, and R101are independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OH, -NH2,-COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2,-OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; n is an integer from 0 to 3; m is an integer from 0 to 8; and X is -Cl, -Br, -I or –F.

[0165] In an aspect, provided herein is an oligonucleotide of formula (Ib):,Attorney Ref.01355-0007-00PCT or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein: oligonucleotide is one or more nucleotides; each B1and B2is independently a natural, modified, or unnatural nucleoside base; Ring A is a substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; each Q is independently a bond, -O-, -C(R6R8)-, -S-, or -N(R9)-; each X1is independently -O-, -CH2-, -CX2-, -CHX-, -N(R101)-, -BH-, or -S-; each Y1is independently O, S, or Se; each Z1is independently -OH, -SH, -BH3, substituted or unsubstituted -O-alkyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, or substituted or unsubstituted -O-aryl; R1is hydrogen, –C(O)R1A, –C(O)OR1A, –OR1A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; R2is hydrogen, –C(O)R2A, –C(O)OR2A, –OR2A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R1and R2together with the nitrogen atom to which they are connected form a substituted or unsubstituted heteroaryl or a substituted or unsubstituted heterocyclyl; R3is hydrogen, –C(O)R3A, –C(O)OR3A, –OR3A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R4is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR4A, -NR4AR4B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstitutedAttorney Ref.01355-0007-00PCT cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R5is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR5A, -NR5AR5B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or an R4and R5attached to the same ring, together with the carbon atoms to which they are connected form a substituted or unsubstituted cycloalkylene or substituted or unsubstituted heterocycloalkylene; each R1A, R2A, R3A, R4A, R4B, R5A, and R5Bare independently hydrogen, -CX3, -CHX2, -CH2X, -C(O)OH, -C(O)NH2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)OH, -NHOH, -OCX3, -OCHX2, -OCH2X, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R4Aand R4Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; R5Aand R5Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; each R6, R8, R9, and R101are independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OH, -NH2,-COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2,-OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; n is an integer from 0 to 3; m is an integer from 0 to 8; andAttorney Ref.01355-0007-00PCT X is -Cl, -Br, -I or –F.

[0166] In embodiments, R1is hydrogen, silyl, –C(O)OR1A, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., substituted with at least one substituent group, size- limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10aryl, C10 aryl, or phenyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0167] In embodiments, a substituted R1(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is independently substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R1is independently substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R1is independently substituted, it is substituted with at least one substituent group. In embodiments, when R1is independently substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R1is independently substituted, it is substituted with at least one lower substituent group.

[0168] In embodiments,R1is a 9-fluorenylmethoxycarbonyl (Fmoc) group or a substitutedFmoc group. Examples of substituted Fmoc groups include, but are not limited to, 2,7-di-tert- butyl-Fmoc, 2-fluro-Fmoc, and 2-monoisooctyl-Fmoc.

[0169] In embodiments, R1is an acyl. In one such embodiment, the acyl has the formula , wherein Ar is a substituted or unsubstituted aromatic moiety and s is an integer from 0Attorney Ref.01355-0007-00PCT to 5. In embodiments, the acyl has the formula. Particular acyls include, but are not In em 1bodiments, R is 2-(4-nitrophenylsulfonyl)ethoxycarbonyl (Nsc), 1,1-dioxobenzo[b]thiophene-2-ylmethoxycarbonyl (Bsmoc), (1,1,dioxonaphtho[1,2-b]thiophene-2-yl)methylcarbonyl (α-Nsmoc), 1-(4,4-dimethyl-2,6- dioxocyclohex-1-ylidene)-e-methylbutyl (ivDde), 2-phenyl(methyl)sulfonio)ethoxycarbonyl tetrafluoroborate (Pms), wthanesulfonylethoxycarbonyl (Esc) 9-fluorenylmethyl (Fm), 4-(N-[1- (4,4-dimethyl-2,6-dioxocyclohexylidene)-3-methylbutyl]-amino)benzyl (Dmab) or 2-(4- sulfophenylsulfonyl)ethoxycarbonyl (Sps).

[0170] In embodiments, R1is hydrogen, silyl, –C(O)OR1A, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted aryl.

[0171] In embodiments, R1is hydrogen, silyl, –C(O)OR1A, substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl).

[0172] In embodiments, R1is hydrogen, silyl, substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), –C(O)OH, or –C(O)OR1Awherein R1Ais a substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl).

[0173] In embodiments, R1is hydrogen, silyl, –C(O)OR1A, or substituted or unsubstituted alkyl. In embodiments, R1is hydrogen, silyl, or substituted or unsubstituted alkyl. In embodiments, R1is hydrogen or substituted or unsubstituted alkyl.Attorney Ref.01355-0007-00PCT

[0174] In embodiments, R1is hydrogen or substituted (e.g., with a substituent group, a size- limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1- C6alkyl, or C1-C4alkyl). In embodiments, R1is hydrogen. In embodiments, R1is unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, R1is independently substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl).

[0175] In embodiments, R1is hydrogen, silyl, or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6alkyl, or C1-C4alkyl).

[0176] In embodiments, silyl may be for example:.

[0177] In embodiments, R1is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t- butyl, benzyl, t-butyldimethyl silyl (TBDMS), t-butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’- isopropylmethylmethoxytrityl, or 4, 4’, 4’’-dimethylmethoxytrityl.

[0178] In embodiments, a modified trityl may be for example:Attorney Ref.01355-0007-00PCT OMe ..

[0179] In embodiments, R1is hydrogen or 4, 4’, 4’’-dimethylmethoxytrityl.

[0180] In embodiments, R1is hydrogen. In embodiments, R1is methyl. In embodiments, R1is ethyl. In embodiments, R1is propyl. In embodiments, R1is isopropyl. In embodiments, R1is butyl. In embodiments, R1is isobutyl. In embodiments, R1is t-butyl. In embodiments, R1is benzyl. In embodiments, R1is t-butyldimethyl silyl (TBDMS). In embodiments, R1is t-butyldiphenyl silyl (TBDPS). In embodiments, R1is trimethoxytrityl (TMT). In embodiments, R1is dimethoxytrityl (DMT). In embodiments, R1is monomethoxytrityl (MMT). In embodiments, R1is modified trityl. In embodiments, R1is 4, 4’, 4’’-isopropylmethylmethoxytrityl. In embodiments, R1is 4, 4’, 4’’-dimethylmethoxytrityl.

[0181] In embodiments, R2is hydrogen, silyl, –C(O)OR2A, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., substituted with at least one substituent group, size- limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), or substituted (e.g., substituted with at least oneAttorney Ref.01355-0007-00PCT substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0182] In embodiments, a substituted R2(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is independently substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R2is independently substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R2is independently substituted, it is substituted with at least one substituent group. In embodiments, when R2is independently substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R2is independently substituted, it is substituted with at least one lower substituent group.

[0183] In embodiments,R2is a 9-fluorenylmethoxycarbonyl (Fmoc) group or a substitutedFmoc group. Examples of substituted Fmoc groups include, but are not limited to, 2,7-di-tert- butyl-Fmoc, 2-fluro-Fmoc, and 2-monoisooctyl-Fmoc.

[0184] In embodiments, R2is an acyl. In one such embodiment, the acyl has the formulaAr is a substituted or unsubstituted aromatic moiety and s is an integer from 0 to 5. In embodiments, the acyl has the formula. Particular acyls include, but are notlimited to In some embodiments, R2is 2-(4-nitrophenylsulfonyl)ethoxycarbonyl (Nsc), 1,1-dioxobenzo[b]thiophene-2- ylmethoxycarbonyl (Bsmoc), (1,1,dioxonaphtho[1,2-b]thiophene-2-yl)methylcarbonyl (α-Nsmoc), 1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)-e-methylbutyl (ivDde), 2-Attorney Ref.01355-0007-00PCT phenyl(methyl)sulfonio)ethoxycarbonyl tetrafluoroborate (Pms), wthanesulfonylethoxycarbonyl (Esc) 9-fluorenylmethyl (Fm), 4-(N-[1-(4,4-dimethyl-2,6-dioxocyclohexylidene)-3-methylbutyl]- amino)benzyl (Dmab) or 2-(4-sulfophenylsulfonyl)ethoxycarbonyl (Sps).

[0185] In embodiments, R2is hydrogen, silyl, –C(O)OR2A, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted aryl.

[0186] In embodiments, R2is hydrogen, silyl, –C(O)OR2A, substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl).

[0187] In embodiments, R2is hydrogen, silyl, substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10aryl, C10aryl, or phenyl), –C(O)OH, or –C(O)OR2Awherein R2Ais a substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl).

[0188] In embodiments, R2is hydrogen, silyl, –C(O)OR2A, or substituted or unsubstituted alkyl. In embodiments, R2is hydrogen, silyl, or substituted or unsubstituted alkyl. In embodiments, R2is hydrogen or substituted or unsubstituted alkyl.

[0189] In embodiments, R2is hydrogen or substituted (e.g., with a substituent group, a size- limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1- C6 alkyl, or C1-C4 alkyl). In embodiments, R2is hydrogen. In embodiments, R2is unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, R2is independently substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl).

[0190] In embodiments, R2is hydrogen, silyl, or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6alkyl, or C1-C4alkyl).Attorney Ref.01355-0007-00PCT

[0191] In embodiments, R2is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t- butyl, benzyl, t-butyldimethyl silyl (TBDMS), t-butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’- isopropylmethylmethoxytrityl, or 4, 4’, 4’’-dimethylmethoxytrityl.

[0192] In embodiments, R2is hydrogen or 4, 4’, 4’’-dimethylmethoxytrityl.

[0193] In embodiments, R2is hydrogen. In embodiments, R2is methyl. In embodiments, R2is ethyl. In embodiments, R2is propyl. In embodiments, R2is isopropyl. In embodiments, R2is butyl. In embodiments, R2is isobutyl. In embodiments, R2is t-butyl. In embodiments, R2is benzyl. In embodiments, R2is t-butyldimethyl silyl (TBDMS). In embodiments, R2is t-butyldiphenyl silyl (TBDPS). In embodiments, R2is trimethoxytrityl (TMT). In embodiments, R2is dimethoxytrityl (DMT). In embodiments, R2is monomethoxytrityl (MMT). In embodiments, R2is modified trityl. In embodiments, R2is 4, 4’, 4’’-isopropylmethylmethoxytrityl. In embodiments, R2is 4, 4’, 4’’-dimethylmethoxytrityl.

[0194] In embodiments, R3is hydrogen, silyl, –C(O)OR3A, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., substituted with at least one substituent group, size- limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10aryl, or phenyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0195] In embodiments, a substituted R3(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R3is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; eachAttorney Ref.01355-0007-00PCT substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R3is substituted, it is substituted with at least one substituent group. In embodiments, when R3is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R3is substituted, it is substituted with at least one lowersubstituent group.

[0196] In embodiments,R3is a 9-fluorenylmethoxycarbonyl (Fmoc) group or a substitutedFmoc group. Examples of substituted Fmoc groups include, but are not limited to, 2,7-di-tert- butyl-Fmoc, 2-fluro-Fmoc, and 2-monoisooctyl-Fmoc.

[0197] In embodiments, R3is an acyl. In one such embodiment, the acyl has the formulaAr is a substituted or unsubstituted aromatic moiety and s is an integer from 0 to 5. In embodiments, the acyl has the formula . Particular acyls include, but are not R3is 2-(4-nitrophenylsulfonyl)ethoxycarbonyl (Nsc), 1,1-dioxobenzo[b]thiophene-2- ylmethoxycarbonyl (Bsmoc), (1,1,dioxonaphtho[1,2-b]thiophene-2-yl)methylcarbonyl (α-Nsmoc), 1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)-e-methylbutyl (ivDde), 2- phenyl(methyl)sulfonio)ethoxycarbonyl tetrafluoroborate (Pms), wthanesulfonylethoxycarbonyl (Esc) 9-fluorenylmethyl (Fm), 4-(N-[1-(4,4-dimethyl-2,6-dioxocyclohexylidene)-3-methylbutyl]- amino)benzyl (Dmab) or 2-(4-sulfophenylsulfonyl)ethoxycarbonyl (Sps).

[0198] In embodiments, R3is hydrogen, silyl, –C(O)OR3A, substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10aryl, C10aryl, or phenyl).

[0199] In embodiments, R3is hydrogen, silyl, –C(O)OR3A, or substituted or unsubstituted alkyl. In embodiments, R3is hydrogen, silyl, or substituted or unsubstituted alkyl. In embodiments, R33is hydrogen or substituted or unsubstituted alkyl.

[0200] In embodiments, R3is hydrogen, silyl, substituted or unsubstituted alkyl, orAttorney Ref.01355-0007-00PCT substituted or unsubstituted aryl. In embodiments, R3is hydrogen, silyl, substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl). In embodiments, R3is hydrogen. In embodiments, R3is silyl. In embodiments, R3is unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl). In embodiments, R3is substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, R3is unsubstituted aryl (e.g., C6-C10aryl, C10aryl, or phenyl). In embodiments, R3is substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) aryl (e.g., C6-C10aryl, C10 aryl, or phenyl).

[0201] In embodiments, R3is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t- butyl, pentyl, isopentyl, hexyl, phenyl, benzyl, 4-chlorobenzyl, t-butyldimethyl silyl (TBDMS), t- butyldiphenyl silyl (TBDPS), dimethoxytrityl (DMT), trimethoxytrityl (TMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’-isopropylmethylmethoxytrityl, or 4, 4’, 4’’- dimethylmethoxytrityl.

[0202] In embodiments, R3is hydrogen. In embodiments, R3is methyl. In embodiments, R3is ethyl. In embodiments, R3is propyl. In embodiments, R3is isopropyl. In embodiments, R3is butyl. In embodiments, R3is isobutyl. In embodiments, R3is t-butyl. In embodiments, R3is pentyl. In embodiments, R3is isopentyl. In embodiments, R3is hexyl. In embodiments, R3is phenyl. In embodiments, R3is benzyl. In embodiments, R3is 4-chlorobenzyl. In embodiments, R3is t- butyldimethyl silyl (TBDMS). In embodiments, R3is t-butyldiphenyl silyl (TBDPS). In embodiments, R3is dimethoxytrityl (DMT). In embodiments, R3is trimethoxytrityl (TMT). In embodiments, R3is monomethoxytrityl (MMT). In embodiments, R3is modified trityl. In embodiments, R3is 4, 4’, 4’’-isopropylmethylmethoxytrityl. In embodiments, R3is 4, 4’, 4’’- dimethylmethoxytrityl.

[0203] In embodiments, each R4is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CHCl2, -CHBr2, -CHF2, -CHI2, -CN, -OR4A, -NR4AR4B, -CONH2, -COOH, -NHC(O)OH, -NO2, -SH, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 memberedAttorney Ref.01355-0007-00PCT heteroalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0204] In embodiments, a substituted R4(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R4is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R4is substituted, it is substituted with at least one substituent group. In embodiments, when R4is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R4is substituted, it is substituted with at least one lowersubstituent group.

[0205] In embodiments, each R4is independently hydrogen.

[0206] In embodiments, each R5is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CHCl2, -CHBr2, -CHF2, -CHI2, -CN, -OR5A, -NR5AR5B, -NO2, -SH, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g.,Attorney Ref.01355-0007-00PCT substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6membered heteroaryl).

[0207] In embodiments, a substituted R5(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R5is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R5is substituted, it is substituted with at least one substituent group. In embodiments, when R5is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R5is substituted, it is substituted with at least one lowersubstituent group.

[0208] In embodiments, each R5is independently hydrogen, halogen, or -OR5A. In embodiments, each R5is independently hydrogen. In embodiments, each R5is independently halogen. In embodiments, each R5is independently -OR5A. In embodiments, each R5is independently chloro. In embodiments, each R5is independently bromo. In embodiments, each R5is independently iodo. In embodiments, each R5is independently fluoro.

[0209] In embodiments, each R5is independently hydroxy, methoxy, ethoxy, propoxy, butoxy, or t-butoxy. In embodiments, each R5is independently hydroxy. In embodiments, each R5is independently methoxy. In embodiments, each R5is independently ethoxy. In embodiments, each R5is independently propoxy. In embodiments, each R5is independently isopropoxy. In embodiments, each R5is independently butoxy. In embodiments, each R5is independently isobutoxy. In embodiments, each R5is independently t-butoxy.

[0210] In embodiments, each R5Ais independently hydrogen or substituted or unsubstituted alkyl. In embodiments, each R5Ais independently hydrogen. In embodiments, each R5Ais independently substituted alkyl. In embodiments, each R5Ais independently an unsubstituted alkyl.

[0211] In embodiments, each R5Ais independently hydrogen, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl).

[0212] In embodiments, a substituted R5A(e.g., substituted alkyl, substituted heteroalkyl,Attorney Ref.01355-0007-00PCT substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R5Ais substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R5Ais substituted, it is substituted with at least one substituent group. In embodiments, when R5Ais substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R5Ais substituted, it is substituted with at least one lowersubstituent group.

[0213] In embodiments, each R5Ais independently hydrogen or substituted or unsubstituted alkyl.

[0001] In embodiments, each R5Ais independently hydrogen or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl). In embodiments, each R5Ais independently hydrogen. In embodiments, each R5Ais independently unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, each R5Ais independently substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl).

[0214] In embodiments, each R5Ais independently hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, hexyl. In embodiments, each R5Ais independently hydrogen. In embodiments, each R5Ais independently methyl. In embodiments, each R5Ais independently ethyl. In embodiments, each R5Ais independently propyl. In embodiments, each R5Ais independently isopropyl. In embodiments, each R5Ais independently butyl. In embodiments, each R5Ais independently isobutyl. In embodiments, each R5Ais independently t- butyl. In embodiments, each R5Ais independently pentyl. In embodiments, each R5Ais independently hexyl.

[0215] In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a substituted or unsubstituted cycloalkylene or substituted or unsubstituted heterocycloalkylene. In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a substituted or unsubstituted cycloalkylene. In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a substituted or unsubstituted heterocycloalkylene.Attorney Ref.01355-0007-00PCT

[0216] In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkylene (e.g., 3 to 8 membered heterocycloalkylene, 3 to 6 membered heterocycloalkylene, or 5 to 6 membered heterocycloalkylene). In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkylene (e.g., C3- C8cycloalkylene, C3-C6cycloalkylene, or C5-C6cycloalkylene).

[0217] In embodiments, a substituted heterocycloalkylene formed by the joining of R4and R5within four atoms of said R4and the atoms to which they are connected, is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted heterocycloalkylene is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when heterocycloalkylene formed by the joining of R4and R5within four atoms of said R4and the atoms to which they are connected is substituted, it is substituted with at least one substituent group. In embodiments, when heterocycloalkylene formed by the joining of R4and R5within four atoms of said R4and the atoms to which they are connected is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when heterocycloalkylene formed by the joining of R4and R5within four atoms of said R4and the atoms to which they are connected is substituted, it is substituted with at least one lower substituentgroup.

[0218] In embodiments, a substituted cycloalkylene formed by the joining of R4and R5within four atoms of said R4and the atoms to which they are connected is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted cycloalkylene is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when cycloalkylene formed by the joining of R4and R5within four atoms of said R4and the atoms to which they are connected is substituted, it is substituted with at least one substituent group. In embodiments, when cycloalkylene formed by the joining of R4and R5within four atoms of said R4and the atoms to which they are connected is substituted, it is substituted with at least one size-Attorney Ref.01355-0007-00PCT limited substituent group. In embodiments, when cycloalkylene formed by the joining of R4and R5within four atoms of said R4and the atoms to which they are connected is substituted, it issubstituted with at least one lower substituent group.

[0219] In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a substituted or unsubstituted 3 to 6 membered heterocycloalkylene. In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a substituted or unsubstituted 4 membered heterocycloalkylene.

[0220] In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a substituted 4 membered heterocycloalkylene. In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming an unsubstituted 4 membered heterocycloalkylene.

[0221] In embodiments, at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a locked nucleic acid (LNA).

[0222] In embodiments, each Q is independently a bond, -CR6R8-, or -NR9-. In embodiments, each Q is independently a bond or -NR9-. In embodiments, each Q is independently a bond. In embodiments, each Q is independently -CR6R8-. In embodiments, each Q is independently -NR9-.

[0223] In embodiments, each Q is independently -NH-, -NCH3-, -NCH2CH3-, -N(CH2)2CH3-, -N(CH2)3CH3-, or -N(CH2)4CH3-. In embodiments, each Q is independently -NH- or -NCH3-. In embodiments, each Q is independently -NH-. In embodiments, each Q is independently -NCH3-. In embodiments, each Q is independently -NCH2CH3-. In embodiments, each Q is independently -N(CH2)2CH3-. In embodiments, each Q is independently -N(CH2)3CH3-. In embodiments, each Q is independently -N(CH2)4CH3-.

[0224] In embodiments, each Q is independently -CH2-. In embodiments, each Q is independently -CH(CH3)-. In embodiments, each Q is independently -C(CH3)2-.

[0225] In embodiments, each R6, R8, and R9is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2,-OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F,Attorney Ref.01355-0007-00PCT -N3, -SF5, substituted (e.g. with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g. with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g. with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6 cycloalkyl), substituted (e.g. with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g. with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), or substituted (e.g. with a substituent group, a size- limited substituent group or a lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0226] In embodiments, each R6, R8, and R9is independently substituted with one or more substituent groups. In embodiments, each R6, R8, and R9is independently substituted with one or more size-limited substituent groups. In embodiments, each R6, R8, and R9is independently substituted with one or more lower substituent groups.

[0227] In embodiments, each R6, R8, and R9is independently hydrogen or substituted or unsubstituted alkyl. In embodiments, each R6, R8, and R9is independently hydrogen. In embodiments, each R6, R8, and R9is independently substituted or unsubstituted alkyl. In embodiments, each R6, R8, and R9is independently a substituted alkyl. In embodiments, each R6, R8, and R9is independently an unsubstituted alkyl. In embodiments, each R6, R8, and R9is independently substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, each R6, R8, and R9is independently substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, each R6, R8, and R9is independently unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl).

[0228] In embodiments, each substituted R6, R8, and R9(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is independently substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if each substituted R6, R8, and R9is independently substituted with a plurality of groups selected from substituent groups, size-limited substituentAttorney Ref.01355-0007-00PCT groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when each R6, R8, and R9is independently substituted, it is substituted with at least one substituent group. In embodiments, when each R6, R8, and R9is independently substituted, it is substituted with at least one size-limited substituent group. In embodiments, when each R6, R8, and R9is independently substituted, it issubstituted with at least one lower substituent group.

[0229] In embodiments, each R6is independently hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, or hexyl. In embodiments, each R6is independently hydrogen. In embodiments, each R6is independently methyl. In embodiments, each R6is independently ethyl. In embodiments, each R6is independently propyl. In embodiments, each R6is independently isopropyl. In embodiments, each R6is independently butyl. In embodiments, each R6is independently isobutyl. In embodiments, each R6is independently t-butyl. In embodiments, each R6is independently pentyl. In embodiments, each R6is independently isopentyl. In embodiments, each R6is independently hexyl.

[0230] In embodiments, each R8is independently hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, or hexyl. In embodiments, each R8is independently hydrogen. In embodiments, each R8is independently methyl. In embodiments, each R8is independently ethyl. In embodiments, each R8is independently propyl. In embodiments, each R8is independently isopropyl. In embodiments, each R8is independently butyl. In embodiments, each R8is independently isobutyl. In embodiments, each R8is independently t-butyl. In embodiments, each R8is independently pentyl. In embodiments, each R8is independently isopentyl. In embodiments, each R8is independently hexyl.

[0231] In embodiments, each R9is independently hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, or hexyl. In embodiments, each R9is independently hydrogen. In embodiments, each R9is independently methyl. In embodiments, each R9is independently ethyl. In embodiments, each R9is independently propyl. In embodiments, each R9is independently isopropyl. In embodiments, each R9is independently butyl. In embodiments, each R9is independently isobutyl. In embodiments, each R9is independently t-butyl. In embodiments, each R9is independently pentyl. In embodiments, each R9is independently isopentyl. In embodiments, each R9is independently hexyl.

[0232] Ring A is a substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.Attorney Ref.01355-0007-00PCT

[0233] In embodiments, Ring A is a substituted or unsubstituted heterocycloalkylene. In embodiments, Ring A is a substituted heterocycloalkylene. In embodiments, Ring A is an unsubstituted heterocycloalkylene.

[0234] In embodiments, Ring A is a substituted or unsubstituted heteroarylene. In embodiments, Ring A is a substituted heteroarylene. In embodiments, Ring A is an unsubstituted heteroarylene.

[0235] In embodiments, Ring A is a 3 to 10 membered substituted heterocycloalkylene. In embodiments, Ring A is a 3 membered substituted heterocycloalkylene. In embodiments, Ring A is a 4 membered substituted heterocycloalkylene. In embodiments, Ring A is a 5 membered substituted heterocycloalkylene. In embodiments, Ring A is a 6 membered substituted heterocycloalkylene. In embodiments, Ring A is a 7 membered substituted heterocycloalkylene. In embodiments, Ring A is a 8 membered substituted heterocycloalkylene. In embodiments, Ring A is a 9 membered substituted heterocycloalkylene. In embodiments, Ring A is a 10 membered substituted heterocycloalkylene.

[0236] In embodiments, Ring A is a 3 to 10 membered unsubstituted heterocycloalkylene. In embodiments, Ring A is a 3 membered unsubstituted heterocycloalkylene. In embodiments, Ring A is a 4 membered unsubstituted heterocycloalkylene. In embodiments, Ring A is a 5 membered unsubstituted heterocycloalkylene. In embodiments, Ring A is a 6 membered unsubstituted heterocycloalkylene. In embodiments, Ring A is a 7 membered unsubstituted heterocycloalkylene. In embodiments, Ring A is a 8 membered unsubstituted heterocycloalkylene. In embodiments, Ring A is a 9 membered unsubstituted heterocycloalkylene. In embodiments, Ring A is a 10 membered unsubstituted heterocycloalkylene.

[0237] In embodiments, Ring A is a substituted or unsubstituted ribose ring. In embodiments, Ring A is a substituted ribose ring. In embodiments, Ring A is an unsubstituted ribose ring. In embodiments, Ring A is a substituted or unsubstituted morpholino ring. In embodiments, Ring A is a substituted morpholino ring. In embodiments, Ring A is an unsubstituted morpholino ring.

[0238] In embodiments, RingIn embodiments,Attorney Ref.01355-0007-00PCTRing ARing.

[0239] In embodiments, each R7is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR7A, –C(O)OR7A, -NR7AR7B, -COOH, -NHC(O)R7A, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, silyl ether, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted heterocycloalkylene; each R7Aand R7Bis independently hydrogen, -CX3, -CHX2, -CH2X, -C(O)OH, -C(O)NH2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, −NHNH2, −ONH2, −NHC=(O)NHNH2, −NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)OH, -NHOH, -OCX3, -OCHX2, -OCH2X, silyl, modified trityl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; R7Aand R7Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl.

[0240] In embodiments, each R7is independently a silyl ether, for example:.Attorney Ref.01355-0007-00PCT

[0241] In embodiments, each R7Ais independently a silyl, for example:.

[0242] In embodiments, each R7Ais independently a modified trityl, for example: OMe .In embodiments, each R7is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CHCl2, -CHBr2, -CHF2, -CHI2, -CN, -OR7A, -C(O)OR7A, -NR7AR7B, -CONH2, -COOH, -NHC(O)R7A, -NO2, -SH, silyl ether, substituted (e.g., substitutedAttorney Ref.01355-0007-00PCT with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., substituted with at least one substituent group, size- limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0243] In embodiments, a substituted R7(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R7is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R7is substituted, it is substituted with at least one substituent group. In embodiments, when R7is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R7is substituted, it is substituted with at least one lowersubstituent group.

[0244] In embodiments, each R7is independently hydrogen, halogen, -OR7A, -C(O)OR7A-NHC(O)R7A, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, each R7is independently hydrogen. In embodiments, each R7is independently halogen. In embodiments, each R7is independently a substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, each R7is independently an unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl). In embodiments, each R7is independently -OR7A. In embodiments, each R7is independently -C(O)OR7A. In embodiments, eachAttorney Ref.01355-0007-00PCT R7is independently -NHC(O)R7A. In embodiments, each R7is independently chloro. In embodiments, each R7is independently bromo. In embodiments, each R7is independently iodo. In embodiments, each R7is independently fluoro.

[0245] In embodiments, each R7is independently substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl).

[0246] In embodiments, each R7is independently hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, hydroxy, methoxy, ethoxy, propoxy, butoxy, t-butoxy, benzyl, or silyl ether.

[0247] In embodiments, each R7is independently hydrogen, hydroxy, methoxy, ethoxy, propoxy, butoxy, t-butoxy, or silyl ether.

[0248] In embodiments, each R7is independently hydrogen, hydroxy, methoxy, or silyl ether. In embodiments, each R7is independently hydroxy or methoxy.

[0249] In embodiments, each R7is independently hydrogen. In embodiments, each R7is independently hydroxy. In embodiments, each R7is independently methoxy. In embodiments, each R7is independently ethoxy. In embodiments, each R7is independently propoxy. In embodiments, each R7is independently butoxy. In embodiments, each R7is independently t-butoxy. In embodiments, each R7is independently silyl ether. In embodiments, each R7is independently -OR7A.

[0250] In embodiments, each R7Ais independently hydrogen, silyl, or substituted or unsubstituted alkyl. In embodiments, each R7Ais independently hydrogen. In embodiments, each R7Ais independently a substituted alkyl. In embodiments, each R7Ais independently an unsubstituted alkyl. In embodiments, each R7Ais independently a silyl.

[0251] In embodiments, each R7Ais independently hydrogen, silyl, or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl).

[0252] In embodiments, a substituted R7A(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R7Ais substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R7Ais substituted, it is substituted with at least one substituentAttorney Ref.01355-0007-00PCT group. In embodiments, when R7Ais substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R7Ais substituted, it is substituted with at least one lowersubstituent group.

[0253] In embodiments, each R7Ais independently hydrogen or substituted or unsubstituted alkyl. In embodiments, each R7Ais independently hydrogen or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl). In embodiments, each R7Ais independently hydrogen. In embodiments, each R7Ais independently unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1- C4alkyl). In embodiments, each R7Ais independently substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4 alkyl).

[0254] In embodiments, each R7Ais independently hydrogen, silyl, or modified trityl.

[0255] In embodiments, each R7Ais independently hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, hexyl, t-butyldimethyl silyl (TBDMS), t- butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), modified trityl, or 4, 4’, 4’’-dimethylmethoxytrityl. In embodiments, each R7Ais independently hydrogen. In embodiments, each R7Ais independently methyl. In embodiments, each R7Ais independently ethyl. In embodiments, each R7Ais independently propyl. In embodiments, each R7Ais independently isopropyl. In embodiments, each R7Ais independently butyl. In embodiments, each R7Ais independently isobutyl. In embodiments, each R7Ais independently t- butyl. In embodiments, each R7Ais independently pentyl. In embodiments, each R7Ais independently isopentyl. In embodiments, each R7Ais independently hexyl. In embodiments, each R7Ais independently t-butyldimethyl silyl (TBDMS). In embodiments, each R7Ais independently t- butyldiphenyl silyl (TBDPS). In embodiments, each R7Ais independently trimethoxytrityl (TMT). In embodiments, each R7Ais independently dimethoxytrityl (DMT). In embodiments, each R7Ais independently monomethoxytrityl (MMT). In embodiments, each R7Ais independently a modified trityl. In embodiments, each R7Ais independently 4, 4’, 4’’-dimethylmethoxytrityl.

[0256] In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted heterocycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted cycloalkylene.

[0257] In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted heterocycloalkylene. In embodiments, two R7Attorney Ref.01355-0007-00PCT substituents together with the carbon atoms to which they are connected form a substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkylene (e.g., 3 to 8 membered heterocycloalkylene, 3 to 6 membered heterocycloalkylene, or 5 to 6 membered heterocycloalkylene).

[0258] In embodiments, a substituted heterocycloalkylene formed by the joining of two R7substituents together with the carbon atoms to which they are connected is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted heterocycloalkylene is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size- limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when heterocycloalkylene formed by the joining of two R7substituents together with the carbon atoms to which they are connected is substituted, it is substituted with at least one substituent group. In embodiments, when heterocycloalkylene formed by the joining of two R7substituents together with the carbon atoms to which they are connected is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when heterocycloalkylene formed by the joining of two R7substituents together with the carbon atoms to which they are connected is substituted, it is substituted with at least one lower substituent group.

[0259] In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted 5 to 6 membered heterocycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted 5 membered heterocycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted 6 membered heterocycloalkylene.

[0260] In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted 5 membered heterocycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected form an unsubstituted 5 membered heterocycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted 6 membered heterocycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected form an unsubstituted 6 membered heterocycloalkylene.

[0261] In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted 3 to 6 membered heterocycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected formAttorney Ref.01355-0007-00PCT a substituted or unsubstituted 4 membered heterocycloalkylene.

[0262] In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted 4 membered heterocycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected form an unsubstituted 4 membered heterocycloalkylene.

[0263] In embodiments, two R7substituents together with the carbon atoms to which they are connected form a locked nucleic acid (LNA).

[0264] In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted or unsubstituted cycloalkylene. In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkylene (e.g., C3-C8 cycloalkylene, C3-C6 cycloalkylene, or C5-C6 cycloalkylene). In embodiments, two R7substituents together with the carbon atoms to which they are connected form a substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) cycloalkylene (e.g., C3-C8 cycloalkylene, C3-C6 cycloalkylene, or C5-C6cycloalkylene). In embodiments, two R7substituents together with the carbon atoms to which they are connected form an unsubstituted cycloalkylene (e.g., C3-C8 cycloalkylene, C3-C6 cycloalkylene, or C5-C6 cycloalkylene).

[0265] In embodiments, a substituted cycloalkylene formed by the joining of two R7substituents together with the carbon atoms to which they are connected is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted cycloalkylene is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when cycloalkylene formed by the joining of two R7substituents together with the carbon atoms to which they are connected is substituted, it is substituted with at least one substituent group. In embodiments, when cycloalkylene formed by the joining of two R7substituents together with the carbon atoms to which they are connected is substituted, it is substituted with at least one size- limited substituent group. In embodiments, when cycloalkylene formed by the joining of two R7substituents together with the carbon atoms to which they are connected is substituted, it issubstituted with at least one lower substituent group.

[0266] In embodiments, p is an integer from 0 to 6. In embodiments, p is 0. In embodiments, p is 1. In embodiments, p is 2. In embodiments, p is 3. In embodiments, p is 4. InAttorney Ref.01355-0007-00PCT embodiments, p is 5. In embodiments, p is 6.

[0267] In embodiments, each X1is independently -O-, -CH2-, -CX2-, -N(R101)-, -S-, or -BH- . In embodiments, each X1is independently -O-, -CH2-, -CX2-, -N(R101)-, or -BH-.

[0268] In embodiments, each X1is independently -O-, -CH2-, -CF2-, -NH- or -BH-. In embodiments, each X1independently -O-. In embodiments, each X1is independently -CH2-. In embodiments, each X1is independently -CF2-. In embodiments, each X1is independently -NH-. In embodiments, each X1is independently -BH-. In embodiments, each X1is independently -S-.

[0269] In embodiments, each R101is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g. with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted cycloalkyl (e.g., C3- C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10aryl, C10 aryl, or phenyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl). In embodiments, R101is substituted with one or more substituent groups. In embodiments, R101is substituted with one or more size-limited substituent groups. In embodiments, R101is substituted with one or more lower substituent groups.

[0270] In embodiments, a substituted R101(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R101is substituted with a plurality of groups selectedAttorney Ref.01355-0007-00PCT from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R101is substituted, it is substituted with at least one substituent group. In embodiments, when R101is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R101is substituted, it is substituted with at least one lower substituent group.

[0271] In embodiments, each X is independently -Cl, -Br, -I or –F. In embodiments, each X is independently -Cl. In embodiments, each X is independently -Br. In embodiments, each X is independently -I. In embodiments, each X is independently –F.

[0272] In embodiments, each Y1is independently O, S, or Se. In embodiments, each Y1is independently O or S. In embodiments, each Y1is independently O. In embodiments, each Y1is independently S. In embodiments, each Y1is independently Se.

[0273] In embodiments, each Z1is independently -OH, -SH, or substituted or unsubstituted -O-alkyl. In embodiments, each Z1is independently -OH. In embodiments, each Z1is independently -SH. In embodiments, each Z1is independently substituted or unsubstituted -O- alkyl. In embodiments, each Z1is independently substituted -O-alkyl. In embodiments, each Z1is independently unsubstituted -O-alkyl.

[0274] In embodiments, each Z1is independently -OH, -SH, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted -O-alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted -O-heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., substituted with at least one substituent group, size- limited substituent group, or lower substituent group) or unsubstituted -O-cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted -O- heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted -O-aryl (e.g., C6-C10aryl, C10aryl, or phenyl), or substituted (e.g., substituted with at least one substituent group, size- limited substituent group, or lower substituent group) or unsubstituted -O-heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0275] In embodiments, each Z1is independently -OH, -SH, or substituted or unsubstitutedAttorney Ref.01355-0007-00PCT -O-alkyl. In embodiments, each Z1is independently -OH. In embodiments, each Z1is independently -SH. In embodiments, each Z1is independently substituted or unsubstituted -O- alkyl. In embodiments, each Z1is independently substituted -O-alkyl. In embodiments, each Z1is independently unsubstituted -O-alkyl. In embodiments, each Z1is independently substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted -O-alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl). In embodiments, each Z1is independently substituted (e.g., substituted with at least one substituent group, size- limited substituent group, or lower substituent group) -O-alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4alkyl). In embodiments, each Z1is independently unsubstituted -O-alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl). In embodiments, each Z1is independently substituted with one or more substituent groups. In embodiments, each Z1is independently substituted with one or more size-limited substituent groups. In embodiments, each Z1is independently substituted with one or more lower substituent groups.

[0276] In embodiments, a substituted Z1(e.g., substituted -O-alkyl, substituted -O- heteroalkyl, substituted -O-cycloalkyl, substituted -O-heterocycloalkyl, substituted -O-aryl, and / or substituted -O-heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted Z1is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when Z1is substituted, it is substituted with at least one substituent group. In embodiments, when Z1is substituted, it is substituted with at least one size- limited substituent group. In embodiments, when Z1is substituted, it is substituted with at least onelower substituent group.

[0277] In embodiments, B1is a natural, modified, or unnatural nucleoside base. In embodiments, B1is a natural nucleoside base. In embodiments, B1is a modified nucleoside base. In embodiments, B1is an unnatural nucleoside base.

[0278] In embodiments, B1is adenine, guanine, cytosine, uracil, or thymine. In embodiments, B1is adenine, N6-methyladenine, guanine, uracil, or cytosine. In embodiments, B1is adenine, N6-methyladenine, guanine, cytosine, uracil,,Attorney Ref.01355-0007-00PCT.

[0279] In embodiments, B1is adenine. In embodiments, B1is N6-methyladenine. In embodiments, B1is guanine. In embodiments, B1is cytosine. In embodiments, B1is uracil. In embodiments, B1is thymine. In embodiments, B1is inosine. In embodiments, B1is . In

[0280] In embodiments, each B2is independently a natural, modified, or unnatural nucleoside base. In embodiments, each B2is independently a natural nucleoside base. In embodiments, each B2is independently a modified nucleoside base. In embodiments, each B2is independently an unnatural nucleoside base.

[0281] In embodiments, each B2is independently adenine, N6-methyladenine, guanine, uracil, or cytosine. In embodiments, each B2is independently adenine, guanine, cytosine, uracil, or thymine. In embodiments, each B2is independently adenine, N6-methyladenine, guanine, cytosine, uracil, or inosine.

[0282] In embodiments, each B2is independently adenine. In embodiments, each B2is independently N6-methyladenine. In embodiments, each B2is independently guanine. In embodiments, each B2is independently cytosine. In embodiments, each B2is independently uracil. In embodiments, each B2is independently inosine.

[0283] In embodiments, each B1and B2is independently 5-methylcytosine, pseudouracil, hypoxanthine, N1-methylpseudouracil, N6-methyladenine, N6-ethyladenine, 7-deazaadenine, N - (alkyl)-cytosines, or 5-ethylcytosine, and the like (U.S. Patent No.6,762,298).Attorney Ref.01355-0007-00PCT

[0284] In embodiments, each B1and B2independently includes, but is not limited to, pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3- deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[l,5-a]l,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1 ,2,4-triazine, pyridazine; and 1 ,3,5 triazine.

[0285] In embodiments, each B1and B2independently includes, but is not limited to, pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3- deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[l,5-a]l,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1 ,2,4-triazine, pyridazine; and 1 ,3,5 triazine.

[0286] In embodiments, each B1and B2is independently adenine, N6-methyladenine, N6- ethyladenine, N6-methyl-2-aminoadenine, guanine, cytosine, uracil, thymine, or inosine. In embodiments, each B1and B2is independently adenine, N6-methyladenine, or guanine. In embodiments, each B1and B2is independently N6-methyladenine or guanine. In embodiments, each B1and B2is independently N6-ethyladenine. In embodiments, each B1and B2is independently N6-methyl-2-aminoadenine.

[0287] In embodiments, each R10is independently hydrogen, silyl, –C(O)R1A, –C(O)OR1A, –OR1A, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstitutedAttorney Ref.01355-0007-00PCT aryl, or substituted or unsubstituted heteroaryl.

[0288] In embodiments, each R10is independently hydrogen, silyl, –C(O)OR1A, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0289] In embodiments, a substituted R10(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is independently substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted R10is independently substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when R10is independently substituted, it is substituted with at least one substituent group. In embodiments, when R10is independently substituted, it is substituted with at least one size-limited substituent group. In embodiments, when R10is independently substituted, it is substituted with at least one lower substituent group.

[0290] In embodiments,each R10is independently a 9-fluorenylmethoxycarbonyl (Fmoc)group or a substituted Fmoc group. Examples of substituted Fmoc groups include, but are not limited to, 2,7-di-tert-butyl-Fmoc, 2-fluro-Fmoc, and 2-monoisooctyl-Fmoc.

[0291] In embodiments, each R10is independently an acyl. In one such embodiment, the acyl has the formulawherein Ar is a substituted or unsubstituted aromatic moiety and sAttorney Ref.01355-0007-00PCT is an integer from 0 to 5. In embodiments, the acyl has the. Particular acylsinclude, but are not limited. Inembodiments, R1is 2-(4-nitrophenylsulfonyl)ethoxycarbonyl (Nsc), 1,1-dioxobenzo[b]thiophene- 2-ylmethoxycarbonyl (Bsmoc), (1,1,dioxonaphtho[1,2-b]thiophene-2-yl)methylcarbonyl (α- Nsmoc), 1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)-e-methylbutyl (ivDde), 2- phenyl(methyl)sulfonio)ethoxycarbonyl tetrafluoroborate (Pms), wthanesulfonylethoxycarbonyl (Esc) 9-fluorenylmethyl (Fm), 4-(N-[1-(4,4-dimethyl-2,6-dioxocyclohexylidene)-3-methylbutyl]- amino)benzyl (Dmab) or 2-(4-sulfophenylsulfonyl)ethoxycarbonyl (Sps).

[0292] In embodiments, each R10is independently hydrogen, silyl, –C(O)OR1A, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted aryl.

[0293] In embodiments, each R10is independently hydrogen, silyl, –C(O)OR1A, or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl).

[0294] In embodiments, each R10is independently hydrogen, silyl, –C(O)OR1A, or substituted or unsubstituted alkyl. In embodiments, each R10is independently hydrogen, silyl, or substituted or unsubstituted alkyl. In embodiments, each R10is independently hydrogen or substituted or unsubstituted alkyl.

[0295] In embodiments, each R10is independently hydrogen, silyl, substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), or –C(O)OR1Awherein R1Ais a substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl).

[0296] In embodiments, each R10is independently hydrogen, silyl, –C(O)OR1A, or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl). In embodiments, eachAttorney Ref.01355-0007-00PCT R10is independently hydrogen. In embodiments, each R10is independently silyl. In embodiments, each R10is independently –C(O)OR1A. In embodiments, each R10is independently unsubstituted alkyl (e.g., C1-C8alkyl, C1-C6alkyl, or C1-C4alkyl). In embodiments, each R10is independently substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl).

[0297] In embodiments, silyl may be for example: Si ,.

[0298] In embodiments, each R10is independently hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, benzyl, t-butyldimethyl silyl (TBDMS), t-butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’-isopropylmethylmethoxytrityl, or 4, 4’, 4’’-dimethylmethoxytrityl.

[0299] In embodiments, each R10is independently hydrogen. In embodiments, each R10is independently methyl. In embodiments, each R10is independently ethyl. In embodiments, each R10is independently propyl. In embodiments, each R10is independently isopropyl. In embodiments, each R10is independently butyl. In embodiments, each R10is independently isobutyl. In embodiments, each R10is independently t-butyl. In embodiments, each R10is independently benzyl. In embodiments, each R10is independently t-butyldimethyl silyl (TBDMS). In embodiments, each R10is independently t-butyldiphenyl silyl (TBDPS). In embodiments, each R10is independently trimethoxytrityl (TMT). In embodiments, each R10is independently dimethoxytrityl (DMT). In embodiments, each R10is independently monomethoxytrityl (MMT). In embodiments, each R10is independently a modified trityl. In embodiments, each R10is independently 4, 4’, 4’’-dimethylmethoxytrityl.

[0300] In embodiments, a modified trityl may be for example:Attorney Ref.01355-0007-00PCT OMe ..

[0301] In embodiments, removable purification handle can be removed under mild acidic conditions, with pH no lower than about 5 (at room temperature for 1 hour). In embodiments, removable purification handle can be removed under mild basic conditions, with a pH no higher than about 9 (at room temperature for 1 hour). In embodiments, removable purification handle can be removed by mild heating, at no higher than about 65oC for 1 hour. In embodiments, removable purification handle can be removed by reductive amination. In embodiments, removable purification handle can be removed by desilylation. In embodiments, removable purification handle can be removed by oxidation. In embodiments, removable purification handle can be removed by photolysis. In embodiments, removable purification handle is not photocleavable (photolabile). In embodiments, a purification handle is considered “cleavable” or “removable” if it can be removed under conditions wherein 5’-capped oligonucleotide is not damaged. In embodiments, a purification handle is considered “cleavable” or “removable” if it can be removed under conditions wherein 5’-capped RNA is not denatured. In embodiments, once removable purification handle(s) are removed, highly pure and readily translatable 5’-capped oligonucleotide is generated.

[0302] In embodiments, each removable purification handle is independently silyl, 9- fluorenylmethoxycarbonyl (Fmoc) group or a substituted Fmoc group, acyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstitutedAttorney Ref.01355-0007-00PCT cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. In embodiments, the removable purification handle may be, for example, substituted or unsubstituted saturated alkyl groups C3-C20or longer (including for example, modified trityls), cycloalkyl rings, aryl rings, silyls, modified and unmodified Fmoc compounds and the like.

[0303] In one such embodiment, the acyl has the, wherein Ar is a substituted or unsubstituted aromatic moiety and s is an integer from 0 to 5. In embodiments, the acyl has the formula

[0304] In embodiments, each removable purification handle is independently silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0305] In embodiments, each removable purification handle is independently silyl, substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8cycloalkyl, C3-C6cycloalkyl, or C5-C6cycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted aryl (e.g., C6-C10 aryl, C10 aryl, or phenyl), or substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 memberedheteroaryl).

[0306] In embodiments, each removable purification handle is independently substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lowerAttorney Ref.01355-0007-00PCT substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, each removable purification handle is independently substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl). In embodiments, each removable purification handle is independently unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl).

[0307] In embodiments, each removable purification handle is independently substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl). In embodiments, each removable purification handle is independently substituted (e.g., substituted with at least one substituent group, size-limited substituent group, or lower substituent group) heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl). In embodiments, each removable purification handle is independently unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl).

[0308] In embodiments, each substituted removable purification handle (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if each substituted removable purification handle is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when each removable purification handle is substituted, it is substituted with at least one substituent group. In embodiments, when each removable purification handle is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when each removable purification handle is substituted, it is substituted with at least one lower substituent group.

[0309] In embodiments, each removable purification handle is independently trityl, ethyl ethers, fluorenylmethyloxycarbonyl (Fmoc), t-butyldimethyl silyl (TBDMS), t-butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), 4, 4’, 4’’- dimethylmethoxytrityl, or a modified trityl.

[0310] In embodiments, each removable purification handle is independently trityl. In embodiments, each removable purification handle is independently ethyl ethers. In embodiments, each removable purification handle is independently fluorenylmethyloxycarbonyl (Fmoc). In embodiments, each removable purification handle is independently t-butyldimethyl silyl (TBDMS).Attorney Ref.01355-0007-00PCT In embodiments, each removable purification handle is independently t-butyldiphenyl silyl (TBDPS). In embodiments, each removable purification handle is independently trimethoxytrityl (TMT). In embodiments, each removable purification handle is independently dimethoxytrityl (DMT). In embodiments, each removable purification handle is independently monomethoxytrityl (MMT). In embodiments, each removable purification handle is independently 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, each removable purification handle is independently a modified trityl.

[0311] In embodiments, each removable purification handle independently comprises trityl. In embodiments, each removable purification handle independently comprises ethyl ethers. In embodiments, each removable purification handle independently comprises fluorenylmethyloxycarbonyl (Fmoc). In embodiments, each removable purification handle independently comprises t-butyldimethyl silyl (TBDMS). In embodiments, each removable purification handle independently comprises t-butyldiphenyl silyl (TBDPS). In embodiments, each removable purification handle independently comprises trimethoxytrityl (TMT). In embodiments, each removable purification handle independently comprises dimethoxytrityl (DMT). In embodiments, each removable purification handle independently comprises monomethoxytrityl (MMT). In embodiments, each removable purification handle independently comprises 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, each removable purification handle independently comprises 4, 4’, 4’’-isopropylmethylmethoxytrityl. In embodiments, each removable purification handle independently comprises a modified trityl.

[0312] In embodiments, rapid removal of the removable purification handle is an advantage. In embodiments, substantially all of the removable purification handle is removed. In embodiments, the substantially complete removal of the removable purification handle is and advantage.

[0313] In embodiments, substantially all of the removable purification handle is removed within 45 minutes or less, 40 minutes or less, 35 minutes or less, 30 minutes or less, 25 minutes or less, 20 minutes or less, 15 minutes or less, 10 minutes or less, 5 minutes or less, or 3 minutes or less.

[0314] In embodiments, 90% or more of the removable purification handle is removed within 30 minutes or less. In embodiments, 95% or more of the removable purification handle is removed within 30 minutes or less. In embodiments, 96% or more of the removable purification handle is removed within 30 minutes or less. In embodiments, 97% or more of the removable purification handle is removed within 30 minutes or less. In embodiments, 98% or more of theAttorney Ref.01355-0007-00PCT removable purification handle is removed within 30 minutes or less. In embodiments, 99% or more of the removable purification handle is removed within 30 minutes or less. In embodiments, 100% or more of the removable purification handle is removed within 30 minutes or less.

[0315] In embodiments, within 45 minutes at least 90% of the removable purification handle is removed. In embodiments, within 35 minutes at least 90% of the removable purification handle is removed. In embodiments, within 30 minutes at least 90% of the removable purification handle is removed. In embodiments, within 25 minutes at least 90% of the removable purification handle is removed. In embodiments, within 20 minutes at least 90% of the removable purification handle is removed. In embodiments, within 15 minutes at least 90% of the removable purification handle is removed. In embodiments, within 10 minutes at least 90% of the removable purification handle is removed. In embodiments, within 5 minutes at least 90% of the removable purification handle is removed.

[0316] In embodiments, within 45 minutes at least 95% of the removable purification handle is removed. In embodiments, within 35 minutes at least 95% of the removable purification handle is removed. In embodiments, within 30 minutes at least 95% of the removable purification handle is removed. In embodiments, within 25 minutes at least 95% of the removable purification handle is removed. In embodiments, within 20 minutes at least 95% of the removable purification handle is removed. In embodiments, within 15 minutes at least 95% of the removable purification handle is removed. In embodiments, within 10 minutes at least 95% of the removable purification handle is removed. In embodiments, within 5 minutes at least 95% of the removable purification handle is removed.

[0317] In embodiments, within 45 minutes at least 96% of the removable purification handle is removed. In embodiments, within 35 minutes at least 96% of the removable purification handle is removed. In embodiments, within 30 minutes at least 96% of the removable purification handle is removed. In embodiments, within 25 minutes at least 96% of the removable purification handle is removed. In embodiments, within 20 minutes at least 96% of the removable purification handle is removed. In embodiments, within 15 minutes at least 96% of the removable purification handle is removed. In embodiments, within 10 minutes at least 96% of the removable purification handle is removed. In embodiments, within 5 minutes at least 96% of the removable purification handle is removed.

[0318] In embodiments, within 45 minutes at least 97% of the removable purification handle is removed. In embodiments, within 35 minutes at least 97% of the removable purification handle is removed. In embodiments, within 30 minutes at least 97% of the removable purificationAttorney Ref.01355-0007-00PCT handle is removed. In embodiments, within 25 minutes at least 97% of the removable purification handle is removed. In embodiments, within 20 minutes at least 97% of the removable purification handle is removed. In embodiments, within 15 minutes at least 97% of the removable purification handle is removed. In embodiments, within 10 minutes at least 97% of the removable purification handle is removed. In embodiments, within 5 minutes at least 97% of the removable purification handle is removed.

[0319] In embodiments, within 45 minutes at least 98% of the removable purification handle is removed. In embodiments, within 35 minutes at least 98% of the removable purification handle is removed. In embodiments, within 30 minutes at least 98% of the removable purification handle is removed. In embodiments, within 25 minutes at least 98% of the removable purification handle is removed. In embodiments, within 20 minutes at least 98% of the removable purification handle is removed. In embodiments, within 15 minutes at least 98% of the removable purification handle is removed. In embodiments, within 10 minutes at least 98% of the removable purification handle is removed. In embodiments, within 5 minutes at least 98% of the removable purification handle is removed.

[0320] In embodiments, within 45 minutes at least 99% of the removable purification handle is removed. In embodiments, within 35 minutes at least 99% of the removable purification handle is removed. In embodiments, within 30 minutes at least 99% of the removable purification handle is removed. In embodiments, within 25 minutes at least 99% of the removable purification handle is removed. In embodiments, within 20 minutes at least 99% of the removable purification handle is removed. In embodiments, within 15 minutes at least 99% of the removable purification handle is removed. In embodiments, within 10 minutes at least 99% of the removable purification handle is removed. In embodiments, within 5 minutes at least 99% of the removable purification handle is removed.

[0321]

[0322] In embodiments, within 45 minutes at least 100% of the removable purification handle is removed. In embodiments, within 35 minutes at least 100% of the removable purification handle is removed. In embodiments, within 30 minutes at least 100% of the removable purification handle is removed. In embodiments, within 25 minutes at least 100% of the removable purification handle is removed. In embodiments, within 20 minutes at least 100% of the removable purification handle is removed. In embodiments, within 15 minutes at least 100% of the removable purification handle is removed. In embodiments, within 10 minutes at least 100% of the removable purification handle is removed. In embodiments, within 5 minutes at least 100% of the removable purificationAttorney Ref.01355-0007-00PCT handle is removed.

[0323] In embodiments, the removable purification handle is not a photocleavable or photolabile purification handle. In embodiments, the removable purification handle is not a photocleavable purification handle. In embodiments, the removable purification handle is not a photolabile purification handle.

[0324] In embodiments, R1, and / or R2, and / or R3comprise the one or more removable purification handle(s), and / or the one or more removable purification handle(s) are attached to Ring A, and / or nucleobase B1of the structure of formula (I) or (Ib).

[0325] In embodiments, R1, and / or R2, and / or R3is or comprises the one or more removable purification handle(s). In embodiments, R1is or comprises a removable purification handle. In embodiments, R2is or comprises a removable purification handle. In embodiments, R3is or comprises a removable purification handle. In embodiments, R1and / or R2is or comprises a removable purification handle. In embodiments, R1and / or R3is or comprises a removable purification handle. In embodiments, R2and / or R3is or comprises a removable purification handle. In embodiments, R1and R2are or comprise a removable purification handle. In embodiments, R1and R3are or comprise a removable purification handle. In embodiments, R2and R3are or comprise a removable purification handle.

[0326] In embodiments, R1, and / or R2, and / or R3comprise the one or more removable purification handle(s). In embodiments, R1comprises a removable purification handle. In embodiments, R2comprises a removable purification handle. In embodiments, R3comprises a removable purification handle. In embodiments, R1and / or R2comprise a removable purification handle. In embodiments, R1and / or R3comprise a removable purification handle. In embodiments, R2and / or R3comprise a removable purification handle. In embodiments, R1and R2comprise a removable purification handle. In embodiments, R1and R3comprise a removable purification handle. In embodiments, R2and R3comprise a removable purification handle.

[0327] In embodiments, R1, and / or R2, and / or R3is the one or more removable purification handle(s). In embodiments, R1is a removable purification handle. In embodiments, R2is a removable purification handle. In embodiments, R3is a removable purification handle. In embodiments, R1and / or R2is a removable purification handle. In embodiments, R1and / or R3is a removable purification handle. In embodiments, R2and / or R3is a removable purification handle. In embodiments, R1and R2are removable purification handle. In embodiments, R1and R3are removable purification handle. In embodiments, R2and R3are removable purification handle.

[0328] In embodiments, R1, and / or R2, and / or R3is or comprises 4, 4’, 4’’-Attorney Ref.01355-0007-00PCT dimethylmethoxytrityl. In embodiments, R1is or comprises 4, 4’, 4’’-dimethylmethoxytrityl. In embodiments, R2is or comprises 4, 4’, 4’’-dimethylmethoxytrityl. In embodiments, R3is or comprises 4, 4’, 4’’-dimethylmethoxytrityl. In embodiments, R1and / or R2is or comprises 4, 4’, 4’’-dimethylmethoxytrityl. In embodiments, R1and / or R3is or comprises 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, R2and / or R3is or comprises 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, R1and R2are or comprise 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, R1and R3are or comprise 4, 4’, 4’’- dimethylmethoxytrityl. In embodiments, R2and R3are or comprise 4, 4’, 4’’- dimethylmethoxytrityl.

[0329] In embodiments, R1, and / or R2, and / or R3is or comprises 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R1is or comprises 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R2is or comprises 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R3is or comprises 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R1and / or R2is or comprises 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R1and / or R3is or comprises 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R2and / or R3is or comprises 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R1and R2are or comprise 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R1and R3are or comprise 4, 4’, 4’’- isopropylmethylmethoxytrityl. In embodiments, R2and R3are or comprise 4, 4’, 4’’- isopropylmethylmethoxytrityl.

[0330] In embodiments, the one or more removable purification handle(s) are attached to Ring A of the structure of formula (I) or (Ib). In embodiments, one removable purification handle is attached to Ring A of the structure of formula (I) or (Ib). In embodiments, two removable purification handles are attached to Ring A of the structure of formula (I) or (Ib). In embodiments, three removable purification handles are attached to Ring A of the structure of formula (I) or (Ib). In embodiments, four removable purification handles are attached to Ring A. In embodiments, five removable purification handles are attached to Ring A of the structure of formula (I) or (Ib).

[0331] In embodiments, the one or more removable purification handle(s) are attached to nucleobase B1of the structure of formula (I) or (Ib). In embodiments, one removable purification handle is attached to nucleobase B1of the structure of formula (I) or (Ib). In embodiments, two removable purification handles are attached to nucleobase B1of the structure of formula (I) or (Ib). In embodiments, three removable purification handles are attached to nucleobase B1of the structure of formula (I) or (Ib). In embodiments, four removable purification handles are attachedAttorney Ref.01355-0007-00PCT to nucleobase B1. In embodiments, five removable purification handles are attached to nucleobase B1of the structure of formula (I) or (Ib).

[0332] In embodiments, n is an integer from 0 to 3. In embodiments, n is 0. In embodiments, n is 1. In embodiments, n is 2. In embodiments, n is 3. In embodiments, n is 1 or 2.

[0333] In embodiments, m is an integer from 0 to 8. In embodiments, m is 0. In embodiments, m is 1. In embodiments, m is 2. In embodiments, m is 3. In embodiments, m is 4. In embodiments, m is 5. In embodiments, m is 6. In embodiments, m is 7. In embodiments, m is 8. In embodiments, m is 0, 1, or 2. In embodiments, m is 0 or 1.

[0334] In embodiments, each R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7Bis independently hydrogen, -CX3, -CHX2, -CH2X, -C(O)OH, -C(O)NH2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)OH, -NHOH, -OCX3, -OCHX2, -OCH2X, silyl, substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heteroalkyl (e.g., 2 to 8 membered heteroalkyl, 2 to 6 membered heteroalkyl, or 2 to 4 membered heteroalkyl), substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6cycloalkyl), substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted aryl (e.g., C6-C10aryl, C10aryl, or phenyl), or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl).

[0335] In embodiments, each substituted R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7B(e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, and / or substituted heteroaryl) is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if each substituted R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7Bis substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different.Attorney Ref.01355-0007-00PCT In embodiments, when each R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7Bis substituted, it is substituted with at least one substituent group. In embodiments, when each R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7Bis substituted, it is substituted with at least one size-limited substituent group. In embodiments, when each R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7Bis substituted,it is substituted with at least one lower substituent group.

[0336] In embodiments, each R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7Bis independently substituted with one or more substituent groups. In embodiments, each R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7Bis independently substituted with one or more size-limited substituent groups. In embodiments, each R1A, R2A, R3A, R4A, R4B, R5A, R5B, R7A, and R7Bis independently substituted with one or more lower substituent groups.

[0337] In embodiments, R7Aand R7Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl). In embodiments, a substituted heterocycloalkyl or substituted heteroaryl formed by the joining of R7Aand R7Bsubstituents bonded to the same nitrogen atom is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted heterocycloalkyl or substituted heteroaryl is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when a heterocycloalkyl formed by the joining of R7Aand R7Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one substituent group. In embodiments, when a heterocycloalkyl formed by the joining of R7Aand R7Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when a heterocycloalkyl formed by the joining of R7Aand R7Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one lower substituent group. In embodiments, when a heteroaryl formed by the joining of R7Aand R7Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one substituent group. In embodiments, when a heteroaryl formed by the joining of R7Aand R7Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when a heteroaryl formed by the joiningAttorney Ref.01355-0007-00PCT of R7Aand R7Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one lower substituent group.

[0338] In embodiments, R5Aand R5Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl, or 5 to 6 membered heteroaryl). In embodiments, a substituted heterocycloalkyl or substituted heteroaryl formed by the joining of R5Aand R5Bsubstituents bonded to the same nitrogen atom is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted heterocycloalkyl or substituted heteroaryl is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when a heterocycloalkyl formed by the joining of R5Aand R5Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one substituent group. In embodiments, when a heterocycloalkyl formed by the joining of R5Aand R5Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when a heterocycloalkyl formed by the joining of R5Aand R5Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one lower substituent group. In embodiments, when a heteroaryl formed by the joining of R5Aand R5Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one substituent group. In embodiments, when a heteroaryl formed by the joining of R5Aand R5Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when a heteroaryl formed by the joining of R5Aand R5Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one lower substituent group.

[0339] In embodiments, R4Aand R4Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heterocycloalkyl (e.g., 3 to 8 membered heterocycloalkyl, 3 to 6 membered heterocycloalkyl, or 5 to 6 membered heterocycloalkyl), or substituted (e.g., with a substituent group, a size-limited substituent group or a lower substituent group) or unsubstituted heteroaryl (e.g., 5 to 10 membered heteroaryl, 5 to 9 membered heteroaryl,Attorney Ref.01355-0007-00PCT or 5 to 6 membered heteroaryl). In embodiments, a substituted heterocycloalkyl or substituted heteroaryl formed by the joining of R4Aand R4Bsubstituents bonded to the same nitrogen atom is substituted with at least one substituent group, size-limited substituent group, or lower substituent group; wherein if the substituted heterocycloalkyl or substituted heteroaryl is substituted with a plurality of groups selected from substituent groups, size-limited substituent groups, and lower substituent groups; each substituent group, size-limited substituent group, and / or lower substituent group may optionally be different. In embodiments, when a heterocycloalkyl formed by the joining of R4Aand R4Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one substituent group. In embodiments, when a heterocycloalkyl formed by the joining of R4Aand R4Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when a heterocycloalkyl formed by the joining of R4Aand R4Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one lower substituent group. In embodiments, when a heteroaryl formed by the joining of R4Aand R4Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one substituent group. In embodiments, when a heteroaryl formed by the joining of R4Aand R4Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one size-limited substituent group. In embodiments, when a heteroaryl formed by the joining of R4Aand R4Bsubstituents bonded to the same nitrogen atom is substituted, it is substituted with at least one lower substituent group.

[0340] In embodiments, provided herein is a compound of the following structure: O 2, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof.

[0341] In embodiments, provided herein is a compound of the following structure:Attorney Ref.01355-0007-00PCT O, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof.

[0342] In embodiments, the structure of formula (I) or (Ib) comprises one or more removable purification handle(s). In embodiments, the structure of formula (I) comprises one removable purification handle. In embodiments, the structure of formula (Ib) comprises one removable purification handle. In embodiments, the structure of formula (I) comprises two removable purification handles. In embodiments, the structure of formula (Ib) comprises two removable purification handles. In embodiments, the structure of formula (I) comprises three removable purification handles. In embodiments, the structure of formula (Ib) comprises three removable purification handles. In embodiments, the structure of formula (I) comprises four removable purification handles. In embodiments, the structure of formula (Ib) comprises four removable purification handles. In embodiments, the structure of formula (I) comprises five removable purification handles. In embodiments, the structure of formula (Ib) comprises five removable purification handles.

[0343] In embodiments, each compound provided herein that comprises a ribose moiety comprises a D-ribose moiety and each compound that comprises a 2’-methoxyribose moiety comprises a 2’-methoxy-D-ribose moiety. In embodiments, each compound provided herein that comprises a ribose moiety comprises a D-ribose moiety. In embodiments, each compound provided herein that comprises a 2’-methoxyribose moiety comprises a 2’-methoxy-D-ribose moiety.

[0344] In embodiments, one or both 2’-methoxyribose moieties are 2’-methoxy-D-ribose moieties. In embodiments, one of the 2’-methoxyribose moieties is 2’-methoxy-D-ribose moiety. In embodiments, both of the 2’-methoxyribose moieties are 2’-methoxy-D-ribose moieties.

[0345] As understood by those of skill in the art, the structures shown of the compounds described herein are representations of one form of the compound. Although such compounds may be drawn or described in protonated (free acid) form, in ionized (anionic) form, or ionized and inAttorney Ref.01355-0007-00PCT association with one or more cations (salt form), aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of a compound described herein, in aqueous solution, exists in equilibrium among free acid, anion, and salt forms.

[0346] In embodiments, a compound of formula I can be depicted in protonated form (free acid):.

[0347] In embodiments, a compound of formula I can be depicted in ionized (anionic) form:.

[0348] In embodiments, a compound of formula I can be depicted in ionized and in association with one or more cations (salt) form:Attorney Ref.01355-0007-00PCT R1 N R2B2OH .

[0349] In embodiments, the sodium cations may be replaced by another suitable cation, e.g., lithium, potassium, or ammonium cations. In embodiments, where n and / or m are >1 the number of cations will be adjusted for neutrality.

[0350] As understood by those of skill in the art, the cation salt form may exist in which one, two, three, four, five or more cations are present (the number of cations depends on the number of Z1s present). Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain compounds have several such linkages, each of which is in equilibrium. Thus, compounds in solution exist in an ensemble of forms at multiple positions all at equilibrium. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or salts thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation.

[0351] In an aspect, provided herein is an oligonucleotide comprising the compound A-1, or stereoisomer, or a salt thereof, wherein the oligonucleotide has the structure of formula A-1b:,Attorney Ref.01355-0007-00PCT or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein oligonucleotide is one or more nucleotides.

[0352] In an aspect, provided herein is an oligonucleotide comprising the compound A-2, or stereoisomer, or a salt thereof, wherein the oligonucleotide has the structure of formula A-2b:, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein oligonucleotide is one or more nucleotides.

[0353] In embodiments, the salt is a sodium salt, a lithium salt, or a potassium salt. In embodiments, the salt is a sodium salt. In embodiments, the salt is a lithium salt. In embodiments, the salt is a potassium salt. In embodiments, the salt is a triethylamine salt. In embodiments, the salt is a pharmaceutically acceptable salt.

[0354] In embodiments, provided herein is a pharmaceutical composition comprising an oligonucleotide comprising any one of the compounds described herein and a pharmaceutically acceptable excipient. In embodiments, the pharmaceutical composition comprising an oligonucleotide comprising any one of the compounds described herein and a pharmaceutically acceptable excipient, may be used in vaccines. In embodiments, the vaccines may be vaccines against infectious diseases or cancer. In embodiments, the pharmaceutical composition comprising an oligonucleotide comprising any one of the compounds described herein and a pharmaceutically acceptable excipient, may be used in genetic vaccination, wherein an immune response is stimulated by introduction of a suitable oligonucleotide, into a subject, which codes for an antigen or a fragment thereof. These vaccine strategies can require large quantities of capped oligonucleotide. The present methods facilitate such synthesis and subsequent purification ofAttorney Ref.01355-0007-00PCT capped oligonucleotide so as to make these vaccines commercially feasible. The present methods also describe strategies to increase the percentage of full-length capped oligonucleotide in a transcription reaction leading to a more homogenous product.

[0355] In embodiments, provided herein is a method of inducing a therapeutic effect in a subject, comprising administering to the subject an oligonucleotide comprising any one of the compounds or pharmaceutical compositions described herein.

[0356] In embodiments, provided herein is an initiating capped oligonucleotide primer of the following formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppA2’OMepG, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a salt, solvate, or hydrate thereof.

[0357] In an aspect, provided herein is an oligonucleotide A-1b comprising an initiating capped oligonucleotide primer, or a stereoisomer or salt thereof, wherein the initiating capped oligonucleotide primer has the formulaN2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppA2’OMepG.

[0358] In embodiments, provided herein is an initiating capped oligonucleotide primer of the following formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppGpG, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a salt, solvate, or hydrate thereof.

[0359] In an aspect, provided herein is an oligonucleotide A-2b comprising an initiating capped oligonucleotide primer, or a stereoisomer or salt thereof, wherein the initiating capped oligonucleotide primer has the formulaN2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppGpG.

[0360] In embodiments, the salt of any of the initiating capped oligonucleotide primers described herein or oligonucleotides comprising any of the initiating capped oligonucleotide primers described herein is a sodium salt, a lithium salt, or a potassium salt. In embodiments, the salt of any of the initiating capped oligonucleotide primers described herein or oligonucleotides comprising any of the initiating capped oligonucleotide primers described herein is a sodium salt. In embodiments, the salt of any of the initiating capped oligonucleotide primers described herein or oligonucleotides comprising any of the initiating capped oligonucleotide primers described herein is a lithium salt. In embodiments, the salt of any of the initiating capped oligonucleotide primers described herein or oligonucleotides comprising any of the initiating capped oligonucleotide primers described herein is a potassium salt.

[0361] In embodiments, provided herein is a pharmaceutical composition comprising anyAttorney Ref.01355-0007-00PCT one of the initiating capped oligonucleotide primers described herein or oligonucleotides comprising any one of the initiating capped oligonucleotide primers described herein and a pharmaceutically acceptable excipient. In embodiments, the pharmaceutical composition comprising oligonucleotides comprising any one of the initiating capped oligonucleotide primers described herein and a pharmaceutically acceptable excipient, may be used in vaccines. In embodiments, the vaccines may be vaccines against infectious diseases or cancer. In embodiments, the pharmaceutical composition comprising the oligonucleotides comprising any one of the initiating capped oligonucleotide primers described herein and a pharmaceutically acceptable excipient, may be used in genetic vaccination, wherein an immune response is stimulated by introduction of a suitable oligonucleotide, into a subject, which codes for an antigen or a fragment thereof. These vaccine strategies can require large quantities of capped oligonucleotides. The present methods facilitate such synthesis and subsequent purification of capped oligonucleotides so as to make these vaccines commercially feasible. The present methods also describe strategies to increase the percentage of full-length capped oligonucleotides in a transcription reaction leading to a more homogenous product.

[0362] In embodiments, provided herein is an oligonucleotide as described herein, for use in therapy. In embodiments, provided herein is a pharmaceutical composition as described herein, for use in therapy. In any embodiments involving a subject, the subject may be a mammal, such as a human. In embodiments, the mammal is a domesticated mammal, a rodent, or a primate. Methods of Making and Using the Compounds and Oligonucleotides

[0363] In embodiments, provided herein is a method of inducing a therapeutic effect in a subject, comprising administering to the subject an oligonucleotide comprising any one of the compounds or pharmaceutical compositions described herein.

[0364] In embodiments, provided herein is a method of inducing a therapeutic effect in a subject, comprising removing the removable purification handle from any one of the oligonucleotides described herein, thereby providing a product oligonucleotide, and administering to the subject the product oligonucleotide or a pharmaceutical composition comprising the product oligonucleotide.

[0365] In embodiments, provided herein is a method of expressing a transgene in a subject, comprising administering to the subject any one of the oligonucleotides or pharmaceutical compositions described herein, wherein the oligonucleotide comprises a sequence encoding the transgene. In embodiments, provided herein is an oligonucleotide as described herein, for use inAttorney Ref.01355-0007-00PCT therapy. In embodiments, provided herein is a pharmaceutical composition as described herein, for use in therapy. In any embodiments involving a subject, the subject may be a mammal, such as a human. In embodiments, the mammal is a domesticated mammal, a rodent, or a primate.

[0366] In embodiments, provided herein is a method of expressing a transgene in a subject, comprising removing the removable purification handle from any one of the oligonucleotides described herein, wherein the oligonucleotide comprises a sequence encoding the transgene, thereby providing a product oligonucleotide, and administering to the subject the product oligonucleotide or a pharmaceutical composition comprising the product oligonucleotide.

[0367] The compounds described herein can be prepared in a variety of ways. The compounds can be synthesized using various synthetic methods. At least some of these methods are known in the art of synthetic organic chemistry. The compounds described herein can be prepared from readily available starting materials. Optimum reaction conditions can vary with the particular reactants or solvent used, but such conditions can be determined by one skilled in the art by routine optimization procedures.

[0368] Additionally, compound synthesis can involve the protection and deprotection of various chemical groups. The use of protection and deprotection, and the selection of appropriate protecting groups can be determined by one skilled in the art. The chemistry of protecting groups can be found, for example, in Wuts, Greene’s Protective Groups in Organic Synthesis, 5th. Ed., Wiley & Sons, 2014, which is incorporated herein by reference in its entirety.

[0369] Product or intermediate formation can be monitored according to any suitable method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance spectroscopy (e.g.,1H or13C) infrared spectroscopy, spectrophotometry (e.g., UV-visible), or mass spectrometry, or by chromatography such as high- performance liquid chromatography (HPLC) or thin layer chromatography.

[0370] The compounds described herein can be prepared via a two step process, including an activation step followed by a coupling step. During the activation step, a TEA salt of a desired (modified) guanosine-5’-diphosphate is dissolved in a solvent mixture (usually water / DMSO) and activated with an activating reagent such as 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride salt (EDC.HCl salt), followed by addition of imidazole. After a period of time, an activated intermediate (imidazolide) is formed and prepared for use in a coupling step. The activated intermediate is then coupled with the desired (modified) dinucleotide.

[0371] Alternatively, a TEA salt of a diphosphate of the desired (modified) dinucleotide is dissolved in a solvent mixture (usually water / DMSO) and activated with an activating reagent suchAttorney Ref.01355-0007-00PCT as 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride salt (EDC.HCl salt), followed by addition of imidazole. After a period of time, an activated intermediate (imidazolide) is formed and prepared for use in a coupling step. The activated intermediate is then coupled with the TEA salt of the modified guanosine-5’-monophosphate.

[0372] Both general synthesis routes are depicted below in the Examples section as Scheme 1 and Scheme 2. Scheme 1 and Scheme 2 are provided for representative purposes only, and those of ordinary skill in the art will understand that the schemes can be applied, with modifications within the purview of those of skill in the art along with the disclosures in the Examples section, to any of the compounds described herein (e.g., compounds A-1 and A-2).

[0373] The oligonucleotides described herein can be synthesized by either of two routes. The first route involves solid-phase synthesis using phosphoramidite chemistry and the second route involves intracellular transcription with co-transcriptional capping. In embodiments, the oligonucleotides described herein are synthesized via solid-phase synthesis using phosphoramidite chemistry.

[0374] In embodiments, the oligonucleotide is prepared via chemical synthesis. In embodiments the oligonucleotide comprises fewer than 500 nucleotides. In embodiments the oligonucleotide comprises fewer than 400 nucleotides. In embodiments the oligonucleotide comprises fewer than 300 nucleotides. In embodiments the oligonucleotide comprises fewer than 200 nucleotides. In embodiments the oligonucleotide comprises fewer than 150 nucleotides. In embodiments the oligonucleotide comprises fewer than 100 nucleotides. In embodiments the oligonucleotide comprises fewer than 75 nucleotides. In embodiments the oligonucleotide comprises fewer than 50 nucleotides.

[0375] In embodiments the oligonucleotide comprises from about 50 to about 500 nucleotides. In embodiments the oligonucleotide comprises from about 75 to about 400 nucleotides. In embodiments the oligonucleotide comprises from about 75 to about 300 nucleotides. In embodiments the oligonucleotide comprises from about 75 to about 200 nucleotides. In embodiments the oligonucleotide comprises from about 75 to about 150 nucleotides.

[0376] In an aspect, provided herein is a method for purifying oligonucleotides described herein, including in embodiments, wherein the purification method is a chromatographic method which allows for the separation of the capped oligonucleotides from uncapped oligonucleotides. In embodiments, the chromatographic method is HPLC method. In embodiments, the HPLC method is RP HPLC method. In embodiments, the chromatographic method is IPRP HPLC method.Attorney Ref.01355-0007-00PCT

[0377] In embodiments, provided herein is a method wherein the oligonucleotide comprises a removable purification handle, and the removable purification handle is removed after the separation of the capped oligonucleotides from uncapped oligonucleotides.

[0378] It is very surprising that even a relatively small molecule such as a modified trityl on the cap of the oligonucleotide (specifically in the N2 position of G - the guanosine 5'-triphosphate (Gppp)) can help separate capped oligonucleotides that are hundreds of nucleotides long from uncapped oligonucleotides. Here it was shown that a 4, 4’, 4’’-dimethylmethoxytrityl group in the N2 position of G (guanosine 5'-triphosphate (Gppp)) can help separate capped 100mer oligonucleotides from uncapped oligonucleotides.

[0379] These small molecules covalently bound to the cap of the RNA molecules or oligonucleotides can help separate capped RNA molecules or oligonucleotides from uncapped / truncated RNA molecules or oligonucleotides.

[0380] In embodiments, described herein are oligonucleotides comprising an initiating capped oligonucleotide primer, stereoisomer, or salt thereof, wherein the initiating capped oligonucleotide primer has the formulaN2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppA2’OMepG. In embodiments, described herein are oligonucleotides comprising an initiating capped oligonucleotide primer, stereoisomer, or salt thereof, wherein the initiating capped oligonucleotide primer has the formulaN2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppGpG. In embodiments, described herein are oligonucleotides comprising a 5’-cap, wherein the 5’-cap comprises any one of the compounds described herein.

[0381] In embodiments, provided herein are pharmaceutical compositions comprising the oligonucleotide comprising any one of the compounds described herein, or a stereoisomer, or salt thereof, and a pharmaceutically acceptable excipient. In embodiments, provided herein are pharmaceutical compositions comprising the oligonucleotide comprising an initiating capped oligonucleotide primer, or a stereoisomer, or salt thereof, and a pharmaceutically acceptable excipient. In embodiments, provided herein are pharmaceutical compositions comprising any initiating capped oligonucleotide primer described herein, or a stereoisomer or salt thereof, and a pharmaceutically acceptable excipient.

[0382] In embodiments, provided herein are methods of inducing a therapeutic effect in a subject, the methods comprising administering to the subject an RNA molecule or oligonucleotide as described herein. In embodiments, the administered RNA may contain some amount of immunogenic double stranded RNA (dsRNA). The amount of dsRNA is calculated per each ug of administered RNA. In embodiments, provided herein are methods of administering to a subject aAttorney Ref.01355-0007-00PCT therapeutic dose unit of an mRNA molecule or an oligonucleotide comprising a 5’-cap, wherein the 5’-cap comprises any one of the compounds or initiating capped oligonucleotide primers described herein.

[0383] In embodiments, the 5’-cap analog described herein is useful for optimized in vivo translation of mRNAs, as further detailed herein.

[0384] In embodiments, provided herein is a method of administering to a mammal a dose of an mRNA molecule or an oligonucleotide comprising a 5’-cap as described herein. In embodiments, the 5’-cap comprises an initiating capped oligonucleotide primer of formulaN2-enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a, solvate, or hydrate, thereof. In embodiments, the 5’-cap comprises an initiating capped oligonucleotide primer of formulaN2-enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a, solvate, or hydrate, thereof.

[0385] In embodiments, provided herein are initiating capped oligonucleotide primer, stereoisomer, or a salt thereof, of any one of the compounds described herein. In embodiments, provided herein is an RNA molecule comprising the initiating capped oligonucleotide primer, stereoisomer, or a salt thereof, of any one of the compounds described herein. In embodiments, provided herein is an oligonucleotide comprising the initiating capped oligonucleotide primer, stereoisomer, or a salt thereof, of any one of the compounds described herein. In embodiments, the salt is a sodium salt, a lithium salt, or a potassium salt. In embodiments, the salt is a sodium salt. In embodiments, the salt is a lithium salt. In embodiments, the salt is a potassium salt. In embodiments, the salt is a triethylamine salt. In embodiments, the salt is a pharmaceutically acceptable salt.

[0386] In embodiments, provided herein is a pharmaceutical composition comprising the oligonucleotide comprising any one of the initiating capped oligonucleotide primer compounds described herein, and a pharmaceutically acceptable excipient. In embodiments, the pharmaceutical composition comprising the oligonucleotide comprising any one of the initiating capped oligonucleotide primers described herein and a pharmaceutically acceptable excipient, may be used in vaccines. In embodiments, the vaccines may be vaccines against infectious diseases or cancer. In embodiments, the pharmaceutical composition comprising the oligonucleotide comprising any one of the initiating capped oligonucleotide primers described herein and a pharmaceutically acceptableAttorney Ref.01355-0007-00PCT excipient, may be used in genetic vaccination, wherein an immune response is stimulated by introduction of a suitable oligonucleotide, into a subject, which codes for an antigen or a fragment thereof. These vaccine strategies can require large quantities of capped oligonucleotide. The present methods facilitate such synthesis and subsequent purification of capped oligonucleotide so as to make these vaccines commercially feasible.

[0387] In embodiments, provided herein is a method of inducing a therapeutic effect in a subject, comprising administering to the subject an oligonucleotide comprising any one of the compounds or pharmaceutical compositions described herein.

[0388] In embodiments, provided herein is a method of administering to a subject a therapeutic dose unit of an oligonucleotide comprising a 5’-cap, wherein the 5’-cap comprises a compound of any one of the initiating capped oligonucleotide primers described herein. Pharmaceutical Compositions and Formulations

[0389] In embodiments, the compounds provided herein may be provided as a pharmaceutically acceptable salt (See, Berge et al., J. Pharm. Sci.1977, 66, 1-19; and “Handbook of Pharmaceutical Salts, Properties, and Use,” Stahl and Wermuth, Ed.; Wiley-VCH and VHCA, Zurich, 2002).

[0390] In embodiments, provided herein are pharmaceutical compositions including one or more of the compounds described herein and a pharmaceutically acceptable excipient. As used herein, the term pharmaceutically acceptable salt refers to those salts of the compound described herein or derivatives thereof that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of subjects without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, and effective for their intended use, as well as the zwitterionic forms, where possible, of the compounds described herein. The term salts refers to the relatively non-toxic, inorganic and organic acid addition salts of the compounds described herein. These salts can be prepared in situ during the isolation and purification of the compounds or by separately reacting the purified compound in its free base form with a suitable organic or inorganic acid and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate mesylate, glucoheptonate, lactobionate, methane sulphonate, and laurylsulphonate salts, and the like. These may include cations based on the alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium,Attorney Ref.01355-0007-00PCT quaternary ammonium, and amine cations including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. (See S.M. Barge et al., J. Pharm. Sci. (1977) 66, 1, which is incorporated herein by reference in its entirety, at least, for compositions taught therein.)

[0391] In embodiments, compounds described herein are in aqueous solution with sodium salt. In embodiments, compounds described herein are in aqueous solution with lithium salt. In embodiments, compounds described herein are in aqueous solution with potassium salt. In embodiments, compounds described herein are in aqueous solution with triethylammonium salt.

[0392] The compounds provided herein may also be provided as a prodrug, which is a functional derivative of the compound, for example, of formula I and is readily convertible into the parent compound in vivo. Prodrugs are often useful because, in some situations, they may be easier to administer than the parent compound. They may, for instance, be bioavailable by oral administration whereas the parent compound is not. The prodrug may also have enhanced solubility in pharmaceutical compositions over the parent compound. A prodrug may be converted into the parent drug by various mechanisms, including enzymatic processes and metabolic hydrolysis. See Harper, Progress in Drug Research 1962, 4, 221-294; Morozowich et al. in “Design of Biopharmaceutical Properties through Prodrugs and Analogs,” Roche Ed., APHA Acad. Pharm. Sci.1977; “Bioreversible Carriers in Drug in Drug Design, Theory and Application,” Roche Ed., APHA Acad. Pharm. Sci.1987; “Design of Prodrugs,” Bundgaard, Elsevier, 1985; Wang et al., Curr. Pharm. Design 1999, 5, 265-287; Pauletti et al., Adv. Drug. Delivery Rev.1997, 27, 235-256; Mizen et al., Pharm. Biotech.1998, 11, 345-365; Gaignault et al., Pract. Med. Chem. 1996, 671-696; Asgharnejad in “Transport Processes in Pharmaceutical Systems,” Amidon et al., Ed., Marcell Dekker, 185-218, 2000; Balant et al., Eur. J. Drug Metab. Pharmacokinet.1990, 15, 143-53; Balimane and Sinko, Adv. Drug Delivery Rev.1999, 39, 183-209; Browne, Clin. Neuropharmacol.1997, 20, 1-12; Bundgaard, Arch. Pharm. Chem.1979, 86, 1-39; Bundgaard, Controlled Drug Delivery 1987, 17, 179-96; Bundgaard, Adv. Drug Delivery Rev.1992, 8, 1-38; Fleisher et al., Adv. Drug Delivery Rev.1996, 19, 115-130; Fleisher et al., Methods Enzymol.1985, 112, 360-381; Farquhar et al., J. Pharm. Sci.1983, 72, 324-325; Freeman et al., J. Chem. Soc., Chem. Commun.1991, 875-877; Friis and Bundgaard, Eur. J. Pharm. Sci.1996, 4, 49-59; Gangwar et al., Des. Biopharm. Prop. Prodrugs Analogs, 1977, 409-421; Nathwani and Wood, Drugs 1993, 45, 866-94; Sinhababu and Thakker, Adv. Drug Delivery Rev.1996, 19, 241-273; Stella et al., Drugs 1985, 29, 455-73; Tan et al., Adv. Drug Delivery Rev.1999, 39, 117-151; Taylor, Adv. Drug Delivery Rev.1996, 19, 131-148; Valentino and Borchardt, Drug Discovery Today 1997, 2, 148-Attorney Ref.01355-0007-00PCT 155; Wiebe and Knaus, Adv. Drug Delivery Rev.1999, 39, 63-80; and Waller et al., Br. J. Clin. Pharmac.1989, 28, 497-507.

[0393] Administration of the oligonucleotides and compositions described herein, or salts thereof can be carried out using therapeutically effective amounts of the oligonucleotides and compositions described herein or salts thereof as described herein for periods of time effective to treat or prevent a disease or disorder. The effective amount of the oligonucleotides and compositions described herein or salts thereof as described herein may be determined by one of ordinary skill in the art. In embodiments, the salts are pharmaceutically acceptable salts.

[0394] Those of skill in the art will understand that the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors, including the activity of the specific oligonucleotides employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition.

[0395] The precise dose to be employed in the formulation will also depend on the route of administration, and should be decided according to the judgment of the practitioner and each subject's circumstances. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems. Further, depending on the route of administration, one of skill in the art would know how to determine doses that result in a plasma concentration for a desired level of response in the cells, tissues and / or organs of a subject.

[0396] Any suitable formulation of the oligonucleotides described herein can be prepared. See generally, Remington's Pharmaceutical Sciences, (2000) Hoover, J. E. editor, 20 th edition, Lippincott Williams and Wilkins Publishing Company, Easton, Pa., pages 780-857. A formulation is selected to be suitable for an appropriate route of administration. In embodiments, the oligonucleotide of formula (Ib) is formulated for oral administration; in other embodiments, the oligonucleotide is formulated for parenteral administration, such as injection or infusion.

[0397] Where contemplated oligonucleotides are administered in a pharmacological composition, it is contemplated that the oligonucleotides can be formulated in admixture with a pharmaceutically acceptable excipient and / or carrier. For example, contemplated oligonucleotides can be administered orally as neutral compounds or as salts, or intravenously in a physiological saline solution. Conventional buffers such as phosphates, bicarbonates or citrates can be used for this purpose. Of course, one of ordinary skill in the art may modify the formulations within the teachings of the specification to provide numerous formulations for a particular route ofAttorney Ref.01355-0007-00PCT administration. In particular, contemplated compounds may be modified to render them more soluble in water or other vehicle, which for example, may be easily accomplished with minor modifications (salt formulation, esterification, etc.) that are well within the ordinary skill in the art. It is also well within the ordinary skill of the art to modify the route of administration and dosage regimen of a particular compound in order to manage the pharmacokinetics of the present compounds for maximum beneficial effect in a patient.

[0398] Depending on the intended mode of administration, the pharmaceutical composition can be in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, or suspensions, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include a therapeutically effective amount of the oligonucleotides described herein or derivatives thereof in combination with a pharmaceutically acceptable carrier and, in addition, may include other medicinal agents, pharmaceutical agents, carriers / excipients or diluents. By pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, which can be administered to an individual along with the selected compound without causing unacceptable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained.

[0399] To practice the method of the present invention, oligonucleotides having formula (Ib) and pharmaceutical compositions thereof may be administered orally, parenterally, by inhalation, topically (including transdermally, buccally, and sublingually), rectally, nasally, vaginally, via an implanted reservoir, or other drug administration methods. The term “parenteral” as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The compositions may be prepared by any method well known in the art of pharmacy.

[0400] Such methods include the step of bringing in association compounds of the invention or combinations thereof with any auxiliary agent. The auxiliary agent(s), also named accessory ingredient(s), include those conventional in the art, such as excipients (e.g., starch, lactose), fillers, binders (e.g., gelatin, cellulose, gum tragacanth), diluents, disintegrants (e.g., alginate, Primogel, and corn starch), lubricants (e.g., magnesium stearate, silicon dioxide), colorants, flavouring agents (e.g., glucose, sucrose, saccharin, methyl salicylate, and peppermint), anti-oxidants, wetting agents, or other material well known in the art for use in pharmaceutical formulations.Attorney Ref.01355-0007-00PCT

[0401] The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington: The Science and Practice of Pharmacy, 22d Edition, Loyd et al. eds., Pharmaceutical Press and Philadelphia College of Pharmacy at University of the Sciences (2012).

[0402] Examples of physiologically acceptable carriers include buffers, such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and / or nonionic surfactants, such as TWEEN® (ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICSTM(BASF; Florham Park, NJ).

[0403] Compositions containing the oligonucleotides described herein or derivatives thereof suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

[0404] These compositions may also contain adjuvants, such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be promoted by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Isotonic agents, for example, sugars, sodium chloride, and the like may also be included. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0405] Solid dosage forms for oral administration of the oligonucleotides described herein or derivatives thereof include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the compounds described herein or derivatives thereof is admixed with at least one inert customary excipient (or carrier), such as sodium citrate or dicalcium phosphate, or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders,Attorney Ref.01355-0007-00PCT as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar- agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example, paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants, as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents.

[0406] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.

[0407] Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others known in the art. They may contain opacifying agents and can also be of such composition that they release the active compound or compounds in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions that can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above- mentioned excipients.

[0408] Liquid dosage forms for oral administration of the oligonucleotides described herein or derivatives thereof include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethyleneglycols, and fatty acid esters of sorbitan, or mixtures of these substances, and the like.

[0409] Besides such inert diluents, the composition can also include additional agents, such as wetting, emulsifying, suspending, sweetening, flavoring, or perfuming agents.

[0410] Suspensions, in addition to the active compounds, may contain additional agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, orAttorney Ref.01355-0007-00PCT mixtures of these substances, and the like.

[0411] Routes of topical administration include nasal, bucal, mucosal, rectal, or vaginal applications. Compositions of the oligonucleotides described herein or derivatives thereof for rectal administrations are optionally suppositories, which can be prepared by mixing the compounds with suitable non-irritating excipients or carriers, such as cocoa butter, polyethyleneglycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and, therefore, melt in the rectum or vaginal cavity and release the active component.

[0412] Dosage forms for topical administration of the oligonucleotides described herein or derivatives thereof include ointments, lotions, creams, gels, pastes, suspensions, drops, powders, sprays, inhalants, and transdermal patches. One or more thickening agents, humectants, and stabilizing agents can be included in the formulations. Examples of such agents include, but are not limited to, polyethylene glycol, sorbitol, xanthan gum, petrolatum, beeswax, or mineral oil, lanolin, squalene, and the like. Methods for preparing transdermal patches are disclosed, e.g., in Brown, et al. (1988) Ann. Rev. Med.39:221-229 which is incorporated herein by reference. The oligonucleotides described herein or derivatives thereof are admixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as may be required. Ophthalmic formulations, ointments, powders, and solutions are also contemplated as being within the scope of the compositions.

[0413] Optionally, the oligonucleotides described herein can be contained in a drug depot. A drug depot comprises a physical structure to facilitate implantation and retention in a desired site (e.g., a synovial joint, a disc space, a spinal canal, abdominal area, a tissue of the patient, etc.). The drug depot can provide an optimal concentration gradient of the compound at a distance of up to about 0.1 cm to about 5 cm from the implant site. A depot, as used herein, includes but is not limited to capsules, microspheres, microparticles, microcapsules, microfibers particles, nanospheres, nanoparticles, coating, matrices, wafers, pills, pellets, emulsions, liposomes, lipid nanoparticles (LNPs), micelles, gels, antibody-compound conjugates, protein-compound conjugates, or other pharmaceutical delivery compositions. Suitable materials for the depot include pharmaceutically acceptable biodegradable materials that are preferably FDA approved or GRAS materials. These materials can be polymeric or non-polymeric, as well as synthetic or naturally occurring, or a combination thereof. The depot can optionally include a drug pump.

[0414] For transdermal administration, e.g. gels, patches or sprays can be contemplated. Compositions or formulations suitable for pulmonary administration e.g. by nasal inhalationAttorney Ref.01355-0007-00PCT include fine dusts or mists which may be generated by means of metered dose pressurized aerosols, nebulisers or insufflators. A nasal aerosol or inhalation compositions can be prepared according to techniques well-known in the art of pharmaceutical formulation and can be prepared as solutions in, for example saline, employing suitable preservatives (for example, benzyl alcohol), absorption promoters to enhance bioavailability, and / or other solubilizing or dispersing agents known in the art.

[0415] The compositions may be presented in unit-dose or multi-dose containers, for example sealed vials and ampoules, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of sterile liquid carrier, for example water, prior to use.

[0416] In addition, the oligonucleotides disclosed herein or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a salt, solvate, hydrate, or prodrug thereof, may be administered alone or in combination with other therapeutic agents. Combination therapies according to the present invention comprise the administration of at least one exemplary oligonucleotide of the present disclosure and at least one other therapeutic agent in a pharmaceutical composition. The at least one exemplary oligonucleotide of the present disclosure and at least one other therapeutic agent(s) may be administered as a pharmaceutical composition separately or together. The amounts of the at least one exemplary oligonucleotide of the present disclosure and the at least one other therapeutic agent(s) and the relative timings of administration will be selected in order to achieve the desired combined therapeutic effect. Kits

[0417] In embodiments, provided herein are kits for purifying capped oligonucleotides from uncapped oligonucleotides. A kit can include any of the compounds or compositions described herein. For example, a kit can include one or more compounds of Formula (I). A kit can further include one or more additional reagents, such as reagents used for activating the compounds described herein. Optionally, a kit can contain a compound as described herein (also referred to herein as a cap analog), a container, and one or more reagents selected from a reaction buffer, magnesium, and activation reagents. In embodiments, a kit contains a compound as described herein (also referred to herein as a cap analog), a container, one or more phosphoramidites, a reaction buffer, magnesium, solid support for oligosynthesis, oligosynthesis reagents, and chromatography media and HPLC buffers for separation of capped oligonucleotides from uncapped / truncated oligonucleotides. A kit can additionally include directions for use of the kitAttorney Ref.01355-0007-00PCT (e.g., instructions for performing the capping of the oligonucleotide and purification of the capped oligonucleotide), a means for administering oligonucleotide (e.g., a syringe), and / or a carrier.

[0418] LIST OF SEQUENCES:

[0419] Sequence modifications: Am, Gm, Cm, Um = 2’-OMe adenosine, 2’-OMe guanosine, 2’-OMe cytidine, 2’-OMe uridine respectively.

[0420] SEQ ID NO:1: 5’monophosphate-GGCGCUUCUAUCUGAUUACUCUGAGCGC CAUCACCAGCGACUAUGUCUAGUGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAGAG AGGAGGACGGCCUGGC

[0421] SEQ ID NO:2: 5’monophosphate-AmGCGCUUCUAUCUGAUUACUCUGAGCG CCAUCACCAGCGACUAUGUCUAGUGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAGA GAGGAGGACGGCCUGGC

[0422] SEQ ID NO:3: 5’monophosphate- GGCGCUUCUA

[0423] SEQ ID NO:1 is also GG-SEQ1A; SEQ ID NO:2 is also AmG-SEQ2A; SEQ ID NO:3 is also GG-SEQ3A. Methods for making compounds of the invention.

[0424] Compounds of the invention are readily prepared using methods illustrated in Scheme 1, Scheme 2, and the examples herein, in view of knowledge in the art.

[0425] As used herein, common organic chemistry abbreviations are defined as follows: Ac Acetyl ACN Acetonitrile AcOH Acetic acid aq. Aqueous AX chromatography Ani...

Claims

Attorney Ref.01355-0007-00PCT What is claimed is:

1. A compound of formula (I)or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein: each B1and B2is independently a natural, modified, or unnatural nucleoside base; Ring A is a substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; each Q is independently a bond, -O-, -C(R6R8)-, -S-, or -N(R9)-; each X1is independently -O-, -CH2-, -CX2-, -CHX-, -N(R101)-, -BH-, or -S-; each Y1is independently O, S, or Se; each Z1is independently -OH, -SH, -BH3, substituted or unsubstituted -O-alkyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, or substituted or unsubstituted -O-aryl; R1is hydrogen, –C(O)R1A, –C(O)OR1A, –OR1A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; R2is hydrogen, –C(O)R2A, –C(O)OR2A, –OR2A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted orAttorney Ref.01355-0007-00PCT unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R1and R2together with the nitrogen atom to which they are connected form a substituted or unsubstituted heteroaryl or a substituted or unsubstituted heterocyclyl; R3is hydrogen, –C(O)R3A, –C(O)OR3A, –OR3A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R4is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR4A, -NR4AR4B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R5is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR5A, -NR5AR5B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or an R4and R5attached to the same ring, together with the carbon atoms to which they are connected form a substituted or unsubstituted cycloalkylene or substituted or unsubstituted heterocycloalkylene; each R1A, R2A, R3A, R4A, R4B, R5A, and R5Bare independently hydrogen, -CX3, -CHX2, -CH2X, -C(O)OH, -C(O)NH2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)OH, -NHOH, -OCX3, -OCHX2, -OCH2X, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; orAttorney Ref.01355-0007-00PCT R4Aand R4Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; R5Aand R5Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; each R6, R8, R9, and R101are independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OH, -NH2,-COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2,-OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; n is an integer from 0 to 3; m is an integer from 0 to 8; and X is -Cl, -Br, -I or –F.

2. An oligonucleotide of formula (Ib):or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein: oligonucleotide is one or more nucleotides;Attorney Ref.01355-0007-00PCT each B1and B2is independently a natural, modified, or unnatural nucleoside base; Ring A is a substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; each Q is independently a bond, -O-, -C(R6R8)-, -S-, or -N(R9)-; each X1is independently -O-, -CH2-, -CX2-, -CHX-, -N(R101)-, -BH-, or -S-; each Y1is independently O, S, or Se; each Z1is independently -OH, -SH, -BH3, substituted or unsubstituted -O-alkyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, or substituted or unsubstituted -O-aryl; R1is hydrogen, –C(O)R1A, –C(O)OR1A, –OR1A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; R2is hydrogen, –C(O)R2A, –C(O)OR2A, –OR2A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R1and R2together with the nitrogen atom to which they are connected form a substituted or unsubstituted heteroaryl or a substituted or unsubstituted heterocyclyl; R3is hydrogen, –C(O)R3A, –C(O)OR3A, –OR3A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R4is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR4A, -NR4AR4B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R5is independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, - CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OR5A, -NR5AR5B, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2,Attorney Ref.01355-0007-00PCT -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or an R4and R5attached to the same ring, together with the carbon atoms to which they are connected form a substituted or unsubstituted cycloalkylene or substituted or unsubstituted heterocycloalkylene; each R1A, R2A, R3A, R4A, R4B, R5A, and R5Bare independently hydrogen, -CX3, -CHX2, -CH2X, -C(O)OH, -C(O)NH2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)OH, -NHOH, -OCX3, -OCHX2, -OCH2X, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R4Aand R4Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; R5Aand R5Bsubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; each R6, R8, R9, and R101are independently hydrogen, halogen, -CCl3, -CBr3, -CF3, -CI3, -CHCl2, -CHBr2, -CHF2, -CHI2, -CH2Cl, -CH2Br, -CH2F, -CH2I, -CN, -OH, -NH2,-COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2,-OCHBr2, -OCHI2, -OCHF2, -OCH2Cl, -OCH2Br, -OCH2I, -OCH2F, -N3, -SF5, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; n is an integer from 0 to 3; m is an integer from 0 to 8; and X is -Cl, -Br, -I or –F.

3. The compound of claim 1 or the oligonucleotide of claim 2, wherein the structure of formula (I) or (Ib) comprises one or more removable purification handle(s).

4. The compound or oligonucleotide of any one of claims 1-3, wherein the salt is a pharmaceutically acceptable salt.Attorney Ref.01355-0007-00PCT 5. The compound or oligonucleotide of any one of claims 1-4, wherein m is 0 or 1.

6. The compound or oligonucleotide of any one of claims 1-5, wherein Ring A is a substituted or unsubstituted heterocycloalkylene.

7. The compound or oligonucleotide of claim 6, wherein Ring A is a substituted or unsubstituted ribose ring.

8. The compound or oligonucleotide of claim 6, wherein Ring A is a substituted or unsubstituted morpholino ring.

9. The compound or oligonucleotide of any one of claims 1-8, wherein each Q is independently a bond or -NR9-.

10. The compound or oligonucleotide of claim 9, wherein each Q is independently a bond.

11. The compound or oligonucleotide of claim 9, wherein each Q is independently -NH- or -N(CH3)-.

12. The compound or oligonucleotide of claim 11, wherein each Q is independently -NH-.

13. The compound or oligonucleotide of any one of claims 1-12, wherein each X1is independently -O-, -CH2-, -CX2-, -N(R101)-, or -BH-.

14. The compound or oligonucleotide of claim 13, wherein each X1is independently -O-, -CH2-, -CF2-, -NH-, or -BH-.

15. The compound or oligonucleotide of claim 14, wherein each X1is independently -O-.

16. The compound or oligonucleotide of any one of claims 1-15, wherein each Y1is independently O or S.

17. The compound or oligonucleotide of claim 16, wherein each Y1is independently O.

18. The compound or oligonucleotide of any one of claims 1-17, wherein n is 1 or 2.

19. The compound or oligonucleotide of claim 18, wherein n is 1.

20. The compound or oligonucleotide of any one of claims 1-19, wherein each Z1is independently -OH.

21. The compound or oligonucleotide of any one of claims 1-20, wherein R1is hydrogen, silyl, –C(O)OR1A, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted aryl.

22. The compound or oligonucleotide of any one of claims 1-21, wherein R1is hydrogen, silyl, or substituted or unsubstituted alkyl.

23. The compound or oligonucleotide of claim 22, wherein R1is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, benzyl, t-butyldimethyl silyl (TBDMS), t-butyldiphenyl silylAttorney Ref.01355-0007-00PCT (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’-isopropylmethylmethoxytrityl, or 4, 4’, 4’’-dimethylmethoxytrityl.

24. The compound or oligonucleotide of claim 23, wherein R1is hydrogen or 4, 4’, 4’’- dimethylmethoxytrityl.

25. The compound or oligonucleotide of any one of claims 1-24, wherein R2is hydrogen, silyl, –C(O)OR2A, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted aryl.

26. The compound or oligonucleotide of claim 25, wherein R2is hydrogen, silyl, or substituted or unsubstituted alkyl.

27. The compound or oligonucleotide of any one of claims 1-26, wherein R2is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, benzyl, t-butyldimethyl silyl (TBDMS), t- butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’-isopropylmethylmethoxytrityl, or 4, 4’, 4’’-dimethylmethoxytrityl.

28. The compound or oligonucleotide of claim 27, wherein R2is hydrogen or 4, 4’, 4’’- dimethylmethoxytrityl.

29. The compound or oligonucleotide of any one of claims 1-28, wherein R3is hydrogen, silyl, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl.

30. The compound or oligonucleotide of any one of claims 1-29, wherein R3is hydrogen, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, hexyl, phenyl, benzyl, 4- chlorobenzyl, t-butyldimethyl silyl (TBDMS), t-butyldiphenyl silyl (TBDPS), dimethoxytrityl (DMT), trimethoxytrityl (TMT), monomethoxytrityl (MMT), modified trityl, 4, 4’, 4’’- isopropylmethylmethoxytrityl, or 4, 4’, 4’’-dimethylmethoxytrityl.

31. The compound or oligonucleotide of claim 30, wherein R3is methyl.

32. The compound or oligonucleotide of any one of claims 1-31, wherein each R4is independently hydrogen.

33. The compound or oligonucleotide of any one of claims 1-32, wherein each R5is independently hydrogen, halogen, or -OR5A.

34. The compound or oligonucleotide of any one of claims 1-33, wherein each R5is independently hydroxy, methoxy, ethoxy, propoxy, butoxy, or t-butoxy.

35. The compound or oligonucleotide of claim 34, wherein each R5is independently methoxy.

36. The compound or oligonucleotide of any one of claims 1-31, wherein at least one R4forms a ring together with the R5within four atoms of said R4and the atoms to which they are connected, thereby forming a locked nucleic acid (LNA).Attorney Ref.01355-0007-00PCT 37. The compound or oligonucleotide of any one of claims 1-36, wherein each B2is independently a natural nucleoside base.

38. The compound or oligonucleotide of claim 37, wherein each B2is independently adenine, N6-methyladenine, guanine, uracil, or cytosine.

39. The compound or oligonucleotide of any one of claims 1-38, wherein B1is adenine, N6- methyladenine, guanine, uracil, cytosine, inosine,wherein each R10is independently hydrogen, –C(O)R1A, –C(O)OR1A, –OR1A, silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

40. The compound or oligonucleotide of any one of claims 3-39, wherein R1, and / or R2, and / or R3comprise the one or more removable purification handle(s), and / or wherein the one or more removable purification handle(s) are attached to Ring A, and / or nucleobase B1of the structure of formula (I) or (Ib).

41. The compound or oligonucleotide of claim 40, wherein the one or more removable purification handle(s) are attached to nucleobase B1of the structure of formula (I) or (Ib).

42. The compound or oligonucleotide of claim 40, wherein R1, and / or R2, and / or R3comprise the one or more removable purification handle(s).

43. The compound or oligonucleotide of claim 40, wherein the one or more removable purification handle(s) are attached to Ring A of the structure of formula (I) or (Ib).

44. The compound or oligonucleotide of any one of claims 3-43, wherein each removable purification handle is independently silyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.Attorney Ref.01355-0007-00PCT 45. The compound or oligonucleotide of any one of claims 1-44, wherein each removable purification handle is independently trityl, ethyl ethers, fluorenylmethyloxycarbonyl (Fmoc), t- butyldimethyl silyl (TBDMS), t-butyldiphenyl silyl (TBDPS), trimethoxytrityl (TMT), dimethoxytrityl (DMT), monomethoxytrityl (MMT), 4, 4’, 4’’-dimethylmethoxytrityl, 4, 4’, 4’’- isopropylmethylmethoxytrityl, or a modified trityl.

46. The compound or oligonucleotide of any one of claims 3-45, wherein at least one removable purification handle is 4, 4’, 4’’-dimethylmethoxytrityl.

47. The compound or oligonucleotide of any one of claims 3-46, wherein R1and / or R2comprise the one or more removable purification handle(s).

48. The compound or oligonucleotide of claim 47, wherein R1and / or R2is or comprises 4, 4’, 4’’-dimethylmethoxytrityl.

49. A compound of the following structure:, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof.

50. A compound of the following structure:, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptableAttorney Ref.01355-0007-00PCT salt, solvate, or hydrate thereof.

51. An oligonucleotide comprising the compound A-1, stereoisomer, or a salt thereof, wherein the oligonucleotide has the structure of formula A-1b:, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein oligonucleotide is one or more nucleotides.

52. An oligonucleotide comprising the compound A-2, stereoisomer, or a salt thereof, wherein the compound has the structure of formula A-2b:, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; wherein oligonucleotide is one or more nucleotides.

53. The compound or oligonucleotide of any one of claims 49-52, wherein the ribose moiety is a D-ribose moiety and one or both 2’-methoxyribose moieties are 2’-methoxy-D-ribose moieties.Attorney Ref.01355-0007-00PCT 54. The compound or oligonucleotide of any one of claims 1-53, wherein the salt is a sodium salt, a lithium salt, or a potassium salt.

55. The compound or oligonucleotide of claim 54, wherein the salt is a sodium salt.

56. A pharmaceutical composition comprising a compound or an oligonucleotide of any one of claims 1-55 and a pharmaceutically acceptable excipient.

57. An initiating capped oligonucleotide primer of the following formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppA2’OMepG, or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a salt, solvate, or hydrate thereof.

58. An initiating capped oligonucleotide primer of the following formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppGpG,enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a salt, solvate, or hydrate thereof.

59. An oligonucleotide comprising an initiating capped oligonucleotide primer, or a stereoisomer or salt thereof, wherein the initiating capped oligonucleotide primer has the formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppA2’OMepG.

60. An oligonucleotide comprising an initiating capped oligonucleotide primer, or a stereoisomer or salt thereof, wherein the initiating capped oligonucleotide primer has the formula:N2-(4, 4’, 4’’-dimethylmethoxytrityl), m7G3'OMepppGpG.

61. The initiating capped oligonucleotide primer or oligonucleotide comprising the initiating capped oligonucleotide primer of any one of claims 57-60, wherein the salt is a sodium salt, a lithium salt, or a potassium salt.

62. The initiating capped oligonucleotide primer or oligonucleotide comprising the initiating capped oligonucleotide primer of claim 61, wherein the salt is a sodium salt.

63. A pharmaceutical composition comprising the initiating capped oligonucleotide primer or oligonucleotide comprising the initiating capped oligonucleotide primer, or stereoisomer or salt thereof, of any one of claims 57-62, and a pharmaceutically acceptable excipient.

64. A method of inducing a therapeutic effect in a subject, comprising administering to the subject an oligonucleotide according to any one of claims 2-48, 51-55, or 59-62, or a pharmaceutical composition according to claim 56 or 63.

65. A method of inducing a therapeutic effect in a subject, comprising removing the removable purification handle from the oligonucleotide according to any one of claims 3-48, 51-55, or 59-62, thereby providing a product oligonucleotide, and administering to the subject the productAttorney Ref.01355-0007-00PCT oligonucleotide or a pharmaceutical composition comprising the product oligonucleotide.

66. A method of expressing a transgene in a subject, comprising administering to the subject an oligonucleotide according to any one of claims 2-48, 51-55, or 59-62, or a pharmaceutical composition according to claim 56 or 63, wherein the oligonucleotide comprises a sequence encoding the transgene.

67. A method of expressing a transgene in a subject, comprising removing the removable purification handle from the oligonucleotide according to any one of claims 3-48, 51-55, or 59-62, wherein the oligonucleotide comprises a sequence encoding the transgene, thereby providing a product oligonucleotide, and administering to the subject the product oligonucleotide or a pharmaceutical composition comprising the product oligonucleotide.

68. The oligonucleotide of any one of claims 2-48, 51-55, or 59-62, for use in therapy.

69. The pharmaceutical composition of claim 56 or 63, for use in therapy.

70. The compound, initiating capped oligonucleotide primer, or oligonucleotide of any one of claims 3-55 or 57-62, wherein the removable purification handle is not a photocleavable purification handle.

71. A method for purifying the oligonucleotides of any one of claims 2-48, 51-55, or 59-62, wherein the purification method is a chromatographic method which separates the capped oligonucleotides from uncapped oligonucleotides.

72. The method of claim 71, wherein the chromatographic method is an HPLC method.

73. The method of claim 71 or 72, wherein the oligonucleotide comprises a removable purification handle, and the removable purification handle is removed after the separation of the capped oligonucleotides from uncapped oligonucleotides.

Images