Edible medium composition with excellent cell proliferation activity
An edible medium composition with specific amino acids, vitamins, and salts addresses the environmental and cost issues of current cell culture media, improving cell proliferation and reducing waste in cell-cultured food production.
Patent Information
- Application Number
- PCT/KR2025/003401
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-18
- Filing Date
- 2025-03-17
- Publication Date
- 2025-09-25
AI Technical Summary
Current cell culture media for producing cell-cultured foods are environmentally detrimental due to the use of expensive and energy-intensive pharmaceutical-grade materials, limiting their ability to meet the growing demand for protein and micronutrients while addressing environmental and animal welfare issues.
Development of an edible medium composition comprising specific amino acids, vitamins, and inorganic salts that enhance cell proliferation and inhibit aging, using ingredients that are safe for human consumption.
The edible medium composition improves cell proliferation activity and reduces environmental impact by utilizing food-safe, cost-effective ingredients, enhancing the production of cell-cultured foods.
Smart Images

Figure KR2025003401_25092025_PF_FP_ABST
Abstract
Description
Edible medium composition with excellent cell proliferation activity
[0001] The present invention relates to an edible medium composition having excellent cell proliferation activity.
[0002] According to a report by the Food and Agriculture Organization of the United Nations (FAO), the world's population is projected to increase from 7.6 billion in 2018 to 9.5 billion by 2050. However, due to climate change and other abnormalities, crop yields are expected to decline, while demand for feed grains is expected to increase, driving up production costs and shrinking production areas. Consequently, livestock products are expected to become a more expensive food source.
[0003] Animal-derived foods, such as livestock products, while expensive in terms of energy and production, are an excellent source of high-quality protein and micronutrients essential for normal human growth and health, contributing directly to human nutrition. Essential amino acids, in particular, are nutrients that cannot be synthesized in the body, or are synthesized in very small amounts, and therefore must be consumed through food. With demand for animal-derived foods projected to double to 550 million tons by 2050, traditional livestock production methods are limited in meeting the protein requirements to supply these essential amino acids.
[0004] Meanwhile, cell-cultured food products are part of an alternative food product that has been the focus of development by numerous companies worldwide as a means to address public health, environmental, and animal welfare issues associated with animal farming and agriculture.
[0005] The culture media currently used in cell culture foods use highly purified or refined growth media containing the necessary components to help plant or animal cells proliferate, and this method is similar to the biotechnology currently used in pharmaceutical manufacturing.
[0006] This suggests that because the media used to cultivate cell-cultured foods use expensive and energy-intensive pharmaceutical-grade materials and processes, more resources are used to purify the components included in the media, essentially making cell-cultured foods more environmentally detrimental.
[0007] Therefore, there is a need to develop edible media that can reduce the environmental impact in the future while simultaneously improving performance and lowering the cost of cell culture media.
[0008] The purpose of the present invention is to provide an edible medium composition having excellent cell proliferation activity.
[0009] In addition, another object of the present invention is to provide a food composition comprising cells cultured in the edible medium composition or a culture thereof.
[0010] In addition, another object of the present invention is to provide a method for producing cell culture food using the edible medium composition.
[0011] In addition, another object of the present invention is a method for increasing the proliferation activity of cells.
[0012] In addition, another object of the present invention is a method for inhibiting cellular aging.
[0013] In order to achieve the above purpose, the present invention provides a composition comprising at least one amino acid selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine and Valine; An edible medium composition having excellent cell proliferation activity is provided, comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
[0014] Next, the present invention provides a food composition comprising cells cultured in the edible medium composition or a culture thereof.
[0015] Next, the present invention provides a method for producing a cell cultured food product, comprising the steps of: culturing animal cells, plant cells, or microbial cells in an edible medium composition according to the present invention; and recovering the cultured cells or a culture thereof.
[0016] Next, the present invention relates to a cell comprising at least one amino acid selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine and Valine; A method for increasing cell proliferation activity is provided, comprising the step of culturing in a medium composition comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
[0017] Furthermore, the present invention provides a cell comprising at least one amino acid selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine, and Valine; A method for inhibiting senescence of a cell is provided, comprising the step of culturing in a medium composition comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
[0018] The edible medium composition according to the present invention has the effect of enhancing cell proliferation activity and inhibiting cell aging. Furthermore, since the edible medium of the present invention is composed of raw materials that can be literally eaten by humans, it can be usefully used as a culture medium for cell cultured foods. In addition, cells cultured in the edible medium composition of the present invention have the advantage of being both more food-safe and less expensive than cells cultured in conventional culture media.
[0019] Figure 1 is a diagram simply showing the edible process of a culture medium in one embodiment of the present invention.
[0020] Figure 2 is a diagram showing the results of comparing the shapes of bovine adipose stem cells according to culture media in one embodiment of the present invention.
[0021] FIG. 3 is a diagram showing the results of comparing the cell proliferation capacity of P3 adipose-derived stem cells according to culture media in one embodiment of the present invention.
[0022] FIG. 4 is a diagram showing the results of comparing the cell proliferation capacity of P4 adipose-derived stem cells according to culture media in one embodiment of the present invention.
[0023] FIG. 5 is a diagram showing the results of comparing the level of cell aging after long-term culture of adipose-derived stem cells according to culture medium in one embodiment of the present invention.
[0024] FIG. 6 is a diagram showing the results of comparing the expression levels of mesenchymal stem cell markers of adipose-derived stem cells according to culture media in one embodiment of the present invention.
[0025] Hereinafter, the present invention will be described in detail with reference to the attached drawings, using exemplary embodiments. However, the following exemplary embodiments are provided as illustrative examples of the present invention. If a detailed description of a technology or configuration well known to those skilled in the art is judged to unnecessarily obscure the gist of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the following claims and equivalents interpreted therefrom.
[0026] In addition, the terms used in this specification are terms used to appropriately express preferred embodiments of the present invention, and may vary depending on the intention of the user or operator, or the customs of the field to which the present invention belongs. Therefore, the definitions of these terms should be determined based on the contents throughout this specification. Throughout the specification, when a part is said to "include" a certain component, this does not mean that other components are excluded, but rather that other components may be included, unless specifically stated otherwise.
[0027] Throughout this specification, '%' used to indicate the concentration of a particular substance means solid / solid (w / w) %, solid / liquid (w / v) %, and liquid / liquid (v / v) %, unless otherwise stated.
[0028] Hereinafter, the present invention will be described in more detail.
[0029]
[0030] In one aspect, the present invention provides a composition comprising at least one amino acid selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine, and Valine; The present invention relates to an edible medium composition having excellent cell proliferation activity, comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
[0031] In one embodiment of the present invention, the arginine may be a substitute for arginine monohydrochloride, which is toxic when taken orally.
[0032] In one embodiment of the present invention, the cystine may be a substitute for cystine dihydrochloride, which may cause burns to the digestive tract and respiratory system when taken orally.
[0033] In one embodiment of the present invention, the tyrosine may be a substitute for tyrosine disodium salt dihydrate, which is toxic when taken orally.
[0034] In one embodiment of the present invention, the ferrous sulfate may be a substitute for iron (III) nitrate nonahydrate, which is toxic when taken orally.
[0035] In one embodiment of the present invention, the edible medium composition may further include a carbon source, but is not limited thereto.
[0036] In addition, the carbon source may be glucose, fructose, mannose, ribose, xylose, sucrose, melibiose, cellobiose, lactose, amylose, carbohydrate, raffinose, sorbitol, mannitol, glycerol, etc., and any substance known in the technical field to which the present invention pertains as a carbon source used as an energy source for cells included in a medium may be used without limitation.
[0037] In one embodiment of the present invention, the edible medium composition comprises 0.0255 to 0.0345 g / L of glycine, 0.0589 to 0.0798 g / L of L-arginine, 0.041 to 0.0556 g / L of L-cystine, 0.4964 to 0.6716 g / L of L-glutamine, 0.0263 to 0.0357 g / L of L-histidine, 0.0892 to 0.1208 g / L of L-isoleucine, 0.0892 to 0.1208 g / L of L-leucine, 0.1241 to 0.1679 g / L of L-lysine hydrochloride, 0.0255 to 0.0345 g / L of L-methionine, and 0.0561 to 0.1679 g / L of L-phenylalanine. 0.0759 g / L, L-serine 0.0357 to 0.0483 g / L, L-threonine 0.0807 to 0.1093 g / L, L-tryptophan 0.0136 to 0.0184 g / L, L-tyrosine 0.0612 to 0.0829 g / L, L-valine 0.0799 to 0.1081 g / L, choline chloride 0.0034 to 0.0046 g / L, calcium pantothenate 0.0034 to 0.0046 g / L, folic acid 0.0034 to 0.0046 g / L, inositol 0.0061 to 0.0083 g / L, nicotinamide 0.0034 to 0.0046 g / L, It may include 0.0034 to 0.0046 g / L of vitamin B6 hydrochloride, 0.0003 to 0.0005 g / L of vitamin B2, 0.0034 to 0.0046 g / L of vitamin B1 hydrochloride, 0.17 to 0.23 g / L of calcium chloride, 0.0003 to 0.0005 g / L of ferrous sulfate, 0.083 to 0.1124 g / L of magnesium sulfate, 0.34 to 0.46 g / L of potassium chloride, 3.145 to 4.255 g / L of sodium bicarbonate, 5.44 to 7.36 g / L of salt, 0.1062 to 0.1438 g / L of sodium monobasic phosphate, and 3.825 to 5.175 g / L of anhydrous crystalline glucose.
[0038] More preferably, the edible medium composition comprises 0.026 to 0.032 g / L of glycine, 0.06 to 0.07 g / L of L-arginine, 0.045 to 0.05 g / L of L-cystine, 0.5 to 0.6 g / L of L-glutamine, 0.027 to 0.032 g / L of L-histidine, 0.09 to 0.110 g / L of L-isoleucine, 0.09 to 0.110 g / L of L-leucine, 0.14 to 0.15 g / L of L-lysine hydrochloride, 0.028 to 0.032 g / L of L-methionine, 0.06 to 0.07 g / L of L-phenylalanine, 0.035 to 0.045 g / L of L-serine, L-threonine 0.09 to 0.1 g / L, L-tryptophan 0.015 to 0.017 g / L, L-tyrosine 0.07 to 0.08 g / L, L-valine 0.085 to 0.1 g / L, choline chloride 0.0038 to 0.0042 g / L, calcium pantothenate 0.0038 to 0.0042 g / L, folic acid 0.0038 to 0.0042 g / L, inositol 0.0065 to 0.0075 g / L, nicotinamide 0.0035 to 0.0042 g / L, vitamin B6 hydrochloride 0.0038 to 0.0045 g / L, vitamin B2 0.00038 to 0.00042 g / L, It may contain 0.0038 to 0.0042 g / L of vitamin B1 hydrochloride, 0.19 to 0.22 g / L of calcium chloride, 0.0004 to 0.00043 g / L of ferrous sulfate, 0.09 to 0.1 g / L of magnesium sulfate, 0.38 to 0.45 g / L of potassium chloride, 3.5 to 3.8 g / L of sodium bicarbonate, 6 to 6.6 g / L of salt, 0.11 to 0.13 g / L of sodium monophosphate, and 4 to 4.6 g / L of anhydrous crystalline glucose.
[0039] In one embodiment of the present invention, the edible medium composition may enhance cell proliferation activity and inhibit cell aging, but is not limited thereto.
[0040] In one embodiment of the present invention, the edible medium composition may be for culturing cell culture food.
[0041] The term “cell-cultured food” used in the present invention means a food produced or cultured using cells, and examples of cell-cultured foods include cell-cultured meat substitutes, proliferated lactic acid bacteria, and cell-cultured protein substitutes.
[0042] In one embodiment of the present invention, the cell cultured food may be, but is not limited to, cultured meat, fungus-based meat substitute, or algae-based meat substitute.
[0043] The term “cultured meat” used in the present invention means a meat substitute produced using cell culture technology, which is manufactured through a process of growing tissue or muscle using animal cells.
[0044] The term “fungal-based meat substitute” used in the present invention refers to a meat substitute produced by culturing fungi, produced using fungal cells or mycelia, and manufactured through cell culture technology or a fermentation process.
[0045] The term “algae-based meat substitute” used in the present invention refers to a meat substitute produced by culturing microalgae, and microalgae (e.g., chlorella and spirulina) are known to have a significantly higher growth rate, higher protein content, and better nutrient quality than terrestrial crops used as vegetable protein.
[0046]
[0047] In one aspect, the present invention relates to a food composition comprising cells cultured in the edible medium composition or a culture thereof.
[0048] In one embodiment of the present invention, the cell may be, but is not limited to, an animal cell, a plant cell, or a microbial cell.
[0049] In an embodiment of the present invention, it was confirmed that when adipose-derived stem cells were cultured using a medium composition according to the present invention, cell proliferation activity was significantly superior to that of DMEM.
[0050] The term “culture” used in the present invention means a product obtained after culturing cells, and includes both a form containing cultured cells and a form in which cultured cells have been removed.
[0051]
[0052] In one aspect, the present invention relates to a method for producing a cell cultured food product, comprising the steps of: culturing animal cells, plant cells, or microbial cells in the edible medium composition of claim 1; and recovering the cultured cells or a culture thereof.
[0053] The term “cultivation” used in this specification may be performed according to a cell culturing method commonly used in the technical field to which the present invention belongs.
[0054] Furthermore, the cell culture of the present invention can be performed using various methods established in industrial biotechnology, such as various fermentation methods established in industrial biotechnology. The edible medium composition according to the present invention can be used in continuous and discontinuous cell culture methods. Other known reactor technologies, such as perfusion technology, can also be utilized. A batch method is a preferred embodiment.
[0055] Batch cell culture includes fed-batch or simple batch culture. The term "fed-batch cell culture" refers to a cell culture in which mammalian cells and cell culture medium are initially supplied to the culture vessel, and additional culture nutrients are supplied to the culture continuously or in discontinuous increments during the culture process, with or without periodic harvesting of cells and / or products prior to the end of the culture. The term "simple batch culture" relates to a procedure in which all components for cell culture, including mammalian cells and cell culture medium, are supplied to the culture vessel at the beginning of the culture process.
[0056] According to a preferred embodiment of the present invention, the culture is fed in a fed-batch manner. This feeding is advantageous for replacing media components and nutrients depleted by the cells during the culture process. Typically, the feeding solution includes amino acids, one or more carbohydrates as an energy source, trace elements, vitamins, or specific ions. The feeding solution is added according to the needs of the cells, which are based on a predetermined schedule determined for a specific cell line, cell clone, and product, or are measured during the culture process. To prevent large volume increases and media dilution, the use of a concentrated feeding solution is particularly advantageous. In some embodiments, the use of two or more different feeding solutions may also be useful. This allows for the independent administration of two or more different groups of nutrients and components to the cells, thereby allowing for better adjustment of feeding conditions for optimal supply of specific nutrients.
[0057]
[0058] In one aspect, the present invention provides a cell comprising at least one amino acid selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine, and Valine; A method for increasing the proliferation activity of a cell, comprising: a step of culturing in a medium composition comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
[0059]
[0060] In one aspect, the present invention provides a cell comprising at least one amino acid selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine, and Valine; A method for inhibiting aging of a cell, comprising: a step of culturing in a medium composition comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
[0061] In one embodiment of the present invention, the medium composition comprises 0.0255 to 0.0345 g / L of glycine, 0.0589 to 0.0798 g / L of L-arginine, 0.041 to 0.0556 g / L of L-cystine, 0.4964 to 0.6716 g / L of L-glutamine, 0.0263 to 0.0357 g / L of L-histidine, 0.0892 to 0.1208 g / L of L-isoleucine, 0.0892 to 0.1208 g / L of L-leucine, 0.1241 to 0.1679 g / L of L-lysine hydrochloride, 0.0255 to 0.0345 g / L of L-methionine, and 0.0561 to 0.1679 g / L of L-phenylalanine. 0.0759 g / L, L-serine 0.0357 to 0.0483 g / L, L-threonine 0.0807 to 0.1093 g / L, L-tryptophan 0.0136 to 0.0184 g / L, L-tyrosine 0.0612 to 0.0829 g / L, L-valine 0.0799 to 0.1081 g / L, choline chloride 0.0034 to 0.0046 g / L, calcium pantothenate 0.0034 to 0.0046 g / L, folic acid 0.0034 to 0.0046 g / L, inositol 0.0061 to 0.0083 g / L, nicotinamide 0.0034 to 0.0046 g / L, It may include 0.0034 to 0.0046 g / L of vitamin B6 hydrochloride, 0.0003 to 0.0005 g / L of vitamin B2, 0.0034 to 0.0046 g / L of vitamin B1 hydrochloride, 0.17 to 0.23 g / L of calcium chloride, 0.0003 to 0.0005 g / L of ferrous sulfate, 0.083 to 0.1124 g / L of magnesium sulfate, 0.34 to 0.46 g / L of potassium chloride, 3.145 to 4.255 g / L of sodium bicarbonate, 5.44 to 7.36 g / L of salt, 0.1062 to 0.1438 g / L of sodium monobasic phosphate, and 3.825 to 5.175 g / L of anhydrous crystalline glucose.
[0062] More preferably, the medium composition comprises 0.026 to 0.032 g / L of glycine, 0.06 to 0.07 g / L of L-arginine, 0.045 to 0.05 g / L of L-cystine, 0.5 to 0.6 g / L of L-glutamine, 0.027 to 0.032 g / L of L-histidine, 0.09 to 0.110 g / L of L-isoleucine, 0.09 to 0.110 g / L of L-leucine, 0.14 to 0.15 g / L of L-lysine hydrochloride, 0.028 to 0.032 g / L of L-methionine, 0.06 to 0.07 g / L of L-phenylalanine, 0.035 to 0.045 g / L of L-serine, and L-threonine. 0.09 to 0.1 g / L, L-tryptophan 0.015 to 0.017 g / L, L-tyrosine 0.07 to 0.08 g / L, L-valine 0.085 to 0.1 g / L, choline chloride 0.0038 to 0.0042 g / L, calcium pantothenate 0.0038 to 0.0042 g / L, folic acid 0.0038 to 0.0042 g / L, inositol 0.0065 to 0.0075 g / L, nicotinamide 0.0035 to 0.0042 g / L, vitamin B6 hydrochloride 0.0038 to 0.0045 g / L, vitamin B2 0.00038 to 0.00042 g / L, vitamin B1 hydrochloride It may contain 0.0038 to 0.0042 g / L of sodium, 0.19 to 0.22 g / L of calcium chloride, 0.0004 to 0.00043 g / L of ferrous sulfate, 0.09 to 0.1 g / L of magnesium sulfate, 0.38 to 0.45 g / L of potassium chloride, 3.5 to 3.8 g / L of sodium bicarbonate, 6 to 6.6 g / L of salt, 0.11 to 0.13 g / L of sodium monobasic phosphate, and 4 to 4.6 g / L of anhydrous crystalline glucose.
[0063] In one embodiment of the present invention, the medium composition may further include a carbon source, but is not limited thereto.
[0064] In addition, the carbon source may be glucose, fructose, mannose, ribose, xylose, sucrose, melibiose, cellobiose, lactose, amylose, carbohydrate, raffinose, sorbitol, mannitol, glycerol, etc., and any substance known in the technical field to which the present invention pertains as a carbon source used as an energy source for cells included in a medium may be used without limitation.
[0065] In one embodiment of the present invention, the cell may be, but is not limited to, an animal cell, a plant cell, or a microbial cell.
[0066]
[0067] Hereinafter, embodiments of the present invention will be described in more detail with reference to the attached drawings. However, the following embodiments are intended only to concretize the contents of the present invention and are not intended to limit the present invention.
[0068]
[0069] <Preparation Example> Isolation of adipose-derived mesenchymal stem cells
[0070] 2.2 g of bovine subcutaneous fat was separated and thoroughly washed with DPBS (Gibco) to remove blood. The tissue was finely chopped using forceps / scissors, and collagenase (collagenase (Sigma)) was added to the tissue and shaken at 37℃. When the tissue was completely digested and single cells were visible, the enzyme reaction was stopped by adding an equal volume of FBS. To isolate some tissue that was not digested, the tissue digest was filtered through a 100 μm nylon mesh and then again through a 70 μm mesh to obtain only pure single cells. After centrifugation (1500 rpm, 5 min), the cell pellet for autologous adipose tissue stem cells (Stromal Vascular Fraction, SVF) was obtained, and this was cultured in a culture flask (FALCON).
[0071]
[0072] <Example 1> Development of edible medium
[0073] Referring to Figure 1, an edible medium was developed by replacing non-edible components of Basal media (Gibco), which is commercially sold as a cell culture medium, with edible components.
[0074] Existing basal media for cell culture have all their components publicly available. However, each component is a combination of reagents developed for research purposes, making it difficult to directly apply cells cultured in these media to food applications. Therefore, to manufacture an edible medium, we sought to replace non-edible components with edible ones based on the composition of the basal media. However, some components were not developed for edible use and thus unusable. For these components, we searched for edible analogs, manufactured media, and tested their cell proliferation activity.
[0075] Finally, the edible medium developed in the present invention was named SPEM (Simple planet Edible Medium), and the composition of the edible medium is shown in Table 1.
[0076]
[0077] Type Ingredient Name Content (g / L) Amino Acid Glycine 0.03L - Arginine 0.06938L - Cystine 0.048329L - Glutamine 0.584L - Histidine 0.031L - Isoleucine 0.105L - Leucine 0.105L - Lysine Hydrochloride 0.146L - Methionine 0.03L - Phenylalanine 0.066L - Serine 0.042L - Threonine 0.095L - Tryptophan 0.016L - Tyrosine 0.07207L - Valine 0.09 4 Vitamins Choline Chloride 0.004 Calcium Pantothenate 0.004 Folic Acid 0.004 Inositol 0.0072 Nicotinamide 0.004 Vitamin B6 Hydrochloride 0.004 Vitamin B2 0.0004 Vitamin B1 Hydrochloride 0.004 Inorganic Salts Calcium Chloride 0.2 Ferrous Sulfate 0.0004 17 Magnesium Sulfate 0.097 67 Potassium Chloride 0.4 Sodium Bicarbonate 3.7 Refined Salt 6.4 Monosodium Phosphate 0.125 Other Anhydrous Crystalline Glucose 4.5 Refined Water up to 1L
[0078]
[0079] <Experimental Example 1> Comparison of the morphology of P2 bovine adipose stem cells
[0080] In order to confirm the cell growth pattern of the edible medium manufactured in Example 1, passage 2 (P2) bovine adipose-derived stem cells were seeded in the edible medium (SPEM) of Example 1 or DMEM (Dulbecco's Modified Eagle Medium, Gibco), and cell attachment, proliferation rate, and morphology were observed visually. Each medium was prepared by adding FBS (10%, Gibco) + Antibiotic Antimycotic solution (1%, Sigma) to DMEM or Edible media. For attachment, the two conditions were compared on day 1 after seeding, and the proliferation rate was compared for 3-4 days. On day 1 after seeding, attachment of the order of RUO was observed, and the proliferation rate was similar. When the cells were 90% confluent, Trypsin EDTA (Welgene) was treated, incubated at 37℃ for 2 minutes, and FBS was added to inhibit the enzyme reaction. Detached cells were collected in a 15 ml tube, centrifuged (1500 rpm, 5 min) to obtain cells, and washed once with DPBS. After obtaining the cell pellet, only viable cells were counted through Trypan blue staining to confirm the total cell number.
[0081] As a result, as shown in Fig. 2, when comparing cell attachment, proliferation, and shape of the existing DMEM and the edible medium of Example 1 during the culture of adipose-derived mesenchymal stem cells, it was confirmed that the initial cell attachment and proliferation showed similar patterns to the existing medium, but the size of the cells cultured in the edible medium of Example 1 remained smaller than that of the cells cultured in DMEM.
[0082]
[0083] <Experimental Example 2> Comparison of the proliferation capacity of P3 bovine adipose stem cells
[0084] In order to confirm the cell proliferation ability of the edible medium manufactured in Example 1, passage 3 (P3) bovine adipose-derived stem cells were subcultured and 3 × 10 were seeded in a 100 mm dish (falcon). 5 Each cell was seeded and cultured in the edible medium (SPEM) or DMEM (Dulbecco's Modified Eagle Medium, Gibco) of Example 1, and the shape and size of the cells were observed visually. The number of cells was counted and PDT (Population doubling time) was measured using the same method as in Experimental Example 1.
[0085] As a result of culturing P3 adipose-derived stem cells, as shown in Fig. 3, in the case of DMEM, the cells were long and some aged cells were observed during culture, whereas in the case of the edible medium (SPEM) of Example 1, the cells were small and showed rapid proliferation ability. In addition, the cell number counting result showed that DMEM had 9.9 × 10 5 , the edible medium (SPEM) of Example 1 was 1.26×10 6 In SPEM, approximately 27% more cell numbers were observed than in DMEM, and PDT was also measured to be lower in SPEM.
[0086] Stem cells are characterized by their small size and rapid proliferation, which are considered highly active. This confirms that stem cells cultured in the edible medium developed in this invention maintain high activity.
[0087]
[0088] <Experimental Example 3> Comparison of the proliferation capacity of P4 bovine adipose stem cells
[0089] In order to confirm the cell proliferation ability of the edible medium manufactured in Example 1, 2×10 passage 4 (P4) bovine adipose-derived stem cells 5 / 100 mm plates and cultured in the edible medium (SPEM) of Example 1 or DMEM (Dulbecco's Modified Eagle Medium, Gibco). Afterwards, the shape and size of the cells were observed visually, and the number of cells was counted using the same method as in Experimental Example 1, and PDT (Population Doubling Time) was measured.
[0090] As a result of culturing P4 adipose-derived stem cells, as shown in Fig. 4, in the case of DMEM, the cells were long and some senescent cells were observed during culture, whereas in the case of the edible medium (SPEM) of Example 1, the cells were small and showed rapid proliferation ability. In particular, in terms of cell yield during the same culture period, the edible medium (SPEM) of Example 1 was able to secure a 44% increase in the number of cells, which is expected to be due to the small number of senescent cells and low PDT.
[0091]
[0092] <Experimental Example 4> Comparison of aging of bovine adipose stem cells
[0093] In cells cultured in DMEM, cell size increased with passage, but this phenomenon was barely observed in edible media. To determine whether this difference was due to differences in the rate of cell aging, staining for cell aging markers was performed.
[0094] In order to confirm the degree of aging of cells cultured in the edible medium prepared in Example 1, bovine adipose-derived stem cells were cultured for a long period of time in the edible medium (SPEM) of Example 1 or DMEM (Dulbecco's Modified Eagle Medium, Gibco), and then senescent cells were confirmed using a Beta-galactosidase assay.
[0095] For staining, cells were seeded at 1×10 in a 6-well plate. 5After seeding, the cells were cultured in each medium, and when more than 90% confluent, the culture medium was discarded and washed with 2 ml of DPBS. 2 ml of 1X Fixing Buffer (diluted the 10X Fixing buffer with deionized H2O, 1:10) was added, the cells were fixed for 10 minutes at room temperature, and then washed twice with 2 ml of DPBS. 2 ml of X-gal staining mix was added, and after incubation at 37°C for 12 hours, the number of stained cells was measured using an optical microscope.
[0096] As a result, as shown in Fig. 5, it was confirmed that the cells cultured in the edible medium of Example 1 showed a senescence level that was approximately 50% reduced compared to the senescence level of the cells cultured in GM.
[0097]
[0098] <Experimental Example 5> Comparison of Mesenchymal Stem Cell Marker Expression
[0099] Bovine adipose-derived stem cells are a type of mesenchymal stem cells, and ISCT designates three markers (CD73, CD90, CD105) as essential expression markers.
[0100] In order to confirm whether the adipose-derived stem cells cultured in the edible medium prepared in Example 1 above maintain stem cell characteristics, P4 bovine-derived adipose stem cells were cultured in the edible medium (SPEM) of Example 1 or DMEM (Dulbecco's Modified Eagle Medium, Gibco), and the mRNA of each cell (GM, SPEM) was used as a template to perform RT-PCR using a primer set targeting CD73, CD90, and CD105, known as mesenchymal stem cell markers, to measure the mRNA expression levels of the markers.
[0101] Specifically, after cell seeding, confluent cells were harvested and the number of cells was 5-10 × 10 61 ml of Trizol (15596026, TRIzol™ Reagent, Invitrogen) was added and incubated at room temperature for 5 minutes. 0.2 ml of chloroform was added and mixed by inverting, incubated at room temperature for 5 minutes, and then centrifuged at 14,000 × g, 4 ° C for 20 minutes. The colorless transparent supernatant was transferred to a new tube, 0.5 ml of isopropanol was added, incubated at room temperature for 10 minutes, and then centrifuged at 14,000 × g, 4 ° C for 10 minutes. The supernatant was discarded, 1 ml of 75% ethanol was added, and centrifuged at 14,000 × g, 4 ° C for 5 minutes. The supernatant was discarded and dried for 5-10 minutes with the tube lid open. The RNA pellet was dissolved in 20 μl of RNase-free water, and the RNA concentration was calculated by measuring the absorbance at 260 nm using a microvolume spectrophotometer (ND-ONEC, NanoDrop™ One / OneC Microvolume UV / VIS Spectrophotometer, Thermo Fisher Scientific). 1 μg of RNA was synthesized using a cDNA synthesis kit (18080051, SuperScript™ III First-Strand Synthesis System, Invitrogen).1 μl of synthesized cDNA was mixed with CD90 (Forward: TTGTAGCAGGTGTGGTTGCT (SEQ ID NO: 1), Reverse: TTTCACCCGTGTCCCATTTG (SEQ ID NO: 2)), CD73 (Forward: AAGGTTCCTGTGGTCCAGGCCT (SEQ ID NO: 3), Reverse: TGCATTCTCGAAAGCGGCAGGA (SEQ ID NO: 4)), CD105 (Forward: GAGCCTTCGTCTAGACTGCC (SEQ ID NO: 5), Reverse: CTGGCCTAGTGACCCCATTG (SEQ ID NO: 6)) primers and SYBR Green Master mix (A25918, PowerUp™ SYBR™ Green MasterMix, Applied Biosystems™) and the mRNA expression level was confirmed using a PCR machine (A28572, QuantStudio™ 3 Real-Time PCR System, Applied Biosystems™).
[0102] As a result, as shown in Fig. 6, it was confirmed that the cells cultured in the edible medium of Example 1 had significantly higher mRNA expression levels of CD73, CD90, and CD105 compared to the cells cultured in GM.
[0103]
[0104] Through these results, it was confirmed that when culturing cells in the edible medium developed in the present invention, cell proliferation activity is improved and cell aging is suppressed compared to a commonly used medium. In addition, since the edible medium of the present invention is composed only of edible ingredients, it can be usefully utilized as a culture medium for cell culture food.
[0105]
[0106] As described above, specific embodiments of the present invention have been described in detail. However, those skilled in the art who understand the spirit of the present invention will be able to easily suggest other inventions that are backwards or other embodiments included within the scope of the spirit of the present invention by adding, changing, or deleting other components within the scope of the same spirit. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention is indicated by the scope of the claims described below rather than the detailed description described above, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.
Claims
1. At least one amino acid selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine, and Valine; An edible medium composition having excellent cell proliferation activity, comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
2. In paragraph 1, An edible medium composition having excellent cell proliferation activity, characterized in that the edible medium composition further comprises a carbon source.
3. In paragraph 2, An edible medium composition having excellent cell proliferation activity, characterized in that the carbon source is at least one selected from the group consisting of glucose, fructose, mannose, ribose, xylose, sucrose, melibiose, cellobiose, lactose, amylose, carbohydrate, raffinose, sorbitol, mannitol, and glycerol.
4. In paragraph 1, The above edible medium composition is an edible medium composition having excellent cell proliferation activity, which enhances cell proliferation activity and inhibits cell aging.
5. In paragraph 1, The above edible medium composition is an edible medium composition having excellent cell proliferation activity, characterized in that it is for culturing cell culture food.
6. In paragraph 5, An edible medium composition having excellent cell proliferation activity, characterized in that the cell cultured food is cultured meat, fungus-based meat substitute, or algae-based meat substitute.
7. A food composition comprising cells cultured in the edible medium composition of paragraph 1 or a culture thereof.
8. In paragraph 7, A food composition, characterized in that the above cells are animal cells, plant cells or microbial cells.
9. A step of culturing animal cells, plant cells or microbial cells in the edible medium composition of claim 1; and A method for producing a cell cultured food product, comprising: a step of recovering cultured cells or a culture thereof.
10. One or more amino acids selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine, and Valine; A method for increasing cell proliferation activity, comprising: a step of culturing in a medium composition comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
11. One or more amino acids selected from the group consisting of Glycine, Arginine, Cysteine, Glutamine, Histidine, Isoleucine, Leucine, Lysine Hydrochloride, Methionine, Phenylalanine, Serine, Threonine, Tryptophan, Tyrosine, and Valine; A method for inhibiting aging of a cell, comprising: a step of culturing in a medium composition comprising at least one vitamin selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and at least one inorganic salt selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.
Citation Information
Patent Citations
Insect cell culture medium
CN106834203A
Nutritional medium for producing slaughter-free meat
CN115989318A
Medium composition, kit, mesenchymal stem cell composition production method, mesenchymal stem cell composition, mesenchymal stem cell, cell culture supernatant, and extracellular vesicle
JP2021040551A
Enriched medium for hutc growth
JP6404227B2
Apparatus and method for allocating resources by applying adaptive dynamic spectrum sharing in wireless communication system
KR1020250045105A