Catalytic material for pathogen inactivation

Abstract

The present invention relates to a catalytic material with oxidant and / or acid-base properties, the preparation method thereof and the specific use thereof for pathogen inactivation. The invention also relates to a filter comprising the material.

Description

[0001] DESCRIPTION

[0002] Catalytic material for the inactivation of pathogens

[0003] The present invention relates to a catalytic material with oxidizing and / or acid-base properties, its preparation process, and its particular use for the inactivation of pathogens. The invention also relates to a filter comprising said material.

[0004] BACKGROUND OF THE INVENTION

[0005] According to the World Health Organization (WHO), lower respiratory tract infections are the most deadly communicable disease worldwide, ranking as the fourth cause of death. The COVID-19 pandemic has been responsible for more than 600 million cases and 6.6 million deaths in 2 years, with airborne transmission being the main vector of spread [Milton et al. Journal of the Pediatr Inf Dis Soc, 9: 413-415, 2020]. This transmission of pathogens is favored in closed spaces, where we spend more than 90% of our time. There is, therefore, a great need for technology that can inactivate pathogens and thus stop their spread. There are numerous devices, even commercial ones, that pursue this purpose. They are based either on air filtration to retain them (e.g., HEPA filters), on the use of ultraviolet light (e.g., uvgiHIT system), on the generation of reactive ions through ozonation (e.g., Ozonetech), plasma (e.g.,, AnnanAir) or other unspecified substances (e.g., ActivePure®), in heat treatment, in the use of disinfectants or lysozymes, in fumigation or in photocatalytic systems (Song et al., J Hazard Mater 424(Pt B):127429, 2021 ; Vlaskin, Applied Thermal Engineering 202 (2022) 117855). These technologies have certain disadvantages such as their low effectiveness and efficiency; the filters become saturated so they need to be replaced, which presents a risk of infection during the change; in the case of UV radiation, it can cause eye and skin damage; and in the case of the generation of reactive ions, harmful secondary compounds can be produced (Potential application of Air Cleaning devices and personal decontamination to manage transmission of COVID-19. SAGE-EMG 4th November 2020).

[0006] Heat treatment is a common decontamination method (E. Araud et al., Appl Environ Microbiol. 2016 Apr 1 ;82(7):2086-2099). Batéjat et al. (Journal of Biosafety and Biosecurity 3 (2021) 1-3) showed that SARS-CoV-2 could be inactivated in less than 30 min, 15 min, and 3 min at 56°C, 65°C, and 95°C, respectively. Yu et al. (Materials Today Physics 15 (2020) 100249) achieved a 99.8% reduction of SARS-CoV-2 present in an aerosol after passing through a Ni foam heated to 200 °C. Canpolat et al. (Journal of Virological Methods 301 (2022) 114465) reported a 99.999% inactivation of SARS-CoV-2 after exposing an aerosol infected with the virus to a temperature of 220° C for 1.44 s. However, the use of high temperatures entails significant energy expenditure, as well as heating of the circulating air that would cause thermal discomfort, making this technology unviable from a practical point of view.

[0007] On the other hand, a study on the functionalization of air filters with ZnO, Ag2 particles has been described. <D, CuO con propiedades antimicrobianas (B. Ribeiro et al. Materials Chemistry and Physics 313 (2024) 128684). En este estudio se reporta una buena actividad microbiana a S. pneumoniae, P. aeruginosa and hRSV-A cuando el tiempo de contacto es alto (24h). Existen también superficies antimicrobianas que contienen un agente biocida que inhibe el crecimiento de los patógenos. Un ejemplo es el de la patente US2014271757A1 donde se detalla el uso de una sal inorgánica de cobre poco soluble en agua que presenta buena actividad biocida tras el uso de un agente funcionalizante, etapa que no es necesaria en la presente invención. Existen también mascarillas que contienen agentes inactivantes tales como yoduro de platino, yoduro de paladio, yoduro de plata, yoduro de cobre o tiocianato de cobre (patente US10744351 B2).First, this patent indicates the need to incorporate a binder for the preparation of the mask, and second, inactivation occurs after irreversible adsorption of the pathogen and not through a catalytic filter, whose purpose is not to adsorb but to transform.

[0008] Therefore, it would be desirable to have a material useful for inactivating pathogens, such as viruses, bacteria and fungi, without it being necessary for the pathogen to remain attached, that is, capable of transforming the pathogens instead of retaining them, such that the material does not become saturated and does not need to be replaced, that is, it could be used for an unlimited time and, by not releasing reactive species, does not constitute a biological or chemical risk. DESCRIPTION OF THE INVENTION

[0009] The present invention relates to a catalytic material, to the process for preparing the same, to its use for the inactivation of pathogens, particularly pathogens present in air, and to a device comprising it.

[0010] In a first aspect, the present invention relates to a catalytic material comprising one or more, preferably one or two, compounds of formula I:

[0011] X n AND m

[0012] I where:

[0013] X represents Ni, Pd, Pt, Cu, Ag, Au, Zn, Cd, Ce or Hg;

[0014] Y represents O, S, Se, Te, F, Cl, Br, I, -SCN or -SC; n represents an integer selected from 1 to 2; and m represents an integer selected from 1 to 3, deposited on a support.

[0015] In another embodiment, the invention relates to the catalytic material defined above, where the support is a glass support, a metal support, a polymeric support, a ceramic support, a textile support or a wooden support, and preferably where the support is a polymeric support, a ceramic support or a textile support.

[0016] In a preferred embodiment, the support is a polymeric support or a ceramic support.

[0017] In another embodiment, the invention relates to the catalytic material defined above, where the support is a polymeric support selected from polyester, cotton and nylon.

[0018] In another embodiment, the invention relates to the catalytic material defined above, where the support is a ceramic support selected from alumina, silica, zeolites, zirconia, ceria, clays and a mixture thereof.

[0019] In another embodiment, the invention relates to the catalytic material defined above, where the support is a ceramic support; and the content of the compound of formula I is between 2 and 140 mmol of compound per gram of ceramic support, and preferably, where the content of the compound of formula I is 57.8 mmol per gram of ceramic support.

[0020] In another embodiment, the invention relates to the catalytic material defined above, wherein the support is a polymeric support; and the content of compound of formula I is between 0.008 and 0.250 mmol of compound per cm 2 polymeric support, and preferably where the content of the compound of formula I is 0.033 mmol of compound per cm 2 polymeric support.

[0021] In another embodiment the invention relates to the catalytic material defined above where X represents Cu, Ni, Ag, Cd, Zn, Pd or Pt.

[0022] In a preferred embodiment of the invention, X represents Cu, Ni, or Zn; and

[0023] In another embodiment the invention relates to the catalytic material defined above where Y represents Cl, Br, I, O, S, SCN or SO4.

[0024] In a preferred embodiment of the invention, Y represents Cl, Br, I, or SCN;

[0025] In another embodiment the invention relates to the catalytic material defined above where:

[0026] X represents Cu, Ni, Ag, Cd, Zn, Pd or Pt; and

[0027] Y represents Cl, Br, I, O, S, SCN or SO4.

[0028] In a more preferred embodiment of the invention:

[0029] X represents Cu, Ni or Zn; and

[0030] Y represents Cl, Br, I, or SCN.

[0031] In another embodiment, the invention relates to the catalytic material defined above, wherein the compound of formula I is selected from CuCl, CuCl2, CuBr, Cui, Cu2O, CuO, Cu2S, CuSCN, CuSÜ4 and Cu2SO4, NiCl2, NH2, Agl, AgCl, Cdl2, Znl2, Pdl2 and Ptl2.

[0032] In another embodiment the invention relates to the catalytic material defined above wherein the compound of formula I is selected from NiH, ZNH, CuCI, CuBr, CuCl, and CuCl2, and Cu2O, and preferably where the compound of formula I is selected from CuSCN, CU2O, CuO, CU2S, CuSU4 and CU2SO4. In another embodiment the invention relates to the catalytic material defined above wherein the compound of formula I is selected from CuCh, CuBr, CuCul, CuSCN, Nil2, and Znl2.

[0033] Another aspect of the invention is a process for obtaining the catalytic material defined above, which comprises the following steps: i) impregnation of the support with a solution of a compound comprising one or more compounds of formula I:

[0034] X n AND m

[0035] I where:

[0036] X represents Ni, Pd, Pt, Cu, Ag, Au, Zn, Cd, Ce or Hg;

[0037] Y represents O, S, Se, Te, F, Cl, Br, I, -SCN or -SO4; n represents an integer selected from 1 to 2; and m represents an integer selected from 1 to 3, with a concentration of between 0.01 and 0.5 M of compound in an organic and / or aqueous solvent; and

[0038] (i) heat treatment of the product obtained in step (i) at a temperature of between 25° C and 90° C to give rise to the catalytic material.

[0039] In another embodiment, the invention relates to the process for obtaining the catalytic material defined above, where in step (i) the impregnation is carried out by spraying, by drop-by-drop deposition or by immersion of the support in the solution of the compound of formula I.

[0040] In another embodiment, the invention relates to the process for obtaining the catalytic material defined above, where the solvent of step (i) is an organic solvent, preferably where the organic solvent is selected from acetonitrile, methanol, ethanol or isopropanol.

[0041] In another embodiment, the invention relates to the process for obtaining the catalytic material defined above, where the solvent in step (i) is an aqueous solvent, and preferably where the aqueous solvent is selected from water and / or an ammonia / water mixture. In another embodiment, the invention relates to the process for obtaining the catalytic material defined above, where the solvent in step (i) is acetonitrile, ethanol, or an ammonia / water mixture in a ratio between 9:1 and 3:7.

[0042] On the other hand, the catalytic materials of the invention, as defined above, have viricidal, fungicidal and / or bactericidal properties, representing an effective solution for inactivating a wide variety of pathogens and preventing transmission problems.

[0043] Therefore, another aspect of the invention relates to the use of the catalytic material defined above for the inactivation of pathogens, preferably where the pathogens are present in the air, more preferably where the pathogens are viruses, bacteria or fungi, and even more preferably where the pathogens are viruses and bacteria.

[0044] In another embodiment, the invention relates to the use of the catalytic material defined above where the viruses are selected from hCoV-229E, hCoV-NL63, Alphacoronavirus 1, TCoV, TGEV, Miniopterus 1, Miniopterus HJU8, Rhinolophus HKU2, Scotophilus 512, SARS-CoV, SARS-CoV-2, hCoV-OC43, hCoV-HKU1, BtCoV- HKU9, MERS-CoV, Rhinovirus hRV-14, and bacteriophage <$>-29.

[0045] In another embodiment, the invention relates to the use of the catalytic material defined above, where the bacteria are Gram-positive bacteria, and preferably where the Gram-positive bacteria are selected from Staphylococcus aureus, Streptococcus pyrogenes, Streptococcus aglactiae, Streptococcus faecalis, Streptococcus pneumoniae, Streptococcus sanguis, Clostridium tetani, Bacilus antracis, Clostridium botullinum and Clostridium perfringes.

[0046] In another embodiment, the invention relates to the use of the catalytic material defined above wherein the bacteria are Gram-negative bacteria, and preferably where the Gram-negative bacteria are selected from Escherichia coli, Neisseria meningitidis, Neisseria gonorrhoeae, Samonella typhi, Salmenella enteritiditis, Haemophilus influenzae, Bordetella pertussis, Brucella bortus, Francisella tularensis and Pasteurella multocida. In another embodiment, the invention relates to the use of the catalytic material defined above where the fungi are selected from Alternaria, Aspergillus, Penicillium, Fusarium, Trichoderma and Cladosporium.

[0047] Another aspect of the invention relates to a catalytic filter comprising the catalytic material defined above.

[0048] In another embodiment, the invention relates to the catalytic filter defined above, where said filter is part of an air purifying device, preferably where the air purifying device is personal protective equipment (PPE).

[0049] In another embodiment, the invention relates to the catalytic filter defined above, where said filter forms part of an air purifying device located inside a specific space or that forms part of a centralized installation of a ventilation / air conditioning system, where the installation is a shared space.

[0050] The catalytic material of the invention exhibits high dispersion and good redox and / or acid-base properties. The redox and / or acid-base properties of the catalytic material of the invention cause damage to pathogens through oxidative stress, preventing them from infecting new cells.

[0051] Furthermore, it allows reducing both the temperature and the necessary exposure time thanks to its high efficiency. The catalytic materials object of this invention have been tested with different types of viruses (hCoV-229E, SARS-CoV-2, hRV-14, and cjj-29) and bacteria (Escherichia coli and Staphylococcus aureus) in solution, observing the total inactivation of the pathogen, as far as can be detected (< 5 plaque forming units / mL for viruses; < 1 colony forming unit / mL for bacteria), at 30-60 min at temperatures between 25° C and 37° C in plate tests.

[0052] Therefore, the advantages presented by the invention are, in summary, that: i) these catalytic materials are capable of inactivating pathogens without the pathogen needing to adhere. Since the pathogen is not retained, the catalytic material does not become saturated nor does it need to be replaced, so it could be used for a virtually unlimited operating time; ii) they do not present a biological or chemical risk since no reactive species are released, as the reaction occurs on the surface; iii) their biocidal nature at moderate temperatures means that the energy consumption required in this technology is very low; iv) the preparation process is very simple, with no binding agent being necessary to confer stability to the active phase.

[0053] Considering all the above, the field of application of the present invention would be that of protection against airborne pathogens for personal protective equipment (PPE), for shared spaces such as, for example, rooms, elevators, bathrooms, hospitals, healthcare centers, schools, daycare centers, offices, gyms, sports facilities, restaurants, hotels, offices, transport stations, means of transport, public buildings, commercial and residential areas, where the spread of pathogens may be favored by poor ventilation or by crowding, among other causes, or as part of a centralized installation of an air ventilation / air conditioning system. These principles are equally valid in livestock and beekeeping applications.

[0054] The term “pathogen” refers to viruses, bacteria, and fungi.

[0055] The term “inactivation” refers to the chemical damage that the catalytic filter inflicts on the pathogen, preventing infection of a new host.

[0056] The term "personal protective equipment" or "PPE" is defined as any equipment intended to be worn or held by a worker to protect them from one or more risks that may threaten their safety or health, as well as any accessory or complement intended for this purpose (RD 773 / 1997, of May 30). This patent refers to a mask containing a catalytic filter that would protect against pathogens.

[0057] Throughout the description and claims, the word "comprise" and its variants are not intended to exclude other technical features, additives, components, or steps. For those skilled in the art, other objects, advantages, and features of the invention will be apparent in part from the description and in part from the practice of the invention. The following examples and figures are provided for illustrative purposes only and are not intended to be limiting of the present invention. BRIEF DESCRIPTION OF THE FIGURES

[0058] Fig. 1 Shows the plaque forming units (pfu) recovered after the viricidal activity test performed at 37° C for 60 min of the materials prepared in examples 1 and 8, in the presence of the hCoV-229E, SARS-CoV-2 and hRV-14 viruses.

[0059] Fig. 2 Shows the plaque forming units (pfu) recovered after the viricidal activity test carried out at 25° C for 60 min of the materials prepared in examples 1 and 7, in the presence of the hCoV-229E, SARS-CoV-2, cjj-29 and hRV-14 viruses.

[0060] Fig. 3 Shows the recovered colony forming units (cfu) after the bactericidal activity test carried out at 37° C for 60 min of the materials prepared in examples 1 and 8, in the presence of E. coli or S. Aureus bacteria.

[0061] Fig. 4 Prototype of the material from example 10 coupled to a fan to test bioactivity in aerosols.

[0062] Fig. 5 Shows the plaque forming units (pfu) recovered after the viricidal activity test performed at 25° C for 60 min of the material prepared in example 10, in the presence of the cjj-29 virus contained in an aerosol.

[0063] Fig. 6 Shows TEM micrographs of E. coli bacteria recovered from control material (a) or P1 material (b) after incubation at 25°C for 60 min.

[0064] Fig. 7 Shows TEM micrographs of bacteriophage cjj-29 recovered from control material (a) or C3 material (b) after incubation at 25°C for 60 min.

[0065] EXAMPLES

[0066] The invention will now be illustrated by tests carried out by the inventors, which demonstrate the effectiveness of the catalytic material object of the invention, of the product of the invention. Example 1. Synthesis of a biocidal material on a polymeric substrate (P1)

[0067] A 0.1 M Cui solution is prepared by dissolving 2.8750 g in 150 mL of acetonitrile. 6 x 6 cm filters are impregnated by airbrushing, depositing 12 mL, and dried at room temperature.

[0068] Example 2. Synthesis of a biocidal material on a polymeric substrate (P2)

[0069] A 0.1 M Znl2 solution is prepared by dissolving 1.9556 g in 60 mL of acetonitrile. 6 x 6 cm polyester filters are impregnated by airbrushing, depositing 14 mL of the solution. The filters are dried at 60° C.

[0070] Example 3. Synthesis of a biocidal material on a polymeric substrate (P3)

[0071] A 0.1M Cui solution is prepared by dissolving 0.3849 g in 20 mL of acetonitrile and left under constant stirring. A 0.1M Znl2 solution is prepared by dissolving 0.5631 g in 20 mL of acetonitrile and left under constant stirring. Once the compounds have completely dissolved, they are combined and left under constant stirring for 2 h until homogeneous. 6 x 6 cm filters are impregnated by airbrushing, depositing 15 mL, and dried at room temperature.

[0072] Example 4. Synthesis of a biocidal material on a polymeric substrate (P4)

[0073] A solution of 20.1 M CuCl is prepared by dissolving 0.8524 g in 50 mL of pure ethanol. 6 x 6 cm filters are impregnated by airbrushing, depositing 12 mL, and dried at room temperature.

[0074] Example 5. Synthesis of a biocidal material on a polymeric substrate (P5)

[0075] A 0.05M solution of NÜ2 is prepared by dissolving 0.7813 g in 50 mL of pure ethanol. It is sonicated for 30 minutes and kept under stirring. 6 x 6 cm filters are impregnated by spraying, depositing 12 mL, and dried at room temperature.

[0076] Example 6. Synthesis of a biocidal material on a polymeric substrate (P6)

[0077] A solution of CuBr 0I M is prepared by dissolving 0.2869 g in 20 mL of ammonium hydroxide. 6 x 6 cm filters are impregnated by airbrushing, depositing 12 mL, and then dried in an oven at 60°C.

[0078] Example 7. Synthesis of a biocidal material on a polymeric substrate (P7) A 0.1M CuSCN solution is prepared by dissolving 0.2433 g in 20 mL of ammonium hydroxide. 6 x 6 cm filters are impregnated by airbrushing, depositing 12 mL, and dried in an oven at 60°C.

[0079] Example 8. Synthesis of a biocidal material on a powdered ceramic substrate (C1) A 0.1 M Cul solution is prepared by dissolving 0.5 g of the compound in 25 mL of an aqueous NH3 solution in a Nh tW ratio of 3:7. The solution is magnetically stirred for 5 h at room temperature. 5 impregnations are carried out with the Cul solution on the aluminium oxide, adding the solution drop by drop until it reaches incipient wetness. It is dried at 90° C and another 4 impregnations are carried out successively. A total of 5.21 g of solution are consumed. It is dried at 90° C.

[0080] Example 9. Synthesis of a biocidal material on a monolithic ceramic substrate (C2) A 0.1 M solution of Cul is prepared by dissolving 5 g of the compound in 250 mL of an aqueous NH3 solution in a Nh tW ratio of 3:7. The previously formed AI2O3 monolith is immersed in the prepared solution for 10 seconds. It is then removed from the solution and immersed again for 30 min. After immersion, the supported material was dried at 90° C. This procedure was repeated 5 times.

[0081] Example 10. Synthesis of a biocidal material on a monolithic ceramic substrate (C3)

[0082] A 0.1 M Cul solution is prepared by dissolving 5 g of the compound in 250 mL of an aqueous NH3 solution in a Nh tW ratio of 7:3. The previously formed 70% Al2Os / 20% Bentonite / 10% sepiolite monolith is immersed in the prepared solution for 30 min. It is then removed from the solution and the excess solution is removed from the channels by blowing with compressed air. Subsequently, the supported material was dried at 90 ° C for 30 min. This procedure was repeated 5 times. Once the impregnated and dry monoliths were cut and filed to adjust them to dimensions of 3.3 x 3.3 cm of the monolith with a length of 5 cm and monoliths were glued to each other in a 3 x 3 configuration. They were adhered by applying Nural 30 and left to dry at room temperature for 2 days.

[0083] Example 11. Oxidative capacity tests The model reaction used to evaluate the oxidative capacity of the prepared catalytic materials is the oxidation of 1,4-dithiothreitol (DTT), whose oxidation product reacts with 5,5-dithio-bis-2-nitrobenzoic acid (DTNB) giving rise to a colored substance (yellow) that can be quantified at 412 nm. The procedure is based on preparing a 100 pM DTT solution on the one hand and a 200 pg mL' suspension on the other. 1of the material to be evaluated. In both cases, 0.01 M PBS is used as a solvent. 3 mL of each solution is taken and kept at 37° C and under constant stirring at 50 rpm for 30 min. After this time, the contents of each vial are filtered to remove particulate matter. A blank is also made with 3 mL of 100 pM DTT and 3 mL of 0.01 M PBS, maintaining it under the same conditions as the previous samples. From this filtered liquid, 2 mL are taken and 2 mL of a 1 mM DTNB solution are added. The absorbance at 412 nm is measured using a UV-vis spectroscope and the percentage of DTT oxidation is calculated from the formula:

[0084] The material prepared in Example 8 showed a 63% oxidation of the DTT molecule.

[0085] Example 12. Viricidal activity tests in solution

[0086] Viricidal activity was investigated using lipid-enveloped respiratory viruses from the Coronaviridae family (hCoV-229 and SARS-CoV-2) and non-lipid-enveloped viruses from the Picornaviridae family (hRV-14). Bacteriophage (c>-29) was also evaluated. The polymeric catalytic materials were used directly for the assay, while the viricidal activity of the ceramic catalytic material was assessed by drop-casting onto a glass coverslip. A suspension of 0.01 g of the material to be tested in 20 mL of distilled water was prepared. The glass coverslip was washed with ethanol and then placed on a hotplate at 60°C. Layers of approximately 0.7 g each were deposited, allowing the suspension to dry after each layer was deposited. A total of 7 layers were deposited.

[0087] Bioassays were performed by inoculating 100 pL of a virus suspension, containing ~105 -10 6pfu (recovered plaque-forming units) on the surface of the impregnated or unimpregnated (control) polymeric or ceramic substrate. Different exposure times (15, 30, and 60 min) and temperatures (25, 30, 33, and 37 °C) were used. After incubation, adherent virus was recovered from the surface by washing with 900 pL of the virus suspension medium [complete DMEM with 2% fetal bovine serum (FBS)]. Bioactivity was assessed by quantifying the number of pfu recovered from the filter using plaque viral titration assays. Briefly, serial 10-fold dilutions were made from the virus solution recovered from the filter in the virus suspension medium. 200 pL of each dilution were used to infect monolayers of HuH7 cells, in the case of the hCoV-229E virus, Vero E6, in the case of the SARS-CoV-2 virus, or HeLa-H1, in the case of the hRV-14 virus, grown in 12-well plates or Bacillus subtilis Su+44 bacteria, in the case of bacteriophage <$>-29.For hCoV-229E, after the first hour of infection at 37°C, the inoculum was removed and complete DMEM medium containing 0.7% noble agar, 2% FBS and 0.09 mg / mL DEAE-dextran was added; and the plates were incubated for 4 days at 33°C. For SARS-CoV-2, after inoculum removal, complete DMEM medium containing 1.5% carboxymethylcellulose, 10 mM HEPES and 2% FBS was added, and the plates were incubated for 3 days at 37°C. For hRV-14, after inoculum removal, complete DMEM medium containing 0.7% noble agar, 2% FBS and 0.045 mg / mL DEAE-dextran was added; and the plates were incubated for 3 days at 35°C. Finally, the cells were fixed with 2% (hCoV-229E and hRV-14) or 10% (SARS-CoV-2) formaldehyde solution for at least 30 minutes. After fixation, the semisolid medium was removed, and the plates were stained with 0.02% crystal violet in 10% ethanol and 2% formaldehyde.The plates were washed with water to remove excess crystal violet and allowed to air dry. Once dry, the pfu formed were counted. For bacteriophage cjj-29, plating was performed on a double layer of agar. 200 pfu of the virus dilution was added to 900 pl of LB containing Bacillus subtilis bacteria, followed by 900 pl of LB + Agar (1.5%) in liquid state tempered at 45°C. From this mixture, 900 pfu were seeded in 6-well plates containing 2 mL of LB + agar (1.5%) in solid state. Finally, the plate was incubated at 37°C overnight, and the resulting plaques were counted the following day.

[0088] Figure 1 shows the inactivation results for the hCoV-229E, SARS-CoV-2, and hRV-14 viruses using the catalytic materials prepared in Examples 1 and 8 after being kept in contact with the virus solution for 60 min at 37°C. The inactivation capacity was verified using a control, which is the support without active phase. It can be observed how they were reduced by between 3 and 4 log units, demonstrating the good inactivation potential of the prepared materials.

[0089] Figure 2 shows the inactivation results of the hCoV-229E, hRV-14 and cjj-29 viruses using the catalytic materials prepared in Examples 3 and 8 after maintaining them for 60 min at 25° C in contact with the virus solution. It can be observed how they were reduced between 4 and 6 log units (9 in the case of P3 against bacteriophage cjj-29) demonstrating the good inactivation potential of the prepared materials.

[0090] The materials prepared in Examples 2 and 3 were tested with SARS-CoV-2 at 37°C and 60 min, showing a reduction in viral titer of 3 log units compared to their control samples. The materials prepared in Examples 4, 5, 6, and 7 were tested with hCoV-229E at 25°C and 60 min, showing a reduction in viral titer of between 3 and 5 log units compared to their control samples (below the detection limit of the technique).

[0091] Example 13. Antimicrobial activity tests in solution

[0092] Bactericidal activity was investigated using Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus) bacteria based on the UNE-EN ISO 20743 standard. The polymeric catalytic material was used directly for the test, whereas, to evaluate the bactericidal activity of the ceramic catalytic material, the material had to be deposited on a glass coverslip by drop-casting. To do this, a suspension of 0.01 g of the material to be evaluated in 20 mL of distilled water was prepared. The glass coverslip was washed with ethanol and subsequently placed on a hot plate at 60°C. Layers of approximately 0.7 g each of the prepared suspension were deposited and allowed to dry between each one. A total of 7 layers were deposited.

[0093] First, an isolated colony of bacteria grown in Petri dish on LB (lysogeny broth: 10 g tryptone, 5 g yeast extract and 10 g NaCl in 1 L distilled water) supplemented with 1.5% agar was grown in 20 mL of LB in a 100 mL flask under shaking (~200 rpm) at 37 ° C for 18-24 hours to generate a preculture. Subsequently, 0.4 mL of the bacterial preculture was added on 20 mL of LB in a 100 mL flask and incubated for 3 hours at 37 ° C under shaking (~200 rpm), to have the bacteria in exponential growth phase. From this culture, a 1 / 100 dilution is made in LB and 100 pL of this suspension is used to test on the surface of the impregnated or unimpregnated (control) polymeric or ceramic substrate for 60 minutes at 37° C.After this incubation period, the bacteria were recovered by washing with 10 mL of physiological saline solution (8.5 g of NaCl in 1 L of distilled water), and the number of CFUs recovered from the filter was then determined by colony counting. To do this, serial dilutions based on 10 of the recovered bacteria were made in physiological saline solution. One mL of each dilution was then plated onto a Petri dish containing LB-1.5% agar and incubated at 37°C for 24 hours. Finally, the number of CFUs recovered from the filter was determined by manual counting of the number of colonies present on the Petri dishes.

[0094] Figure 2 shows the amount of bacteria recovered from the catalytic materials prepared in Examples 1 and 8 after they were kept in contact with the bacterial solution for 60 min at 37°C. The inactivation capacity was verified using a control, which was the support without the active phase. A reduction of between 4 and 5 log units in recovered cfu can be observed, demonstrating the good bactericidal potential of the prepared materials.

[0095] Example 14. Viricidal activity tests in aerosols

[0096] Viricidal activity against aerosols was investigated using bacteriophage cjj-29 using the material from Example 10. The test was conducted in a 91 L aerosol chamber fitted with a bioaerosol generation system, a particulate matter monitoring system, a bioaerosol recovery system, and a disinfection system. A fan and an adapter were located inside the aerosol chamber to allow the aerosol to be recirculated through the material from Example 10 (Figure 4). While the fan with the filter was on, the bioaerosol was generated with a modified Counterfog® SDR-F05A+ system (Counterfog) at a pressure of 11 bars, using 1 ml of phage diluent (50 mM Tris-HCl, pH 8; 10 mM MgCh; 100 mM NaCl; 0.05% Tween-80®) containing 7.6 x 10 10PFU of virus. The aerosol chamber remains hermetically sealed, allowing only the air generated during aerosol production to enter (static chamber). The fan that allows air recirculation is kept on for 1 h at room temperature. Finally, the generated aerosol is recovered by filtration with a vacuum pump (KNF Holdings Pumps) using a 25 mm nanofiber filter for 15 min. The virus adhering to the nanofiber filter was recovered by washing with 1000 µL of the phage diluent.

[0097] The amount of total virus recovered from the filter was determined by qPCR. For this purpose, 50 pl of the virus diluent containing the virus recovered from the filter was used to perform the automated extraction of the viral genetic material using a Maxwell® instrument and the Maxwell® Viral Total Nucleic Acid purification kit from Promega following the manufacturer's instructions. The detection and quantification of viral genomes by qPCR was performed on a CFX Opus 384 Real-Time POR Instrument (BioRad) using specific primers (-29 Fw: ATGGAACCGAGTACGGTGAG (SEQ ID NO:1); *-29 Rv: TGACGGGTCATGTGCTGTAT (SEQ ID NO:2)) and the SsoAdvanced Universal SYBR® Green Supermix enzyme (BioRad). The number of genomic equivalents in pfu / mL was calculated by comparison with a standard curve generated from previously titrated viruses.

[0098] Bioactivity was assessed by quantifying the number of pfu recovered (infectious virus) from the filter using double agar layer titration assays as previously described in Example 13.

[0099] Figure 5 shows the results of the total virus recovered (infectious and non-infectious) determined by qPCR, where it can be observed that the amount of DNA copies / mL recovered is similar to the amount of virus nebulized in the aerosol chamber, indicating that there was no retention in the filter, whether control or with catalytic material. Furthermore, Figure 5 shows the inactivation results of the virus *- 29, observing that when the catalytic material prepared in example 10 is used, viral viability is reduced by 6 log units with respect to the control. These results demonstrate the good inactivation potential of the materials prepared under real operating conditions.

[0100] Example 15. Transmission electron microscopy (TEM) characterization of E. coli after negative staining

[0101] The morphology of the bacteria recovered after a bactericidal assay similar to that of Example 13 was studied by TEM, comparing it with the bacteria recovered from the control filter. Briefly, 0.1 mL of an exponentially growing culture prepared as indicated in Example 13 was incubated on a 1x1 cm surface of material P1 (Example 1). It was incubated at 37°C for 60 min. After treatment, the bacteria were collected by washing with 1 mL of saline solution and centrifuged at 2000 rpm for 5 minutes. The supernatant was removed and the bacterial pellet was resuspended in 100 pL of saline solution. Negative staining was then performed immediately, which consisted of depositing the resuspended bacteria (10 pL) on the ionized side of a grid and holding them for 5 minutes to allow them to absorb.

[0102] The sample was then washed with double-distilled water to remove salts, and finally stained with 0.5% uranyl acetate for 1 min. Excess stain was removed by decanting onto filter paper, the grid was allowed to air dry, and the sample was observed under a microscope. The microscope used was a Jeol JEM-1010 transmission electron microscope (Jeol) operated at an accelerating voltage of 80 kV and equipped with a Bioscan 792 digital camera (Gatan).

[0103] Figure 6 shows micrographs of the bacteria before and after treatment with the material from Example 1. Increased staining is observed in the bacteria after treatment, which seems to indicate a partial rupture of the cell wall. Furthermore, the morphology changes slightly, with the appearance of certain roughness.

[0104] Example 16. Transmission electron microscopy (TEM) characterization of bacteriophage <j>-29 after negative staining

[0105] The morphology of the vines recovered after a virucidal assay similar to that of Example 12 was studied by TEM, comparing it with the bacteriophages recovered from the control filter. Briefly, 0.1 mL of phage diluent containing approximately 8x10 11 pfu is incubated on a 1x1 cm surface of P1 material (example 1). It is incubated at 25°C for 30 and 60 min. After treatment, the viruses are collected by washing with 900 pL of the phage diluent buffer (50 mM Tñs-HCI, pH 8; 10 mM MgCl2; 100 mM NaCl; 0.05% Tween-80®) and centrifuged for 5 min at 7500 rpm. The supernatant is recovered and 10 pL of it is mixed with 10 pL of 8% PFA to fix the vines for at least 20 minutes. The fixed vines are deposited on the ionized side of a grid and kept for 5 minutes to be absorbed. The sample is then washed with double-distilled water to remove salts, and finally stained with 0.2% uranyl acetate for 1 minute. Excess stain is removed by decanting onto filter paper. The grid is allowed to air dry and observed under a microscope.The microscope used was a Jeol JEM-1010 transmission electron microscope (Jeol) operated at an accelerating voltage of 80 kV and equipped with a Bioscan 792 digital camera (Gatan).

[0106] Figure 7 shows micrographs of the bacteria before and after treatment with the material from Example 10. Greater staining is observed in the virus after treatment, which seems to indicate a deterioration of the virion structure.< / j>

Claims

CLAIMS 1.- Catalytic material comprising one or more compounds of formula I: X n AND m I where: X represents Ni, Pd, Pt, Cu, Ag, Au, Zn, Cd, Ce or Hg; Y represents O, S, Se, Te, F, Cl, Br, I, -SCN or -SC; n represents an integer selected from 1 to 2; and m represents an integer selected from 1 to 3, deposited on a support, where the support is a ceramic support and the content of the compound of formula I is between 2 and 140 mmol of compound per gram of ceramic support; or where the support is a polymeric support and the content of the compound of formula I is between 0.008 and 0.250 mmol of compound per cm 2 polymeric support.

2. The catalytic material according to claim 1, wherein X represents Cu, Ni, Ag, Cd, Zn, Pd or Pt.

3. The catalytic material according to claims 1 or 2, wherein X represents Cu, Ni, or Zn.

4. The catalytic material according to any one of claims 1 to 3, wherein Y represents Cl, Br, I, O, S, SCN or SO4.

5. The catalytic material according to any one of claims 1 to 4, wherein Y represents Cl, Br, I, or SCN.

6. The catalytic material according to claims 1 to 5, wherein: X represents Cu, Ni or Zn; and Y represents Cl, Br, I, or SCN. 7.- The catalytic material according to any of claims 1 to 2 or 4, wherein the compound of formula I is selected from CuCl, CuCl2, CuBr, Cui, Cu2O, CuO, Cu2S, CuSCN, CuSO4 and Cu2SO4, NiCl2, Nil2, Agl, AgCl, Cdl2, Znl2, Pdl2 and Ptl2. 8.- The catalytic material according to claim 7, wherein the compound is selected from CuCh, CuBr, Cul, CuSCN, Nil2, and Znl2. 9.- Method for obtaining the catalytic material as defined in any of claims 1 to 8, comprising the following steps: i) impregnation of the support with a solution of a compound comprising one or more compounds of formula I: X n AND m I where: X represents Ni, Pd, Pt, Cu, Ag, Au, Zn, Cd, Ce or Hg; Y represents O, S, Se, Te, F, Cl, Br, I, -SCN or -SO4; n represents an integer selected from 1 to 2; and m represents an integer selected from 1 to 3, with a concentration of between 0.01 and 0.5 M of compound in an organic and / or aqueous solvent; and (i) heat treatment of the product obtained in step (i) at a temperature of between 25° C and 90° C to give rise to the catalytic material. 10.- Use of a catalytic material according to any of claims 1 to 8 for the inactivation of pathogens. 11.- The use of the catalytic material according to claim 10 where the pathogens are viruses, bacteria or fungi.

12. The use of the catalytic material according to claim 11, wherein the pathogens are viruses or bacteria. 13.- Catalytic filter comprising the catalytic material according to any of claims 1 to 8. 14.- The catalytic filter according to claim 13, wherein said filter is part of a air purifying device. 15.- The catalytic filter according to claim 14, wherein the air purifying device is personal protective equipment (PPE).

Images