Methods for genetically engineering mammalian cells using serial delivery
The method of delivering DNA and RNA/nuclease cargos to mammalian cells addresses inefficiencies in existing protocols, improving knock-in efficiency and cost-effectiveness while ensuring GMP compliance for genetically engineered cell production.
Patent Information
- Application Number
- PCT/US2025/018769
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-06
- Filing Date
- 2025-03-06
- Publication Date
- 2025-09-11
AI Technical Summary
Current protocols for generating genetically engineered mammalian cells, particularly human induced pluripotent stem cells, are inefficient in terms of cost and process duration, and often incompatible with Good Manufacturing Practices (GMP) regulations due to complexity, reliance on undefined media components, and costly equipment.
A method involving the sequential delivery of a first cargo comprising DNA and a second cargo comprising RNA and a nuclease to mammalian cells, mediating single or double-strand DNA breaks at a target locus, followed by incubation to produce genetically engineered cells.
This method enhances knock-in efficiency and reduces production costs while meeting GMP compliance requirements, offering a more consistent and cost-effective process for generating genetically engineered mammalian cells.
Smart Images

Figure US2025018769_12092025_PF_FP_ABST
Abstract
Description
METHODS FOR GENETICALLY ENGINEERING MAMMALIAN CELLSUSING SERIAL DELIVERYCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 562,006, filed March 6, 2024, the disclosure of the prior application is considered to be part of and is herein incorporated by reference in the disclosure of this application in its entirety.SEQUENCE STATEMENT
[0002] The instant application contains a Sequence Listing, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said XML copy, created on February 25, 2025, is named N2041 -0350 l_Sequence_Listing. xml and is 28.7 kb in size.FIELD
[0003] The present invention relates generally to stem cells and more specifically to methods of increasing knock-in efficiency when transfecting pluripotent stem cells (PSCs).BACKGROUND
[0004] Induced pluripotent stem cells (iPSCs) are versatile cells with a wide potential for application in both therapy and research. For example, transplanted iPSCs that have been programmed to differentiate into mesenchymal stromal cells (MSCs) may exert beneficial effects such as immunomodulation. Alternatively, iPSCs can be used to regenerate or replace damaged tissues, or they can be engineered to actively fight disease by releasing specific factors or killing unwanted cells, as in cancer immunotherapy. iPSCs may serve as a universal starting point to generate cells for all these needs.
[0005] Fundamentally, the promise of iPSCs relies upon their capability for self-renewal - as needed for clonal isolation and expansion - and their pluripotency as a basis for generating virtually any cell type at will. Indeed, reliable culture conditions and dedicated differentiation protocols based on iPSCs have been established over the years and have been entering the first clinical trials. Viable examples include workflows for creating retinal pigment epithelium (RPE), the derivation of MSCs, cardiomyocyte differentiation, or the scalable generation of engineered natural killer (NK) cells. In addition, CRISPR / Cas-based gene editing technology as well as the idea of generating HLA-homozygous iPS cells from corresponding donors have opened perspectives for allogeneic cell therapy with a reduced need for immune suppression in patients.
[0006] However, guidelines for Good Manufacturing Practices (GMP) impose strict regulations and, thereby, significant costs for the manufacture of advanced therapy medicinal products (ATMPs). Many contemporary iPSC manipulation protocols originating in academic settings are either incompatible with these strict regulations or impose high costs for GMP compliance. For instance, the requirement to formally qualify and control / test every supplier, device and critical reagent - and to purchase necessary reagents in their GMP-grade form - strongly selects for simplicity in ATMP manufacturing workflows.
[0007] Another major concern is interexperimental consistency, as failed GMP batches trigger lengthy internal and external / regulatory investigations and can lead to the imposition of large fines as well as high costs for corrective actions. Overall, most available differentiation protocols are complicated in terms of handling steps or in terms of the number of reagents used. They are also prone to technical inconsistencies due to their: (1) reliance on spontaneous differentiation or on selective rather than inductive mechanisms, (2) reliance on undefined, complex, or animal-derived media components, which create an increased risk of contamination or infection; (3) requirement for hard- to -qualify or GMP-incompatible equipment, including, but not limited to, equipment for cell enrichment and cell selection.SUMMARY
[0008] The present disclosure features protocols for generating genetically engineered mammalian cells, including as a non-limiting example, human induced pluripotent stem cells comprising: a) delivering a first cargo comprising DNA to a culture of mammalian cells; b) incubating the culture of mammalian cells in a medium with the first cargo; c) delivering to the culture of mammalian cells a second cargo comprising: an RNA and a nuclease, or an RNA and a nucleotide sequence that encodes a nuclease; thereby mediating a single or double-strand DNA break at a target locus; and d) further incubating the culture of mammalian cells, thereby producing genetically engineered mammalian cells. Most protocols of cellular differentiation are inefficient in terms of their cost of goods and / or process duration, and the strategies that have been developed to improve the efficiency of knock-in processes, such as the use of selection, enrichment, or enhancer molecules, are often incompatible with clinical manufacturing requirements or require complex and costly equipment. In some aspects, the present disclosure features methods that address these many shortcomings with improved efficiency in terms of their cost of goods and / or process duration and other advantageous features as described herein. In some aspects, the present disclosure relates to methods of rapidand efficient production of genetically engineered mammalian cells, including human induced pluripotent stem cells.
[0009] Among the various aspects of the present disclosure is a method of generating genetically engineered mammalian cells comprising: a) delivering a first cargo comprising DNA to a culture of mammalian cells; b) incubating the culture of mammalian cells in a medium with the first cargo; c) delivering to the culture of mammalian cells a second cargo comprising: an RNA and a nuclease, or an RNA and a nucleotide sequence that encodes a nuclease; thereby mediating a single or double-strand DNA break at a target locus; and d) further incubating the culture of mammalian cells, thereby producing genetically engineered mammalian cells.
[0010] In some embodiments, the incubation in step b) is for about 1-60 hours. In some embodiments, the incubation in step b) is for about 1-6 hours, about 1-12 hours, 1-18 hours, 1- 24 hours, 1-30 hours, 1-36 hours, 1-42 hours, 1-48 hours, 1-54 hours, 1-60 hours, or more than about 60 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In certain embodiments, the incubation in step b) is for about 1-12 hours. In certain embodiments, the incubation in step b) is for about 1-24 hours. In certain embodiments, the incubation in step b) is for about 1-30 hours. In certain embodiments, the incubation in step b) is for about 1-36 hours. In certain embodiments, the incubation in step b) is for about 1-42 hours. In certain embodiments, the incubation in step b) is for about 1-48 hours. In certain embodiments, the incubation in step b) is for about 1-54 hours.
[0011] In some embodiments, the incubation in step b) is for about 12-60 hours. In some embodiments, the incubation in step b) is for about 12-18 hours, 12-24 hours, 12-30 hours, 12- 36 hours, 12-42 hours, 12-48 hours, 12-54 hours, 12-60 hours, or more than about 60 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In certain embodiments, the incubation in step b) is for about 12-18 hours. In certain embodiments, the incubation in step b) is for about 12-24 hours. In certain embodiments, the incubation in step b) is for about 12-30 hours. In certain embodiments, the incubation in step b) is for about 12-36 hours. In certain embodiments, the incubation in step b) is for about 12- 42 hours. In certain embodiments, the incubation in step b) is for about 12-48 hours. In certain embodiments, the incubation in step b) is for about 12-54 hours.
[0012] In certain other embodiments, the incubation in step b) is for about 18-30 hours. In some embodiments, the incubation in step b) is for about 18-19 hours, 18-20 hours, 18-21 hours, 18-22 hours, 18-23 hours, 18-24 hours, 18-25 hours, 18-26 hours, or 18-27 hours, 18-28 hours, 18-29 hours, 18-30 hours, more than about 30 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In certain embodiments, the incubation step in b) is for about 24 hours.
[0013] In some embodiments, the incubation in step b) is for a period of about 12-72 hours. In some embodiments, the incubation in step b) is for about 12-18 hours, 12-24 hours, 12-30 hours, 12-36 hours, 12-42 hours, 12-48 hours, 12-54 hours, 12-60 hours, 12-72 hours or more than about 72 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In some embodiments, the incubation in step b) is for a period of about 12-60 hours. In some embodiments, the incubation in step b) is for a period of 12-48 hours. In some embodiments, the incubation in step b) is for a period of about 12-36 hours. In some embodiments, the incubation in step b) is for a period of about 12-30 hours. In some embodiments, the incubation in step b) is for a period of about 12-24 hours. In some embodiments, the incubation in step b) is for a period of about 12-18 hours. In some embodiments, the incubation in step b) is for a period of about 12 hours.
[0014] In some embodiments, the incubation in step b) is for a period of about 18-72 hours. In some embodiments, the incubation in step b) is for about 18-24 hours, 18-30 hours, 18-36 hours, 18-42 hours, 18-48 hours, 18-54 hours, 18-60 hours, 18-72 hours or more than about 72 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In some embodiments, the incubation in step b) is for a period of about I860 hours. In some embodiments, the incubation in step b) is for a period of about 18-48 hours. In some embodiments, the incubation in step b) is for a period of about 18-36 hours. In some embodiments, the incubation in step b) is for a period of about 18-30 hours. In some embodiments the incubation in step b) is for a period of about 18-24 hours. In some embodiments, the incubation in step b) is for a period of about 24 hours. In some embodiments, the incubation in step b) is for a period of about 18 hours.
[0015] In some embodiments, the incubation in step b) further comprises plating the culture of mammalian cells on an adherent surface. In some other embodiments, the incubation in step b) further comprises plating the culture of mammalian cells on a non-adherent surface.
[0016] As featured and disclosed herein, the introduction of complexes, polypeptides, and nucleic acids of the disclosure into cells can occur by bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphateprecipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like. In some embodiments, the first cargo or the second cargo is delivered to the culture of mammalian cells by electroporation, lipofection, nucleofection, microinjection, sonoporation, or magnetofection.
[0017] In some embodiments, the first cargo and the second cargo are sequentially delivered to the culture of mammalian cells using nucleofection.
[0018] In some embodiments, the first cargo comprises a donor nucleotide sequence. In some embodiments, the donor nucleotide sequence is either a circular donor nucleotide sequence or a linear donor nucleotide sequence. In some embodiments, the donor nucleotide sequence is double-stranded. In some embodiments, the donor nucleotide sequence is single- stranded which is converted to a double- stranded nucleotide in the host cell. In some embodiments, the donor nucleotide sequence, includes, as non-limiting examples, a cosmid, artificial chromosome, and / or a vector, such as an expression vector. In some embodiments, the expression vector is a mammalian vector, bacterial vector, a mammalian non-episomal vector, or any other expression vector featured herein. As featured herein, an expression vector includes, as non-limiting examples, a plasmid and a transposon. In some aspects, an expression vector is a plasmid. In some embodiments, the first cargo comprises a donor nucleotide sequence, wherein the donor nucleotide sequence comprises a plasmid. In some embodiments, the first cargo comprises one or more donor nucleotide sequences. In some aspects, one or more donor nucleotide sequences is codon-optimized for expression in the mammalian host cell. In certain embodiments, the donor nucleotide sequence comprises one or more knock-in nucleotide sequences. In certain other embodiments, the donor nucleotide sequence comprises at least two knock-in nucleotide sequences. In certain additional embodiments, the donor nucleotide sequence comprises two, three, four, five, or more than five knock-in nucleotide sequences. In some embodiments, the donor nucleotide sequence comprises one or more knock-in nucleotide sequences, and further comprises a protein-coding sequence.
[0019] In one embodiment the vector is a viral vector based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus) and other recombinant viral vectors. Expression vectors contemplated herein expressly do not include viral vectors.
[0020] In some embodiments, the first cargo and / or second cargo comprise a nuclease, including, as a non-limiting example, an endonuclease. As featured and disclosed herein, certain endonucleases specifically cleave phosphodiester bonds within a polynucleotide and include, as non-limiting examples, transcription activator like effector nuclease (TALEN), a zinc finger nuclease (ZFN), homing endonuclease (HE), meganuclease, MegaTAL, CRISPR- associated endonuclease, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e (CasX), Casl2f (Casl4), Casl2g, Casl2i, Casl2j, Casl3, CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or Cpfl (Casl2a) endonuclease, or any of the endonucleases featured above or herein or a homolog thereof, a recombination of the naturally occurring molecule thereof, a modified version thereof, or combinations thereof. Certain endonucleases specifically cleave phosphodiester bonds within a DNA polynucleotide. Certain endonucleases specifically cleave phosphodiester bonds within an RNA polynucleotide. In some embodiments, an endonuclease may introduce one or more single-stranded breaks (SSBs) and / or one or more double-stranded breaks (DSBs).
[0021] As featured and disclosed herein, certain endonucleases are specifically DNA-guided endonucleases and include, as non-limiting examples, Casl, CaslB, Cas2, Cas4, a TALEN, a ZFN, a homing endonuclease, meganuclease, MegaTAL, or any DNA-guided endonucleases featured above or herein.
[0022] As featured and disclosed herein, certain endonucleases are specifically RNA-guided endonucleases, including, as non-limiting examples, a CRISPR nuclease, e.g., a Type II CRISPR Cas9 endonuclease or a Type V CRISPR Cpfl endonuclease. In some embodiments, RNA-guided endonucleases and include, as non limiting examples, Cas3, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e (CasX), Casl2f (Casl4), Casl2g, Casl2i, Casl2j, Casl3, Csel, Csc2, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csb2, CsxlO, Csxl, Csfl, Csf2, Csf3, Csf4, Cpfl (Casl2a), and CRISPR associated endonuclease or any RNA-guided endonucleases featured above or herein.
[0023] In some embodiments, the second cargo comprises a nuclease. In certain embodiments, the nuclease is selected from: a meganuclease, a TALEN, and a Zinc Finger nuclease, or a functional variant thereof. In some embodiments, the second cargo comprises ameganuclease, or a functional variant thereof. In some embodiments, the second cargo comprises a TALEN, or a functional variant thereof. In some embodiments, the second cargo comprises a Zinc Finger nuclease, or a functional variant thereof.
[0024] In some embodiments, the second cargo comprises: a nucleotide sequence encoding a nuclease. In some embodiments, the nucleotide sequence encoding a nuclease is codon- optimized for expression in the mammalian host cell. In some embodiments, the second cargo comprises a nucleotide sequence encoding a functional variant or active fragment of a nuclease. In certain embodiments, the nucleotide sequence encodes a nuclease selected from: a meganuclease, a TALEN, and a Zinc Finger nuclease or a functional variant thereof, and in some embodiments the nucleotide sequence is codon-optimized for expression in the mammalian host cell. In certain embodiments, the second cargo comprises: a nucleotide sequence encoding a meganuclease, or a functional variant thereof. In some embodiments, the nucleotide sequence encoding a meganuclease is codon-optimized for expression in the mammalian host cell. In certain embodiments, the second cargo comprises: a nucleotide sequence encoding a TALEN, or a functional variant thereof. In some embodiments, the nucleotide sequence encoding a TALEN is codon-optimized for expression in the mammalian host cell. In certain embodiments, the second cargo comprises: a nucleotide sequence encoding a Zinc Finger nuclease, or a functional variant thereof. In some embodiments, the nucleotide sequence encoding a Zinc Finger nuclease is codon-optimized for expression in the mammalian host cell.
[0025] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence.
[0026] In some embodiments, the second cargo comprises: a nucleotide sequence encoding a nuclease and a nucleotide sequence that is complementary to a target nucleotide sequence. In some embodiments, the nucleotide sequence encoding a nuclease is a codon-optimized for expression in a mammalian host cell.
[0027] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is selected from a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof.
[0028] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR- associated system (Cas) protein or functional variant thereof.
[0029] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR- associated system (Cas) protein, wherein the Cas protein is selected from Cas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, C2cl, C2c2, or a homolog or functional variant thereof.
[0030] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR- associated system (Cas) protein, wherein the Cas protein is selected from: Cas9, Cas 12a (Cpfl), or a homolog or functional variant thereof.
[0031] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR- associated system (Cas) protein, wherein the Cas protein is Cas9, or a homolog or functional variant thereof. In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas9, or a functional variant thereof. In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas9.
[0032] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR- associated system (Cas) protein, wherein the Cas protein is HiFiCas9, or a homolog or functional variant thereof. In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is HiFiCas9 or functional variant thereof. In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is HiFiCas9.
[0033] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR- associated system (Cas) protein, wherein the Cas protein is Casl2a (Cpfl), or a homolog or functional variant thereof. In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas 12a (Cpfl) orfunctional variant thereof. In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRIS PR-associated system (Cas) protein, wherein the Cas protein is Casl2a (Cpfl).
[0034] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR- associated system (Cas) protein, wherein the Cas protein is Cas 12a (Cpfl) Ultra, or a homolog or functional variant thereof. In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas 12a (Cpfl) Ultra, or a functional variant thereof. In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas 12a (Cpfl) Ultra.
[0035] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is selected from a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain embodiments, the Cas protein is selected from: Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof.
[0036] In some embodiments, the Cas protein is selected from: Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof.
[0037] In some embodiments, the Cas protein is selected from: Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5,Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a functional variant thereof.
[0038] In some embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9.
[0039] In some embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof.
[0040] In some embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, spCas9mSA, HpaCas9, and xCas9; or a functional variant thereof.
[0041] In some embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, spCas9mSA, HpaCas9, and xCas9.
[0042] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is selected from a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain further embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9 and xCas9; or a homolog or functional variant thereof.
[0043] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence. In certain embodiments, the nuclease isselected from a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9 and xCas9; or a homolog or functional variant thereof. In certain further embodiments, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2f, and Casl2j, Casl3; or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO and CasX; or a functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, HiFiCas9, Cas 12a (Cpfl) and Cas 12a (Cpfl) Ultra. In certain other embodiments, the Cas protein is selected from Cas9 or Cas 12a (Cpfl), or a functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9 or Cas 12a (Cpfl).
[0044] In some embodiments, the second cargo comprises: a nucleotide sequence encoding a nuclease, and a nucleotide sequence that is complementary to a target nucleotide sequence. In some embodiments, the nucleotide sequence encoding a nuclease is codon-optimized for expression in the mammalian host cell. In certain embodiments, the nucleotide sequence encoding a nuclease encodes a CRISPR-associated system (Cas) protein or a homolog or functional variant thereof, and in some embodiments, the nucleotide sequence is codon- optimized for expression in the mammalian host cell. In certain additional embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, Cas 12a (Cpfl), Casl2f, and Cas 13; or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2f, or a homolog or functional variant thereof.
[0045] In some embodiments, the second cargo comprises: a nucleotide sequence encoding a nuclease, wherein the nucleotide sequence is operably linked to a guide sequence that is complementary to a target nucleotide sequence. In certain embodiments, the second cargo comprises a CRIS PR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, Cas 12a (Cpfl), Casl2f, and Cas 13; or a functional variant thereof.
[0046] In certain embodiments, the second cargo comprises a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain embodiments, the second cargo further comprises a guide sequence that is complementary to a target nucleotide sequence. In certain embodiments, the Cas protein is selected from: Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof. In certain embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or functional variant thereof. In certain embodiments, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9. In certain additionalembodiments, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra; or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Cas 12g, Casl2i, Casl2j, Cas 13, Cas 100, CasX. In certain other embodiments, the Cas protein is selected from: Cas9, HiFiCas9, Cas 12a (Cpfl), and Cas 12a (Cpfl) Ultra; or a functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, HiFiCas9, Cas 12a (Cpfl) and Cas 12a (Cpfl) Ultra. In certain additional embodiments, the Cas protein is selected from: HiFiCas9 and Cas 12a (Cpfl) Ultra; or a functional variant thereof. In certain other embodiments, the Cas protein is selected from: Cas9, or a functional variant thereof. In certain other embodiments, the Cas protein is selected from: HiFiCas9, or a functional variant thereof. In certain other embodiments, the Cas protein is selected from: Cas 12a (Cpfl), or a functional variant thereof.
[0047] Another of the various aspects of the present disclosure is a method of generating genetically engineered human induced pluripotent stem cells (hiPSCs), the method comprising: a) delivering a first cargo to a culture of hiPSCs, wherein the first cargo comprises: a donor nucleotide sequence, and wherein the first cargo is delivered using nucleofection; b) incubating the culture of hiPSCs with the first cargo for about 1-60 hours; and c) delivering a second cargo to the culture of hiPSCs, wherein the second cargo comprises: Cas9, Cas 12a (Cpfl), or Cas 13, or a homolog or functional variant thereof, and a guide sequence that is complementary to a target nucleotide sequence; thereby producing genetically engineered hiPSCs.
[0048] In some embodiments, after step b) and before step c), that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c), the cells are pooled. For example, after the incubating in step b) and before the second cargo delivery in step c), the cells are pooled from multiple tubes, such as when a reaction using cells is split over multiple tubes, or when a reaction run in duplicate, triplicate, or any multiple. In some embodiments, cells are pooled from multiple timepoints. In some embodiments, cells are pooled from identical reactions run in multiples. In some embodiments, samples are pooled from different reactions.
[0049] In certain embodiments, after step b) and before step c), that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the hiPSCs are pooled. In certain embodiments after the incubating in step b) and before the second cargo delivery in step c): the hiPSCs are not pooled. In certain further embodiments, after the incubating in step b) and before the second cargo delivery instep c): the pooled hiPSCs are transiently incubated in a basal medium which is different from the medium in step b). As featured and disclosed herein, a basal medium includes, as nonlimiting examples, RPMI, StemMACS iPS-Brew XF Medium, or StemMACS PSC Brew XF. In some embodiments, the cells are cultured in a basal medium, in which a desired concentration of one or more agents of interest is added. In some embodiments, the cells are cultured in a basal medium, in which a desired concentration of one or more agents of interest is added, then switched to a different culture basal medium, in which a desired concentration of one or more agents of interest is added. For example, the basal medium is supplemented with one or more of: a DNA, an RNA, and a nuclease. In some embodiments, the cells are cultured in a basal medium such as StemMACS iPS-Brew XF Medium then switched to a basal medium such as RPMI or StemMACS PSC Brew XF. In some embodiments, the basal medium change occurs after the first cargo delivery in step a), after the incubating in step b), after the second cargo delivery in step c); or at multiple steps as referred to herein.
[0050] In some embodiments, the basal medium is supplemented with an additive to improve cell survival, including, as non-limiting examples, defined supplements. As featured and disclosed herein, a ROCK inhibitor such as Y-27632 or any ROCK inhibitor disclosed herein, and defined supplements are added to basal medium to improve cell survival, including to add nutrients for specific cell types or differentiation stages, and include, as non-limiting examples, CloneR, CloneR2, BIT 9500 Serum Substitute, and Insulin-Transferrin-Selenium. In some embodiments, the basal medium is supplemented with one or more of: a ROCK inhibitor such as Y-27632 or any ROCK inhibitor disclosed herein, a defined media supplement such as CloneR2 or any other defined supplement featured herein, a DNA, an RNA, and a nuclease.
[0051] In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature below 37°C.
[0052] As featured and disclosed herein, temperatures below 37°C include, as non-limiting examples, temperatures of 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C,20°C, 21°C, 22°C, 23°C, 24°C 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C,35°C, 36°C, or any value below the aforementioned temperatures, or any temperature ranging between any two of the recited temperature values referred to above or herein. In someembodiments, temperatures below or at about 32°C are understood to be “cold shock” temperatures.
[0053] Another aspect of the present disclosure is a method of generating genetically engineered human induced pluripotent stem cells (hiPSCs) comprising: a) delivering a first cargo to a culture of hiPSCs, wherein the first cargo comprises: a donor plasmid comprising a knock-in nucleotide sequence, and wherein the first cargo is delivered using nucleofection; b) incubating the culture of hiPSCs with the first cargo for about 12-60 hours; and c) delivering a second cargo to the culture of hiPSCs, wherein the second cargo comprises: Cas9, Casl2a (Cpfl), or Casl3, or a homolog or functional variant thereof, and a guide sequence that is complementary to a target nucleotide sequence; thereby producing genetically engineered hiPSCs.
[0054] In certain embodiments, after step b) and before step c), that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the hiPSCs are pooled. In certain further embodiments, after the incubating in step b) and before the second cargo delivery in step c): the pooled hiPSCs are transiently incubated in a basal medium which is different from the medium in step b). In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at about 32°C.
[0055] Another aspect of the present disclosure is a method of generating genetically engineered human induced pluripotent stem cells (hiPSCs) comprising: a) delivering a first cargo to a culture of hiPSCs, wherein the first cargo comprises: a donor plasmid comprising a knock-in nucleotide sequence, and wherein the first cargo is delivered using nucleofection; b) incubating the culture of hiPSCs with the first cargo for about 18-30 hours; and c) delivering a second cargo to the culture of hiPSCs, wherein the second cargo comprises: Cas9, Casl2a (Cpfl), or Casl3, or a homolog or functional variant thereof, and a guide sequence that is complementary to a target nucleotide sequence; thereby producing genetically engineered hiPSCs. In certain embodiments, after step b) and before step c), that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the hiPSCs are pooled. In certain further embodiments, after the incubating in step b) and before the second cargo delivery in step c): the pooled hiPSCs are transiently incubated in a basal medium which is different from the medium in step b). Incertain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at about 32°C.
[0056] Another aspect of the present disclosure is a method of generating genetically engineered human induced pluripotent stem cells (hiPSCs) comprising: a) delivering a first cargo to a culture of hiPSCs, wherein the first cargo comprises: a donor plasmid comprising a knock-in nucleotide sequence, and wherein the first cargo is delivered using nucleofection; b) incubating the culture of hiPSCs with the first cargo for about 18-36 hours; and c) delivering a second cargo to the culture of hiPSCs, wherein the second cargo comprises: Cas9, Casl2a (Cpfl), or Casl3, or a homolog or functional variant thereof, and a guide sequence that is complementary to a target nucleotide sequence; thereby producing genetically engineered hiPSCs. In certain embodiments, after step b) and before step c), that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the hiPSCs are pooled. In certain further embodiments, after the incubating in step b) and before the second cargo delivery in step c): the pooled hiPSCs are transiently incubated in a basal medium which is different from the medium in step b). In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at about 32°C.
[0057] Another aspect of the present disclosure is a method of generating genetically engineered human induced pluripotent stem cells (hiPSCs) comprising: a) delivering a first cargo to a culture of hiPSCs, wherein the first cargo comprises: a donor plasmid comprising a knock-in nucleotide sequence, and wherein the first cargo is delivered using nucleofection; b) incubating the culture of hiPSCs with the first cargo for about 18-60 hours; and c) delivering a second cargo to the culture of hiPSCs, wherein the second cargo comprises: Cas9, Casl2a (Cpfl), or Casl3, or a homolog or functional variant thereof, and a guide sequence that is complementary to a target nucleotide sequence; thereby producing genetically engineered hiPSCs. In certain embodiments, after step b) and before step c) that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the hiPSCs are pooled. In certain further embodiments, after the incubating in step b) and before the second cargo delivery in step c): the pooled hiPSCs aretransiently incubated in a basal medium which is different from the medium in step b). In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at about 32°C.
[0058] In some embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37 °C. In some embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature of about 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, or any temperature below the aforementioned temperatures, or any temperature ranging between any two of the recited temperature values referred to above or herein. In some embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at about 32°C.
[0059] In some embodiments, after step b) and before step c) that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the mammalian cells are pooled. For example, after the incubating in step b) and before the second cargo delivery in step c) the mammalian cells are pooled from multiple tubes, such as when a reaction using mammalian cells is split over multiple tubes, or when a reaction run in duplicate, triplicate, or any multiple. In some embodiments, cells are pooled from multiple timepoints. In some embodiments, cells are pooled from identical reactions run in multiples. In some embodiments, cells are pooled from different reactions.
[0060] In some embodiments, after delivery of the first cargo and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In some embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In some embodiments, after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature below 37 °C. In some embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a temperature below 37 °C, and again after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature below 37°C.
[0061] In some embodiments, after delivery of the first cargo and / or second cargo, the culture of mammalian cells is incubated at a temperature of about 32°C. In some embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a temperature of about32°C. In some embodiments, after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature of about 32°C. In some embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a temperature of about 32°C, and again after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature of about 32°C.
[0062] Another of the various aspects of the present disclosure is a method of generating genetically engineered induced pluripotent stem cells (iPSCs) comprising: a) delivering a first cargo comprising DNA to a culture of iPSCs; b) incubating the culture of iPSCs in a medium with the first cargo; and c) delivering to the culture of iPSCs a second cargo comprising an RNA, a nuclease, and / or a nuclease-encoding nucleotide sequence, thereby mediating a single or double-strand DNA break at a target locus; and d) further incubating the culture of iPSCs, thereby producing genetically engineered iPSCs.
[0063] In some embodiments, the incubation in step b) comprises plating the culture of iPSCs on an adherent surface.
[0064] In some embodiments, the first cargo or the second cargo is delivered to the culture of iPSCs by electroporation, lipofection, microinjection, sonoporation, or magnetofection. In certain embodiments, the first cargo or the second cargo is delivered to the culture of iPSCs using nucleofection. In certain other embodiments, the first cargo and the second cargo are delivered to the culture of iPSCs using nucleofection.
[0065] In some embodiments, the first cargo comprises a donor nucleotide sequence. In some embodiments, the donor nucleotide sequence is either a circular donor nucleotide sequence or a linear donor nucleotide sequence. In some embodiments, the donor nucleotide sequence is double-stranded. In some embodiments, the donor nucleotide sequence is single-stranded. In some embodiments, the donor nucleotide sequence, includes, as non-limiting examples, a cosmid, artificial chromosome, and / or a vector, such as an expression vector. In some embodiments, the expression vector is a mammalian vector, bacterial vector, a mammalian non-episomal vector, or any other expression vector featured herein. As featured herein, an expression vector includes, as non-limiting examples, a plasmid and a transposon. In some aspects, an expression vector is a plasmid. In some embodiments, the first cargo comprises a donor nucleotide sequence, wherein the donor nucleotide sequence comprises a plasmid. In some embodiments, the first cargo comprises one or more donor nucleotide sequences. In some aspects, one or more donor nucleotide sequences is codon-optimized for expression in the mammalian host cell. In certain embodiments, the donor nucleotide sequence comprises one ormore knock-in nucleotide sequences. In certain other embodiments, the donor nucleotide sequence comprises at least two knock-in nucleotide sequences. In certain additional embodiments, the donor nucleotide sequence comprises two, three, four, five, or more than five knock-in nucleotide sequences. In some embodiments, the donor nucleotide sequence comprises one or more knock-in nucleotide sequences, and further comprises a protein-coding sequence.
[0066] In some embodiments, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence.
[0067] In some embodiments, the second cargo comprises: a nucleotide sequence encoding a nuclease and a nucleotide sequence that is complementary to a target nucleotide sequence. In some embodiments, the nucleotide sequence encoding a nuclease is codon-optimized for expression in the mammalian host cell.
[0068] In some embodiments, the second cargo comprises: a nucleotide sequence encoding a nuclease, wherein the nucleotide sequence is operably linked to a guide sequence that is complementary to a target nucleotide sequence.
[0069] In some embodiments, the nuclease is selected from a meganuclease, a TALEN, and a Zinc Finger nuclease, or a functional variant thereof.
[0070] In some embodiments, the second cargo comprises a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain embodiments, the second cargo further comprises a guide sequence that is complementary to a target nucleotide sequence.
[0071] In some embodiments, the second cargo comprises a CRISPR-associated system (Cas) protein, or a functional variant thereof. In certain embodiments, the second cargo further comprises a guide sequence that is complementary to a target nucleotide sequence. In certain further embodiments, the Cas protein is selected from: Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO and CasX; or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra,Casl2c and Casl3; or a homolog or functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl) and Casl2a (Cpfl) Ultra; or a functional variant thereof. In certain additional embodiments, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl) and Casl2a (Cpfl) Ultra.
[0072] In some embodiments, the iPSCs are obtained or derived from a mammal.
[0073] In some embodiments, the iPSCs are obtained or derived from a human or a rodent.
[0074] In some embodiments, the iPSCs are obtained or derived from a human.
[0075] The present invention is exemplified but not limited by the disclosure in the Examples herein.BRIEF DESCRIPTION OF THE DRAWINGS
[0076] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
[0077] FIGS. 1A-1C show that co-delivery of ribonucleoprotein (“RNP”) results in low plasmid transfection efficiency. FIG. 1A shows fluorescence microscopy (4x magnification) images comparing nucleofection efficiency of a GFP donor vector only (bottom of left column) versus the nucleofection efficiency of a GFP donor vector that was delivered in combination with RNP (bottom of right column - showing only a faint GFP signal). Images were taken 24 hours after transfection. FIG. IB shows flow cytometry quantification of transfection efficiency. Although approximately 80% of the cells transfected with the GFP donor vector alone expressed GFP after 24 hours, co-delivery of the GFP donor vector and RNP significantly reduced transfection efficiency; only 10% of the transfected cells expressed GFP after 24 hours. FIG. 1C shows flow cytometry quantification of the number of living cells 24 hours after nucleofection. Nucleofection with GFP donor vector alone resulted in approximately 3.7 x 104living cells, while simultaneous nucleofection with GFP donor and RNP resulted in approximately 1.2 x 104living cells, a reduction of about 2 / 3 or approximately 67%.
[0078] FIGS. 2A-2G show that serial nucleofection improves knock-in efficiency. FIG. 2A is a schematic timeline of a standard CRISPR nucleofection protocol, which involves the simultaneous nucleofection of a GFP donor vector and a Cas 12a RNP. Nucleofection occurs on Day Zero (“Day 0” or “dO”), which is two days after cell passage (d-2). Eight to twelve days after nucleofection (d8-12), GFP fluorescence was measured to determine the efficacy ofnucleofection. FIG. 2B is a schematic timeline of a serial nucleofection. On Day 0, the donor nucleotide sequence (Donor) was delivered via nucleofection. Due to cell death occurring after the initial nucleofection, 3 nucleofection samples were pooled just before the RNP nucleofection on Day 1 (dl). Eight to twelve days after the first nucleofection, GFP fluorescence was measured and the cells were photographed. FIG. 2C shows fluorescence microscopy images (4x magnification) for cells that were nucleofected using the standard CRISPR approach. In contrast, the fluorescence microscopy images (4x magnification) in FIG. 2D show the GFP fluorescence of cells which were nucleofected using serial delivery of donor and RNP. (In the bottom comer of the image on the left, “bf” = bright field. In the bottom comer of the image on the right, “GFP” = green fluorescent protein). FIG. 2E shows the flow cytometry results for the cells that were nucleofected using the standard nucleofection (“Standard”) protocol (2.17%). FIG. 2F shows the flow cytometry results for the cells that were nucleofected using the serial nucleofection (“Serial Nucleofection” or “Serial NF”) protocol (12.64%). FIG. 2G shows the quantifications, including controls (consisting of the same setup with irrelevant gRNA). Unpaired T-test. **P < 0,01. The calculated knock-in efficiency for cells transfected using the standard protocol was (1.92% + / - 0.64%), while the calculated knock-in efficiency for the cells transfected using the serial nucleofection protocol was (7.53%, + / - 3.25%). Serial delivery of the donor plasmid and RNP, with a 24 hour interval between each nucleofection, significantly improved the knock-in rate as compared to the standard nucleofection protocol (“std”), as shown both qualitatively by the fluorescence microscopy images in FIG. 2C versus FIG. 2D and quantitatively by the flow cytometry results in FIG. 2E versus FIG. 2F, as well as the bar graphs in FIG. 2G.
[0079] FIGS. 3A-3G show that pooled donor delivery on dO improves knock-in (KI) efficiency. FIG. 3A is a schematic timeline of the initial serial nucleofection protocol. As noted above, cells that have been nucleofected with donor on dO are cultured for 1 day and then pooled by scaling up cell numbers and donor amount by a factor of 3 within one reaction. These pooled cells are subjected to a second nucleofection to deliver the RNP (Casl2a), then cultured until d8-12 and analyzed for GFP expression. These cells, which were not pooled before the first nucleofection (but were instead pooled 1 day later, just before the second nucleofection) are referred to as the “Serial Nucleofection (Pooled on dl)” cells or simply “Serial NF (dl)” cells. FIG. 3B is a schematic timeline of a different serial nucleofection protocol, in which the cell numbers and the amount of nucleofected donor were scaled up by a factor of 3 within one reaction just prior to the first nucleofection on dO, then cultured for 1 day and subjected to asecond nucleofection to deliver the RNP (Casl2a), at which point they were cultured until d8- 12 and analyzed for GFP expression. These cells are referred to as the “Serial NF (Pooled on dO)” cells or “Serial NF (dO)” cells. FIG. 3C shows fluorescence microscopy images after >1 week (4x magnification) for cells that were nucleofected using the serial NF protocol and pooled on dl. FIG. 3D shows fluorescence microscopy images after >1 week (4x magnification) for cells that were nucleofected using the serial NF (Pooled on dO) protocol. FIG. 3E shows the flow cytometry results for cells that were nucleofected using the serial NF protocol and pooled on dl (7.54%). FIG. 3F shows the flow cytometry results for cells that were nucleofected using the serial NF (Pooled on dO) protocol (17. 41%). Compared to pooling the cells for the second nucleofection on dl as shown in FIG. 3C, scaling up one pooled nucleofection on dO, as indicated by the increased GFP fluorescence shown in FIG. 3D improves the knock-in efficiency significantly, from about 7.53% + / - 3.25% for serial NF (pooled on dl) cells as quantitatively verified by flow cytometry in FIG. 3C to about 19.69% + / - 4.43% for serial NF (pooled on dO) cells as quantitatively verified by flow cytometry in FIG. 3F. FIG. 3G shows the quantifications, including controls (consisting of the same setup with irrelevant gRNA). Data points come from experiments in three different cell lines. Unpaired T-test. **P < 0,01.
[0080] FIGS. 4A-4G show that Cold shock significantly improves KI efficiency. Compared to the improved initial serial nucleofection protocol (serial NF (pooled on dO)) shown in FIG. 4A, a 24 hour incubation step at 32°C (“cold shock”) was added after nucleofection with the RNP on day 1 (dl), as shown in the timeline in FIG. 4B. FIG. 4C shows fluorescence microscopy images (4x magnification) of Serial NF (pooled on dO) cells that were subject to continuous incubation at 37°C; the images were captured 8-12 days after their first nucleofection. In contrast, the fluorescence microscopy (4x magnification) images shown in FIG. 4D indicate that including a 24-hour cold shock step improves the knock-in rate significantly. This qualitative data is quantitatively verified by the flow cytometry results shown in FIG. 4E (25.34%) and FIG. 4F (35.46%), where it is shown that 19.69% + / - 4.43% of serially nucleofected (pooled on dO) cells expressed GFP, while 29.93% + / - 4.6% of the viable serially nucleofected (pooled on dO + 32°C) cells expressed GFP. FIG. 4G shows the quantifications, including controls (consisting of the same setup with irrelevant gRNA). Data points come from experiments knocking in GFP at two different loci (AAVS 1 ; B2M). Unpaired T-test. **P < 0,01.
[0081] FIGS. 5A-5G show that culture medium affects KI efficiency significantly. FIG. 5A is a schematic timeline of the serial nucleofection protocol that includes a cold shock (serial NF (pooled on d0)+ 32°C), in which the cells were cultured continuously in the standard culturing medium (Medium- A). FIG. 5B is a schematic timeline of a serial nucleofection protocol that is the same as that in FIG. 5A except that the cell cultures were switched to a different medium (StemMACs PSC Brew XF; also referred to herein as “Medium-B”) during the last passaging before the nucleofection (d-2). FIG. 5C shows fluorescence microscopy images (4x magnification) of the serially nucleofected (pooled on dO + 32°C) cells which remained in the standard culturing medium (Medium-A) throughout. FIG. 5D shows fluorescence microscopy images (4x magnification) of the serially nucleofected (pooled on pO + 32°C) cells which were switched to Medium-B during the last passaging before nucleofection. Switching from Medium-A to Medium-B leads to significant improvements in knock-in efficiency, as qualitatively illustrated by the fluorescence microscopy images of FIG. 5C versus FIG. 5D, and as quantitatively verified by the fluorescence-activated cell sorting analyses shown in FIG. 5E (26.70%) and FIG. 5F (45.15%). FIG. 5G shows the quantifications, including controls (consisting of the same setup with irrelevant gRNA). Data points come from experiments knocking in GFP at two different loci (AAVS1; B2M) and show an improvement from 29.93% + / - 4.6% (pooled on dO +32°C Medium-A) to 41.26% + / - 2.53% (pooled on dO +32°C Medium-B). Unpaired T-test. *P < 0,05.
[0082] FIG. 6 shows that incremental improvement of knock-in efficiency by each optimization described. Summary of described optimizations centered around serial nucleofection / sequential delivery of donor and RNP. Datapoints pooled from all previously described experiments Unpaired T-test. *P < 0,05; **P < 0,01.
[0083] FIGS. 7A-7E show that serial delivery is a key component of the improved gene editing protocol. To demonstrate the essential role that serial delivery of GFP-donor and nuclease plays in the high knock-in efficiency protocol (also referred to herein as the “optimized protocol”), each optimization aspect of the optimized protocol was separately omitted, in order to test the remaining conditions and establish that the 2- step nucleofection process (also referred to herein as a “serial delivery” or a “serial nucleofection”) is an essential element of the claimed methods. Omission of the serial delivery aspect diminishes high knock- in efficiencies completely, while the absence of other optimization aspects leads to only minor reductions in KI efficiency. FIG. 7A shows brightfield, GFP, and flow cytometry results for a negative control (far left column), for an unoptimized “standard” nucleofection (middlecolumn), and for fully optimized protocol in Medium-A. The first page of FIG. 7B shows a column of bright field (top), GFP fluorescence (middle), and flow cytometry results (bottom) when a fully optimized gene editing protocol, using Medium-A, is used to knock-in GFP into a cell culture, except that the protocol is missing one optimization aspect, which is referred to as Condition A: “no scaling up NF1 by a factor of 3.” Likewise, the second page of FIG. 7B shows similar bright field microscopy (top of both columns), fluorescence (middle of both columns), and flow cytometric results (bottom of both columns). On this second page of FIG. 7B, the first column (left column) labeled “cold shock” at the top of the page, shows that when a fully optimized gene editing protocol conducted in Medium-A was used to knock-in GFP into a cell culture, except that no “cold shock” for 24 hours at 32°C was performed. The second column (right column) of this second page of page of FIG. 7B labeled “CloneR2 (Replace by std ROCKi)” shows the results of using a fully optimized protocol conducted in Medium-A, minus the “Clone R2” compound, which is referred to as “Condition C.” Again likewise the third page of FIG. 7B shows similar bright field microscopy (top of both columns), fluorescence (middle of both columns), and flow cytometric results (bottom of both columns). On this third page of FIG. 7B, the first column (left column) labeled “serial delivery” at the top of the page, shows a fully optimized protocol conducted in Medium-A except that “serial delivery” was not used; this is referred to as “Condition D.” The second column (right column) of this third page of page of FIG. 7B labeled “Serial Delivery (But include passage on dayO)” shows the results when a fully optimized gene editing protocol is conducted in Medium-A, except that that no serial delivery was used and the cells were passaged on Day 0; this is referred to as “Condition E.” FIG. 7C shows the results of a fully optimized gene editing protocol conducted in Medium-A, except that no optimized recovery period between the first and second nucleofections was used. Without an optimized recovery period after nucleofection, the gene editing process cannot be performed, as the number of viable cells is too limited. FIG. 7D shows the results when a fully optimized gene editing protocol is conducted in Medium-B. Data from a previous experiment additionally shows that switching to Medium-B does not result in high editing efficiencies, if the donor and nuclease are delivered simultaneously. An overview of KI effciencies of this “-1” experiment, as well as cell number quantifications, are shown in FIG. 7E.
[0084] FIGS. 8A-8C show that optimized nucleofection works with both Casl2a and Cas9. The protocol optimized to achieve high KI efficiencies with Casl2a was tested with Cas9 at the same locus, using the same GFP-donor construct for HDR. FIG. 8A shows fluorescencemicroscopy images (4x magnification) of the GFP expression by cells that have been serially nucleofected with Cas9 and guide RNA using the optimized protocol (Serial NF (Pooled at dO) + 32°C), all the while being continuously grown on Medium-A. The top and bottom images for each column are paired, and the labels at the top indicate the condition of each column, i.e., “Negative Control” (left column), “Casl2a (Medium A)” (middle column), and “Cas9 (Medium A).” FIG. 8B shows the corresponding flow cytometry results for the cells of each of the conditions indicated in FIG. 8A, again, i.e., “Negative Control” (left column), “Casl2a (Medium A)” (middle column), and “Cas9 (Medium A)”; when Cas9 nuclease was nucleofected instead of Casl2a, 53.15% of the viable cells expressed GFP 24 hours after nucleofection (right panel). In comparison, when Casl2a was tested under the same conditions as Cas9 in Medium-A, 29.80% of the viable cells expressed GFP after 24 hours (middle panel). The negative control resulted in only 0.01% of the viable cells expressing GFP after 24 hours (left panel). Thus, KI efficiencies can be achieved at least within the same range. FIG. 8C shows the lower number of viable cells with Cas9 may be a result of higher toxicity and could be addressed by small adjustments of the protocol.DETAILED DESCRIPTION OF THE INVENTION
[0085] Applicants have unexpectedly discovered improved methods of culturing induced pluripotent stem cells; these methods are simple and inexpensive to implement, and yet result in significant increases in knock-in efficiency without the need for costly and time-consuming selection or enhancement molecules and processes.
[0086] Researchers in the field have for years been taught that cells should be transfected with donor plasmids and CRISPR-Cas nucleases in a single transfection or a single nucleofection, as this was thought to be less stressful on the cell cultures and more likely to result in stable and effective CRISPR-Cas and guideRNA complexes.
[0087] However, Applicant discovered that when nucleofection of the donor plasmid was conducted simultaneously with the ribonucleoprotein (RNP), knock in efficiency drastically decreased. Applicant split the standard “single step” delivery into two separate nucleofection steps, then plated the cells on adherent plates and let them recover for about 18-30 hours, preferably for about 24 hours, before the second nucleofection. This process, which went against the common thinking in the field, resulted in significant increases in knock-in efficiency. Additional changes, such as subjecting cells to cold-shock by incubating them at 32°C (rather than the standard 37 °C) for about 24 hours after nucleofection, also resulted in improved knock-in efficiencies.
[0088] Applicant’s data shows that the benefit of sequential delivery is obtained regardless of the nuclease used, as Applicant has seen considerable improvements in KI efficiency when using the Casl2a and Cas9 nucleases. Simply breaking up the nucleofection into two steps increased the KI efficiency from around 2% to 4.5-12%. Pooling the first nucleofection by scaling up everything by factor of 3 within one nucleofection reaction further increased KI efficiency to over 15% and made the process more robustly efficient. Combination of this with other optimizations, such as the use of a “cold shock” by culturing cells at 32°C for 24 hours, and / or changing to a different basal medium prior to nucleofection, led to KI efficiencies up to 40%. Importantly, this efficiency can be achieved without any need of enrichment or selection by stepwise improvement of the method. Applicant’s data also shows that without the use of serial nucleofection, KI efficiencies fail to reach values anywhere near 40%; when simultaneous (not serial) delivery was applied, KI efficiencies essentially dropped down to zero.
[0089] In certain aspects, the present disclosure provides a method of generating genetically engineered mammalian cells comprising: a) delivering a first cargo comprising DNA to a culture of mammalian cells; b) incubating the culture of mammalian cells in a medium with the first cargo; c) delivering to the culture of mammalian cells a second cargo comprising: an RNA and a nuclease, or an RNA and a nucleotide sequence that encodes a nuclease; thereby mediating a single or double-strand DNA break at a target locus; and d) further incubating the culture of mammalian cells, thereby producing genetically engineered mammalian cells.
[0090] In certain aspects, the present disclosure provides a method of generating genetically engineered mammalian cells comprising: a) delivering a first cargo comprising DNA to a culture of mammalian cells; b) incubating the culture of mammalian cells in a medium with the first cargo for about 1-60 hours; c) delivering to the culture of mammalian cells a second cargo comprising: an RNA and a nuclease, or an RNA and a nucleotide sequence that encodes a nuclease; thereby mediating a single or double-strand DNA break at a target locus; and d) further incubating the culture of mammalian cells, thereby producing genetically engineered mammalian cells for about 1-60 hours and optionally at a temperature below 37°C. In some embodiments, the incubation in step d) is at about 32°C. In some embodiments, the incubation in step b) and / or step d) is for about 24 hours.
[0091] In certain aspects, the present disclosure provides a method of generating genetically engineered induced pluripotent stem cells (iPSCs) comprising: a) delivering a first cargo comprising DNA to a culture of iPSCs; b) incubating the culture of iPSCs in a medium withthe first cargo; c) delivering to the culture of iPSCs a second cargo comprising: an RNA and a nuclease, or an RNA and a nucleotide sequence that encodes a nuclease; thereby mediating a single or double-strand DNA break at a target locus; and d) further incubating the culture of iPSCs, thereby producing genetically engineered iPSCs. In some embodiments, the iPSCs are human induced pluripotent stem cells (hiPSCs).
[0092] In certain aspects, the present disclosure provides a method of generating genetically engineered iPSCs comprising: a) delivering a first cargo comprising DNA to a culture of iPSCs; b) incubating the culture of iPSCs in a medium with the first cargo for about 1-60 hours; c) delivering to the culture of iPSCs a second cargo comprising: an RNA and a nuclease, or an RNA and a nucleotide sequence that encodes a nuclease; thereby mediating a single or doublestrand DNA break at a target locus; and d) further incubating the culture of iPSCs, thereby producing genetically engineered iPSCs for about 1-60 hours and optionally at a temperature below 37°C. In some embodiments, the incubation in step d) is at about 32°C. In some embodiments, the incubation in step b) and / or step d) is for about 24 hours.
[0093] In certain aspects, the present disclosure provides a method of generating genetically engineered induced pluripotent stem cells (iPSCs) comprising: a) delivering a first cargo comprising DNA to a culture of iPSCs; b) incubating the culture of iPSCs in a medium with the first cargo; and c) delivering to the culture of iPSCs a second cargo comprising an RNA, a nuclease, and / or a nuclease-encoding nucleotide sequence, thereby mediating a single or double-strand DNA break at a target locus; and d) further incubating the culture of iPSCs, thereby producing genetically engineered iPSCs. In some embodiments, the iPSCs are obtained or derived from a mammal. In some embodiments, the iPSCs are obtained or derived from a human or a rodent. In some embodiments, the iPSCs are obtained or derived from a human.
[0094] In some aspects, the incubation in step b) and / or step d) is for about 1-60 hours. In some embodiments, the incubation in step b) and / or step d) is for about 1-10 hours, 1-20 hours, 1-30 hours, 1-40 hours, 1-50 hours, 1-60 hours, or more than 60 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein.
[0095] In some aspects, the incubation in step b) and / or step d) is for about 12-60 hours. In some embodiments, the incubation in step b) and / or step d) is for about 12-18 hours, 12-24 hours, 12-30 hours, 12-36 hours, 12-42 hours, 12-48 hours, 12-54 hours, 12-60 hours, or more than about 60 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In certain embodiments, the incubation in step b) and / or step d) is for about 12-18 hours. In certain embodiments, the incubation in step b) and / or step- l-d) is for about 12-24 hours. In certain embodiments, the incubation in step b) and / or step d) is for about 12-30 hours. In certain embodiments, the incubation in step b) and / or step d) is for about 12-36 hours. In certain embodiments, the incubation in step b) and / or step d) is for about 12-42 hours. In certain embodiments, the incubation in step b) and / or step d) is for about 12- 48 hours. In certain embodiments, the incubation in step in step b) and / or step d) is for about 12-54 hours.
[0096] In certain other aspects, the incubation in step b) and / or step d) is for about 18-30 hours. In some embodiments, the incubation in step b) and / or step d) is for about 18-19 hours, 18-20 hours, 18-21 hours, 18-22 hours, 18-23 hours, 18-24 hours, 18-25 hours, 18-26 hours, or 18-27 hours, 18-28 hours, 18-29 hours, 18-30 hours, more than about 30 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In certain embodiments, the incubation step in b) and / or step d) is for about 24 hours.
[0097] In some aspects, the incubation in step b) and / or step d) is for a period of about 12-72 hours. In some embodiments, the incubation in step b) and / or step d) is for about 12-18 hours, 12-24 hours, 12-30 hours, 12-36 hours, 12-42 hours, 12-48 hours, 12-54 hours, 12-60 hours, 12-72 hours or more than about 72 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In some embodiments, the incubation in step b) and / or step d) is for a period of about 12-60 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of 12-48 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 12-36 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 12-30 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 12-24 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 12-18 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 12 hours.
[0098] In some aspects, the incubation in step b) and / or step d) is for a period of about 18-72 hours. In some embodiments, the incubation in step b) and / or step d) is for about 18-24 hours, 18-30 hours, 18-36 hours, 18-42 hours, 18-48 hours, 18-54 hours, 18-60 hours, 18-72 hours or more than about 72 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In some embodiments, the incubation in step b) and / or step d) is for a period of about 18-60 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 18-48 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 18-36 hours. In some embodiments, theincubation in step b) and / or step d) is for a period of about 18-30 hours. In some embodiments the incubation in step b) and / or step d) is for a period of about 18-24 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 24 hours. In some embodiments, the incubation in step b) and / or step d) is for a period of about 18 hours.
[0099] In certain aspects, the present disclosure provides a method of generating genetically engineered human induced pluripotent stem cells (hiPSCs) comprising: a) delivering a first cargo to a culture of hiPSCs, wherein the first cargo comprises: a donor plasmid comprising a knock-in nucleotide sequence, and wherein the first cargo is delivered using nucleofection; b) incubating the culture of hiPSCs with the first cargo; and c) delivering a second cargo to the culture of hiPSCs, wherein the second cargo comprises: Cas9, Casl2a (Cpfl), or Casl3, or a homolog or functional variant thereof, and a guide sequence that is complementary to a target nucleotide sequence; thereby producing genetically engineered hiPSCs.
[0100] In certain aspects, the present disclosure provides a method of generating genetically engineered human induced pluripotent stem cells (hiPSCs) comprising: a) delivering a first cargo to a culture of hiPSCs, wherein the first cargo comprises: a donor plasmid comprising a knock-in nucleotide sequence, and wherein the first cargo is delivered using nucleofection; b) incubating the culture of hiPSCs with the first cargo for about 1-60 hours; and c) delivering a second cargo to the culture of hiPSCs, wherein the second cargo comprises: Cas9, Casl2a (Cpfl), or Casl3, or a homolog or functional variant thereof, and a guide sequence that is complementary to a target nucleotide sequence; thereby producing genetically engineered hiPSCs.
[0101] In some embodiments, the incubation in step b) is for about 1-60 hours. In some embodiments, the incubation in step b) is for about 1-10 hours, 1-20 hours, 1-30 hours, 1-40 hours, 1-50 hours, 1-60 hours, or more than 60 hours, or for any length of time ranging between any two of the recited number of hours referred to above or herein. In some embodiments, the incubation in step b) is for about 12 to 60 hours. In some embodiments, the incubation in step b) is for about 18 to 30 hours. In some embodiments, the incubation in step b) is for about 18 to 36 hours. In some embodiments, the incubation in step b) is for about 18 to 60 hours.
[0102] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0103] Certain Exemplary Definitions
[0104] Before the present compositions and methods are described, it is to be understood that this invention is not limited to the particular methods, compositions, or experimental conditions described herein, as such compositions, methods, and conditions may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only and is not intended to be limiting since the scope of the present invention will be limited only to the appended claims.
[0105] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, references to “the method” include one or more methods and / or steps of the type described herein, which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.
[0106] As used herein, the terms “about” and “substantially” will be understood by persons of ordinary skill in the art and will vary to some extent depending upon the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill in the art, given the context in which it is used, “about” and “substantially” will mean up to plus or minus 10% of the particular term.
[0107] As used herein, the term “subject” refers to a mammal. In some embodiments, a subject is non-human primate or rodent. In some embodiments, a subject is a human. In some embodiments, a subject has, is suspected of having, or is at risk for, a disease or disorder. In some embodiments, a subject has one or more symptoms of a disease or disorder.
[0108] By “incubating” it is meant that the cells are cultured with one or more agents of interest, added to a basal medium, including, as non-limiting examples, RPMI, StemMACS iPS-Brew XF Medium, or StemMACS PSC Brew XF. That is, the cells are cultured in a basal medium, in which a desired concentration of one or more agents of interest is added. In some embodiments, the basal medium is supplemented with one or more of: a DNA, an RNA, and a nuclease.
[0109] In some aspects, the basal medium is supplemented with an additive to improve cell survival, including, as non-limiting examples, a ROCK inhibitor such as Y-27632 or any ROCK inhibitor disclosed herein, and defined supplements. As featured and disclosed herein, defined supplements are added to basal medium to improve cell survival, including to add nutrients for specific cell types or differentiation stages, and include, as non-limiting examples, CloneR, CloneR2, BIT 9500 Serum Substitute, and Insulin-Transferrin-Selenium. In some embodiments, the basal medium is supplemented with one or more of: a ROCK inhibitor suchas Y-27632 or any ROCK inhibitor disclosed herein, a defined media supplement such as CloneR2 or any other defined supplement featured herein, a DNA, an RNA, and a nuclease. In some embodiments, the cells are cultured in their regular culture basal medium, in which a desired concentration of one or more agents of interest is added, then changed to a different culture basal medium, in which a desired concentration of one or more agents of interest is added. For example, the cells are cultured with one or more of: a DNA, an RNA, and a nuclease. In some aspects, the cells are cultured in a basal medium such as StemMACS iPS-Brew XF Medium then changed to a basal medium such as RPMI or StemMACS PSC Brew XF. In some aspects, the basal medium change occurs after the first cargo delivery in step a), after the incubating in step b), after the second cargo delivery in step c), or at multiple steps as referred to herein. In certain aspects, after step b) and before step c), that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the pooled hiPSCs are transiently incubated in a basal medium which is different from the medium in step b).
[0110] As used herein, the term “endonuclease” or “nuclease” generally refers to an enzyme that cleaves phosphodiester bonds within a polynucleotide and include, as non-limiting examples, a zinc finger nuclease (ZFN), transcription activator like effector nuclease (TALEN), homing endonuclease (HE), meganuclease, MegaTAL, or a CRISPR-associated endonuclease including, as non-limiting examples, a Type II CRISPR Cas9 endonuclease or a Type V CRISPR Cpfl endonuclease. In some embodiments, an endonuclease specifically cleaves phosphodiester bonds within a DNA polynucleotide. In some embodiments, an endonuclease is a zinc finger nuclease (ZFN), transcription activator like effector nuclease (TALEN), homing endonuclease (HE), meganuclease, MegaTAL, or a CRISPR-associated endonuclease. In some embodiments, an endonuclease is an RNA-guided endonuclease. In certain aspects, the RNA-guided endonuclease is a CRISPR nuclease, e.g., a Type II CRISPR Cas9 endonuclease or a Type V CRISPR Cpfl endonuclease. In some embodiments, an endonuclease is a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Casl2a, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or Cpfl (Casl2a) endonuclease, or a homolog thereof, a recombination of the naturally occurring molecule thereof, or a modified version thereof, or combinations thereof. In some embodiments, an endonuclease mayintroduce one or more single-stranded breaks (SSBs) and / or one or more double- stranded breaks (DSBs).
[0111] As used herein, the term “polynucleotide,” which may be used interchangeably with the term “nucleic acid” generally refers to a biomolecule that comprises two or more nucleotides. In some embodiments, a polynucleotide comprises at least two, at least five at least ten, at least twenty, at least 30, at least 40, at least 50, at least 100, at least 200, at least 250, at least 500, or any number of nucleotides ranging between any two numbers of nucleotides referred to above or herein. For example, the polynucleotides may include at least 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 4500 nucleotides, or at least about 5000 nucleotides, or ranging between any two numbers of nucleotides referred to above or herein. A polynucleotide may be a DNA or RNA molecule or a hybrid DNA / RNA molecule. A polynucleotide may be single- stranded or double- stranded. In some embodiments, a polynucleotide is a site or region of genomic DNA. In some embodiments, a polynucleotide is an endogenous gene that is comprised within the genome of an unmodified cell or universal donor cell. In some embodiments, a polynucleotide is an exogenous polynucleotide that is not integrated into genomic DNA. In some embodiments, a polynucleotide is an exogenous polynucleotide that is integrated into genomic DNA. In some embodiments, a polynucleotide is a plasmid. In some embodiments, a polynucleotide is a circular or linear molecule. In some embodiments a polynucleotide is made recombinantly. In some embodiment a polynucleotide is synthesized. In some embodiments a polynucleotide may have modified bases, modified backbone moieties, or modified sugar moieties. In some embodiments, polynucleotides are RNA comprising a cap suitable for expressed RNAs in the mammalian host cell.
[0112] As used herein, the term “guide RNA” or “gRNA” generally refers to short ribonucleic acid that can interact with, e.g., bind to, to an endonuclease and bind, or hybridize to a target genomic site or region. In some embodiments, a gRNA is a single-molecule guide RNA (sgRNA). In some embodiments, a gRNA may comprise a spacer extension region. In some embodiments, a gRNA may comprise a tracrRNA extension region. In some embodiments, a gRNA is single- stranded. In some embodiments, a gRNA comprises naturally occurring nucleotides. In some embodiments, a gRNA is a chemically modified gRNA. In some embodiments, a chemically modified gRNA is a gRNA that comprises at least onenucleotide with a chemical modification, e.g., a 2’-O-methyl sugar modification. In some embodiments, a chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, a chemically modified gRNA comprises a 2’-O-methyl-phosphorothioate residue. In some embodiments, a gRNA is not pre-complexed with a DNA endonuclease. In some embodiments, a gRNA is pre-complexed with a DNA endonuclease. In some embodiments the gRNA is one or two prime-editing guide RNAs.
[0113] A gRNA interacts with an endonuclease (e.g., an RNA-guided nuclease such as Cas9), thereby forming a complex. This complex is referred to as an “RNP” or “ribonucleoprotein” or “ribonucleoprotein complex.” The gRNA guides the endonuclease to a target polynucleotide. The endonuclease and gRNA can each be administered separately to a cell or a subject. In some embodiments, the endonuclease can be pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA. The pre-complexed material can then be administered to a cell or a subject. Such pre-complexed material is known as a ribonucleoprotein particle (RNP). The endonuclease in the RNP can be, for example, a Cas9 endonuclease or a Cpfl endonuclease. The endonuclease can be flanked at the N-terminus, the C-terminus, or both the N-terminus and C-terminus by one or more nuclear localization signals (NLSs). For example, a Cas9 endonuclease can be flanked by two NLSs, one NLS located at the N-terminus and the second NLS located at the C-terminus. The NLS can be any NLS known in the art, such as a SV40 NLS. The molar ratio of genome-targeting nucleic acid to endonuclease in the RNP can range from about 1 : 1 to about 10:1. For example, the molar ratio of sgRNA to Cas9 endonuclease in the RNP can be 3:1.
[0114] In some embodiments, a sgRNA comprises a 20-nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, a sgRNA comprises a less than a 20- nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, a sgRNA comprises a more than 20 nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, a sgRNA comprises a variable length spacer sequence with 17-30 nucleotides (nt) at the 5’ end of the sgRNA sequence. In some embodiments, a variable length spacer sequence is about 17 to 18 nt, 17 to 19 nt, 17 to 20 nt, 17 to 21 nt, 17 to 22 nt, 17 to 23 nt, 17 to 24 nt, 17 to 25 nt, 17 to 26 nt, 17 to 27 nt, 17 to 28 nt, 17 to 29 nt, 17 to 30 nt, or any length ranging between any two lengths referred to above or herein.
[0115] In some embodiments, a prime-editing guide RNA (pegRNA) comprises a 20- nucleotide spacer sequence at the 5’ end of the pegRNA sequence. In some embodiments, a pegRNA comprises a less than a 20-nucleotide spacer sequence at the 5’ end of the pegRNAsequence. In some embodiments, a pegRNA comprises a more than 20 nucleotide spacer sequence at the 5’ end of the pegRNA sequence. In some embodiments, a pegRNA comprises a variable length spacer sequence with 17-30 nucleotides (nt) at the 5’ end of the pegRNA sequence. In some embodiments, a variable length spacer sequence is about 17 to 18 nt, 17 to 19 nt, 17 to 20 nt, 17 to 21 nt, 17 to 22 nt, 17 to 23 nt, 17 to 24 nt, 17 to 25 nt, 17 to 26 nt, 17 to 27 nt, 17 to 28 nt, 17 to 29 nt, 17 to 30 nt, or any length ranging between any two lengths referred to above or herein.
[0116] In some embodiments, a sgRNA comprises a spacer extension sequence with a length that is about 1 to 200 nt. In some embodiments, a sgRNA comprises a spacer extension sequence that is about 1 to 3 nt, 1 to 5 nt, 1 to 10 nt, 1 to 20 nt, 1 to 30 nt, 1 to 40 nt, 1 to 50 nt, 1 to 60 nt, 1 to 70 nt, 1 to 80 nt, 1 to 90 nt, 1 to 100 nt, 1 to 110 nt, 1 to 120 nt, 1 to 130 nt, 1 to 140 nt, 1 to 150 nt, 1 to 160 nt, 1 to 170 nt, 1 to 180 nt, 1 to 190 nt, 1 to 200 nt, or more than 200 nt, or any length ranging between any two lengths referred to above or herein. In some embodiments, a sgRNA comprises a spacer extension sequence with a length of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotides or any length ranging between any two lengths referred to above or herein. In some embodiments, a sgRNA comprises a spacer extension sequence with a length of less than 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides or any length ranging between any two lengths referred to above or herein.
[0117] In some embodiments, a sgRNA may comprise a linker sequence with a length from about 3 to about 100 nucleotides. In some embodiments, a sgRNA linker sequence is about 3 to 5 nt, 3 to 10 nt, 3 to 20 nt, 3 to 30 nt, 3 to 40 nt, 3 to 50 nt, 3 to 60 nt, 3 to 70 nt, 3 to 80 nt, 3 to 90 nt, 3 to 100 nt, or any length ranging between any two lengths referred to above or herein. In Jinek et al., supra, for example, a simple 4 nucleotide “tetraloop” (-GAAA-) was used (Jinek et al., Science, 2012, 337(6096):816-821). An illustrative linker has a length from about 3 to about 90 nt, from about 3 nt to about 80 nt, from about 3 nt to about 70 nt, from about 3 nt to about 60 nt, from about 3 nt to about 50 nt, from about 3 nt to about 40 nt, from about 3 nt to about 30 nt, from about 3 nt to about 20 nt, from about 3 nt to about 10 nt, or any length ranging between any two lengths referred to above or herein. For example, the linker can have a length from about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt,from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt, or any length ranging between any two lengths referred to above or herein.
[0118] As used herein, the term “knock-in” which may be used interchangeably with the terms “genetic insertion” or “insertion,” generally refers to a genetic modification wherein a polynucleotide is introduced or added into a site or region of genomic DNA by any molecular biological method, e.g., methods described herein, e.g., by delivering to a site of genomic DNA an endonuclease, a donor nucleotide sequence, and at least one gRNA. In some aspects, a donor nucleotide sequence includes, as a non-limiting example, a vector such as a virus or an expression vector such as a plasmid, or any expression vector as featured herein. In some embodiments, the donor nucleotide sequence is a donor plasmid. In some embodiments, the donor vector, e.g., plasmid comprises one or more knock-in nucleotide sequences. In some embodiments, the donor sequence is an RNA sequence. In some embodiments, the gRNA is, as non-limiting examples, a sgRNA or pegRNA. In some embodiments, an insertion may occur within or near a site of genomic DNA that has been the site of a prior genetic modification, e.g., a deletion or insertion-deletion mutation. In some embodiments, an insertion occurs at a site of genomic DNA that partially overlaps, completely overlaps, or is contained within a site of a prior genetic modification, e.g., a deletion or insertion-deletion mutation. In some embodiments, an insertion occurs at a safe harbor locus. In some embodiments, an insertion involves the introduction of a polynucleotide that encodes a protein of interest. In some embodiments, an insertion involves the introduction of a polynucleotide that encodes a tolerogenic factor. In some embodiments, an insertion involves the introduction of a polynucleotide that encodes a survival factor. In some embodiments, an insertion involves the introduction of an exogenous promoter, e.g., a constitutive promoter, e.g., a CAG promoter. In some embodiments, an insertion involves the introduction of a polynucleotide that encodes a noncoding gene. In general, a polynucleotide to be inserted is flanked by sequences (e.g., homology arms) having substantial sequence homology with genomic DNA at or near the site of insertion.
[0119] As used herein, the term “safe harbor locus” generally refers to any location, site, or region of genomic DNA that may be able to accommodate a genetic insertion into said location, site, or region without adverse effects on a cell. In some embodiments, a safe harbor locus is an intragenic or extragenic region. In some embodiments, a safe harbor locus is a region of genomic DNA that is typically transcriptionally silent. In some embodiments, a safe harbor locus is a AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCRS, FIX (F9), G6PC,Gys2, HGD, Lp(a), Pcsk9, Serpinal, TF, or TTR locus. In some embodiments, a safe harbor locus is described in Sadelain, M. et al., “Safe harbours for the integration of new DNA in the human genome,” Nature Reviews Cancer, 2012, Vol 12, pages 51-58, which is hereby incorporated by reference, specifically for what it discloses about safe harbors, and also generally for all that it discloses.
[0120] As used herein, the terms “Major histocompatibility complex class I” or “MHC-I” generally refer to a class of biomolecules that are found on the cell surface of all nucleated cells in vertebrates, including mammals, e.g., humans; and function to display peptides of non-self or foreign antigens, e.g., proteins, from within the cell (i.e. cytosolic) to cytotoxic T cells, e.g., CD8+ T cells, in order to stimulate an immune response. In some embodiments, an MHC-I biomolecule is a MHC-I gene or a MHC-I protein. Complexation of MHC-I proteins with beta- 2 microglobulin (B2M) protein is required for the cell surface expression of all MHC-I proteins. In some embodiments, decreasing the expression of an MHC-I human leukocyte antigen (HLA) relative to an unmodified cell involves a decrease (or reduction) in the expression of an MHC-I gene. In some embodiments, decreasing the expression of an MHC-I human leukocyte antigen (HLA) relative to an unmodified cell involves a decrease (or reduction) in the cell surface expression of an MHC-I protein. In some embodiments, an MHC-I biomolecule is HLA-A (NCBI Gene ID No: 3105), HLA-B (NCBI Gene ID No: 3106), HLA-C (NCBI Gene ID No: 3107), or B2M (NCBI Gene ID No: 567).
[0121] As used herein, the term “Major histocompatibility complex class II” or “MHC-II” generally refer to a class of biomolecules that are typically found on the cell surface of antigen- presenting cells in vertebrates, including mammals, e.g., humans; and function to display peptides of non-self or foreign antigens, e.g., proteins, from outside of the cell (extracellular) to cytotoxic T cells, e.g., CD8+ T cells, in order to stimulate an immune response. In some embodiments, an antigen-presenting cell is a dendritic cell, macrophage, or a B cell. In some embodiments, an MHC-II biomolecule is an MHC-II gene or a MHC-II protein. In some embodiments, decreasing the expression of an MHC-II human leukocyte antigen (HLA) relative to an unmodified cell involves a decrease (or reduction) in the expression of an MHC-II gene. In some embodiments, decreasing the expression of an MHC-II human leukocyte antigen (HLA) relative to an unmodified cell involves a decrease (or reduction) in the cell surface expression of an MHC-II protein. In some embodiments, a MHC-II biomolecule is HLA-DPA (NCBI Gene ID No: 3113), HLA-DPB (NCBI Gene ID No: 3115), HLA-DMA (NCBI Gene ID No: 3108), HLA-DMB (NCBI Gene ID No: 3109), HLA-DOA (NCBI GeneID No: 3111), HLA-DOB (NCBI Gene ID No: 3112), HLA-DQA (NCBI Gene ID No: 3117), HLA-DQB (NCBI Gene ID No: 3119), HLA-DRA (NCBI Gene ID No: 3122), or HLA-DRB (NCBI Gene ID No: 3123).
[0122] As used herein, the terms “pooling” and “pooled” refers to samples such as cells that have been combined into a single sample. For example, cells are pooled from multiple tubes, multiple timepoints, or from reactions that were run in duplicate, triplicate, or any multiple. In some embodiments, after step b) and before step c), that is, after incubating the culture of cells with the first cargo (step b) and before delivering to the culture of cells a second cargo (step c): the cells are pooled. For example, after the incubating in step b) and before second cargo delivery in step c) the cells are pooled from multiple tubes, such as when a reaction using cells is split over multiple tubes, or when a reaction run in duplicate, triplicate, or any multiple. In some embodiments, cells are pooled from multiple timepoints. In some embodiments, cells are pooled from identical reactions run in multiples. In some embodiments, samples are pooled from different reactions.
[0123] In certain embodiments, after step b) and before step c), that is, after incubating the culture of mammalian with the first cargo (step b) and before delivering to the culture of mammalian a second cargo (step c): the mammalian cells are pooled. In certain embodiments, after the incubating in step b) and before second cargo delivery in step c): the mammalian cells are not pooled.
[0124] In certain embodiments, after step b) and before step c) that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the iPSCs are pooled. In certain embodiments, after the incubating in step b) and before the second cargo delivery in step c): the iPSCs are not pooled.
[0125] In certain embodiments, after step b) and before step c), that is, after incubating the culture of hiPSCs with the first cargo (step b) and before delivering to the culture of hiPSCs a second cargo (step c): the hiPSCs are pooled. In certain embodiments, after the incubating in step b) and before the second cargo delivery in step c): the hiPSCs are not pooled. In some embodiments, cells are pooled from multiple timepoints. In some embodiments, cells are pooled from identical reactions run in multiples. In some embodiments, samples are pooled from different reactions.
[0126] Descriptions of Gene Editing Systems
[0127] CRISPR Endonuclease System
[0128] The CRISPR-endonuclease system is a naturally occurring defense mechanism in prokaryotes that has been repurposed as an RNA-guided DNA-targeting platform used for gene editing. CRISPR systems include Types I, II, III, IV, V, and VI systems. In some aspects, the CRISPR system is a Type II CRISPR / Cas9 system. In other aspects, the CRISPR system is a Type V CRISPR / Cprf system. CRISPR systems rely on a DNA endonuclease, e.g., Cas9, and two noncoding RNAs — crisprRNA (crRNA) and trans-activating RNA (tracrRNA) — to target the cleavage of DNA.
[0129] The crRNA drives sequence recognition and specificity of the CRISPR-endonuclease complex through Watson-Crick base pairing, typically with an approximately 20 nucleotide (nt) sequence in the target DNA. Changing the sequence of the 5’ 20 nt in the crRNA allows targeting of the CRISPR-endonuclease complex to specific loci. The CRISPR-endonuclease complex only binds DNA sequences that contain a sequence match to the first 20 nt of the single-guide RNA (sgRNA) if the target sequence is followed by a specific short DNA motif (with the sequence NGG) referred to as a protospacer adjacent motif (PAM).
[0130] TracrRNA hybridizes with the 3’ end of crRNA to form an RNA-duplex structure that is bound by the endonuclease to form the catalytically active CRISPR-endonuclease complex, which can then cleave the target DNA.
[0131] Once the CRISPR-endonuclease complex is bound to DNA at a target site, two independent nuclease domains within the endonuclease each cleave one of the DNA strands three bases upstream of the PAM site, leaving a double-strand break (DSB) where both strands of the DNA terminate in a base pair (a blunt end).
[0132] In some embodiments, the endonuclease is a Cas9 (CRISPR associated protein 9). In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes, although other Cas9 homologs may be used, e.g., S. aureus Cas9, N. meningitidis Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR 3 Cas9, or T. denticola Cas9. In other instances, the CRISPR endonuclease is Cpfl, e.g., L. bacterium ND2006 Cpfl or Acidaminococcus sp. BV3L6 Cpfl. In some embodiments, the endonuclease is Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Casl2a (Cpfl), Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or Cpfl endonuclease. In some embodiments, wild-type variants may be used. In some embodiments, modified versions (e.g., a homolog thereof, a recombination of thenaturally occurring molecule thereof, codon-optimized thereof, or modified versions thereof) of the preceding endonucleases may be used.
[0133] The CRISPR nuclease can be linked to at least one nuclear localization signal (NLS). The at least one NLS can be located at or within 50 amino acids of the amino-terminus of the CRISPR nuclease and / or at least one NLS can be located at or within 50 amino acids of the carboxy-terminus of the CRISPR nuclease.
[0134] Exemplary CRISPR / Cas polypeptides include the Cas9 polypeptides as published in Fonfara et al., “Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems,” Nucleic Acids Research, 2014, 42: 2577-2590. The CRISPR / Cas gene naming system has undergone extensive rewriting since the Cas genes were discovered. Fonfara et al. also provides PAM sequences for the Cas9 polypeptides from various species.
[0135] Zinc Finger Nucleases
[0136] Zinc finger nucleases (ZFNs) are modular proteins comprised of an engineered zinc finger DNA binding domain linked to the catalytic domain of the type II endonuclease Fokl. Because Fokl functions only as a dimer, a pair of ZFNs must be engineered to bind to cognate target “half-site” sequences on opposite DNA strands and with precise spacing between them to enable the catalytically active Fokl dimer to form. Upon dimerization of the Fokl domain, which itself has no sequence specificity per se, a DNA double-strand break is generated between the ZFN half-sites as the initiating step in genome editing.
[0137] The DNA binding domain of each ZFN is typically comprised of 3-6 zinc fingers of the abundant Cys2-His2 architecture, with each finger primarily recognizing a triplet of nucleotides on one strand of the target DNA sequence, although cross-strand interaction with a fourth nucleotide also can be important. Alteration of the amino acids of a finger in positions that make key contacts with the DNA alters the sequence specificity of a given finger. Thus, a four-finger zinc finger protein will selectively recognize a 12 bp target sequence, where the target sequence is a composite of the triplet preferences contributed by each finger, although triplet preference can be influenced to varying degrees by neighboring fingers. An important aspect of ZFNs is that they can be readily re-targeted to almost any genomic address simply by modifying individual fingers. In most applications of ZFNs, proteins of 4-6 fingers are used, recognizing 12-18 bp respectively.
[0138] Hence, a pair of ZFNs will typically recognize a combined target sequence of 24-36 bp, not including the typical 5-7 bp spacer between half-sites. The binding sites can beseparated further with larger spacers, including 15-17 bp. A target sequence of this length is likely to be unique in the human genome, assuming repetitive sequences or gene homologs are excluded during the design process. Nevertheless, the ZFN protein-DNA interactions are not absolute in their specificity so off-target binding and cleavage events do occur, either as a heterodimer between the two ZFNs, or as a homodimer of one or the other of the ZFNs. The latter possibility has been effectively eliminated by engineering the dimerization interface of the FokI domain to create “plus” and “minus” variants, also known as obligate heterodimer variants, which can only dimerize with each other, and not with themselves. Forcing the obligate heterodimer prevents formation of the homodimer. This has greatly enhanced specificity of ZFNs, as well as any other nuclease that adopts these FokI variants.
[0139] A variety of ZFN-based systems have been described in the art, modifications thereof are regularly reported, and numerous references describe rules and parameters that are used to guide the design of ZFNs; see, e.g., Segal et al., Proc Natl Acad Sci, 1999 96(6):2758-63; Dreier B et al., J Mol Biol., 2000, 303(4):489-502; Liu Q et al., J Biol Chem., 2002, 277(6):3850-6; Dreier et al., J Biol Chem., 2005, 280(42):35588-97; and Dreier et al., J Biol Chem. 2001, 276(31):29466-78.
[0140] Transcription Activator-Like Effector Nucleases (TALENs)
[0141] TALENs represent another format of modular nucleases whereby, as with ZFNs, an engineered DNA binding domain is linked to the FokI nuclease domain, and a pair of TALENs operate in tandem to achieve targeted DNA cleavage. The major difference from ZFNs is the nature of the DNA binding domain and the associated target DNA sequence recognition properties. The TALEN DNA binding domain derives from TALE proteins, which were originally described in the plant bacterial pathogen Xanthomonas sp. TALEs are comprised of tandem arrays of 33-35 amino acid repeats, with each repeat recognizing a single base pair in the target DNA sequence that is typically up to 20 bp in length, giving a total target sequence length of up to 40 bp. Nucleotide specificity of each repeat is determined by the repeat variable diresidue (RVD), which includes just two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine and thymine are predominantly recognized by the four RVDs: Asn- Asn, Asn-Ile, His-Asp and Asn-Gly, respectively. This constitutes a much simpler recognition code than for zinc fingers, and thus represents an advantage over the latter for nuclease design. Nevertheless, as with ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs have also benefitted from the use of obligate heterodimer variants of the FokI domain to reduce off-target activity.
[0142] Additional variants of the FokI domain have been created that are deactivated in their catalytic function. If one half of either a TALEN or a ZFN pair contains an inactive FokI domain, then only single- strand DNA cleavage (nicking) will occur at the target site, rather than a DSB. The outcome is comparable to the use of CRISPR / Cas9 or CRISPR / Cpfl “nickase” mutants in which one of the Cas9 cleavage domains has been deactivated. DNA nicks can be used to drive genome editing by HDR, but at lower efficiency than with a DSB. The main benefit is that off-target nicks are quickly and accurately repaired, unlike the DSB, which is prone to NHEJ-mediated mis-repair.
[0143] A variety of TALEN-based systems have been described in the art, and modifications thereof are regularly reported; see, e.g., Boch, Science, 2009 326(5959): 1509- 12; Mak et al., Science, 2012, 335(6069):716-9; and Moscou et al., Science, 2009, 326(5959): 1501. The use of TALENs based on the “Golden Gate” platform, or cloning scheme, has been described by multiple groups; see, e.g., Cermak et al., Nucleic Acids Res., 2011, 39(12):e82; Li et al., Nucleic Acids Res., 2011, 39(14):6315-25; Weber et al., PLoS One., 2011, 6(2):el6765; Wang et al., J Genet Genomics, 2014, 41(6):339-47.; and Cermak T et al., Methods Mol Biol., 2015 1239:133-59.
[0144] MegaTAL / Tev-mTALEN / MegaTev
[0145] As further examples of hybrid nucleases, the MegaTAL platform and Tev-mTALEN platform use a fusion of TALE DNA binding domains and catalytically active HEs, taking advantage of both the tunable DNA binding and specificity of the TALE, as well as the cleavage sequence specificity of the HE; see, e.g., Boissel et al., Nucleic Acids Res., 2014, 42: 2591-2601; Kleinstiver et al., G3, 2014, 4:1155-65; and Boissel and Scharenberg, Methods Mol. Biol., 2015, 1239: 171-96.
[0146] In a further variation, the MegaTev architecture is the fusion of a meganuclease (Mega) with the nuclease domain derived from the GIY-YIG homing endonuclease I-TevI (Tev). The two active sites are positioned ~30 bp apart on a DNA substrate and generate two DSBs with non-compatible cohesive ends; see, e.g., Wolfs et al., Nucleic Acids Res., 2014, 42, 8816-29. It is anticipated that other combinations of existing nuclease-based approaches will evolve and be useful in achieving the targeted genome modifications described herein.
[0147] Nucleic Acids Encoding System Components
[0148] The present disclosure provides a nucleic acid comprising a nucleotide sequence encoding a genome-targeting nucleic acid of the disclosure, an endonuclease of the disclosure, and / or any nucleic acid or proteinaceous molecule necessary to carry out the aspects of themethods of the disclosure. The encoding nucleic acids can be RNA, DNA, or a combination thereof.
[0149] The nucleic acid encoding a genome-targeting nucleic acid of the disclosure, an endonuclease of the disclosure, and / or any nucleic acid or proteinaceous molecule necessary to carry out the aspects of the methods of the disclosure can comprise a vector (e.g., a recombinant expression vector).
[0150] The term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a “plasmid,” which refers to a circular double-stranded DNA loop into which additional nucleic acid segments can be ligated. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
[0151] In some examples, vectors can be capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as “recombinant expression vectors,” or more simply “expression vectors,” which serve equivalent functions.
[0152] The term “operably linked” means that the nucleotide sequence of interest is linked to regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence. The term “regulatory sequence” is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology, 1990, 185, Academic Press, San Diego, Calif. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression desired, and the like.
[0153] In one embodiment the vector is a viral vector based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammarytumor virus) and other recombinant viral vectors. “Expression vectors” contemplated herein expressly do not include viral vectors.
[0154] In some examples, a vector can comprise one or more transcription and / or translation control elements. Depending on the host / vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. can be used in the expression vector.
[0155] A promoter can be an inducible promoter (e.g., a heat shock promoter, tetracycline- regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor- regulated promoter, etc.). The promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter, CAG promoter). In some cases, the promoter can be a spatially restricted and / or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.).
[0156] Non-limiting examples of suitable eukaryotic promoters (i.e., promoters functional in a eukaryotic cell) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retrovirus, human elongation factor- 1 a promoter (EFla), chicken beta-actin promoter (CBA), ubiquitin C promoter (UBC), a hybrid construct comprising the cytomegalovirus enhancer fused to the chicken beta-actin promoter (CAG), a hybrid construct comprising the cytomegalovirus enhancer fused to the promoter, the first exon, and the first intron of chicken beta-actin gene (CAG or CAGGS), murine stem cell virus promoter (MSCV), phosphoglycerate kinase- 1 locus promoter (PGK), and mouse metallothionein-I promoter.
[0157] Introduction of the complexes, polypeptides, and nucleic acids of the disclosure into cells can occur by bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.
[0158] In some aspects, the first cargo or the second cargo is delivered to the culture of mammalian cells by electroporation, lipofection, nucleofection, microinjection, sonoporation, or magnetofection. In some embodiments, the first cargo or the second cargo is delivered to the culture of iPSCs by electroporation, lipofection, microinjection, sonoporation, or magnetofection.
[0159] In some aspects, the first cargo and the second cargo are sequentially delivered to the culture of mammalian cells using nucleofection. In certain embodiments, the first cargo or the second cargo is delivered to the culture of iPSCs using nucleofection. In certain other embodiments, the first cargo and the second cargo are delivered to the culture of iPSCs using nucleofection.
[0160] In some embodiments, the first cargo comprises a donor nucleotide sequence. In some aspects, the donor nucleotide sequence is either a circular donor nucleotide sequence or a linear donor nucleotide sequence. In some aspects, the donor nucleotide sequence is double- stranded. In some aspects, the donor nucleotide sequence is single-stranded. In some aspects, the donor nucleotide sequence, includes, as non-limiting examples, a cosmid, artificial chromosome, and / or a vector, such as an expression vector. In some aspects, the expression vector is a mammalian vector, bacterial vector, a mammalian non-episomal vector, or any other expression vector featured herein. As featured herein, an expression vector includes, as nonlimiting examples, a plasmid and a transposon. In some embodiments, an expression vector is a plasmid. In some aspects, the first cargo comprises a donor nucleotide sequence, wherein the donor nucleotide sequence comprises a plasmid. In some aspects, the first cargo comprises one or more donor nucleotide sequences. In some embodiments, one or more donor nucleotide sequences is codon-optimized for expression in the mammalian host cell. In certain embodiments, the donor nucleotide sequence comprises one or more knock-in nucleotide sequences. In certain other embodiments, the donor nucleotide sequence comprises at least two knock-in nucleotide sequences. In certain additional embodiments, the donor nucleotide sequence comprises two, three, four, five, or more than five knock-in nucleotide sequences. In some embodiments, the donor nucleotide sequence comprises one or more knock-in nucleotide sequences, and further comprises a protein-coding sequence.
[0161] In some aspects, the second cargo comprises a nuclease. In some aspects, the second cargo comprises a nuclease, or a functional variant thereof. In certain aspects, the nuclease is selected from: a meganuclease, a TALEN, and a Zinc Finger nuclease, or a functional variant thereof. In some aspects, the second cargo comprises a meganuclease, or a functional variant thereof. In some aspects, the second cargo comprises a TALEN, or a functional variant thereof. In some aspects, the second cargo comprises a Zinc Finger nuclease, or a functional variant thereof.
[0162] In some aspects, the second cargo comprises: a nucleotide sequence encoding a nuclease. In some embodiments, the nucleotide sequence encoding a nuclease is codon-optimized for expression in the mammalian host cell. In certain aspects, the nucleotide sequence encodes a nuclease selected from: a meganuclease, a TALEN, and a Zinc Finger nuclease, or a functional variant thereof, and in some aspects, the nucleotide sequence is codon- optimized for expression in the mammalian host cell. In certain aspects, the second cargo comprises: a nucleotide sequence encoding a meganuclease, or a functional variant thereof. In some embodiments, the nucleotide sequence encoding a meganuclease is codon-optimized for expression in the mammalian host cell. In certain aspects, the second cargo comprises: a nucleotide sequence encoding a TALEN, or a functional variant thereof. In some embodiments, the nucleotide sequence encoding a TALEN is codon-optimized for expression in the mammalian host cell. In certain aspects, the second cargo comprises: a nucleotide sequence encoding a Zinc Finger nuclease, or a functional variant thereof. In some embodiments, the nucleotide sequence encoding a Zinc Finger nuclease is codon-optimized for expression in the mammalian host cell.
[0163] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence.
[0164] In some aspects, the second cargo comprises: a nucleotide sequence encoding a nuclease and a nucleotide sequence that is complementary to a target nucleotide sequence. In some embodiments, the nucleotide sequence encoding a nuclease is codon-optimized for expression in the mammalian host cell.
[0165] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence.
[0166] In some aspects, the second cargo comprises: a nucleotide sequence encoding a nuclease, wherein the nucleotide sequence is operably linked to a guide sequence that is complementary to a target nucleotide sequence.
[0167] In some aspects, the second cargo comprises a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain aspects, the second cargo further comprises a guide sequence that is complementary to a target nucleotide sequence.
[0168] In some aspects, the second cargo comprises a CRISPR-associated system (Cas) protein, or a functional variant thereof. In certain aspects, the second cargo further comprises a guide sequence that is complementary to a target nucleotide sequence. In certain further aspects, the Cas protein is selected from: Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2,Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO and CasX; or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c and Casl3; or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl) and Casl2a (Cpfl) Ultra; or a functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl) and Casl2a (Cpfl) Ultra.
[0169] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is selected from a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof.
[0170] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein or functional variant thereof.
[0171] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is selected from Cas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, C2cl, C2c2, or a homolog or functional variant thereof.
[0172] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is selected from: Cas9, Cas 12a (Cpfl), or a homolog or functional variant thereof.
[0173] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas9, or a homolog or functional variant thereof. In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas9, or a functional variant thereof. In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementaryto a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas9.
[0174] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is HiFiCas9, or a homolog or functional variant thereof. In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is HiFiCas9 or functional variant thereof. In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is HiFiCas9.
[0175] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas 12a (Cpfl), or a homolog or functional variant thereof. In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR- associated system (Cas) protein, wherein the Cas protein is Casl2a (Cpfl) or functional variant thereof. In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Casl2a (Cpfl).
[0176] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Casl2a (Cpfl) Ultra, or a homolog or functional variant thereof. In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Cas 12a (Cpfl) Ultra, or a functional variant thereof. In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is a CRISPR-associated system (Cas) protein, wherein the Cas protein is Casl2a (Cpfl) Ultra.
[0177] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is selected from a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7,Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csfl, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof.
[0178] In some aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csfl, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof.
[0179] In some aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a functional variant thereof.
[0180] In some aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9.
[0181] In some aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof.
[0182] In some aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, spCas9mSA, HpaCas9, and xCas9; or a functional variant thereof.
[0183] In some aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c,Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, spCas9mSA, HpaCas9, and xCas9.
[0184] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence, wherein the nuclease is selected from a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain further aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csfl, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9 and xCas9; or a homolog or functional variant thereof.
[0185] In some aspects, the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence. In certain aspects, the nuclease is selected from a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9 and xCas9; or a homolog or functional variant thereof. In certain further aspects, the Cas protein is selected from: Cas9, Cas 12a (Cpfl), Casl2f, and Casl2j, Cas 13; or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO and CasX; or a functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl) and Casl2a (Cpfl) Ultra. In certain other aspects, the Cas protein is selected from Cas9 or Casl2a (Cpfl), or a functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9 or Casl2a (Cpfl).
[0186] In some aspects, the second cargo comprises: a nucleotide sequence encoding a nuclease and a nucleotide sequence that is complementary to a target nucleotide sequence. In some embodiments, the nucleotide sequence encoding a nuclease is codon-optimized for expression in the mammalian host cell. In certain aspects, the nucleotide sequence encoding a nuclease encodes a CRISPR-associated system (Cas) protein, or a homolog or functionalvariant thereof, and in some embodiments the nucleotide sequence is codon-optimized for expression in the mammalian host cell. In certain additional aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, Cas 100, CasX, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, Cas 12a (Cpfl), Casl2f, and Cas 13; or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2f, or a homolog or functional variant thereof.
[0187] In some aspects, the second cargo comprises: a nucleotide sequence encoding a nuclease, wherein the nucleotide sequence is operably linked to a guide sequence that is complementary to a target nucleotide sequence. In certain aspects, the second cargo comprises a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, Casl2a (Cpfl), Casl2f, and Cas 13; or a functional variant thereof.
[0188] In certain aspects, the second cargo comprises a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof. In certain aspects, the second cargo further comprises a guide sequence that is complementary to a target nucleotide sequence. In certain aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or a homolog or functional variant thereof. In certainaspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9; or functional variant thereof. In certain aspects, the Cas protein is selected from: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, HiFiCas9, CaslO, Casl2a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, and xCas9. In certain additional aspects, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl), Casl2a (Cpfl) Ultra; or a homolog or functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, Cas 12a (Cpfl), Casl2a (Cpfl) Ultra, Casl2c, Casl2e, Casl2f, Casl2g, Casl2i, Casl2j, Casl3, CaslOO, CasX. In certain other aspects, the Cas protein is selected from: Cas9, HiFiCas9, Casl2a (Cpfl), and Cas 12a (Cpfl) Ultra; or a functional variant thereof. In certain additional aspects, the Cas protein is selected from: Cas9, HiFiCas9, Cas 12a (Cpfl) and Cas 12a (Cpfl) Ultra. In certain additional aspects, the Cas protein is selected from: HiFiCas9 and Cas 12a (Cpfl) Ultra; or a functional variant thereof. In certain other aspects, the Cas protein is selected from: Cas9, or a functional variant thereof. In certain other aspects, the Cas protein is selected from: HiFiCas9, or a functional variant thereof. In certain other aspects, the Cas protein is selected from: Cas 12a (Cpfl), or a functional variant thereof.
[0189] Cells and Physical Culture Conditions
[0190] Stem cells are undifferentiated cells that have the ability to self-renew indefinitely and to remain in said undifferentiated state. As opposed to embryonic stem cells, which can only be isolated from the inner mass of a blastocyst, there are three known accessible sources of adult stem cells: the bone marrow, which requires the drilling of a bone; the adipose tissue, which is accessible by liposuction; and the blood, from which the cells can be extracted among other cells. The term “pluripotent stem cells,” as used herein, refers to cells that are capable of generating all the cell types of an organism, i.e., cells derived from any of the three germ layers. On the other hand, multipotent stem cells can differentiate into several cell types, but only those of a closely related family of cells, generally the cell types of the organ from which theyoriginate. Most adult stem cells are multipotent, but small amounts of pluripotent adult stem cells can be retrieved from the umbilical cord or other tissues. The sources of cells used for cell therapy include stem cells such as embryonic stem cells (ESCs), adult stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the cells are iPSCs. In some embodiments, the cells are, as non-limiting examples, mammalian cells, including, as nonlimiting examples, primate, rodent, and human cells, pluripotent stem cells (PSCs), and iPSCs.
[0191] There are two basic systems for growing cells in culture: monolayers on an artificial substrate (i.e., adherent culture) or free-floating in the culture medium (suspension culture). The majority of the cells derived from vertebrates, with the exception of hematopoietic cell lines and a few others, are anchorage-dependent and have to be cultured on a suitable substrate that is specifically treated to allow cell adhesion and spreading (i.e., tissue-culture-treated). However, many cell lines can also be adapted for suspension culture.
[0192] In some embodiments, the culture of PSCs is an adherent layer of cells. In some embodiments, the layer of cells is grown in a two-dimensional culture system or on microcarriers.
[0193] In addition to the treatment of the tissue-culture surface, cells can be required to be grown on coated surfaces to enhance or improve their adhesion and / or spreading (i.e., using a coating). “Coating” as an additional surface treatment stands for all additional modifications made to increase cell adhesion in addition to the standard plasma or corona treatment that is performed on all cell culture plastic by the manufacturer. Usually, coating is done with proteins or peptides. Various proteins can be used to coat tissue-culture-treated dishes, including poly- L-lysine, poly-D-lysine, poly-Omithine, gelatin, collagen I, IV, fibronectin, laminin, vitronectin, osteopontin, fibronectin domains, MatrigelTM (several components of the extracellular matrix with bound growth factors, etc.), collagen gels, alginate gels, and lactate gels. In some embodiments, the PSCs are plated on an adherent surface. In some embodiments, the PSCs are cultured on a coated surface, including a laminin coating.
[0194] In some embodiments, the incubation in step b) further comprises plating the culture of mammalian cells on an adherent surface. In some other embodiments, the incubation in step b) further comprises plating the culture of mammalian cells on a non-adherent surface. In some embodiments, the incubation in step b) comprises plating the culture of iPSCs on an adherent surface. In some other embodiments, the incubation in step b) further comprises plating the culture of iPSCs on a non-adherent surface.
[0195] Physical culture conditions include, as non-limiting examples, the culture environment of the cell (e.g., adherent versus suspension culture, or in two-dimensional versus in three-dimensional culture systems), the pH of the culture medium, the gas concentration in the incubator (e.g., CO2 concentration, O2 concentration), and the temperature. Incubation of cell cultures is typically performed in a normal atmosphere with 15-22% oxygen and 5% CO2 for expansion and seeding. In some embodiments, the incubation of cell cultures is performed in a normal atmosphere with about 10 to 11% oxygen, 11 to 12% oxygen, 12 to 13% oxygen, 13 to 14% oxygen, 14 to 15% oxygen, 15 to 16% oxygen, 16 to 17% oxygen, 17 to 18% oxygen, 18 to 19% oxygen, 19 to 20% oxygen, 20 to 21% oxygen, 21 to 22% oxygen, 22 to 23% oxygen, 23 to 24% oxygen, 24 to 25% oxygen, or any percentage oxygen ranging between any two of the recited temperature ranges referred to above or herein, and about 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% CO2, or any percentage CO2 ranging between any two of the recited percentages referred to above or herein.
[0196] In some embodiments, the PSCs are grown in a humidified atmosphere with about 5%CO2 concentration and normoxic conditions (non-hypoxic O2 concentration). While hypoxic culture conditions are thought to support stem cell performance in general, in the present methods, the PSCs are cultured under conditions that are not hypoxic. As used herein, “normoxic” conditions refer to culture conditions including atmospheric O2 concentration (e.g., about 15-25% O2 concentration). As used herein, hypoxic conditions are characterized by a lower oxygen concentration as compared to the oxygen concentration of ambient air (approximately 15%-25% oxygen).
[0197] As featured and disclosed herein, temperatures below 37°C include, as non-limiting examples, temperatures of 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C,20°C, 21°C, 22°C, 23°C, 24°C 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C,35°C, 36°C, or any value below the aforementioned temperatures, or any temperature ranging between any two of the recited temperature values referred to above or herein. In some embodiments, temperatures below or at about 32°C are understood to be “cold shock” temperatures. In some embodiments, the PSCs are subjected to “cold shock” treatment, in which they are exposed to temperature of 32°C for between about 1 to 24 hours. In some embodiments, the PSCs are subjected to “cold shock” treatment, in which they are exposed to temperature of 32°C for about 24 hours.
[0198] In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In some embodiments,after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature of about 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, or any temperature below the aforementioned temperatures, or any temperature ranging between any two of the recited temperature values referred to above or herein. In some embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at about 32°C. In some embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a temperature of about 32°C. In some embodiments, after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature of about 32°C. In some embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a temperature of about 32°C, and again after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature of about 32°C. In certain additional embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the first cargo, the culture of mammalian cells is incubated at a 32°C. In certain additional embodiments, after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature below 37°C. In certain additional embodiments, after delivery of the second cargo, the culture of mammalian cells is incubated at a temperature below 32°C.
[0199] Another of the various aspects of the present disclosure is a method of generating genetically engineered induced pluripotent stem cells (iPSCs) comprising: a) delivering a first cargo comprising DNA to a culture of iPSCs; b) incubating the culture of iPSCs in a medium with the first cargo; and c) delivering to the culture of iPSCs a second cargo comprising an RNA, a nuclease, and / or a nuclease-encoding nucleotide sequence, thereby mediating a single or double-strand DNA break at a target locus; and d) further incubating the culture of iPSCs, thereby producing genetically engineered iPSCs. In some embodiments, the iPSCs are obtained or derived from a mammal. In some embodiments, the iPSCs are obtained or derived from a human or a rodent. In some embodiments, the iPSCs are obtained or derived from a human.
[0200] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of the ordinary skilled in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, it will be understood thatmodifications and variations are encompassed within the spirit and scope of the instant disclosure. The preferred methods and materials are now described.
[0201] The following examples are provided to further illustrate the embodiments of the present invention, but they are not intended to limit the scope of the invention. While they are typical of those that might be used, other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.EXAMPLESExample 1Optimization of CRISPR-Mediated Knock-in Efficiencies in hiPSCs Using a Green Fluorescent Protein Vector Targeting the AAVS1 and B2M Loci
[0202] Maintenance of hiPSCs Prior to Nucleofection
[0203] Human induced pluripotent stem cells (hiPSCs) were cultured in Stem MACS™ iPS- Brew XF medium (also referred to herein as “Medium-A”) (Supplier: Miltenyi; Catalog No. 130-104-368) on iMatrix-511 (ASM Bio; Cat. No. 892011) and regularly split twice per week using Accutase, for maintenance (200,000 cells / 6-well). For nucleofection they were split 2 days before nucleofection (300,000 - 350,000 cells / 6-well)d-2 (Monday).
[0204] Genotyping of Target Region
[0205] To validate different gRNAs, a PCR was designed with primers spanning the target region of human AAVS1 gene, and another PCR was designed spanning the target region of human B2M gene. Each PCR fragment was sequenced to ensure no single nucleotide polymorphisms (SNPs) were within the gRNA binding site that would interfere with the editing process. Genomic target sequences for human AAVS1 and B2M were obtaining using Benchling or the National Center for Biotechnological Information (NCBI) database.
[0206] AAVS1 is an exemplary locus, originally described as a major hotspot for adeno- associated virus (AAV) integration, within intron 1 of the constitutively expressed protein phosphatase 1, regulatory subunit 12C (PPP1R12C) gene on human chromosome 19. This AAVS1 locus permits robust expression of CAG promoter-driven transgenes in many cell types, including embryonic stem cells. As disruption of PPP1R12C is not associated with any known disease, the AAVS1 locus is often considered a safe harbor for transgene targeting. Reporter expression patterns using AAVS1 have been shown to be reproducible and scalable by other groups, and our studies have likewise found that gene expression is maintained duringlong-term human iPSC culture and during in vitro differentiation along multiple lineages using this locus.
[0207] B2M encodes the HLA-I light chain component of the major histocompatibility complex (MHC) class I, which exerts substantive biological functions in tumorigenesis and immune control. The B2M gene locus is on human chromosome 15.
[0208] PCR primers were designed using Primer Blast tool available on NCBI website. The amplicons were approximately 1000 basepairs in length with the guideRNA (gRNA) cut site located asymmetrically inside, to facilitate identification of clones with the proper knock-in sequences.
[0209] Selection of GuideRNAs (gRNA)
[0210] Target sequences were analyzed using CRISPOR web-based application and an initial length of approximately 500 bp was selected at the start of the gRNA design process. The GRCh37 / hgl9 was used as the starting human genome sequence, and the ‘TTT / (A / C / G)-21- bp-Casl2a(Cpfl)-21 bp guides’ were selected as recommended by IDT. Three (3) to five (5) gRNAs were selected based on predicted efficiency and off-target specificity profile; the sequences with the lowest number of off targets and lowest number of mismatches were selected and ordered from Integrated DNA Technologies (IDT). Sequencing files were uploaded to ICE tool to receive an efficiency score for each gRNA. To enable this calculation, a wild-type DNA sample was amplified and sequenced as well. For the knock-in of GFP into the AAVS1 locus, the best gRNA has the following DNA sequence:CTGGAGCCATCTCTCTCCTTG (SEQ ID NO: 1) [Table 1], For the knock-in of GFP into the B2M locus, the best gRNA has the following sequence:GGGCGTCGATAAGCGTCAGAG (SEQ ID NO: 2) [Table 1], Other gRNA sequences are also given in Table 1 below.Table 1:
[0211] Generation of First Cargo, e.g., Donor Vectors
[0212] First cargo donor vectors, e.g., expression vectors, e.g., donor plasmids were designed to contain overhangs of over 500 hundred basepairs on each side which are homologous to the nucleotides proximal and distal to the nuclease cut site (18 nucleotides distal to the PAM for Cas9) flanking the sgRNA-induced cut using A Plasmid Editor (ApE) freeware. The PAM portion of the homology arm was mutated so that after integration of the donor sequence, the guide RNA can no longer bind. This prevents re-editing of the already mutated locus. Separate donor vectors targeting the AAV 1 locus or the B2M locus were designed and synthesized by GenScript (Piscataway, NJ). The donor vectors contain a strong CAG promoter and a green fluorescent protein (GFP) reporter with an SV40 terminator. The donor vectors were provided in the pUC-Kan standard backbone cloning vector. They were amplified and finally reconstituted in buffer EB (Qiagen U 19086) at 1-1.5 ug / ul. Sequences for the donor vectors are provided in Table 1.
[0213] The DNA from the hiPSC target cell line was isolated using QiAmp DNA Blood Mini Kit and eluted in 30 ul EB buffer. Q5 PCR was performed to amplify the target region. DNA was purified using MinElute PCR purification Kit and eluted in 15 ul EB buffer, and samples were analyzed using Sanger sequencing. Sequencing files were analyzed using SnapGene Viewer or ApE.
[0214] Two Days Before the Delivery of the Donor Vector (d-2)
[0215] Two days prior to the first nucleofection (referred to herein as “d-2”), hiPSCs were split with 300,000 - 350,000 cells divided evenly into the wells of a 6-well plate that was precoated with 3ul of iMatrix-511 per well in 2ml of XF medium with CloneR2 for at least one hour at 37°C.
[0216] DayO - Day of Delivering the Donor Vector
[0217] The medium for the cells to be nucleofected was changed to StemMACS iPS-Brew XF (Medium-A) + CloneR2 for at least one hour. Pre-warmed Accutase and 10 uM Y-27632 were combined in preparation for next steps.
[0218] 3 ug of donor vector was nucleofected into 106hiPSC cells using a P4 Lonza 4D nucleofector kit (# V4XP-4024).
[0219] Cells were allowed to recover by adding 400 ul base RPMI base medium with 10 uM Y-27632 or lx CloneR2, followed by incubation at 37°C for 10 min at 5% CO2. All nucleofected iPSCs were then plated out on an iMatrix-511 -coated 6-well in iPS Brew media containing 10 uM Y-27632 or lx CloneR2.
[0220] Dayl - Delivery of the Second Cargo, e.g., RNPs
[0221] The wells of a 6-well plate were coated with 3 ul iMatrix-511 per well in 2ml XF medium with Clone R2 for at least one hour at 37 degrees Celsius. The medium for the hiPSC cells to be nucleofected was changed to StemMACS iPS-BrewXF with CloneR2 and the cells were kept at 37 °C for one hour.
[0222] The hiPSC cells were detached from the iMatrix-511 plates. The medium was aspirated to collect dead cells and the remaining cells were washed twice with 2 ml PBS- / -. Prewarmed Accutase and Y-27632 were added and the cells were counted using a NucleoCounter® N-200. Cell titer was determined by looking at the number of viable cells. One million cells per planned nucleofection were transferred to a new falcon tube. In a separate tube, the gRNA and the A.s. Casl2a(Cpfl)Ultra (hereafter, Cpfl) nuclease were combined; this gRNA+Casl2a RNP solution was combined with the hiPSC cells in a nucleofection cassette and nucleofected using a P4 Lonza 4D nucleofector kit (# V4XP-4024).
[0223] Cells were allowed to recover by adding 400 ul base RPMI base medium with 10 uM Y-27632 or lx CloneR2, followed by incubation at 37 °C for 10 min at 5 percent carbon dioxide. All nucleofected iPSCs were then plated out on an iMatrix-511 -coated 6-well in iPS Brew medium containing 10 uM Y-27632 or lx CloneR2.
[0224] When the survived iPSCs had resumed exponential growth (typically anywhere from 12 hours later up to 84 hours later), cultures were replated again, at a dilution compatible withclonal colony picking after 1-2 weeks. Alternatively, the dissociated cells were clonally dispensed into iMatrix-511 -coated 96- well plates using a DispenCell device (SEED Biosciences). Bulk cultures were analyzed immediately before clonal reseeding.
[0225] Isolated candidate clones were further propagated to sufficient numbers to then be screened based on GFP expression and / or PCR using primers in Table 1. Optimization of knock-in efficiencies and associated cell survival rates included details about the nucleofection procedure such as allowing recovery and transiently exposing the cells to lower temperature (32°C) for 24 hours post nucleofection or using the CloneR2 reagent instead of Y-27632 after seeding bulk cultures.
[0226] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered accordingly.
Claims
CLAIMSWhat is claimed is:
1. A method of generating genetically engineered induced pluripotent stem cells (iPSCs) comprising: a) delivering a first cargo comprising DNA to a culture of iPSCs; b) incubating the culture of iPSCs in a medium with the first cargo for about 12- 60 hours; c) delivering to the culture of iPSCs a second cargo comprising: an RNA and a nuclease, or an RNA and a nucleotide sequence that encodes a nuclease; thereby mediating a single or double- strand DNA break at a target locus; and d) further incubating the culture of iPSCs for about 12-60 hours, thereby producing genetically engineered iPSCs.
2. The method of claim 1, wherein the incubation in step b) and incubation in step d) is for about 24 hours.
3. The method of claim 1, wherein the incubation in step b) comprises plating the culture of iPSCs on an adherent surface.
4. The method of claim 2, wherein the first cargo or the second cargo is delivered to the culture of iPSCs by electroporation, lipofection, nucleofection, microinjection, sonoporation, or magnetofection.
5. The method of claim 2, wherein the first cargo or the second cargo is delivered to the culture of iPSCs using nucleofection.
6. The method of claim 2, wherein the first cargo and the second cargo are sequentially delivered to the culture of iPSCs using nucleofection.
7. The method of claim 6, wherein the first cargo comprises a donor nucleotide sequence.
8. The method of claim 7, wherein the donor nucleotide sequence is a linear doublestranded donor nucleotide sequence, a circular double-stranded nucleotide sequence, or a single- stranded donor nucleotide sequence.
9. The method of claim 8, wherein the double- stranded donor nucleotide sequence comprises a knock-in nucleotide sequence.
10. The method of claim 9, wherein the double- stranded donor nucleotide sequence further comprises a protein-coding sequence.
11. The method of claim 7, wherein the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence.
12. The method of claim 7, wherein the second cargo comprises: a nucleotide sequence encoding a nuclease and a nucleotide sequence that is complementary to a target nucleotide sequence.
13. The method of claim 7, wherein the second cargo comprises: a nucleotide sequence encoding a nuclease, wherein the nucleotide sequence is operably linked to a guide sequence that is complementary to a target nucleotide sequence.
14. The method of claim 2, wherein the nuclease in step a) and step c) is selected from a meganuclease, a TALEN, and a Zinc Finger nuclease, or a functional variant thereof.
15. The method of any one of claims 11-13, wherein the second cargo comprises a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof.
16. The method of claim 15, wherein the Cas protein is selected from:Casl2a (Cpfl) Ultra, Casl2a (Cpfl), Cas9, Cas 13, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, HiFiCas9, Cas 10, Casl2f, Cas 12c, Casl2e, Casl2f, Cas 12g, Casl2i, Casl2j, Casl2j, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, or xCas9; or a homolog or functional variant thereof.
17. The method of claim 1, wherein the iPSCs are obtained or derived from a human or rodent.
18. The method of claim 17, wherein the mammal is a iPSCs are obtained or derived from a human.
19. The method of claim 18, wherein the iPSCs are human induced pluripotent stem cells (hiPSCs).
20. The method of any one of claims 1-19, wherein after step b) and before step c): the iPSCs are pooled.
21. The method of claim 20, wherein after delivery of the first and / or second cargo, the culture of iPSCs is incubated at a temperature below 37°C.
22. The method of claim 21, wherein after delivery of the first and / or second cargo, the culture of iPSCs is incubated at about 32°C.
23. A method of generating genetically engineered human induced pluripotent stem cells (hiPSCs) comprising: a) delivering a first cargo to a culture of hiPSCs, wherein the first cargo comprises: a donor nucleotide sequence comprising a knock-in nucleotide sequence, and wherein the first cargo is delivered using nucleofection; b) incubating the culture of hiPSCs with the first cargo for about 18-30 hours; and c) delivering a second cargo to the culture of hiPSCs, wherein the second cargo comprises:Casl2a (Cpfl), Cas9, or Casl3, or a homolog or functional variant thereof, and a guide sequence that is complementary to a target nucleotide sequence; thereby producing genetically engineered hiPSCs.
24. The method of claim 23, wherein after step b) and before step c): the hiPSCs are pooled.
25. The method of claim 24, wherein after step b) and before step c): the pooled hiPSCs are transiently incubated in a basal medium which is different from the medium in step b).
26. The method of claim 24, wherein after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at a temperature below 37 °C.
27. The method of claim 27, wherein after delivery of the first and / or second cargo, the culture of mammalian cells is incubated at 32°C.
28. A method of generating genetically engineered mammalian cells comprising: a) delivering a first cargo comprising DNA to a culture of mammalian cells; b) incubating the culture of mammalian cells in a medium with the first cargo for about 12-60 hours; andc) delivering to the culture of mammalian cells a second cargo comprising an RNA, a nuclease, and / or a nuclease-encoding nucleotide sequence, thereby mediating a single or double- strand DNA break at a target locus; and d) further incubating the culture of mammalian cells for about 12-60 hours, thereby producing genetically engineered mammalian cells.
29. The method of claim 28, wherein the incubation in step b) and incubation in step d) is for about 24 hours.
30. The method of claim 29, wherein the incubation in step b) comprises plating the culture of mammalian cells on an adherent surface.
31. The method of claim 30, wherein the first cargo or the second cargo is delivered to the culture of mammalian cells by electroporation, lipofection, microinjection, sonoporation, or magnetofection.
32. The method of claim 30, wherein the first cargo or the second cargo is delivered to the culture of mammalian cells using nucleofection.
33. The method of claim 30, wherein the first cargo and the second cargo are delivered to the culture of mammalian cells using nucleofection.
34. The method of claim 32 or 33, wherein the first cargo comprises a donor nucleotide sequence.
35. The method of claim 34, wherein the donor nucleotide sequence comprises a linear double-stranded donor nucleotide sequence, a circular double- stranded nucleotide sequence, or a single-stranded donor nucleotide sequence.
36. The method of claim 35, wherein double-stranded donor nucleotide sequence comprises a knock-in nucleotide sequence.
37. The method of claim 36, wherein the double- stranded donor nucleotide sequence further comprises a protein-coding sequence.
38. The method of claim 34, wherein the second cargo comprises: a nuclease and a guide sequence that is complementary to a target nucleotide sequence.
39. The method of claim 34, wherein the second cargo comprises: a nucleotide sequence encoding a nuclease and a nucleotide sequence that is complementary to a target nucleotide sequence.
40. The method of claim 34, wherein the second cargo comprises: a nucleotide sequence encoding a nuclease, wherein the nucleotide sequence is operably linked to a guide sequence that is complementary to a target nucleotide sequence.
41. The method of claim 29, wherein the nuclease is selected from a meganuclease, a TALEN, and a Zinc Finger nuclease, or a functional variant thereof.
42. The method of any one of claims 38-40, wherein the second cargo comprises a CRISPR-associated system (Cas) protein, or a homolog or functional variant thereof.
43. The method of claim 42, wherein the second cargo further comprises a guide sequence that is complementary to a target nucleotide sequence.
44. The method of claim 43, wherein the Cas protein is selected from:Casl2a (Cpfl) Ultra, Casl2a (Cpfl), Cas9, Cas 13, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, HiFiCas9, Cas 10, Cas 12c, Casl2e, Casl2f, Cas 12g, Casl2i, Casl2j, CaslOO, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4 CsxlO, Csxl6, CsaX, Csxl, Csx3, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, C2cl, C2c2, spCas9mSA, HpaCas9, or xCas9; or a homolog or functional variant thereof.
45. The method of claim 28, wherein the mammalian cells are obtained or derived from a primate or a rodent.
46. The method of claim 45, wherein mammalian cells are induced pluripotent stem cells obtained or derived from a primate or a rodent.
47. The method of claim 46, wherein the mammalian cells are human induced pluripotent stem cells (hiPSCs).
Citation Information
Patent Citations
Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells
US20150174169A1
Efficient TCR gene editing in t lymphocytes
US20230041268A1