Genetically modified non-human animal with human or chimeric tau
Genetically modified animals with human or chimeric TAU proteins address the limitations of traditional animal models by creating a more accurate preclinical environment for drug screening, improving drug development efficiency and reducing costs.
Patent Information
- Application Number
- PCT/CN2025/081326
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-29
- Filing Date
- 2025-03-07
- Publication Date
- 2025-09-11
AI Technical Summary
Traditional drug research and development methods using in vitro and in vivo animal models fail to replicate the complex biological environment of human diseases, leading to high failure rates and discrepancies between animal test results and clinical trials.
Development of genetically modified non-human animals with human or chimeric TAU proteins, expressed through specific regulatory elements or inserted at safe harbor loci, to create models that mimic human biology and improve drug screening efficacy.
The humanized animal models reduce the differences between human and animal test results, enhancing drug development efficiency and reducing costs by providing a more accurate preclinical evaluation.
Smart Images

Figure CN2025081326_12092025_PF_FP_ABST
Abstract
Description
GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC TAU
[0001] CLAIM OF PRIORITY
[0002] This application claims the benefit of Chinese Patent Application App. No. 202410266705.1, filed on March 08, 2024, Chinese Patent Application App. No. 202411181880.7, filed on August 27, 2024, and Chinese Patent Application App. No. 202411375831.7, filed on September 29, 2024. The entire contents of the foregoing applications are incorporated herein by reference.TECHNICAL FIELD
[0003] This disclosure relates to genetically modified animal expressing human or chimeric (e.g., humanized) TAU and methods of use thereof.BACKGROUND
[0004] The traditional drug research and development typically use in vitro screening approaches. However, these screening approaches cannot provide the complex biological environment (such as tumor microenvironment, stromal cells, extracellular matrix components, and immune cell interaction, etc. ) , resulting in a higher rate of failure in drug development. In addition, in view of the differences between humans and animals, the test results obtained from the use of conventional experimental animals for in vivo pharmacological test may not reflect the real disease state and the interaction at the targeting sites, resulting in that the results in many clinical trials are significantly different from the animal experimental results.
[0005] Therefore, the development of humanized animal models that are suitable for human antibody and / or drug screening and evaluation will significantly improve the efficiency of new drug development and reduce the cost for drug research and development.SUMMARY
[0006] This disclosure is related to genetically-modified, non-human animals whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric microtubule associated protein (TAU) . In some embodiments, the sequence encoding the human or chimeric TAU is at an endogenous TAU gene locus in the at least one chromosome. In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to an endogenous regulatory element (e.g., an endogenous 5’ -UTR) . In some embodiments, the sequence encoding the human or chimeric TAU is at a safe harbor locus (e.g., Hipp11 or ROSA26) . In some embodiments, the sequence encoding the human or chimeric TAU is at a locus that is not an endogenous TAU gene locus and is not at a safe harbor locus. In some embodiments, the sequence encoding the human or chimeric TAU is inserted at a random locus in the genome (e.g., with BAC vector) . In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to a human regulatory element or a chimeric regulatory element. In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to a brain specific regulatory element (e.g., a mouse Prnp promoter) . In some embodiments, the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TAU (NP_001116538.2 (SEQ ID NO: 2) ) , SEQ ID NO: 5, or SEQ ID NO: 33. In some embodiments, the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence comprising a P301S mutation, optionally, wherein the amino acid sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5 or 33. In some embodiments, the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat. In some embodiments, the animal is a mouse. In some embodiments, the animal does not express endogenous TAU or expresses a decreased level of endogenous TAU as compared to TAU expression level in a wild-type animal. In some embodiments, the animal has one or more cells expressing human or chimeric TAU.
[0007] This disclosure is related to genetically-modified, non-human animals, wherein the genome of the animal comprises a replacement of a sequence encoding a region of an endogenous TAU with a sequence encoding a corresponding region of a human TAU at an endogenous TAU gene locus. In some embodiments, the sequence encoding a corresponding region of the human TAU is operably linked to an endogenous regulatory element at the endogenous TAU locus, and one or more cells of the animal expresses a human or chimeric TAU. In some embodiments, the animal does not express the endogenous TAU or expresses a decreased level of the endogenous TAU as compared to the TAU expression level in a wild-type animal. In some embodiments, the sequence encoding the corresponding region of the human TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, or a portion thereof, of a human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human TAU comprises a portion of exon 2 and the entire exons 3~15 of the human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human TAU comprises a portion of exon 2 and the entire exons 3~15, optionally including at least 50, 100, 150, 200, 250, or 300 bp contiguous nucleotides downstream of 3’ -UTR of the human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human TAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to the nucleotide sequence of positions 45962338 to 46028634 of NC_000017.11 or SEQ ID NO: 6. In some embodiments, the sequence encoding a region of the endogenous TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or a portion thereof, of the endogenous TAU gene. In some embodiments, the sequence encoding a region of the endogenous TAU comprises a portion of exon 2 and the entire exons 3~10 of the endogenous TAU gene. In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous TAU gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous TAU gene locus. In some embodiments, the animal is a mouse.
[0008] The disclosure further relates to non-human animals whose genome comprises an insertion of a sequence encoding a human or chimeric TAU. In some embodiments, the insertion is at a safe harbor locus (e.g., Hipp11 (or H11) or ROSA26 site) . In some embodiments, the insertion is at a random locus in the genome. In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to a brain specific regulatory element (e.g., mouse prion protein (Prnp) promoter) . In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to a human or chimeric regulatory element (e.g., a human TAU promoter) . In some embodiments, the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence comprising P301S mutation, optionally wherein the amino acid sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5 or 33. In some embodiments, the one or more cells of the non-human animal expresses a human or chimeric TAU.
[0009] This disclosure is related to methods for making a genetically-modified, non-human animal, comprising: replacing a sequence encoding a region of an endogenous TAU with a sequence encoding a corresponding region of a human or chimeric TAU, at an endogenous TAU gene locus. In some embodiments, the animal does not express the endogenous TAU or expresses a decreased level of endogenous TAU as compared to TAU expression level in a wild-type animal. In some embodiments, the sequence encoding a corresponding region of the human or chimeric TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, or a portion thereof, of a human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human or chimeric TAU comprises a portion of exon 2 and the entire exons 3~15 of the human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human or chimeric TAU comprises a portion of exon 2 and the entire exons 3~15, optionally including at least 50, 100, 150, 200, 250, or 300 bp contiguous nucleotides downstream of 3’ -UTR of the human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human or chimeric TAU is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to positions 45962338 to 46028634 of NC_000017.11 or SEQ ID NO: 6. In some embodiments, the sequence encoding a region of the endogenous TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or a portion thereof, of the endogenous TAU gene. In some embodiments, the sequence encoding the region of the endogenous TAU comprises a portion of exon 2, the entire exons 3~10 of the endogenous TAU gene. In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous TAU gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous TAU gene locus. In some embodiments, the animal is a mouse.
[0010] The disclosure further relates to methods for making a genetically-modified, non-human animal, comprising inserting a sequence encoding a human or chimeric TAU to the genome of the animal. In some embodiments, the sequence encoding a human or chimeric TAU is inserted at a safe harbor locus (e.g., Hipp11 (or H11) or ROSA26 locus) . In some embodiments, the sequence encoding a human or chimeric TAU is inserted at a random locus in the genome. In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to a brain specific regulatory element (e.g., a mouse Prnp promoter) . In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to a human or a chimeric regulatory element (e.g., a human TAU promoter) . In some embodiments, the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence comprising P301S mutation, optionally wherein the amino acid sequence is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5 or 33. In some embodiments, the non-human animal expresses a human or chimeric TAU. In some embodiments, the non-human animal is a mouse.
[0011] In one aspect, animals as described herein further comprises a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is one or more selected from the group consisting of Sonic Hedgehog (SHH) , Apolipoprotein E2 (APOE2) , Amyloid Beta Precursor-Like Protein 2 (APLP2) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , and Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) .
[0012] In one aspect, in the methods as described herein, the animals further comprise a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is one or more selected from the group consisting of SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGHT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.
[0013] In one aspect, the disclosure is related to methods of determining effectiveness of a therapeutic agent for the treatment of cancer, comprising: a) administering the therapeutic agent to the animal as described herein, wherein the animal has a tumor; and b) determining inhibitory effects of the therapeutic agent to the tumor. In some embodiments, the therapeutic agent is an anti-TAU antibody (e.g., an anti-human TAU antibody) . In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. In some embodiments, determining inhibitory effects of the anti-TAU antibody to the tumor involves measuring the tumor volume in the animal. In some embodiments, the cancer is a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.
[0014] In one aspect, the disclosure is related to methods of determining effectiveness of an anti-TAU antibody and an additional therapeutic agent for the treatment of cancer, comprising a) administering the anti-TAU antibody and the additional therapeutic agent to the animal as described herein, wherein the animal has a tumor; and b) determining inhibitory effects on the tumor. In some embodiments, the animal further comprises a sequence encoding a human or chimeric PD-1, a human or chimeric PD-L1, and / or a human or chimeric CTLA4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express PD-L1. In some embodiments, the tumor comprises one or more tumor cells that are injected into the animal. In some embodiments, determining inhibitory effects of the treatment involves measuring the tumor volume in the animal. In some embodiments, the animal has a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.
[0015] In one aspect, the disclosure is related to methods of determining effectiveness of a therapeutic agent for the treatment an immune disorder (e.g., an autoimmune disease) , comprising: a) administering the therapeutic agent to the animal as described herein, wherein the animal has the immune disorder; and b) determining effects of the therapeutic agent to the immune disorder. In some embodiments, the immune disorder (e.g., an autoimmune disease) is Alzheimer’s disease, Multiple sclerosis (MS) , systemic lupus erythematosus with neuropsychiatric manifestations (NPSLE) , Hashimoto’s encephalopathy (HE) , autoimmune encephalitis, and paraneoplastic neurological syndromes (PNS) .
[0016] In one aspect, the disclosure is related to methods of determining effectiveness of a therapeutic agent for reducing an inflammation, comprising: a) administering the therapeutic agent to the animal as described herein, wherein the animal has the inflammation; and b) determining effects of the therapeutic agent to the inflammation. In some embodiments, the inflammation comprises neuroinflammation, arthritis, nephritis, hepatitis, or inflammatory bowel disease (IBD) .
[0017] In one aspect, the disclosure is related to methods of determining effectiveness of a therapeutic agent for the treatment of a neurological disorder, comprising: a) administering the therapeutic agent to the animal as described herein, wherein the animal has the neurological disorder; and b) determining effects of the therapeutic agent to the neurological disorder. In some embodiments, the neurological disorder comprises a neurodegenerative disease, Alzheimer's disease, cognitive impairment, Parkinson's disease, Huntington's disease, or depression.
[0018] In one aspect, the disclosure is related to methods of determining effectiveness of a therapeutic agent for reducing aggregation of a TAU protein or removing amyloid plaques, comprising: a) administering the therapeutic agent to the animal as described herein, wherein the animal has the neurological disorder; and b) determining effects of the therapeutic agent for reducing aggregation of a TAU protein or removing amyloid plaques.
[0019] In one aspect, the disclosure is related to methods of determining toxicity of a therapeutic agent comprising: (a) administering the therapeutic agent to the animal as described herein; and (b) determining effects of the therapeutic agent to the animal. In some embodiments, the therapeutic agent is a TAU-targeting agent (e.g., anti-TAU antibody) . In some embodiments, determining effects of the therapeutic agent to the animal involves measuring the body weight, red blood cell count, hematocrit, and / or hemoglobin of the animal.
[0020] In one aspect, the disclosure is related to methods of determining effectiveness of a therapeutic agent for the treatment of a TAU-related disorder, comprising: (a) administering the therapeutic agent to the animal as described herein, wherein the animal has the TAU-related disorder; and (b) determining therapeutic effects of the therapeutic agent to the TAU-related disorder, wherein the TAU-related disorder is a cancer (e.g., a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., Alzheimer’s disease, Multiple sclerosis (MS) , systemic lupus erythematosus with neuropsychiatric manifestations (NPSLE) , Hashimoto’s encephalopathy (HE) , autoimmune encephalitis, and paraneoplastic neurological syndromes (PNS) ) , or a neurological disorder (e.g., a neurodegenerative disease, Alzheimer's disease, cognitive impairment, Parkinson's disease, Huntington's disease, or depression) . In some embodiments, the therapeutic agent is a TAU-targeting agent. In some embodiments, the TAU-targeting agent is an anti-TAU antibody (e.g., an anti-human TAU antibody) . In some embodiments, the TAU-targeting agent is a TAU-inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) .
[0021] In one aspect, the disclosure is related to methods of determining effectiveness of an anti-TAU antibody and an additional therapeutic agent for the treatment of a TAU-related disorder, comprising (a) administering the anti-TAU antibody and the additional therapeutic agent to the animal as described herein, wherein the animal has the TAU-related disorder; and (b) determining inhibitory effects on the TAU-related disorder, wherein the TAU-related disorder is a cancer (e.g., a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., Alzheimer’s disease, Multiple sclerosis (MS) , systemic lupus erythematosus with neuropsychiatric manifestations (NPSLE) , Hashimoto’s encephalopathy (HE) , autoimmune encephalitis, and paraneoplastic neurological syndromes (PNS)) , or a neurological disorder (e.g., a neurodegenerative disease, Alzheimer's disease, cognitive impairment, Parkinson's disease, Huntington's disease, or depression) . In some embodiments, the animal further comprises a sequence encoding Sonic Hedgehog (SHH) , Apolipoprotein E2 (APOE2) , Amyloid Beta Precursor-Like Protein 2 (APLP2) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) , or any combination thereof. In some embodiments, the additional therapeutic agent is an antibody (e.g., an anti-human antibody) that binds to SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, CTLA4, or any combination thereof. In some embodiments, the additional therapeutic agent is an inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) that targets SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, CTLA4, or any combination thereof.
[0022] The disclosure further relates to proteins comprising an amino acid sequence, wherein the amino acid sequence is one of the following: (a) an amino acid sequence set forth in SEQ ID NO: 1, 2, 5, 33, or 36; (b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 1, 2, 5, 33, or 36; (c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 2, 5, 33, or 36; (d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, 5, 33, or 36 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid; or (e) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, 5, 33, or 36.
[0023] In one aspect, the disclosure is related to nucleic acids comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following: (a) a sequence that encodes the protein as described herein; (b) SEQ ID NO: 3, 4, 6, 7, 8, 21, 27, 28, 34, or a nucleotide sequence of positions 45962338 to 46028634 of NC 000017.11; (c) a sequence that is at least 90%identical to SEQ ID NO: 3, 4, 6, 7, 8, 21, 27, 28, 34, or a nucleotide sequence of positions 45962338 to 46028634 of NC_000017.11; or (d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 6, 7, 8, 21, 27, 28, 34, or a nucleotide sequence of positions 45962338 to 46028634 of NC_000017.11.
[0024] In one aspect, the disclosure is related to cells comprising the protein as described herein and / or the nucleic acid as described herein.
[0025] In one aspect, the disclosure is related to animals comprising the protein as described herein and / or the nucleic acid as described herein.
[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0027] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.DESCRIPTION OF DRAWINGS
[0028] FIG. 1 is a schematic diagram showing mouse and human TAU (MAPT) gene loci (not to scale) .
[0029] FIG. 2 is a schematic diagram showing an exemplary TAU (MAPT) targeting strategy with an exemplary targeting vector V1 design (not to scale) .
[0030] FIGs. 3A-3B show the PCR identification results of F1 generation TAU gene humanized mice. WT is the wild-type control. PCR primer pairs include WT-F / WT-R (FIG. 3A) and WT-F / Mut-R (FIG. 3B) . M is the marker.
[0031] FIG. 4 shows RT-PCR detection results of mouse TAU (mTAU) and human TAU (hTAU) . + / + represents wild-type C57BL / 6 mice, and H / H represents TAU gene humanized homozygous mice.
[0032] FIG. 5 shows the Western Blot results of TAU protein (m / h) expression in brain. + / +represents wild-type C57BL / 6 mice, and H / H represents TAU gene humanized homozygous mice.
[0033] FIG. 6 shows the targeting schematic of humanized TAU gene mice in Example 2.
[0034] FIG. 7 shows the PCR identification results of TAU gene humanized mice. + / +represents wild-type C57BL / 6 mice, H / + represents TAU humanized heterozygous gene mice, and H2O is the water control.
[0035] FIG. 8 shows Western Blot results of TAU protein expression in cortex and hippocampus. + / + represents wild-type C57BL / 6 mice, and H / H represents homozygous humanized TAU gene mice.
[0036] FIGs. 9A-9B show qPCR detection of human TAU (hTAU) mRNA expression levels in the mouse cortex (FIG. 9A) and mouse hippocampus (FIG. 9B) .
[0037] FIG. 10A shows the alignment between human TAU amino acid sequence (NP_001116538.2; SEQ ID NO: 2) and mouse TAU amino acid sequence (NP_034968.3; SEQ ID NO: 1) .
[0038] FIG. 10B shows the alignment between human TAU amino acid sequence (NP_001116538.2; SEQ ID NO: 2) and rat TAU amino acid sequence (NP_058908.2; SEQ ID NO: 37) .DETAILED DESCRIPTION
[0039] Experimental animal models are an indispensable research tool for studying the effects of therapeutic agents targeting TAU (e.g., anti-TAU antibodies) . With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal’s endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in portion of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening using animal models.
[0040] This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) microtubule-associated proteins TAU protein, and methods of use thereof. The described transgenic non-human animal can express human or chimeric TAU (e.g., humanized TAU) protein. It can be used for studying the function of the TAU gene and for screening and evaluating TAU pathway modulators (e.g., anti-human TAU antibodies, oligonucleotide drugs, and / or peptide drugs) . Additionally, the animal model prepared by the methods described herein can be used for drug screening, pharmacodynamic studies, treatment of immune-related diseases, and treatment of diseases targeting human TAU sites. The model described herein can also be used to promote new drug development and design, saving time and costs.
[0041] TAU
[0042] Tubulin Associated Unit (TAU) proteins are microtubule-associated proteins primarily found in neurons. They are intrinsically disordered in solution but can fold into stable structures upon binding to microtubules. Tau proteins have various isoforms produced by alternative splicing of the microtubule-associated protein TAU (MAPT) gene. The relevant information (e.g., mRNA or protein) for these isoforms can be found in NCBI database, which is incorporated by reference herein in its entirety. TAU (MAPT) alternative splicing and TAU isoform expression are highly species dependent. While six isoforms are often expressed in the adult human brain (2N4R, 1N4R, 0N4R, 2N3R, 1N3R, 0N3R) , only three are detected in adult rodents (2N4R, 1N4R, 0N4R) . TAU proteins play a crucial role in stabilizing microtubules in axons, which is essential for maintaining neuronal structure and function. The C-terminus binds axonal microtubules while the N-terminus binds neural plasma membrane components, suggesting that TAU functions as a linker protein between both. Axonal polarity is predetermined by TAU localization (in the neuronal cell) in the domain of the cell body defined by the centrosome. The short isoforms allow plasticity of the cytoskeleton whereas the longer isoforms may preferentially play a role in its stabilization. The longest containing four microtubule-binding repeat motifs in the C-terminal that are vital for what is considered the major biological function of TAU, to stabilize microtubules and facilitate axonal transport. TAU proteins are involved in various cellular processes, including axonal transport, neuronal development, and maintaining neuronal polarity.
[0043] TAU proteins are abundantly expressed in neurons of the central nervous system, particularly in the cerebral cortex. The formation of insoluble TAU aggregates disrupts normal cellular functions and leads to neuronal death, resulting in tauopathies. These include a class of neurodegenerative diseases such as a neurodegenerative disease, Alzheimer's Disease, Parkinson's Disease, Frontotemporal Dementia, Progressive Supranuclear Palsy, and Corticobasal Degeneration, all characterized by the abnormal aggregation of TAU proteins.
[0044] TAU protein has been found to interact with immune cells, particularly in the brain, leading to the activation of the inflammatory cGAS-STING pathway or T cell activation in neuroinflammation and neurodegeneration.
[0045] Additionally, TAU protein expression has been observed in the liver (e.g., hepatocellular carcinoma (HCC) ) and kidney (e.g., podocytes) . Elevated levels of TAU have been linked to the promotion of hepatocellular carcinogenesis by inhibiting autophagosome-lysosome fusion, which can lead to poorer survival outcomes in HCC patients. TAU plays a role in maintaining podocyte architecture and kidney metabolism under normal physiological conditions. TAU is also found with abnormally high expression in various types of cancer, such as breast cancer, ovarian cancer, gastric cancer, prostate cancer, pediatric neuroblastoma, glioma, and more.
[0046] A detailed description of TAU and its function can be found, e.g., in Bravo C. P., et al. “Cellular and pathological functions of tau. ” Nature Reviews Molecular Cell Biology. 2024, 25: 845–864; Zhang X., et al. “Tau in neurodegenerative diseases: molecular mechanisms, biomarkers, and therapeutic strategies. ” Translational Neurodegeneration. 2024, 13, Article number: 40; Jin M., et al. “Tau activates microglia via the PQBP1-cGAS-STING pathway to promote brain inflammation. ” Nature Communications. 2021, 12 (1) DOI: 10.1038 / s41467-021-26851-2; Hedna R., et al. “Tau Protein as Therapeutic Target for Cancer? Focus on Glioblastoma. ” Cancers. 2022, 14 (21) : 5386; Chen X. et al. “Microglia-mediated T cell infiltration drives neurodegeneration in tauopathy. ” Nature. 2023, 615: 668–677; Liu X., et al. “Accumulation of microtubule-associated protein tau promotes hepatocellular carcinogenesis through inhibiting autophagosome-lysosome fusion. ” Molecular and Cellular Biochemistry. 2024, DOI: 10.1007 / s11010-024-05193-9; Valles-Saiz L. et al. “Microtubule-associated protein tau in murine kidney: role in podocyte architecture. ” Cellular and Molecular Life Sciences. 2022, 79:97 DOI 10.1007 / s00018-021-04106-z, and Buchholz S. et al. “The six brain-specific TAU isoforms and their role in Alzheimer's disease and related neurodegenerative dementia syndromes. ” Alzheimer’s &Dementia. 2024, 20 (5) : 3606-3628. DOI 10.1002 / alz. 13784.
[0047] In human genome, human TAU gene (NCBI Gene ID: 4137, UniPro ID: P10636) is in Chromosome 17 of the human genome, which is located at NC_000017.11 from the position 45894554 to the position 46028334 (GRCh38. p14 (GCF_000001405.40) ) . Human TAU gene (Gene ID: 4137) locus has fifteen exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and exon 15. The nucleotide sequence for human TAU mRNA is NM_001123066.4, and the amino acid sequence for human TAU is NP_001116538.2 (SEQ ID NO: 2) . The location for each exon and each region in human TAU nucleotide sequence and amino acid sequence is listed below:
[0048] Table 1
[0049] Based on transcript NM_001123066.4 and its encoding protein NP_001116538.2 (SEQ ID NO: 2) , the 5’ -UTR is at positions from 45894554 to 45962337, exon 1 is at positions from 45894554 to 45894686, intron 1 is at positions from 45894687 to 5962320, exon 2 is at positions from 5962321 to 45962470, intron 2 is at positions from 45962471 to 45971858, exon 3 is at positions from 45971859 to 45971945, intron 3 is at positions from 45971946 to 45974384; exon 4 is at positions from 45974385 to 45974471, intron 4 is at positions from 45974472 to 45978374, exon 5 is at positions from 45978375 to 45978440, intron 5 is at positions from 45978441 to 45983177, exon 6 is at positions from 45983178 to 45983930, intron 6 is at positions from 45983931 to 45987039, exon 7 is at positions from 45987040 to 45987095, intron 7 is at positions from 45987096 to 45989877, exon 8 is at positions from 45989878 to 45990075, intron 8 is at positions from 45990076 to 45991459, exon 9 is at positions from 45991460 to 45991586, intron 9 is at positions from 45991587 to 45993923, exon 10 is at positions from 45993924 to 45993977, intron 10 is at positions from 45993978 to 45996398, exon 11 is at positions from 45996399 to 45996664, intron 11 is at positions from 45996665 to 46010309, exon 12 is at positions from 46010310 to 46010402, intron 12 is at positions from 46010403 to 46014242, exon 13 is at positions from 46014243 to 46014324, intron 13 is at positions from 46014325 to 46018617, exon 14 is at positions from 46018618 to 46018730, intron 14 is at positions from 46018731 to 46023955, exon 15 is at positions from 46023956 to 46028334, and the 3’ -UTR is at positions from 46024172 to 46028334. All relevant information for human TAU locus can be found in the NCBI website with Gene ID: 4137, which is incorporated by reference herein in its entirety.
[0050] In mouse genome, mouse TAU gene (NCBI Gene ID: 17762, UniProt ID: P10637) is in Chromosome 11 of the mouse genome, which is located at NC_000077.7 from the position 104120235 to the position 104222916 (GRCm39 (GCF_000001635.27) ) . Mouse TAU gene (Gene ID: 17762) locus has ten exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and exon 10. The nucleotide sequence for mouse TAU mRNA is NM_010838.5, and the amino acid sequence for mouse TAU is NP_034968.3 (SEQ ID NO: 1) . The location for each exon and each region in mouse TAU nucleotide sequence and amino acid sequence is listed below:
[0051] Table 2
[0052] Based on transcript NM_010838.5 and its encoding protein NP_034968.3 (SEQ ID NO: 1) , the 5’ -UTR is at positions from 104122305 to 104173206, exon 1 is at positions from 104122305 to 104122433, intron 1 is at positions from 104122434 to 104173193, exon 2 is at positions from 104173194 to 104173306, intron 2 is at positions from 104173307 to 104185684, exon 3 is at positions from 104185685 to 104185750, intron 3 is at positions from 104185751 to 104193186; exon 4 is at positions from 104193187 to 104193236, intron 4 is at positions from 104193237 to 104197451, exon 5 is at positions from 104197452 to 104197584, intron 5 is at positions from 104197585 to 104201094, exon 6 is at positions from 104201095 to 104201360, intron 6 is at positions from 104201361 to 104208982, exon 7 is at positions from 104208983 to 104209075, intron 7 is at positions from 104209076 to 104212176, exon 8 is at positions from 104212177 to 104212258, intron 8 is at positions from 104212259 to 104213253, exon 9 is at positions from 104213254 to 104213366, intron 9 is at positions from 104213367 to 104218797, exon 10 is at positions from 104218798 to 104222916, and the 3’ -UTR is at positions from 104219014 to 104222916. All relevant information for human TAU locus can be found in the NCBI website with Gene ID: 17762, which is incorporated by reference herein in its entirety.
[0053] FIG. 10A shows the alignment between human TAU amino acid sequence (NP_001116538.2; SEQ ID NO: 2) and mouse TAU amino acid sequence (NP_034968.3; SEQ ID NO: 1) . Thus, the corresponding amino acid residue or region between human and mouse TAU can be found in FIG. 10A.
[0054] TAU genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for TAU in Rattus norvegicus (rat) is 29477, the gene ID for TAU in Macaca mulatta (Rhesus monkey) is 574327, the gene ID for TAU in Canis lupus familiaris (dog) is 480488, and the gene ID for TAU in Sus scrofa (pig) is 100738351. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which is incorporated by reference herein in its entirety. FIG. 10B shows the alignment between human TAU amino acid sequence (NP_001116538.2; SEQ ID NO: 2) and rat TAU amino acid sequence (NP_058908.2; SEQ ID NO: 37) . Thus, the corresponding amino acid residue or region between human and rat TAU can be found in FIG. 10B.
[0055] The present disclosure provides human or chimeric (e.g., humanized) TAU nucleotide sequences and / or amino acid sequences. The human TAU nucleotide sequences and / or amino acid sequences can be various isoforms, e.g., NM_001123066.4 (corresponding to NP_001116538.2) ; NM_001123067.4 (corresponding to NP_001116539.1) ; NM_001203251.2 (corresponding to NP_001190180.1) ; NM_001203252.2 (corresponding to NP_001190181.1) ; NM_001377265.1 (corresponding to NP_001364194.1) ; NM_001377266.1 (corresponding to NP_001364195.1) ; NM_001377267.1 (corresponding to NP_001364196.1) ; NM_001377268.1 (corresponding to NP_001364197.1) ; NM_005910.6 (corresponding to NP_005901.2) ; NM_016834.5 (corresponding to NP_058518.1) ; NM_016835.5 (corresponding to NP_058519.3) ; or NM_016841.5 (corresponding to NP_058525.1) . All of these sequences are incorporated by reference. For example, the human TAU nucleotide sequences and / or amino acid sequences can be isoforms expressed in human brain, e.g., 2N4R, 1N4R, 0N4R, 2N3R, 1N3R, or 0N3R. In some embodiments, the human or chimeric (e.g., humanized) TAU nucleotide sequences and / or amino acid sequences have mutations. In some embodiments, the mutation in amino acid sequences is a P301S mutation. In some embodiments, the mutation in nucleotide sequences is a change from codon CCG to codon TCG.
[0056] In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and / or exon 10 are replaced by the corresponding human sequence. In some embodiments, a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and / or exon 10 are replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5022, or 5164 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 355, 360, 365, 370, or 372 amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and / or exon 10. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and / or exon 10 (e.g., a portion of exon 2 and the entire exons 3~10) are replaced by a region, a portion, or the entire sequence of the human exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and / or exon 15. In some embodiments, the corresponding human sequence includes a portion of exon 2 and the entire exons 3~15. In some embodiments, the corresponding human sequence includes a portion of exon 2, the entire exons 3~15, and a portion of downstream of 3’ -UTR of human TAU. In some embodiments, the portion of downstream of 3’ -UTR of human TAU is a portion of downstream of human TAU exon 15. In some embodiments, the portion of downstream of 3’ -UTR of human TAU is at least 50, 100, 150, 200, 250, or 300 bp in length.
[0057] In some embodiments, a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and / or exon 10 is deleted.
[0058] In some embodiments, the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized) TAU nucleotide sequence. In some embodiments, the chimeric TAU nucleotide sequence encodes a human or chimeric TAU protein. In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a human or humanized TAU protein.
[0059] In some embodiments, the present disclosure is related to a non-human animal whose genome comprises an insertion of a sequence encoding a human or chimeric TAU. The insertion can be at a safe harbor locus (e.g., Hipp11 (or H11) or ROSA26) or at a random locus in the genome.
[0060] In some embodiments, the chimeric (e.g., humanized) TAU nucleotide sequence encodes a TAU protein. In some embodiments, the human or chimeric TAU protein has a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100%identical to amino acids 1~776 or 1~412 of SEQ ID NO: 2, 5, or 33.
[0061] UTRs are untranslated regions are crucial segments of mRNA that do not code for proteins but play significant roles in regulating gene expression. UTRs includes 5’ -UTR located upstream of the coding sequence and 3’ -UTR located downstream of the coding sequence. 5’ -UTR contains regulatory elements that influence the initiation of translation and helps in the binding of ribosomes to the mRNA. 3’ -UTR contains regulatory regions that affect mRNA stability, localization, and translation efficiency, and often includes binding sites for microRNAs (miRNAs) and proteins that can either enhance or repress translation.
[0062] In some embodiments, the genetically-modified non-human animal described herein comprises a human or humanized TAU gene. In some embodiments, the humanized TAU gene comprises 11 or 15 exons. In some embodiments, the humanized TAU gene comprises human or humanized exon 1, human or humanized exon 2, human or humanized exon 3, human or humanized exon 4, human or humanized exon 5, human or humanized exon 6, human or humanized exon 7, human or humanized exon 8, human or humanized exon 9, human or humanized exon 10, human or humanized exon 11, human or humanized exon 12, human or humanized exon 13, human or humanized exon 14, and / or human or humanized exon 15. In some embodiments, the humanized TAU gene comprises humanized exon 1, human exon 2, human exon 3, human exon 4, human exon 5, human exon 6, human exon 7, human exon 8, human exon 9, human exon 10, human exon 11, human exon 12, human exon 13, human exon 14, and / or human exon 15. In some embodiments, the humanized TAU gene comprises human or humanized 5’ -UTR. In some embodiments, the humanized TAU gene comprises human or humanized 3’ -UTR. In some embodiments, the humanized TAU gene comprises endogenous 5’ -UTR. In some embodiments, the humanized TAU gene comprises endogenous 3’ -UTR. In some embodiments, the humanized TAU gene comprises at least 50 nucleotides (e.g., contiguous or non-contiguous) downstream of the 3’ -UTR of human TAU gene. In some embodiments, the humanized TAU gene comprises at least 300 nucleotides (e.g., contiguous or non-contiguous) downstream of the 3’ -UTR of human TAU gene. In some embodiments, the humanized TAU locus includes the entire downstream of the endogenous TAU gene 3’ -UTR (e.g., downstream of mouse TAU exon 10) and 300 nucleotides (e.g., contiguous or non-contiguous) downstream of the human TAU gene 3’ -UTR (e.g., downstream of human TAU exon 15) .
[0063] Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) TAU nucleotide sequence and / or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%of the sequence are identical to or derived from mouse TAU mRNA sequence (e.g., NM_010838.5) , mouse TAU amino acid sequence (e.g., NP_034968.3; SEQ ID NO: 1) , or a portion thereof (e.g., 5’ -UTR, the entire exon 1 and a portion of exon 2, and / or 3’ -UTR) ; and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%of the sequence are identical to or derived from human TAU mRNA sequence (e.g., NM_001123066.4) , human TAU amino acid sequence (e.g., NP_001116538.2; SEQ ID NO: 2) , or a portion thereof (e.g., a portion of exon 2, the entire exons 3~15, and a portion of downstream of 3’ -UTR of human TAU) .
[0064] In some embodiments, the sequence encoding amino acids 1~372 of mouse TAU (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human TAU (e.g., amino acids 1~776 of human TAU (SEQ ID NO: 2) , 1~412 of SEQ ID NO: 5, or 1~776 of SEQ ID NO: 33) .
[0065] In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse TAU promotor, an inducible promoter, an enhancer, and / or any mouse or human regulatory elements.
[0066] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6494, 6600, or 6644 nucleotides (contiguous or non-contiguous nucleotides) that are different from portion of or the entire mouse TAU nucleotide sequence (e.g., a portion of exon 2, the entire exons 3~10 of NM_010838.5) .
[0067] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5022, or 5164 nucleotides (contiguous or non-contiguous nucleotides) that are the same as portion of or the entire mouse TAU nucleotide sequence (e.g., 5’ -UTR, the entire exon 1, a portion of exon 2, and / or 3’ -UTR of NM_010838.5) .
[0068] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5022, or 5164 nucleotides (contiguous or non-contiguous nucleotides) that are different from portion of or the entire human TAU nucleotide sequence (e.g., 5’ -UTR, the entire exon 1, a portion of exon 2, and / or 3’ -UTR of NM_001123066.4) .
[0069] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6494, 6600, or 6644 nucleotides (contiguous or non-contiguous nucleotides) that are the same as part of or the entire human TAU nucleotide sequence (e.g., a portion of exon 2, the entire exons 3~15, and / or a portion of 3’ -UTR of NM_001123066.4) .
[0070] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 412, 450, 500, 550, 600, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, or 776 amino acid residues (contiguous or non-contiguous amino acid residues) that are different from portion of or the entire mouse TAU amino acid sequence (e.g., amino acids 1~372 of NP_034968.3 (SEQ ID NO: 1) ) . In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 355, 360, 365, 370, or 372 amino acid residues (contiguous or non-contiguous amino acid residues) that are the same as portion of or the entire mouse TAU amino acid sequence (e.g., amino acids 1~372 of NP_034968.3 (SEQ ID NO: 1)) .
[0071] In some embodiments, the amino acid sequence has no more than a portion (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 355, 360, 365, 370, or 372 amino acid residues (contiguous or non-contiguous amino acid residues) that are the same as portion of or the entire mouse TAU amino acid sequence. In some embodiments, no amino acids are identical to mouse TAU amino acid sequence (NP_034968.3 (SEQ ID NO: 1)) .
[0072] In some embodiments, the amino acid sequence has no more than a portion (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 355, 360, 365, 370, or 372 amino acid residues (contiguous or non-contiguous amino acid residues) that is different from portion of or the entire human TAU amino acid sequence (e.g., amino acids 1~776 of NP_001116538.2 (SEQ ID NO: 2) , 1~776 of SEQ ID NO: 33, or 1~412 of SEQ ID NO: 5) . In some embodiments, no amino acids are different from human TAU amino acid sequence (NP_001116538.2 (SEQ ID NO: 2)) In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 412, 450, 500, 550, 600, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, or 776 amino acid residues (contiguous or non-contiguous amino acid residues) that is the same as portion of or the entire human TAU amino acid sequence (e.g., amino acids 1~776 of NP_001116538.2 (SEQ ID NO: 2) , 1~776 of SEQ ID NO: 33, or 1~412 of SEQ ID NO: 5) .
[0073] The present disclosure also provides a humanized TAU mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:
[0074] a) an amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36;
[0075] b) an amino acid sequence having a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36;
[0076] c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO:1, 2, 5, 33, or 36 under a low stringency condition or a strict stringency condition;
[0077] d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36;
[0078] e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or
[0079] f) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36.
[0080] The present disclosure also provides a humanized TAU amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:
[0081] a) all or portion of amino acids 1~776 or 1~412 of SEQ ID NO: 2, 5, or 33;
[0082] b) an amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%to amino acids 1~776 or 1~412 of SEQ ID NO: 2, 5, or 33;
[0083] c) an amino acid sequence that is different from amino acids 1~776 or 1~412 of SEQ ID NO: 2, 5, or 33 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and
[0084] d) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to amino acids 1~776 or 1~412 of SEQ ID NO: 2, 5, or 33.
[0085] The present disclosure also provides a humanized TAU amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:
[0086] a) all or portion of amino acids 1~372, 1~412, or 1~766 of SEQ ID NO: 1, 5, or 33;
[0087] b) an amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%to amino acids 1~372, 1~412, or 1~766 of SEQ ID NO: 1, 5, or 33;
[0088] c) an amino acid sequence that is different from amino acids 1~372, 1~412, or 1~766 of SEQ ID NO: 1, 5, or 33 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and
[0089] d) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to amino acids 1~372, 1~412, or 1~766 of SEQ ID NO: 1, 5, or 33.
[0090] The present disclosure also relates to a TAU nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:
[0091] a) a nucleic acid sequence as shown in SEQ ID NO: 3, 4, 6, 7, 8, 21, 22, 23, 24, 25, 27, 28, or 34, or a nucleic acid sequence encoding a homologous TAU amino acid sequence of a humanized mouse TAU;
[0092] b) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 6, 7, 8, 21, 22, 23, 24, 25, 27, 28, or 34 under a low stringency condition or a strict stringency condition;
[0093] c) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 6, 7, 8, 21, 22, 23, 24, 25, 27, 28, or 34;
[0094] d) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36;
[0095] e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36;
[0096] f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and / or
[0097] g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and / or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36.
[0098] The present disclosure further relates to a TAU genomic DNA sequence of a humanized mouse. The DNA sequence is obtained by reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 2, 5, or 33.
[0099] The disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36 and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
[0100] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 1, 2, 5, 33, or 36 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
[0101] The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 2, 5, or 33, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 2, 5, or 33 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
[0102] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 3, 4, 6, 7, 8, 21, 22, 23, 24, 25, 27, 28, or 34 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
[0103] The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 100, 200, 400, 600, 800, 1000, 1220, 1239, 2000, 3000, 3500, 4000, 4500, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6494, 6600, 6626, 6644, 6645, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 16000, 18000, 20000, 25000, 30000, 35000, 40000, 45000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 66278, 66297, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 9000, 100000, 110000, 120000, 130000, 133762, or 133781 nucleotides. In some embodiments, the amino acid sequence is less than 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 412, 450, 500, 550, 600, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, or 776 amino acid residues.
[0104] In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.
[0105] In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.
[0106] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For example, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
[0107] The percentage of residues conserved with similar physicochemical properties (percent homology) , e.g., leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid) , uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine) , nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . The homology percentage, in many cases, is higher than the identity percentage.
[0108] Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) TAU from an endogenous non-human TAU locus.
[0109] Genetically modified animals
[0110] As used herein, the term “genetically-modified non-human animal” refers to a non-human animal having exogenous DNA in at least one chromosome of the animal’s genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, or 50%of cells of the genetically-modified non-human animal have the exogenous DNA in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, an antigen presenting cell, a macrophage, a dendritic cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous TAU locus that comprises an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.
[0111] As used herein, the term “chimeric gene” or “chimeric nucleic acid” refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.
[0112] As used herein, the term “chimeric protein” or “chimeric polypeptide” refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.
[0113] As used herein, the term “humanized protein” or “humanized polypeptide” refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.
[0114] As used herein, the term “humanized nucleic acid” refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be, e.g., a human exon or a chimeric exon.
[0115] In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized TAU gene or a humanized TAU nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human TAU gene, at least one or more portions of the gene or the nucleic acid is from a non-human TAU gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes a TAU protein. The encoded TAU protein is functional or has at least one activity of the human TAU protein or the non-human TAU protein, e.g., modulating cell growth or immune responses.
[0116] In some embodiments, the humanized TAU gene includes a nucleotide sequence of 20 bp~133781 bp (contiguous or non-contiguous) that is identical to the sequence at human TAU gene locus. In some embodiments, the nucleotide sequence is 20~133781 bp, 20~66297 bp, 151-6644 bp, 20~6645, or 20~1239, e.g., 20, 100, 200, 400, 600, 800, 1000, 1220, 1239, 2000, 3000, 3500, 4000, 4500, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6494, 6600, 6626, 6644, 6645, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 16000, 18000, 20000, 25000, 30000, 35000, 40000, 45000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 66278, 66297, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 9000, 100000, 110000, 120000, 130000, 133762, or 133781 bp in length.
[0117] In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized TAU protein or a humanized TAU polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human TAU protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human TAU protein. The humanized TAU protein or the humanized TAU polypeptide is functional or has at least one activity of the human TAU protein or the non-human TAU protein.
[0118] In some embodiments, the humanized TAU protein includes a polypeptide sequence of 1~776 or 1~412 amino acids (contiguous or non-contiguous) that is identical to human TAU protein. In some embodiments, the polypeptide sequence is 1~776 or 1~412 amino acids, e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 412, 450, 500, 550, 600, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, or 776 amino acids in length.
[0119] The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) . For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.
[0120] In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) . In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat. In some embodiments, genetically modified rodent is selected from a mouse or rat. In some embodiments, the non-human animal is a mouse.
[0121] In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm) , 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv-and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL / 6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL / 6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB / c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB / c-50%12954 / Sv; or 50%C57BL / 6-50%129) . In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a mouse having a BALB / c, A, A / He, A / J, A / WySN, AKR, AKR / A, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola) , C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, or CBA / H background. In some embodiments, the non-human animal is a mouse having NOD, NOD / SCID, or NOD-Prkdcscid IL-2rgnull background.
[0122] In one aspect, the non-human animal is a mammal. In one aspect, the non-human animal is a small mammal, e.g., a jerboa. In one embodiment, the genetically humanized non-human animal is a rodent. In one embodiment, the rodent is selected from the group consisting of mice, rats and hamsters. In one embodiment, the rodent is selected from the murine family. In one embodiment, the genetically modified animal is selected from a group consisting of hamsteridae (e.g., mouse-like hamsters) , hamsteridae (e.g., hamsters, New World rats and mice, voles) , murine superfamily (e.g., true mouse and rats, gerbils, spiny rats, and crested rats) , Falkomuridae (e.g., climbing mice, rock mice, tailed rats, Madagascar rats and mice) , Dormocidae (e.g., spiny dormouse) and Moleidae (e.g., mole rats, bamboo rats, and zokors) families. In a specific embodiment, the genetically modified rodent is selected from the group consisting of true mice or rats (Muridae) , gerbils, spiny rats and crested rats. In one embodiment, the genetically modified mouse is from a member of the family Muridae. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.
[0123] In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.
[0124] The animal can have one or more other genetic modifications, and / or other modifications, that are suitable for the particular purpose for which the humanized TAU animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor) , can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and / or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and / or genetic modification (e.g., knocking out one or more genes) . Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD / SCID mice, IL2Rγknockout mice, NOD / SCID / γcnull mice (Ito, M. et al., NOD / SCID / γcnull mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100 (9) ; 3175-3182, 2002) , nude mice, and Rag1 and / or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human TAU locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD / SCID mice, IL-2Rγ knockout mice, NOD / SCID / γcnull mice, nude mice, Rag1 and / or Rag2 knockout mice, NOD-Prkdcscid IL-2rγnull mice, NOD-Rag 1- / --IL2rg- / - (NRG) mice, Rag 2- / --IL2rg- / - (RG) mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or portion of mature TAU coding sequence with human mature TAU coding sequence. In some embodiments, the mouse can include an insertion of all or portion of human mature TAU coding sequence.
[0125] Genetically modified non-human animals can comprise a modification at an endogenous non-human TAU locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature TAU protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the mature TAU protein sequence) . Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous TAU locus in the germline of the animal.
[0126] Genetically modified animals can express a human TAU and / or a chimeric (e.g., humanized) TAU from endogenous mouse loci, wherein the endogenous mouse TAU gene has been replaced with a human TAU gene and / or a nucleotide sequence that encodes a region of human TAU sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identical to the human TAU sequence. In various embodiments, an endogenous non-human TAU locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature TAU protein.
[0127] In some embodiments, the genetically modified mice can express the human TAU and / or chimeric TAU (e.g., humanized TAU) from endogenous loci that are under control of mouse promoters and / or mouse regulatory elements. The replacement (s) at the endogenous mouse loci provide non-human animals that express human TAU or chimeric TAU (e.g., humanized TAU) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. In some embodiments, the genetically modified mice can express the human TAU and / or chimeric TAU (e.g., humanized TAU) from a bacterial artificial chromosome (BAC) inserted into the genome.
[0128] The human TAU or the chimeric TAU (e.g., humanized TAU) expressed in animal can maintain one or more functions of the wild-type mouse or human TAU in the animal. Furthermore, in some embodiments, the animal does not express endogenous TAU. In some embodiments, the animal expresses a decreased level of endogenous TAU as compared to TAU expression level in a wild-type animal. As used herein, the term “endogenous TAU” refers to TAU protein that is expressed from an endogenous TAU nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.
[0129] The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TAU (NP_001116538.2; SEQ ID NO: 2) . In some embodiments, the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 2, 5, or 33.
[0130] The genome of the genetically modified animal can comprise a replacement at an endogenous TAU gene locus of a sequence encoding a region of endogenous TAU with a sequence encoding a corresponding region of human TAU. The genome of the genetically modified animal comprises a human or humanized (e.g., chimeric) TAU gene locus after the replacement at an endogenous TAU gene locus of a sequence encoding a region of endogenous TAU with a sequence encoding a corresponding region of human TAU. In some embodiments, the sequence that is replaced is any sequence within the endogenous TAU gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, 5’ -UTR, 3’ -UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or any combination thereof. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous TAU gene. In some embodiments, the sequence that is replaced is a portion of exon 2 and the entire exons 3~10 of an endogenous mouse TAU gene locus.
[0131] In some embodiments, the humanized TAU locus includes a portion of or an entire human TAU gene 5’ -UTR. In some embodiments, the humanized TAU locus lacks a human TAU gene 5’ -UTR. In some embodiments, the humanized TAU locus includes a portion of or an entire endogenous (e.g., mouse) 5’ -UTR. In some embodiments, the humanized TAU locus includes a portion of or an entire human 3’ -UTR. In some embodiments, the humanized TAU locus includes a portion of or an entire endogenous (e.g., mouse) 3’ -UTR. In some embodiments, the humanized TAU locus comprises a portion of or an entire downstream of the 3’ -UTR of endogenous (e.g., mouse) TAU gene. In some embodiments, the humanized TAU locus comprises at least 50 nucleotides (e.g., contiguous or non-contiguous) downstream of the endogenous (e.g., mouse) 3’ -UTR (downstream of endogenous TAU exon 10) . In some embodiments, the humanized TAU locus comprises a portion of or an entire downstream of the 3’-UTR of human TAU gene. In some embodiments, the humanized TAU locus comprises at least 50, 100, 150, 200, 250, or 300 nucleotides (e.g., contiguous or non-contiguous) downstream of the 3’ -UTR of human TAU gene (downstream of the human TAU exon 15) . In some embodiments, the humanized TAU locus comprises at least 300 nucleotides (e.g., contiguous or non-contiguous) downstream of the 3’ -UTR of human TAU gene. In some embodiments, the humanized TAU locus includes the entire downstream of the endogenous TAU gene 3’ -UTR (e.g., downstream of mouse TAU exon 10) and 300 nucleotides (e.g., contiguous or non-contiguous) downstream of the human TAU gene 3’ -UTR (e.g., downstream of human TAU exon 15) . In appropriate cases, it may be reasonable to presume that the mouse and human TAU genes appear to be similarly regulated based on the similarity of their 5’ -flanking sequence. As shown in the present disclosure, humanized TAU mice that comprise a replacement at an endogenous mouse TAU locus, which retain mouse regulatory elements but comprise a humanization of TAU encoding sequence, do not exhibit pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized TAU are grossly normal. The genetically modified animal can have one or more cells expressing a human or chimeric TAU. In some embodiments, the human or chimeric TAU described herein has an amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the human or chimeric TAU described herein has an amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the human or chimeric TAU described herein has an amino acid sequence set forth in SEQ ID NO: 33.
[0132] As disclosed herein, the DNA sequence obtained by reverse transcription of mRNA is identical or complementary to the genomic DNA sequence of the TAU gene in humanized mice; constructs expressing the amino acid sequence encoded by the DNA sequence; cells containing these constructs; and tissues including these cells.
[0133] Because human TAU and non-human TAU (e.g., mouse TAU) sequences, in many cases, are different, antibodies that bind to human TAU will not necessarily have the same binding affinity with non-human TAU or have the same effects to non-human TAU. Therefore, the genetically modified animal having a human, or a humanized TAU can be used to better evaluate the effects of anti-human TAU antibodies in an animal model.
[0134] In some embodiments, the entire humanized TAU described herein are derived from human TAU sequence.
[0135] In some embodiments, the genome of the genetically modified animal comprises a sequence that corresponds to a portion or the entire sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and / or exon 15 of human TAU. In some embodiments, the genome of the genetically modified animal comprises a sequence that corresponds to a portion or the entire sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and / or exon 15 of human TAU, wherein the sequence includes at least one nucleotide mutation. In some embodiments, the nucleotide mutation is in Exon 10. In some embodiments, the nucleotide mutation is a substitution of cytosine (C) by thymine (T) at position 964 of nucleotide sequence of human TAU NM_001123067. In some embodiments, the genome of the genetically modified animal comprises a sequence that is set forth in SEQ ID NO: 21.
[0136] In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to a portion or the entire sequence of amino acids 1~776 of SEQ ID NO: 2 or 33. In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to a portion or the entire sequence of amino acids 1~412 of SEQ ID NO: 36 or 5. In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that includes a P301S mutation. In some embodiments, the P301S mutation is the substitution of Proline (P) by Serine (S) at position 272 of SEQ ID NO: 36 (e.g., by alignment) . In some embodiments, the amino acid sequence has S at position 272, wherein the position is based on SEQ ID NO: 36 (e.g., by alignment) .
[0137] The P301S mutation occurs in the microtubule-associated protein tau (MAPT) gene. The human TAU gene has multiple transcripts. In isoform 2N4R transcript (NM_005910.6) , the codon for the amino acid at position 301 changes from CCG to TCG, which is known as the P301S mutation. The position of the 301st amino acid varies in different transcripts. For example, in isoform 1N4R transcript (NM_001123067.4, SEQ ID NO: 36) , the codon for the amino acid at position 272 changes from CCG to TCG, wherein the mutated codon is on exon 10.
[0138] The P301S mutation leads to the production of a mutant tau protein that is prone to aggregation. Mice with the P301S mutation develop neurofibrillary tangles, which are similar to those found in human Alzheimer's Disease (AD) and Frontotemporal Dementia (FTD) patients. These tangles are composed of hyperphosphorylated tau protein. A detailed description of TAU and its function can be found, e.g., in Yoshiyama Y., et al. “Synapse loss and microglial activation precede tangles in a P301S tauopathy mouse model. ” Neuron. 2007, 53 (3) : 337-51.
[0139] In some embodiments, the genome of the genetically modified animal comprises a portion of exon 2 and the entire exons 3~15 of human TAU gene. In some embodiments, the portion of exon 2 includes at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, or 150 nucleotides. In some embodiments, the portion of exon 2 includes 133 nucleotides. In some embodiments, the portion of exon 2 includes a nucleotide of at least 20 bp.
[0140] In some embodiments, the non-human animal can have, at an endogenous TAU gene locus, a nucleotide sequence encoding a chimeric human / non-human TAU polypeptide, wherein the chimeric human / non-human TAU polypeptide includes at least a portion of human TAU.
[0141] The animal described herein expresses a functional TAU in the animal. The human portion of the chimeric human / non-human TAU polypeptide includes an amino acid sequence encoded by a portion of exon 2 and the entire exons 3~15 of human TAU. In some embodiments, the human portion of the chimeric human / non-human TAU polypeptide includes a sequence that is at least 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 1~776 of SEQ ID NO: 2 or 33. In some embodiments, the human portion of the chimeric human / non-human TAU polypeptide includes a sequence that is at least 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 1~412 of SEQ ID NO: 5.
[0142] Furthermore, the genetically modified animal can be heterozygous with respect to the replacement at the endogenous TAU locus, or homozygous with respect to the replacement at the endogenous TAU locus. In some embodiments, the genetically modified animal has an intact endogenous TAU locus. In some embodiments, the human or humanized TAU fragment is inserted with a BAC. In some embodiments, the BAC is inserted into a random locus. In some embodiments, the BAC is inserted into the endogenous TAU locus.
[0143] The non-human animals as described in this disclosure includes one or more cells comprising a nucleotide sequence encoding a human or chimeric TAU polypeptide, wherein the human or chimeric TAU polypeptide comprises at least 50, 100, 500, 700, or 776 contiguous amino acid residues that are identical to a corresponding contiguous amino acid sequence of a human TAU polypeptide (e.g., with or without mutations) , wherein the animal expresses the human or chimeric TAU polypeptide. In some embodiments, the nucleotide sequence encoding the human or chimeric TAU polypeptide is operably linked to an endogenous regulatory element (e.g., endogenous 5’ -UTR) , human regulatory element (e.g., human TAU promoter) , a chimeric regulatory element, or a brain specific regulatory element (e.g., a mouse prion protein (Prnp) promoter) . In some embodiments, the nucleotide sequence encoding the human or chimeric TAU polypeptide is integrated to an endogenous TAU gene locus, a safe harbor site (e.g., Hipp11 (or H11) or ROSA26 site) or a random locus, of the animal. In some embodiments, the animal is a mouse, wherein the human or chimeric TAU polypeptide has at least one mouse TAU activity and / or at least one human TAU activity.
[0144] The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene (s) .
[0145] In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.
[0146] In some embodiments, the non-human mammal expresses a protein encoded by a humanized TAU gene.
[0147] In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse) .
[0148] The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.
[0149] The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized TAU in the genome of the animal.
[0150] In some embodiments, the non-human mammal comprises the genetic construct as described herein. In some embodiments, a non-human mammal expressing human or humanized TAU is provided. In some embodiments, the tissue-specific expression of human or humanized TAU protein is provided.
[0151] In some embodiments, the expression of human or humanized TAU in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance. In some embodiments, the specific inducer is selected from Tet-Off System / Tet-On System, or Tamoxifen System.
[0152] Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents) . In some embodiments, the non-human mammal is a mouse.
[0153] Genetic, molecular, and behavioral analyses for the non-human mammals described above can be performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.
[0154] The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cells can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human TAU protein can be detected by a variety of methods.
[0155] There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) . In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized TAU protein.
[0156] In another aspect, the disclosure also provides a genetically-modified, non-human animal whose genome include a disruption in the animal’s endogenous TAU gene, wherein the disruption of the endogenous TAU gene comprises deletion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or a portion thereof, of the endogenous TAU gene.
[0157] In some embodiments, the disruption of the endogenous TAU gene includes deletion of one or more exons or a portion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10 of the endogenous TAU gene.
[0158] In some embodiments, the disruption of the endogenous TAU gene further includes deletion of the entire or portion of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, and / or intron 9 of the endogenous TAU gene.
[0159] In some embodiments, the deletion includes deleting at least 20, 100, 200, 400, 600, 800, 1000, 2000, 3000, 3500, 4000, 4500, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6494, 6600, 6644, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 16000, 18000, 20000, 25000, 30000, 35000, 40000, 45000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 66278, 66297, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 9000, 100000, 102682 bp, or more nucleotides.
[0160] In some embodiments, the disruption of the endogenous TAU gene includes the deletion of at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5022, or 5164 nucleotides of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and / or exon 10 (e.g., deletion of 5022 nucleotides from a portion of exon 2, and the entire exons 2~10) .
[0161] Vectors
[0162] The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) , which is selected from the TAU gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired / donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) , which is selected from the TAU gene genomic DNAs in the length of 100 to 10,000 nucleotides.
[0163] In some embodiments, a) the DNA fragment homologous to the 5’ end of a conversion region to be altered (5’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000077.7; b) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000077.7.
[0164] In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 104170214 to the position 104173206 of the NCBI accession number NC_000077.7; b) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 104222917 to the position 104225877 of the NCBI accession number NC_000077.7.
[0165] In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotide sequence of SEQ ID NO: 27; b) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequence of SEQ ID NO: 28.
[0166] In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be more than about 3 kb, about 3.5 kb, about 4 kb, about 4.5 kb, about 5 kb, about 5.5 kb, about 6 kb, about 6.5 kb, about 7 kb, about 7.5 kb, or about 8 kb.
[0167] In some embodiments, the region to be altered is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and / or exon 10 of TAU gene (e.g., a portion of exon 2 and the entire exons 3~10 of mouse TAU gene) .
[0168] The targeting vector can further include one or more selectable markers, e.g., positive or negative selectable markers. In some embodiments, the positive selectable marker is a Neo gene or Neo cassette. In some embodiments, the negative selectable marker is a DTA gene.
[0169] In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 3; and the sequence of the 3’ arm is shown in SEQ ID NO: 4. In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 27; and the sequence of the 3’ arm is shown in SEQ ID NO: 28.
[0170] In some embodiments, the sequence is derived from human TAU sequence (e.g., positions 45962338 to 46028634 of NC_000017.11, 151~6644 of NM_001123066.4, or SEQ ID NO: 6) . In some embodiments, the sequence is derived from human or humanized TAU sequence, optionally with mutations, (e.g., SEQ ID NOs: 21 or 34) . For example, the target region in the targeting vector is a portion or entirety of the nucleotide sequence of a human TAU gene, preferably exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and / or exon 15 of the human TAU gene. In some embodiments, the nucleotide sequence of the humanized TAU gene encodes the entire or a portion of human TAU protein with the NCBI accession number NP_001116538.2 (SEQ ID NO: 2) . In some embodiments, the nucleotide sequence of the humanized TAU gene encodes the entire or a portion of SEQ ID NO: 5. In some embodiments, the nucleotide sequence of the humanized TAU gene encodes the entire or a portion of SEQ ID NO: 33.
[0171] The disclosure also relates to a cell comprising the targeting vectors as described above.
[0172] In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes a Cas 9 mRNA or an in vitro transcript thereof. In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous. In some embodiments, the cell includes a BAC DNA construct.
[0173] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.
[0174] Methods of making genetically modified animals
[0175] Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , BAC DNA constructs, and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., "Delivery technologies for genome editing, " Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.
[0176] Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous TAU gene locus, a sequence encoding a region of an endogenous TAU with a sequence encoding a corresponding region of human or chimeric TAU. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.
[0177] The targeting strategies involve a vector comprising a 5’ homologous arm, a human TAU gene fragment (e.g., a human TAU donor sequence) , and a 3’ homologous arm. The process can involve replacing endogenous TAU sequence with human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strands break, and the homologous recombination is used to replace endogenous TAU sequence with human TAU sequence.
[0178] Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous TAU locus (or site) , a nucleic acid sequence encoding a region of endogenous TAU protein with a sequence encoding a corresponding region of human TAU protein. The nucleic acid sequence includes a region (e.g., a portion or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, and / or exon 15 of a human TAU gene. In some embodiments, the nucleic acid sequence includes a portion of exon 2 and the entire exons 3~15 of a human TAU encoding sequence (e.g., nucleic acids 151~6644 of NM_001123066.4) . In some embodiments, the nucleic acid sequence includes a portion of exon 2 and the entire exons 3~15 of a human TAU encoding sequence (e.g., nucleic acids 151~6644 of NM_001123066.4) , and 300 nucleotides downstream of 3’ -UTR of a human TAU gene (e.g., downstream of a human TAU exon 15) .
[0179] In some embodiments, the nucleic acid sequence includes a region (e.g., a portion or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and / or exon 10 of mouse TAU. In some embodiments, the sequence includes the entire exon 1 and a portion of exon 2 of mouse TAU gene (e.g., nucleic acids 1~142 of NM_010838.5) .
[0180] In some embodiments, the methods of modifying a TAU locus of a mouse to express a chimeric human / mouse TAU peptide can include the steps of replacing at the endogenous mouse TAU locus a nucleotide sequence encoding a mouse TAU with a nucleotide sequence encoding a human TAU, thereby generating a sequence encoding a chimeric human / mouse TAU.
[0181] In some embodiments, the nucleotide sequences as described herein do not overlap with each other (e.g., the first nucleotide sequence, the second nucleotide sequence, and / or the third nucleotide sequence do not overlap) . In some embodiments, the amino acid sequences as described herein do not overlap with each other.
[0182] The present disclosure further provides a method for establishing a TAU gene humanized animal model, involving the following steps:
[0183] (a) providing the cell (e.g. a fertilized egg cell) based on the methods described herein;
[0184] (b) culturing the cell in a liquid culture medium;
[0185] (c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;
[0186] (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .
[0187] In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL / 6 mouse) .
[0188] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or false pregnancy) .
[0189] In some embodiments, the fertilized eggs for the methods described above are C57BL / 6 fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs and DBA / 2 fertilized eggs.
[0190] Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the methods described above.
[0191] In some embodiments, methods of making the genetically modified animal comprises modifying the coding frame of the non-human animal’s TAU gene, e.g., by inserting a nucleotide sequence (e.g., DNA or cDNA sequence) encoding human or humanized TAU protein, e.g., immediately after the endogenous regulatory element of the non-human animal’s TAU gene. For example, one or more functional region sequences of the non-human animal’s TAU gene can be knocked out, or inserted with a sequence, such that the non-human animal cannot express or expresses a decreased level of endogenous TAU protein. In some embodiments, the coding frame of the modified non-human animal’s TAU gene can be all or portion of the nucleotide sequence from exon 1 to exon 4 of the non-human animal’s TAU gene.
[0192] In some embodiments, methods of making the genetically modified animal comprises inserting a nucleotide sequence encoding human or humanized TAU protein and / or an auxiliary sequence after the endogenous regulatory element of the non-human animal’s TAU gene. In some embodiments, the auxiliary sequence can be a stop codon, such that the TAU gene humanized animal model can express human or humanized TAU protein in vivo, but does not express non-human animal’s TAU protein. In some embodiments, the auxiliary sequence includes WPRE (WHP Posttranscriptional Response Element) , loxP, and / or polyA.
[0193] In some embodiments, the insertion refers to placing a target fragment directly between two adjacent bases without deleting nucleotides. For example, the target fragment can be a human TAU gene, a humanized TAU gene, a nucleotide sequence encoding a human or humanized TAU protein, or a nucleotide sequence obtained by splicing human TAU and non-human TAU genes. In some embodiments, the target fragment can also be a partial nucleotide sequence of the human TAU gene. Preferably, exon x+1 to exon 15 of the human TAU gene can be inserted adjacent to exon x of the TAU gene of non-human animals. For example, exon 2 to exon 4 of the human TAU gene can be inserted adjacent to exon 1 of the TAU gene of non-human animals; exon 3 to exon 5 of the human TAU gene can be inserted adjacent to exon 2 of the TAU gene of non-human animals; exon 4 to exon 6 of the human TAU gene can be inserted adjacent to exon 3 of the TAU gene of non-human animals; exon 5 to exon 7 of the human TAU gene can be inserted adjacent to exon 4 of the TAU gene of non-human animals; exon 6 to exon 8 of the human TAU gene can be inserted adjacent to exon 5 of the TAU gene of non-human animals; exon 7 to exon 9 of the human TAU gene can be inserted adjacent to exon 6 of the TAU gene of non-human animals; exon 8 to exon 10 of the human TAU gene can be inserted adjacent to exon 7 of the TAU gene of non-human animals; exon 9 to exon 11 of the human TAU gene can be inserted adjacent to exon 8 of the TAU gene of non-human animals; exon 10 to exon 12 of the human TAU gene can be inserted adjacent to exon 9 of the TAU gene of non-human animals; exon 11 to exon 13 of the human TAU gene can be inserted adjacent to exon 10 of the TAU gene of non-human animals; exon 12 to exon 14 of the human TAU gene can be inserted adjacent to exon 11 of the TAU gene of non-human animals; or exon 13 to exon 15 of the human TAU gene can be inserted adjacent to exon 12 of the TAU gene of non-human animals.
[0194] In some embodiments, the method for making the genetically modified animal comprises:
[0195] (1) providing a plasmid comprising a human TAU gene fragment (e.g., a human TAU donor sequence) , flanked by a 5’ homologous arm and a 3’ homologous arm, wherein the 5’ and 3’ homologous arms target an endogenous TAU gene;
[0196] (2) providing one or more small guide RNAs (sgRNAs) that target the endogenous TAU gene;
[0197] (3) modifying genome of a fertilized egg or an embryonic stem cell by using the plasmid of step (1) , the sgRNAs of step (2) , and Cas9;
[0198] (4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudopregnant female mouse or transplanting the embryonic stem cell obtained in step (3) into a blastocyst which is then transplanted into the oviduct of a pseudopregnant female mouse to produce a child mouse that functionally expresses a humanized TAU protein; and
[0199] (5) mating the child mouse obtained in step (2) to obtain a homozygote mouse,
[0200] In some embodiments, the fertilized egg is modified by CRISPR with sgRNAs that target a 5’ -terminal targeting site and a 3’ -terminal targeting site.
[0201] In some embodiments, the sequence encoding the humanized TAU protein is operably linked to an endogenous regulatory element at the endogenous TAU gene locus.
[0202] In some embodiments, the genetically-modified animal does not express an endogenous TAU protein.
[0203] In some embodiments, the method for making the genetically modified animal comprises:
[0204] (1) providing a plasmid comprising a human or chimeric TAU gene fragment (e.g., a human TAU donor sequence) , flanked by a 5’ homologous arm and a 3’ homologous arm, wherein the 5’ and 3’ homologous arms target an endogenous TAU gene;
[0205] (2) providing one or more small guide RNAs (sgRNAs) that target the endogenous TAU gene; and
[0206] (3) modifying genome of a fertilized egg or an embryonic stem cell by inserting the human or chimeric TAU gene fragment (e.g., a human TAU donor sequence) into the genome.
[0207] In some embodiments, the methods of making a genetically-modified animal cells that expresses a human or chimeric TAU includes replacing a nucleotide sequence encoding a region of an endogenous TAU, at an endogenous TAU gene locus, with a nucleotide sequence encoding a corresponding region of a human TAU. The methods of making genetically-modified animal cells that express a human or chimeric TAU includes inserting a nucleotide sequence encoding a human or chimeric TAU into a safe harbor site (e.g., Hipp11 (or H11) or ROSA26 site) or a random locus. As described herein, the methods of making genetically-modified animal cells that express a human or chimeric TAU can generate genetically-modified animal cells that includes a nucleotide sequence that encodes the human or chimeric TAU, wherein the animal cell expresses the human or chimeric TAU.
[0208] In some embodiments, the sequence encoding a corresponding region of the human TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, or a portion thereof, of a human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human TAU comprises a portion of exon 2 and the entire exons 3~15 of the human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human TAU comprises a portion of exon 2 and the entire exons 3~15, optionally including at least 50 bp contiguous nucleotides downstream of 3’ -UTR of the human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human TAU comprises a portion of exon 2 and the entire exons 3~15, optionally including at least 300 bp contiguous nucleotides downstream of 3’ -UTR of the human TAU gene. In some embodiments, the sequence encoding the corresponding region of the human TAU is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 2. In some embodiments, the sequence encoding the corresponding region of the human TAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to the nucleotide sequence of positions 45962338 to 46028634 of NC_000017.11 or SEQ ID NO: 6. In some embodiments, the sequence encoding a region of the endogenous TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or a portion thereof, of the endogenous TAU gene. In some embodiments, the sequence encoding a region of the endogenous TAU comprises a portion of exon 2 and the entire exons 3~10 of the endogenous TAU gene. In some embodiments, the sequence encoding a corresponding region of the human TAU is operably linked to an endogenous, a human, or a chimeric regulatory element at the endogenous TAU locus.
[0209] In the methods of making genetically-modified animal cells by inserting a nucleotide sequence encoding a human or chimeric TAU into a safe harbor site (e.g., Hipp11 (or H11) or ROSA26 site) or a random locus. In some embodiments, the insertion is at a safe harbor site (e.g., Hipp11 (or H11) or ROSA26 site) . In some embodiments, the insertion is at a random locus. In some embodiments, the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence comprising P301S mutation, wherein the amino acid sequence is set forth in SEQ ID NO: 5 or 33. In some embodiments, the sequence encoding the human or chimeric TAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 21 or 34. In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to a brain specific regulatory element (e.g., mouse Prnp promoter) . In some embodiments, the sequence encoding the human or chimeric TAU is operably linked to a human or chimeric regulatory element (e.g., human TAU promoter) .
[0210] Methods of using genetically modified animals
[0211] Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters, 5’ -UTR, and / or any other regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and / or protein assay and / or functional assay. Inclusion in the human transgene of upstream and / or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and / or regulation of the transgene.
[0212] In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.
[0213] Genetically modified animals that express human or humanized TAU protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and / or the efficacy of these human therapeutics in the animal models.
[0214] In various aspects, genetically modified animals are provided that express human or humanized TAU, which are useful for testing therapeutic agents that can decrease or block the interaction between the interaction between TAU and anti-human TAU antibodies, testing whether a therapeutic agent can increase or decrease the immune response, and / or determining whether an agent is a TAU agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (aknock-in or knockout) . In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor (e.g., a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, head and neck cancer, liver cancer, or lung cancer) or a blood cell tumor (e.g., a lymphocyte tumor) .
[0215] In some embodiments, the genetically modified animals can be used for determining effectiveness of a therapeutic agent for the treatment of an TAU-related disorder, wherein the TAU-related disorder is a cancer (e.g., a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., Alzheimer’s disease, Multiple sclerosis (MS) , systemic lupus erythematosus with neuropsychiatric manifestations (NPSLE) , Hashimoto’s encephalopathy (HE) , autoimmune encephalitis, and paraneoplastic neurological syndromes (PNS) ) , an inflammation (e.g., neuroinflammation, arthritis, nephritis, hepatitis, or inflammatory bowel disease (IBD) ) , or a neurological disorder (e.g., a neurodegenerative disease, Alzheimer's disease, cognitive impairment, Parkinson's disease, Huntington's disease, or depression) . In some embodiments, the method includes administering the therapeutic agent to the animal as described herein, wherein the therapeutic agent is a TAU-targeting agent, e.g., an anti-TAU antibody, or a TAU-inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) , and determining therapeutic effects of the therapeutic agent to the TAU-related disorder.
[0216] In some embodiments, the genetically modified animals can be used for determining effectiveness of a therapeutic agent (e.g., an anti-TAU antibody or a TAU-targeting drug (e.g., a TAU-inhibitory nucleic acid) ) for the treatment of cancer. In some embodiments, the methods involve administering the therapeutic agent (e.g., an anti-human TAU antibody or a TAU-targeting drug (e.g., a TAU-inhibitory nucleic acid) ) to the animal as described herein, wherein the animal has a cancer or tumor; and determining inhibitory effects of the therapeutic agent to the cancer or tumor. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment) , a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT.
[0217] In some embodiments, the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal. In some embodiments, the anti-TAU antibody activates TAU signaling pathways. In some embodiments, the anti-TAU antibody does not activate TAU signaling pathways. In some embodiments, the anti-TAU antibody inhibits TAU signaling pathways.
[0218] In some embodiments, the genetically modified animals can be used for determining whether an anti-TAU antibody is a TAU agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of the therapeutic agent (e.g., anti-TAU antibodies) on TAU, whether the agent can upregulate the immune response or downregulate immune response, and / or whether the agent can induce complement mediated cytotoxicity (CMC) or antibody dependent cellular cytotoxicity (ADCC) . In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., cancer.
[0219] The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and / or determining tumor (volume) inhibition rate (TGITV) . The tumor growth inhibition rate can be calculated using the formula TGITV (%) = (1–TVt / TVc) × 100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.
[0220] In some embodiments, the therapeutic agent (e.g., an anti-TAU antibody or a TAU-targeting drug) is designed for treating various cancers. As used herein, the term “cancer” refers to cells having the capacity for autonomous growth, e.g., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term “tumor” as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and / or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. In some embodiments, the agents described herein are designed for treating or diagnosing a carcinoma in a subject. The term “carcinoma” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.
[0221] In some embodiments, the cancer described herein is lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, nervous system tumors, astrocytoma, melanoma, myeloproliferation abnormal syndromes, and sarcomas. In some embodiments, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia. In some embodiments, the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom macroglobulinemia. In some embodiments, the sarcoma is selected from the group consisting of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma , and chondrosarcoma. In a specific embodiment, the tumor is non-small cell lung cancer, metastatic colorectal cancer, cervical cancer, ovarian cancer, nasopharyngeal cancer, gastric cancer, glioma.
[0222] In some embodiments, the cancer described herein a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.
[0223] In some embodiments, the therapeutic agent (e.g., an anti-TAU antibody or a TAU-targeting drug) is designed for treating various autoimmune diseases, including rheumatoid arthritis, Crohn’s disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel diseases (IBD) , ulcerative colitis, or scleroderma. In some embodiments, the therapeutic agent is designed for treating various immune disorders, e.g., asthma, rheumatoid arthritis, or multiple sclerosis. Thus, the methods as described herein can be used to determine the effectiveness of a therapeutic agent (e.g., an anti-TAU antibody or a TAU-targeting drug) in inhibiting immune response. In some embodiments, the immune disorders described herein is Alzheimer’s disease, Multiple sclerosis (MS) , systemic lupus erythematosus with neuropsychiatric manifestations (NPSLE) , Hashimoto’s encephalopathy (HE) , autoimmune encephalitis, and paraneoplastic neurological syndromes (PNS) .
[0224] In some embodiments, the therapeutic agent (e.g., an anti-TAU antibody or a TAU-targeting drug) is designed for treating various inflammations, e.g., neuroinflammation, arthritis, nephritis, hepatitis. In some embodiments, the inflammation described herein includes both acute inflammation and chronic inflammation. Specifically, the inflammation includes but not limited to degenerative inflammation, exudative inflammation (e.g., serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotic inflammation, catarrhal inflammation) , proliferative inflammation, specific inflammation (e.g., tuberculosis, syphilis, leprosy, or lymphogranuloma) .
[0225] In some embodiments, the therapeutic agent (e.g., an anti-TAU antibody or a TAU-targeting drug) is designed for treating neurological disorders, including e.g., a neurodegenerative disease, Alzheimer's disease, cognitive impairment, Parkinson's disease, Huntington's disease, or depression.
[0226] The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-TAU antibody) . The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and / or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC) , hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%. In some embodiments, the animals can have a weight that is at least 5%, 10%, 20%, 30%, or 40%smaller than the weight of the control group (e.g., average weight of the animals that are not treated with the antibody) .
[0227] The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.
[0228] In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and / or a therapeutic strategy.
[0229] The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the TAU gene function, human TAU antibodies, drugs for human TAU targeting sites, the drugs or efficacies for human TAU targeting sites, the drugs for immune-related diseases and antitumor drugs. In some embodiments, the disclosure provides a method to verify in vivo efficacy of TCR-T, CAR-T, and / or other immunotherapies (e.g., T-cell adoptive transfer therapies) . For example, the methods include transplanting human tumor cells into the animal described herein, and applying human CAR-T to the animal with human tumor cells. Effectiveness of the CAR-T therapy can be determined and evaluated. In some embodiments, the animal is selected from the TAU gene humanized non-human animal prepared by the methods described herein, the TAU gene humanized non-human animal described herein, the double-or multi-humanized non-human animal generated by the methods described herein (or progeny thereof) , a non-human animal expressing the human or humanized TAU protein, or the tumor-bearing or inflammatory animal models described herein. In some embodiments, the TCR-T, CAR-T, and / or other immunotherapies can treat the TAU-associated diseases described herein. In some embodiments, the TCA-T, CAR-T, and / or other immunotherapies provides an evaluation method for treating the TAU-associated diseases described herein.
[0230] Genetically modified animal model with two or more human or chimeric genes
[0231] The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric TAU gene and a sequence encoding an additional human or chimeric protein.
[0232] In some embodiments, the additional human or chimeric protein can be Sonic Hedgehog (SHH) , Apolipoprotein E2 (APOE2) , Amyloid Beta Precursor-Like Protein 2 (APLP2) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , and / or Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) .
[0233] The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:
[0234] (a) using the methods of introducing human TAU gene or chimeric TAU gene as described herein to obtain a genetically modified non-human animal;
[0235] (b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.
[0236] In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4 gene. Some of these genetically modified non-human animals are described, e.g., in PCT / CN2017 / 090320, PCT / CN2017 / 099574, PCT / CN2017 / 099576, PCT / CN2022 / 113594, PCT / CN2021 / 095273, PCT / CN2022 / 096667, PCT / CN2020 / 113618, PCT / CN2019 / 128358, PCT / CN2020 / 128201, PCT / CN2022 / 131092, and PCT / CN2021 / 085053; each of which is incorporated herein by reference in its entirety.
[0237] In some embodiments, the TAU humanization is directly performed on a genetically modified animal having a human or chimeric SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4.
[0238] As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-TAU antibody and an additional therapeutic agent for the treatment of cancer. The methods include administering the anti-TAU antibody and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab) , an anti-PD-1 antibody (e.g., nivolumab) , or an anti-PD-L1 antibody. In some embodiments, the additional therapeutic agent is an inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) that targets SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, CTLA4, or any combination thereof.
[0239] In some embodiments, the animal further comprises a sequence encoding a human or humanized PD-1, a sequence encoding a human or humanized PD-L1, or a sequence encoding a human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab) , an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express CD80, CD86, PD-L1, and / or PD-L2.
[0240] In some embodiments, the combination treatment is designed for treating various cancers as described herein, e.g., a solid tumor, gynecologic cancer, breast cancer, colorectal cancer, gastric adenocarcinoma, lung adenocarcinoma, pancreatic cancer, or head and neck cancer.
[0241] In some embodiments, the methods described herein can be used to evaluate the combination treatment with some other methods. The methods of treating a cancer that can be used alone or in combination with methods described herein, include, e.g., treating the subject with chemotherapy, e.g., campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and / or methotrexate. Alternatively or in addition, the methods can include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor (s) , from the patient.
[0242] EXAMPLES
[0243] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0244] Materials and Methods
[0245] The following equipment and materials used in the following examples were obtained from companies identified below.
[0246] C57BL / 6 mice and Flp recombinase transgenic mice were purchased from the National Institutes for Food and Drug Control, National Rodent Laboratory Animal Resources Center.
[0247] Tau (D1M9X) Rabbit mAb was purchased from CST, catalog number: 46687.
[0248] HRP-conjugated GAPDH Monoclonal antibody was purchased from Proteintech, catalog number: HRP-6000.
[0249] EXAMPLE 1: Mice with humanized TAU gene (I)
[0250] In this example, a non-human animal (e.g., a mouse) was modified to include a nucleotide sequence encoding human or humanized TAU protein, and the obtained genetically-modified non-human animal can express a human or humanized TAU protein in vivo. Specifically, using gene-editing techniques, under control of mouse TAU gene regulatory elements, a sequence from portion of exon 2 to the entire exon 10 of the mouse TAU gene (e.g., from the start codon ATG to 3’ -UTR) , about 49.7 kb, was replaced with a corresponding sequence from portion of exon 2 to the entire exon 15 of the human TAU gene (e.g., from the start codon ATG to downstream of 3’ -UTR) , about 66.3 kb. This resulted in a humanized TAU gene locus.
[0251] The mouse TAU gene (NCBI Gene ID: 17762) is located at 104120235 to 104222916 of chromosome 11 (NC_000077.7) , and the human TAU gene (NCBI Gene ID: 4137) is located at 45894554 to 46028334 of chromosome 17 (NC_000017.11) . The mouse TAU transcript is NM_010838.5, and the corresponding protein sequence NP_034968.3 is set forth in SEQ ID NO: 1. The human TAU transcript is NM_001123066.4, and the corresponding protein sequence NP_001116538.2 is set forth in SEQ ID NO: 2. Mouse and human TAU gene loci are shown in FIG. 1.
[0252] FIG. 2 shows an exemplary humanization strategy for the TAU locus. The targeting strategy involves a vector comprising a 5’ homologous arm, a human TAU gene fragment, and a 3’homologous arm. The process involves replacing endogenous TAU sequence with human sequence by homologous recombination.
[0253] To implement the targeting strategy, a targeting vector was constructed. The targeting vector contains homologous arm sequences upstream and downstream of the mouse TAU gene, and an “A Fragment” containing DNA sequences of the human TAU gene. Specifically, sequence of the upstream 5’ homologous arm (5’ homologous arm, SEQ ID NO: 3) is identical to nucleotide sequence at positions 104170214 to 104173206 of NCBI accession number NC_000077.7, and sequence of the downstream 3’ homologous arm (3’ homologous arm, SEQ ID NO: 4) is identical to nucleotide sequence at positions 104222917 to 104225877 of NCBI accession number NC_000077.7. The nucleotide sequence of the human TAU gene fragment is identical to nucleotide sequence at positions 45962338 to 46028634 of NCBI accession number NC_000017.11. The connection between the upstream of the human TAU gene fragment and the mouse sequence was designed as: 5’ -CCACCTGTAACCAATTCCATTGTCTTTTTTTCCTCCAGGCTTTGAACCAGT TGAGCCCCGCCAGGAGTTCGAAGTGATGGAAGATCACGCTGGGACG-3’ (SEQ ID NO: 7) , wherein the last “T” in sequence “CCAGT” is the last nucleotide of the mouse sequence, and the first “A” in sequence is the first nucleotide of the human sequence. The connection between the downstream of the human TAU gene fragment and the mouse sequence was designed as (without the Neo cassette) : 5’ -AGCCTTGTGGCTGACCTCACGATGCAGCACTCAGTTTGCAAGACCGGCACCA ATCTCTGTTCATGAGTTCCAAGTACAAGAAAACAATGGTTTACAAGTTCTTTCCCCC-3’ (SEQ ID NO: 8) , wherein the last “A” in sequence “CACCA” is the last nucleotide of the human sequence, and the first “C” in sequence is the first nucleotide of the mouse sequence.
[0254] The targeting vector also includes a resistance gene for positive clone selection, namely the neomycin phosphotransferase coding sequence (Neo) , flanked by two site-specific recombination system Frt recombination sites arranged in the same direction, forming a Neo cassette. The connection between the 5’ end of the Neo cassette and the mouse sequence was designed as: 5’ -ACACACCATTGCCTGTAATCACTAAAGGCGGGAGCAGCCTACACATCCATCCACA AACGTTCCTTATCATCTGGCGAATCGGACCCACAAGAGCACTGAGGTCGGAAGTTCCT-3’ (SEQ ID NO: 9) , wherein the last “A” in sequence “CCACA” is the last nucleotide of the mouse sequence, and the first “G” in sequence is the first nucleotide of the Neo cassette. The connection between the 3’ end of the Neo cassette and the human sequence was designed as: 5’ -CTAGAAAGTATAGGAACTTCATCAGTCCAGGATACATAGATTACCACAACTCCGAGCCCTTCCACC GTAGATGCCTTTTGGTACATCCGTGGCGACGGAATACTAAGCAGCCTGTGT-3’ (SEQ ID NO: 10) , wherein the last “C” in sequence “CCACC” is the last nucleotide of the Neo cassette, and the first “G” in sequence is the first nucleotide of the human sequence. The mRNA sequence of the engineered humanized mouse TAU is set forth in SEQ ID NO: 6, and its encoded protein sequence is set forth in SEQ ID NO: 2.
[0255] The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation. The constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. Embryonic stem cells of C57BL / 6 mice were transfected by electroporation with the targeting vector that had been verified as correct. The obtained cells were screened using a positive clone selection marker gene to identify the correct positive clone cells. The correct positive clone cells (black mice) were introduced into isolated blastocysts (white mice) using techniques known in the art. The resulting chimeric blastocysts were briefly cultured in a medium and then transplanted into the fallopian tubes of recipient female mice (white mice) , producing F0 generation chimeric mice (black and white) . The F0 chimeric mice were backcrossed with wild-type mice to obtain F1 generation mice. The F1 heterozygous mice were then interbred to produce F2 generation homozygous mice. Additionally, positive (e.g., heterozygous) mice were mated with Flp tool mice to remove the positive clone selection marker gene, and subsequent interbreeding produced TAU gene humanized homozygous mice.
[0256] The genotype of somatic cells in F1 generation mice was identified using the PCR method. PCR identification was performed using the primers described in the table below. Exemplary results are shown in FIGs. 3A-3B (the unmarked lanes in the picture are irrelevant results) . Based on the PCR and sequencing results, 7 mice numbered from F1-01 to F1-07 were positive mice.
[0257] Table 3. PCR primer sequences and target fragment size
[0258] The expression of mRNA in TAU gene humanized mice was detected by RT-PCR. Specifically, one 7-week-old C57BL / 6 mouse (+ / +) and one 7-week-old male TAU gene humanized homozygous (H / H) mouse prepared in this study were selected. After euthanasia by cervical dislocation, brain tissue was collected, and RT-PCR detection was performed using the primer sequences shown in the table below. The results are shown in FIG. 4. As can be seen from FIG. 4, only mouse TAU mRNA was detected in the wild-type C57BL / 6 mouse, and no human TAU mRNA was detected; in the TAU gene humanized homozygous mouse, only human TAU mRNA was detected.
[0259] Table 4. RT-PCR primer sequences and target fragment size
[0260] Additionally, the expression of human TAU protein in TAU humanized mice was detected using conventional methods, e.g., Western Blot. Specifically, one 7-week-old male C57BL / 6 mouse (+ / +) and one 7-week-old male TAU gene humanized homozygous (H / H) mouse prepared in this study were selected. After euthanasia by cervical dislocation, brain tissues were collected. Western Blot was performed to detect the expression of human or humanized TAU protein using human-mouse cross-antibody Tau (D1M9X) Rabbit mAb. The detection results are shown in FIG. 5. The results indicate that the expression of TAU protein was detected in the brain tissues of both wild-type C57BL / 6 mice and TAU gene humanized homozygous mice. Combined with the above RT-PCR results in FIG. 4, the modified humanized mice can normally express human TAU protein.
[0261] EXAMPLE 2: Mice with humanized TAU gene (Ⅱ)
[0262] In this example, a non-human animal (e.g., a mouse) was modified to include a nucleotide sequence encoding human or humanized TAU P301S protein, and the obtained genetically-modified non-human animal can express a human or humanized TAU P301S protein in vivo. Specifically, using gene-editing techniques, the human TAU P301S protein coding sequence (e.g., coding CDS) was inserted into the H11 or ROSA26 locus of the mouse, resulting in a humanized TAU gene locus. The human TAU transcript is NM_001123067.4, and the corresponding protein sequence NP_001116539.1 is set forth in SEQ ID NO: 36.
[0263] To implement the targeting strategy, a targeting vector was constructed as shown in FIG. 6. The targeting vector contains homologous arm sequences upstream and downstream of the mouse TAU gene, two copies of an insulator sequence (2×Insulator, SEQ ID NO: 26) at both the 5’ and 3’ ends, and an “A Fragment” that contains DNA sequences of the human TAU gene fragment along with the first and second parts of the mouse Prnp gene. Specifically, sequence of the upstream 5’ homologous arm is set forth in SEQ ID NO: 27, and sequence of the downstream 3’ homologous arm is set forth in SEQ ID NO: 28. The nucleotide sequence of the human TAU gene fragment is set forth in SEQ ID NO: 21. The connection between the upstream of the first part of the mouse Prnp sequence and the 2×Insulator sequence at 5’ end was designed as: 5’ -TCATCCAACTCCAGGACGGAGTCAGTGAGAA CTCGACAGAGTATTTTCATTCTAACTACCACAGTTGCTGAGGAATTTAATTAAAACTACAAC-3’ (SEQ ID NO: 22) , wherein the last “T” in sequence is the last nucleotide of the 2×Insulator sequence at 5’ end, and the first “C” in sequence “CTCGAC” is the first nucleotide of the first part of the mouse Prnp sequence. The connection between the downstream of the first part of the mouse Prnp sequence and the human sequence was designed as: 5’ -GCATTCTGCCTTCCTAGTGGTACCG ATGGCTGAGCCCCGCCAGGAGTTC-3’(SEQ ID NO: 23) , wherein the last “C” in sequence is the last nucleotide of the mouse sequence, and the first “A” in sequence “ATGGCT” is the first nucleotide of the human sequence. The connection between the upstream of the second part of the mouse Prnp sequence and the human sequence was designed as: 5’ -TCCCTGGCCAAGCAGGGTT CTCGAGCCTTCCTGCTTGTTCCTTCGCATT-3’ (SEQ ID NO: 24) , wherein the last “A” in sequence is the last nucleotide of the human sequence, and the first “C” in sequence “CTCGA” is the first nucleotide of the second part of the mouse Prnp sequence. The connection between the downstream of the second part of the mouse Prnp sequence and the 2×Insulator sequence at 3’ end was designed as: 5’ -CAGAGAGGGTTACGCGTTCGAAATAGATCTGGCCATCTAGACATGGAATCGATGTC GAGCTCACGGGGACAGCCCCCCCCCAAAG-3’ (SEQ ID NO: 25) , wherein the last “C” in sequence is the last nucleotide of the mouse sequence, and the first “G” in sequence “GAGCT” is the first nucleotide of the 2×Insulator sequence at 3’ end. F0 generation chimeric mice were produced with the methods as described in Example 1. The obtained F0 chimeric mice were backcrossed with wild-type mice to obtain F1 generation mice. The F1 heterozygous mice were then interbred to obtain F2 generation homozygous mice. The protein sequence expressed by the modified humanized mice is set forth in SEQ ID NO: 5.
[0264] The expression of mRNA in TAU P301S gene humanized mice was detected by RT-PCR. Specifically, one C57BL / 6 mouse (+ / +) and one TAU P301S gene humanized heterozygous (H / +) mouse prepared in this study were selected. After euthanasia by cervical dislocation, brain tissue was collected, and RT-PCR detection was performed using the primer sequences shown in the table below. The results are shown in FIG. 7. As can be seen from FIG. 7, only mouse TAU mRNA was detected in the wild-type C57BL / 6 mouse, and no human TAU P301S mRNA was detected; in the TAU P301S gene humanized heterozygous mice, both human TAU P301S mRNA and mouse TAU mRNA was detected.
[0265] Table 5. RT-PCR primer sequences and target fragment size
[0266] Additionally, the expression of human TAU P301S protein in TAU P301S humanized mice was detected using conventional methods, e.g., Western Blot. Specifically, one 12-week-old male C57BL / 6 mouse (+ / +) and one 12-week-old male TAU P301S gene humanized homozygous (H / H) mouse prepared in this study were selected. After euthanasia by cervical dislocation, brain tissues (e.g., cortex and hippocampus) were collected. Western Blot was performed to detect the expression of human or humanized TAU P301S protein using human-mouse cross-antibody Phospho-Tau (Ser202, Thr205) Monoclonal Antibody (AT8) , Biotin (Invitrogen, Cat. No: MN1020) and anti-TAU antibody (CST, Cat. No: 46687) . The detection results are shown in FIG. 8. The results indicate that the expression of TAU protein was detected in brain cortex and hippocampus of both wild-type C57BL / 6 mice and TAU gene humanized homozygous mice. Combined with the above RT-PCR results in FIG. 7, the modified humanized mice can normally express human TAU protein.
[0267] EXAMPLE 3: Transgenic Humanized Mice with TAU Gene Point Mutation (P301S)
[0268] In this example, C57BL / 6 mice are used as the background. Bacterial artificial chromosome (BAC) transgenic technology was employed to modify the C57BL / 6 mice by introducing the nucleotide sequence of the full-length human TAU gene with the point mutation (P301S) (SEQ ID NO: 33) into the human BAC (BAC Clone NO: CH17-236D4) . The goal was to achieve the expression of the human TAU point mutation (P301S) protein (SEQ ID NO: 5) in C57BL / 6 background mice, regulated by the human TAU promoter. Specifically, using a BAC clone containing the entire human TAU gene, the vector containing the human TAU point mutation P301S sequence and auxiliary sequence (Neo cassette) , about 3.1kb in length, was electroporated into the BAC, where the vector sequence is as shown in SEQ ID NO: 35. Subsequently, the Neo resistance gene is deleted by electroporation of a vector containing a nucleotide sequence encoding Flp recombinase, leaving one Frt site, resulting in a modified human BAC clone.
[0269] The modified human BAC clone was injected into the pronucleus of fertilized eggs by microinjection to produce F0 generation transgenic mice. These mice were screened to confirm whether the target gene has integrated into the mouse genome. The F0 positive mice were backcrossed with wild-type mice to obtain F1 generation mice. The F1 heterozygous mice were then intercrossed to obtain F2 generation homozygous mice. The mRNA sequence of the engineered humanized mouse TAU is set forth in SEQ ID NO: 34, and its encoded protein sequence is set forth in SEQ ID NO: 33.
[0270] The construction of the targeting vector can be carried out using conventional methods, e.g., enzyme digestion and ligation, or direct synthesis. The constructed targeting vector was preliminarily tested by enzyme digestion and then sent to a sequencing company for sequencing verification. The targeting vector, verified to have the correct sequence, was used for subsequent experiments.
[0271] EXAMPLE 4: In vivo efficacy verification
[0272] The humanized mice disclosed in this invention can be used to induce and produce various human disease models, e.g., models for Alzheimer's disease, Parkinson's disease, or other diseases, and can be used to test the in vivo efficacy of human-specific antibodies. For example, TAU gene humanized mice or TAU P301S humanized mice can be used to evaluate the efficacy, pharmacokinetics, and in vivo therapeutic efficacy of antagonists targeting the human-specific TAU signaling pathway in various disease models known in the field.
[0273] The TAU humanized mice or TAU P301S humanized mice prepared in this disclosure can be used to evaluate the efficacy of drugs targeting human TAU. Specifically, three 10-week-old male TAU humanized mice were randomly divided into a control group (G1) and a treatment group (G2) , with one mouse in the control group and two mice in the treatment group. On day 0 after grouping, the treatment group mice were injected intracerebroventricularly with a human TAU-targeting nucleic acid drug, while the control group mice were injected with an equal volume of αCSF (Artificial Cerebrospinal Fluid) . Fourteen days after the first administration, the mice were euthanized, and brain tissue was collected. The mRNA expression levels of human TAU in the cortex and hippocampus of the mice were detected using qRT-PCR.
[0274] The results showed that compared with the control group (G1) , the mRNA expression of human TAU (hTAU mRNA) in the cortex and hippocampus of the treatment group (G2) mice was significantly reduced (with the G1 group content set as 100%) , with inhibition rates of 79.5%in cortex (FIG. 9A) and 84.5%hippocampus (FIG. 9B) , respectively. This indicates that TAU humanized mice can be used for in vivo efficacy evaluation of drugs targeting human TAU.
[0275] EXAMPLE 5: Generation of double-or multi-gene humanized mice
[0276] The methods described herein or the TAU / TAU P301S gene humanized mice produced by the disclosed methods can also be used to create multi-humanized mouse models. For example, in Example 1, the embryonic stem cells used for microinjection can be obtained from mice containing at least one gene modification such as modified (e.g., human or humanized) SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4. Alternatively, based on the humanized TAU mice, double or multi-humanized mouse models can be obtained using isolated mouse embryonic stem cells and gene recombination targeting techniques. TAU homozygous or heterozygous mice obtained by the methods described herein can also be crossed with other gene-modified mice. Their offspring can be screened, and according to Mendelian inheritance, there is a certain probability of obtaining multi-gene modified mice with humanized TAU gene and other gene modifications. Interbreeding these heterozygous mice can produce homozygous mice with double or multiple gene modifications.
[0277] OTHER EMBODIMENTS
[0278] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1.A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric microtubule associated protein (TAU) .2.The animal of claim 1, wherein the sequence encoding the human or chimeric TAU is at an endogenous TAU gene locus in the at least one chromosome.3.The animal of claim 1 or 2, wherein the sequence encoding the human or chimeric TAU is operably linked to an endogenous regulatory element (e.g., an endogenous 5’-UTR) .4.The animal of claim 1, wherein the sequence encoding the human or chimeric TAU is at a safe harbor locus (e.g., Hipp11 or ROSA26) .5.The animal of claim 1, wherein the sequence encoding the human or chimeric TAU is inserted at a random locus in the genome, or wherein the sequence encoding the human or chimeric TAU is not an endogenous TAU gene locus and is not at a safe harbor locus.6.The animal of any one of claims 1-5, wherein the sequence encoding the human or chimeric TAU is operably linked to a human regulatory element, a mouse regulatory element, or a chimeric regulatory element.7.The animal of any one of claims 1-6, wherein the sequence encoding the human or chimeric TAU is operably linked to a brain specific regulatory element (e.g., a mouse Prnp promoter) .8.The animal of any one of claims 1-7, wherein the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TAU (NP_001116538.2 (SEQ ID NO: 2) ) , SEQ ID NO: 5, or SEQ ID NO: 33.9.The animal of any one of claims 1-8, wherein the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence comprising a P301S mutation, optionally, wherein the amino acid sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5 or 33.10.The animal of any one of claims 1-9, wherein the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat.11.The animal of any one of claims 1-10, wherein the animal is a mouse.12.The animal of any one of claims 1-11, wherein the animal does not express endogenous TAU or expresses a decreased level of endogenous TAU as compared to TAU expression level in a wild-type animal.13.The animal of any one of claims 1-12, wherein the animal has one or more cells expressing human or chimeric TAU.14.A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of an endogenous TAU with a sequence encoding a corresponding region of a human TAU at an endogenous TAU gene locus.15.The animal of claim 14, wherein the sequence encoding a corresponding region of the human TAU is operably linked to an endogenous regulatory element at the endogenous TAU locus, and one or more cells of the animal expresses a human or chimeric TAU.16.The animal of claim 14 or15, wherein the animal does not express the endogenous TAU or expresses a decreased level of the endogenous TAU as compared to the TAU expression level in a wild-type animal.17.The animal of any one of claims 14-16, wherein the sequence encoding the corresponding region of the human TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, or a portion thereof, of a human TAU gene.18.The animal of any one of claims 14-17, wherein the sequence encoding the corresponding region of the human TAU comprises a portion of exon 2 and the entire exons 3~15 of the human TAU gene.19.The animal of any one of claims 14-18, wherein the sequence encoding the corresponding region of the human TAU comprises a portion of exon 2 and the entire exons 3~15, optionally including at least 50, 100, 150, 200, 250, or 300 bp contiguous nucleotides downstream of 3’-UTR of the human TAU gene.20.The animal of any one of claims 14-19, wherein the sequence encoding the corresponding region of the human TAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to the nucleotide sequence of positions 45962338 to 46028634 of NC_000017.11 or SEQ ID NO: 6.21.The animal of any one of claims 14-20, wherein the sequence encoding a region of the endogenous TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or a portion thereof, of the endogenous TAU gene.22.The animal of any one of claims 14-21, wherein the sequence encoding a region of the endogenous TAU comprises a portion of exon 2 and the entire exons 3~10 of the endogenous TAU gene.23.The animal of any one of claims 14-22, wherein the animal is heterozygous with respect to the replacement at the endogenous TAU gene locus.24.The animal of any one of claims 14-23, wherein the animal is homozygous with respect to the replacement at the endogenous TAU gene locus.25.The animal of any one of claims 14-24, wherein the animal is a mouse.26.A non-human animal whose genome comprises an insertion of a sequence encoding a human or chimeric TAU.27.The non-human animal of claim 26, wherein the insertion is at a safe harbor locus (e.g., Hipp11 (or H11) or ROSA26 site) .28.The non-human animal of claim 26, wherein the insertion is at a random locus in the genome.29.The non-human animal of any one of claims 26-28, wherein the sequence encoding the human or chimeric TAU is operably linked to a brain specific regulatory element (e.g., mouse prion protein (Prnp) promoter) .30.The non-human animal of any one of claims 26-28, wherein the sequence encoding the human or chimeric TAU is operably linked to a human or chimeric regulatory element (e.g., a human TAU promoter) .31.The non-human animal of any one of claims 27-30, wherein the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence comprising P301S mutation, optionally wherein the amino acid sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5 or 33.32.The non-human animal of any one of claims 27-31, wherein the one or more cells of the non-human animal expresses a human or chimeric TAU.33.A method for making a genetically-modified, non-human animal, comprising:replacing a sequence encoding a region of an endogenous TAU with a sequence encoding a corresponding region of a human or chimeric TAU, at an endogenous TAU gene locus.34.The method of claim 32, wherein the animal does not express the endogenous TAU or expresses a decreased level of endogenous TAU as compared to TAU expression level in a wild-type animal.35.The method of claim 33 or 34, wherein the sequence encoding a corresponding region of the human or chimeric TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, or a portion thereof, of a human TAU gene.36.The method of any one of claims 33-35, wherein the sequence encoding the corresponding region of the human or chimeric TAU comprises a portion of exon 2 and the entire exons 3~15 of the human TAU gene.37.The method of any one of claims 33-36, wherein the sequence encoding the corresponding region of the human or chimeric TAU comprises a portion of exon 2 and the entire exons 3~15, optionally including at least 50, 100, 150, 200, 250, or 300 bp contiguous nucleotides downstream of 3’-UTR of the human TAU gene.38.The method of any one of claims 33-37, wherein the sequence encoding the corresponding region of the human or chimeric TAU is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to positions 45962338 to 46028634 of NC_000017.11 or SEQ ID NO: 6, and / or wherein the animal expresses an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TAU (NP_001116538.2 (SEQ ID NO: 2) ) , SEQ ID NO: 5, or SEQ ID NO: 33.39.The method of any one of claims 33-38, wherein the sequence encoding a region of the endogenous TAU comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or a portion thereof, of the endogenous TAU gene.40.The method of any one of claims 33-39, wherein the sequence encoding the region of the endogenous TAU comprises a portion of exon 2, the entire exons 3~10 of the endogenous TAU gene.41.The method of any one of claims 33-40, wherein the animal is heterozygous with respect to the replacement at the endogenous TAU gene locus.42.The method of any one of claims 33-41, wherein the animal is homozygous with respect to the replacement at the endogenous TAU gene locus.43.The method of any one of claims 33-42, wherein the animal is a mouse.44.A method for making a genetically-modified, non-human animal, comprising inserting a sequence encoding a human or chimeric TAU to the genome of the animal.45.The method of claim 44, wherein the sequence encoding a human or chimeric TAU is inserted at a safe harbor locus (e.g., Hipp11 (or H11) or ROSA26 locus) .46.The method of claim 44, wherein the sequence encoding a human or chimeric TAU is inserted at a random locus in the genome.47.The method of any one of claims 44-46, wherein the sequence encoding the human or chimeric TAU is operably linked to a brain specific regulatory element (e.g., a mouse Prnp promoter) .48.The method of any one of claims 44-47, wherein the sequence encoding the human or chimeric TAU is operably linked to a human or a chimeric regulatory element (e.g., a human TAU promoter) .49.The method of any one of claims 44-48, wherein the sequence encoding the human or chimeric TAU comprises a sequence encoding an amino acid sequence comprising P301S mutation, optionally wherein the amino acid sequence is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5 or 33.50.The method of any one of claims 44-49, wherein the non-human animal expresses a human or chimeric TAU.51.The method of any one of claims 44-50, wherein the non-human animal is a mouse.52.The animal of any one of claims 1-32, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.53.The animal of claim 52, wherein the additional human or chimeric protein is one or more selected from the group consisting of Sonic Hedgehog (SHH) , Apolipoprotein E2 (APOE2) , Amyloid Beta Precursor-Like Protein 2 (APLP2) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , and Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) .54.The method of any one of claims 33-51, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.55.The method of claim 54, wherein the additional human or chimeric protein is one or more selected from the group consisting of SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGHT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.56.A method of determining effectiveness of a therapeutic agent for the treatment of cancer, comprising:a) administering the therapeutic agent to the animal of any one of claims 1-32, 52, and 53, wherein the animal has a tumor; andb) determining inhibitory effects of the therapeutic agent to the tumor.57.The method of claim 56, wherein the therapeutic agent is an anti-TAU antibody (e.g., an anti-human TAU antibody) .58.The method of claim 56 or 57, wherein the tumor comprises one or more cancer cells that are injected into the animal.59.The method of any one of claims 56-58, wherein determining inhibitory effects of the anti-TAU antibody to the tumor involves measuring the tumor volume in the animal.60.The method of any one of claims 56-59, wherein the cancer is a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.61.A method of determining effectiveness of an anti-TAU antibody and an additional therapeutic agent for the treatment of cancer, comprisinga) administering the anti-TAU antibody and the additional therapeutic agent to the animal of any one of claims 1-32, 52, and 53, wherein the animal has a tumor; andb) determining inhibitory effects on the tumor.62.The method of claim 61, wherein the animal further comprises a sequence encoding a human or chimeric PD-1, a human or chimeric PD-L1, and / or a human or chimeric CTLA4.63.The method of claim 61 or 62, wherein the additional therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA4 antibody.64.The method of any one of claims 61-63, wherein the tumor comprises one or more tumor cells that express PD-L1.65.The method of any one of claims 61-64, wherein the tumor comprises one or more tumor cells that are injected into the animal.66.The method of any one of claims 61-65, wherein determining inhibitory effects of the treatment involves measuring the tumor volume in the animal.67.The method of any one of claims 61-66, wherein the animal has a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.68.A method of determining effectiveness of a therapeutic agent for the treatment an immune disorder (e.g., an autoimmune disease) , comprising:a) administering the therapeutic agent to the animal of any one of claims 1-32, 52, and 53, wherein the animal has the immune disorder; andb) determining effects of the therapeutic agent to the immune disorder.69.The method of claim 68, wherein the immune disorder (e.g., an autoimmune disease) is Alzheimer’s disease, Multiple sclerosis (MS) , systemic lupus erythematosus with neuropsychiatric manifestations (NPSLE) , Hashimoto’s encephalopathy (HE) , autoimmune encephalitis, and paraneoplastic neurological syndromes (PNS) .70.A method of determining effectiveness of a therapeutic agent for reducing an inflammation, comprising:a) administering the therapeutic agent to the animal of any one of claims 1-32, 52, and 53, wherein the animal has the inflammation; andb) determining effects of the therapeutic agent to the inflammation.71.The method of claim 70, wherein the inflammation comprises neuroinflammation, arthritis, nephritis, hepatitis, or inflammatory bowel disease (IBD) .72.A method of determining effectiveness of a therapeutic agent for the treatment of a neurological disorder, comprising:a) administering the therapeutic agent to the animal of any one of claims 1-32, 52, and 53, wherein the animal has the neurological disorder; andb) determining effects of the therapeutic agent to the neurological disorder.73.The method of claim 72, wherein the neurological disorder comprises a neurodegenerative disease, Alzheimer's disease, cognitive impairment, Parkinson's disease, Huntington's disease, or depression.74.A method of determining effectiveness of a therapeutic agent for reducing aggregation of a TAU protein or removing amyloid plaques, comprising:a) administering the therapeutic agent to the animal of any one of claims 1-32, 52, and 53, wherein the animal has the neurological disorder; andb) determining effects of the therapeutic agent for reducing aggregation of a TAU protein or removing amyloid plaques.75.A method of determining toxicity of a therapeutic agent comprising:(a) administering the therapeutic agent to the animal of any one of claims 1-32, 52, and 53; and(b) determining effects of the therapeutic agent to the animal.76.The method of claim 75, wherein the therapeutic agent is a TAU-targeting agent (e.g., anti-TAU antibody) .77.The method of claim 75 or 76, wherein determining effects of the therapeutic agent to the animal involves measuring the body weight, red blood cell count, hematocrit, and / or hemoglobin of the animal.78.A method of determining effectiveness of a therapeutic agent for the treatment of a TAU-related disorder, comprising:(a) administering the therapeutic agent to the animal of any one of claims 1-32, 52, and 53, wherein the animal has the TAU-related disorder; and(b) determining therapeutic effects of the therapeutic agent to the TAU-related disorder, wherein the TAU-related disorder is a cancer (e.g., a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., Alzheimer’s disease, Multiple sclerosis (MS) , systemic lupus erythematosus with neuropsychiatric manifestations (NPSLE) , Hashimoto’s encephalopathy (HE) , autoimmune encephalitis, and paraneoplastic neurological syndromes (PNS) ) , or a neurological disorder (e.g., a neurodegenerative disease, Alzheimer's disease, cognitive impairment, Parkinson's disease, Huntington's disease, or depression) .79.The method of claim 78, wherein the therapeutic agent is a TAU-targeting agent.80.The method of claim 78 or 79, wherein the TAU-targeting agent is an anti-TAU antibody (e.g., an anti-human TAU antibody) .81.The method of any one of claims 78-80, wherein the TAU-targeting agent is a TAU-inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) .82.A method of determining effectiveness of an anti-TAU antibody and an additional therapeutic agent for the treatment of a TAU-related disorder, comprising(a) administering the anti-TAU antibody and the additional therapeutic agent to the animal of any one of claims 1-32, 52, and 53 wherein the animal has the TAU-related disorder; and(b) determining inhibitory effects on the TAU-related disorder,wherein the TAU-related disorder is a cancer (e.g., a breast cancer, endocrine cancer, nervous system tumors, pancreatic cancer, colon cancer, solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., Alzheimer’s disease, Multiple sclerosis (MS) , systemic lupus erythematosus with neuropsychiatric manifestations (NPSLE) , Hashimoto’s encephalopathy (HE) , autoimmune encephalitis, and paraneoplastic neurological syndromes (PNS) ) , or a neurological disorder (e.g., a neurodegenerative disease, Alzheimer's disease, cognitive impairment, Parkinson's disease, Huntington's disease, or depression) .83.The method of claim 82, wherein the animal further comprises a sequence encoding Sonic Hedgehog (SHH) , Apolipoprotein E2 (APOE2) , Amyloid Beta Precursor-Like Protein 2 (APLP2) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) , or any combination thereof.84.The method of claim 82 or 83, wherein the additional therapeutic agent is an antibody (e.g., an anti-human antibody) that binds to SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, CTLA4, or any combination thereof.85.The method of any one of claims 82-84, wherein the additional therapeutic agent is an inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) that targets SHH, APOE2, APLP2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, CTLA4, or any combination thereof.86.A protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:(a) an amino acid sequence set forth in SEQ ID NO: 1, 2, 5, 33, or 36;(b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 1, 2, 5, 33, or 36;(c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 2, 5, 33, or 36;(d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, 5, 33, or 36 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid; or(e) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, 5, 33, or 36.87.A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:(a) a sequence that encodes the protein of claim 81;(b) SEQ ID NO: 3, 4, 6, 7, 8, 21, 27, 28, 34, or a nucleotide sequence of positions 45962338 to 46028634 of NC 000017.11;(c) a sequence that is at least 90%identical to SEQ ID NO: 3, 4, 6, 7, 8, 21, 27, 28, 34, or a nucleotide sequence of positions 45962338 to 46028634 of NC_000017.11; or(d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 6, 7, 8, 21, 27, 28, 34, or a nucleotide sequence of positions 45962338 to 46028634 of NC_000017.11.88.A cell comprising the protein of claim 86 and / or the nucleic acid of claim 87.89.An animal comprising the protein of claim 86 and / or the nucleic acid of claim 87.
Citation Information
Patent Citations
Human anti-TAU antibodies
CN103339146A
Models of tauopathy
CN113906134A
Method for constructing rabbit model of Alzheimer's disease
CN115125244A
Detection and treatment of neurodegenerative tauopathies
WO2008094713A2