Systems and methods for delivery of crispr-CAS gene editing machinery
AAV vectors with distinct promoters and gRNAs effectively excise or invert viral sequences, addressing safety and efficacy challenges in CRISPR-Cas gene delivery systems for HIV and HSV, improving packaging efficiency and therapeutic outcomes.
Patent Information
- Application Number
- PCT/US2025/020459
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-19
- Filing Date
- 2025-03-18
- Publication Date
- 2025-09-25
AI Technical Summary
Current CRISPR-Cas gene delivery systems face challenges in achieving efficient and safe delivery of multiplexed vectors for viral excision, particularly in the context of HIV and HSV, with issues such as increased safety risks, reduced efficacy, and recombination of homologous sequences leading to decreased packaging efficiency.
Design of AAV vectors with distinct pol III promoters and gRNAs targeting different sites within the viral genome to efficiently excise or invert regions, minimizing recombination and enhancing packaging efficiency.
The AAV vectors achieve efficient excision or inversion of viral sequences, reducing recombination and improving packaging efficiency while maintaining strong expression of CRISPR-Cas endonuclease and gRNAs, thereby enhancing therapeutic efficacy.
Smart Images

Figure US2025020459_25092025_PF_FP_ABST
Abstract
Description
SYSTEMS AND METHODS FOR DELIVERY OF CRISPR-CAS GENE EDITINGMACHINERYCROSS-REFERENCE
[0001] This application claims the benefit of U. S. Provisional Patent Application No. 63 / 567,374, filed on March 19, 2024, and U. S. Provisional Patent Application No. 63 / 567,371, filed on March 19, 2024, which are incorporated herein by reference in its entirety .BACKGROUND
[0002] Gene editing systems have the potential to treat an array of diseases, however, one of the major challenges facing their implementation is improving the rate and efficacy of delivery of gene editing machinery. The development of safe and efficient systems and methods for delivery of gene editing systems is important for the broad implementation of genome-editing technologies in the treatment of disease. The challenges of developing safe and effective systems and methods for delivery of genomeediting technologies differs from that facing classical gene replacement therapy, which requires long-term transgene expression and does not involve nucleobase or genome editing.SUMMARY
[0003] Adeno-associated virus (AAV) vectors can effectively deliver CRISPR-Cas gene editing systems to a cell; however, such CRISPR-Cas systems are generally directed to targeting a single target site within a cell. Moreover, if CRISPR-Cas systems are multiplexed (e.g. , designed to target two different target sites), such systems are generally (1 ) limited use two or more delivery vectors to achieve effective delivery, and (2) aimed and / or limited to the generation of multiple, independent indels. Administering multiple vectors simultaneously can limit dose effectiveness while increasing safety risks, and in the context of viral inactivation, the generation of indels is often insufficient to achieve viral inactivation.
[0004] In contrast to indel generation, excision of viral sequences (e.g., deletion of >500 nucleobase pairs, >1 ,000 nucleobase pairs, inter-gene regions, etc.) using multiplexed CRISPR-Cas systems targeting and cutting at two different target sites provides a more efficient platform for effective viral inactivation. However, current CRISPR-Cas gene delivery strategies do not (1 ) account forthe optimization of excision in the design of viral vector, and / or (2) demonstrate an understanding of the relationship between vector design and achieving effective and efficient excision of a viral sequence.
[0005] Additional challenges in the generation of multiplexed CRISPR-Cas AAV vectors arise in the manufacturability of such vectors for therapeutic applications. In certain instances, repeated sequence elements (e.g., gRNA scaffold sequences) can lead to increased recombination of homologous sequences within the viral vector. This can then recombination result in decreased packaging efficiencies of the full length vector, and ultimately, decreased efficacy of the therapeutic. Moreover, recombination of components within multiplexed CRISPR-Cas systems can be independent of the arrangement of vector elements (e.g., recombination of homologous promoter and guide sequences can be independent to the distance between the two promoters and guide sequences)
[0006] Provided in some instances herein are viral vectors useful and advantageous for efficient excision and / or inactivation of viruses using multiplexed CRISPR-Cas systems targeting two target sites for excision. Further, p rovided in some instances herein are viral vectors useful and advantageous for efficient HIV- 1 or HSV excision and / or inactivation using multiplexed CRISPR-Cas systems targeting two different target sites for excision. Moreover, in some instances, AAV viral vectors provided herein exhibit reduced recombination of vector elements and improved packaging of full length vectors.
[0007] In some embodiments, an AAV vector provided herein comprises a nucleic acid molecule comprising: a sequence encoding a CRISPR-Cas endonuclease; a firstpol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule); and a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein: (i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter); (ii) the first gRNA and the second gRNA are different (e.g., having a non -identical sequence); (iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the firsttarget site and generates a first cleaved region; and (iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the second target site and generates a second cleaved region; thereby excising or inverting a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region.
[0008] In some embodiments, an AAV vector provided herein comprises a nucleic acid molecule comprising: a sequence encoding a CRISPR-Cas endonuclease; a firstpol III promoterand a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule); and a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein: (i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter); (ii) the first gRNA and the second gRNA are different (e.g., having a non -identical sequence); (iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the first target site and generates a first cleaved region comprising a first nucleic acid sequence; and (iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the second target site and generates a second cleaved region comprising a second nucleic acid sequence having microhomology to the first nucleic acid sequence. In certain embodiments, the first cleaved region and the second cleaved region comprising the first and second nucleic acid sequences having microhomology, results in the excision of a region of the template nucleic acid molecule between the first and second nucleic acid sequences having microhomology. In certain embodiments, the first pol III promoter and the second pol III promoter are different.
[0009] In some embodiments, an AAV vector provided herein comprises a nucleic acid molecule. In some embodiments, the AAV vector comprises a sequence encoding a CRISPR-Cas endonuclease. In some embodiments, the sequence encoding the CRISPR-Cas endonuclease is a full-length coding region of a CRISPR-Cas endonuclease. In some embodiments, the sequence encoding the full-length coding region of the CRISPR-Cas endonuclease encodes a Cas9 endonuclease. In some embodiments, the sequence encoding the full-length coding region of the CRISPR-Cas endonuclease encodes a CasX endonuclease.
[0010] In some embodiments, the AAV vector comprises a sequence encoding a first guide RNA (gRNA). In some embodiments, the AAV vector comprises a sequence encoding a second gRNA.
[0011] In some embodiments, the AAV vector comprises one or more promoters. In some embodiments, the AAV vector comprises a promoter operably linked to each coding sequence (e.g., a sequence encoding a CRISPR-Cas endonuclease or gRNA). In some embodiments, the AAV vector comprises a promoter operably linked to a sequence encoding a CRISPR-Cas endonuclease. In some embodiments, the AAV vector comprises a promoter operably linked to asequence encoding a first gRNA. In some embodiments, the AAV vector comprises a promoter operably linked to a sequence encoding a second gRNA.
[0012] In some embodiments, the promoter operably linked to the sequence encoding the CRISPR-Cas endonuclease is different from the promoter operably linked to the sequence encodingthe first gRNA and / or the sequence encoding the second gRNA (e.g., a different type of promoter). In some embodiments, the promoter operably linked to the sequence encoding the CRISPR-Cas endonuclease is a pol II promoter. In some embodiments, the promoter operably linked to the sequence encodingthe first gRNA is a pol III promoter. In some embodiments, the promoter operably linked to the sequence encodingthe second gRNA is a pol III promoter. In some embodiments, the pol III promoter operably linked to the first gRNA is different from the pol III promoter operably linked to the second gRNA (e.g., a pol III promoter with a different sequence).
[0013] In some embodiments, the first gRNA comprises a spacer sequence. In some embodiments, the spacer sequence of the first gRNA can hybridize to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule). In some embodiments, the second gRNA comprises a spacer sequence. In some embodiments, the spacer sequence of the second gRNA can hybridize to a second target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule).
[0014] In some embodiments, the first gRNA and the second gRNA are different (e.g., having non-identical sequences). In some embodiments, the spacer sequence of the first gRNA and the spacer sequence of the second gRNA are different (e.g., having non-identical sequences). In some embodiments, the first target site on the template nucleic acid molecule and the second target site on the template nucleic acid molecule are different (e.g., having non-identical sequences).
[0015] In some embodiments, expression of a first gRNA and a CRISPR-Cas endonuclease results in cleavage of a template nucleic acid molecule within or proximate to a first target stie on thetemplate nucleic acid molecule and generation of a first cleaved region. In some embodiments, cleavage of the template nucleic acid molecule proximate to the first target site on the template nucleic acid molecule is cleavage within a distance of about 1, 2, 3, 4, 5, 10, 15, or 20 nucleobase positions from the first target site on the template nucleic acid molecule.
[0016] In some embodiments, expression of a second gRNA and a CRISPR-Cas endonuclease results in cleavage of a template nucleic acid molecule within or proximate to a second target site on the template nucleic acid and generation of a second cleaved region. In some embodiments, cleavage of the template nucleic acid molecule proximate to the second target site on the template nucleic acid molecule is cleavage within a distance of about 1, 2, 3, 4, 5, 10, 15, or 20 nucleobase positions from the second target site on the template nucleic acid molecule.
[0017] In some embodiments, generation of a first cleaved region of a template nucleic acid molecule and generation of a second cleaved region of the template nucleic acid molecule results in excision of a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region. In some embodiments, generation of a first cleaved region of a template nucleic acid molecule and generation of a second cleaved region of the template nucleic acid molecule results in inversion of a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region. In some embodiments, a first cleaved region generated from expression of a first gRNA and a CRISPR-Cas endonuclease and cleavage of a template nucleic acid molecule within or proximate to a first target site comprises a first nucleic acid sequence. In some embodiments, a second cleaved region generated from expression of a second gRNA and a CRISPR-Cas endonuclease and cleavage of a template nucleic acid molecule within or proximate to a second target site comprises a second nucleic acid sequence. In some embodiments, the second nucleic acid sequence has microhomology to the first nucleic acid sequence. In some embodiments, generatingthe first cleaved region and the second cleaved region comprising the first nucleic acid sequence and the second nucleic acid sequence having microhomology results in the excision of a region of the template nucleic acid molecule between the first nucleic acid sequence and the second nucleic acid sequence having microhomology.
[0018] In some embodiments, an AAV vector provided herein comprises a nucleic acid molecule comprising: a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease; a first pol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule); and a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein: (i) the first pol III promoter and the second pol III promoter are different (e.g., not the same pol III promoter); (ii) the first gRNA and the second gRNA are different (e.g., having a nonidentical sequence); (iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the first target site and generates a first cleaved region; and (iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the second target site and generates a second cleaved region; thereby excising or inverting a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region.
[0019] In some embodiments, an AAV vector provided herein comprises a nucleic acid molecule comprising: a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease;a first pol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule); and a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein: (i) the first pol III promoter and the second pol III promoter are different (e.g., notthe same promoter); (ii) the first gRNA and the second gRNA are different (e.g., having a nonidentical sequence); (iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the first target site and generates a first cleaved region comprising a first nucleic acid sequence; and (iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the second target site and generates a second cleaved region comprising a second nucleic acid sequence having microhomology to the first nucleic acid sequence. In certain embodiments, the first cleaved region and the second cleaved region comprising the first and second nucleic acid sequences having microhomology, results in the excision of a region of the template nucleic acid molecule between the first and second nucleic acid sequences having microhomology. In certain embodiments, the first pol III promoter and the second pol III promoter are different.
[0020] In some embodiments, an AAV vector provided herein comprises a nucleic acid molecule. In some embodiments, the AAV vector comprises a sequence encoding a CRISPR-Cas endonuclease. In some embodiments, the nucleic acid sequence encoding the CRISPR-Cas endonuclease is a full-length coding region of a CRISPR-Cas endonuclease. In some embodiments, the sequence encoding the full-length coding region of the CRISPR-Cas endonuclease encodes a Cas9 endonuclease. In some embodiments, the sequence encoding the full-length coding region of the CRISPR-Cas endonuclease encodes a CasX endonuclease.
[0021] In some embodiments, the AAV vector comprises a sequence encoding a first guide RNA (gRNA). In some embodiments, the AAV vector comprises a sequence encoding a second gRNA.
[0022] In some embodiments, the AAV vector comprises one or more promoters. In some embodiments, the AAV vector comprises a promoter operably linked to each coding sequence (e.g., a sequence encoding a CRISPR-Cas endonuclease or gRNA). In some embodiments, the AAV vector comprises a pol II promoter operably linked to a sequence encoding a CRISPR-Cas endonuclease. In some embodiments, the AAV vector comprises a pol III promoter operablylinked to a sequence encoding a first gRNA. In some embodiments, the AAV vector comprises a pol III promoter operably linked to a sequence encoding a second gRNA.
[0023] In some embodiments, the pol III promoter operably linked to the first gRNA is different from the pol III promoter operably linked to the second gRNA (e.g., a pol III promoter with a different sequence).
[0024] In some embodiments, the first gRNA comprises a spacer sequence. In some embodiments, the spacer sequence of the first gRNA can hybridize to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule). In some embodiments, the second gRNA comprises a spacer sequence. In some embodiments, the spacer sequence of the second gRNA can hybridize to a second target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule).
[0025] In some embodiments, the first gRNA and the second gRNA are different (e.g., having non-identical sequences). In some embodiments, the spacer sequence of the first gRNA and the spacer sequence of the second gRNA are different (e.g., having non-identical sequences). In some embodiments, the first target site on the template nucleic acid molecule and the second target site on the template nucleic acid molecule are different (e.g., having non-identical sequences).
[0026] In some embodiments, expression of a first gRNA and a CRISPR-Cas endonuclease results in cleavage of a template nucleic acid molecule within or proximate to a first target stie on the template nucleic acid molecule and generation of a first cleaved region. In some embodiments, cleavage of the template nucleic acid molecule proximate to the first target site on the template nucleic acid molecule is cleavage within a distance of about 1, 2, 3, 4, 5, 10, 15, or 20 nucleobase positions from the first target site on the template nucleic acid molecule.
[0027] In some embodiments, expression of a second gRNA and a CRISPR-Cas endonuclease results in cleavage of a template nucleic acid molecule within or proximate to a second target site on the template nucleic acid and generation of a second cleaved region. In some embodiments, cleavage of the template nucleic acid molecule proximate to the second target site on the template nucleic acid molecule is cleavage within a distance of about 1, 2, 3, 4, 5, 10, 15, or 20 nucleobase positions from the second target site on the template nucleic acid molecule.
[0028] In some embodiments, generation of a first cleaved region of a template nucleic acid molecule and generation of a second cleaved region of the template nucleic acid molecule results in excision of a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region. In some embodiments, generation of a first cleaved region of a template nucleic acid molecule and generation of a second cleaved region of the template nucleic acid molecule results in inversion of a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region.
[0029] In some embodiments, provided herein is an AAV vector comprising a nucleic acid molecule comprising: a sequence encoding a CRISPR-Cas endonuclease; a first pol III promoter and a sequence encoding a first gRNA; and a second pol III promoter and a sequence encoding a second gRNA, wherein: the first pol III promoter and the second pol III promoter are different; and the first gRNA and second gRNA are different.
[0030] In some embodiments, provided herein is an AAV vector comprising a nucleic acid molecule comprising: a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease; a first pol III promoter and a sequence encoding a first gRNA; and a second pol III promoter and a sequence encoding a second gRNA. In some embodiments, the first pol III promoter and the second pol III promoter are different (e.g., having a different sequence). In some embodiments, the first gRNA and second gRNA are different (e.g., having a different sequence).
[0031] Provided herein in some embodiments is an AAV vector comprising a nucleic acid molecule comprising from 5 ’ to 3 ’ : a first pol III promoter and a sequence encoding a first gRNA; a second pol III promoter and a sequence encoding a second gRNA; and a sequence encoding CRISPR-Cas endonuclease, wherein the first gRNA and second gRNA are different.
[0032] Provided herein in some embodiments is an AAV vector comprising a nucleic acid molecule comprising from 5 ’ to 3 ’ : a first pol III promoter and a sequence encoding a first gRNA; a second pol III promoter and a sequence encoding a second gRNA; and a pol II promoter and a sequence encoding CRISPR-Cas endonuclease. In some embodiments, the first gRNA and second gRNA are different (e.g., having a different sequence). In some embodiments, the first pol III promoter and the second pol III promoter are different (e.g., having a different sequence).
[0033] In some embodiments, the first pol III promoter is operably linked to the sequence encoding the first gRNA (e.g. , located 5 ’ and capable of promoting transcription); and the second pol III promoter is operably linked to the sequence encoding the second gRNA (e.g., located 5 ’ and capable of promoting transcription). In certain embodiments, the pol III promoter comprises 300 base pairs or less.
[0034] In some embodiments, the nucleic acid molecule comprises a pol II promoter operably linked to the sequence encoding CRISPR-Cas endonuclease. In certain embodiments, the pol II promoter is selected from Table 1 . In certain embodiments, the pol II promoter comprises a mini CMV promoter.
[0035] In some embodiments, the first pol III promoter and second pol III promoter are selected from Table 2. In certain embodiments, the first pol III promoter is a U6promoter or 7 SK promoter, and the second pol III promoter is a U6 promoter or 7SK promoter.
[0036] In some embodiments, the nucleic acid molecule comprises a polyA sequence operably linked to the sequence encoding CRISPR-Cas endonuclease, wherein the polyA sequence is 150 base pairs or less.
[0037] In some embodiments, the first gRNA comprises a first spacer sequence and a first scaffold sequence; and the second gRNA comprises a second spacer sequence and a second scaffold sequence.
[0038] In some embodiments, the first spacer sequence and the second spacer sequence are different; and the first scaffold sequence and the second scaffold sequence are the same sequence. In some embodiments, the first spacer sequence and the second spacer sequence are different; and the first scaffold sequence and the second scaffold sequence are different.
[0039] In some embodiments, the CRISPR-Cas endonuclease is a Type 2 CRISPR- Cas endonuclease. In some embodiments, the CRISPR-Cas endonuclease is a Type 2-II CRISPR-Cas endonuclease or Type 2 -V CRISPR-Cas endonuclease. In some embodiments, the CRISPR-Cas endonuclease is a Cas9 or CasX.
[0040] In some embodiments, the first gRNA hybridizes to a first target nucleic acid sequence within the LTR of an HIV nu cleic acid molecule; and the second gRNA hybridizes to a second target nucleic acid sequence within the gag gene of the HIV nucleic acid molecule.
[0041] In some embodiments, the first gRNA hybridizes to a first target nucleic acid sequence within a first immediate early (alpha) gene region of the HSV nucleic acid molecule. In some embodiments, the second gRNA hybridizes to a second target nucleic acid sequence within a second immediate early (alpha) gene region of the HS V nucleic acid molecule. In some embodiments, the first gRNA hybridizes to a first target nucleic acid with the ICP0 region of an HSV nucleic acid molecule; and the second gRNA hybridizes to a second target nucleic acid sequence within the ICP27 region of the HSV nucleic acid molecule.
[0042] In some embodiments, provided herein is a plasmid comprising a nucleic acid molecule provided herein and a stuffer sequence, wherein the plasmid has at least 5,000 or greater base pairs. In certain embodiments, the stuffer sequence has atleast 2,500 base pairs. In certain embodiments, the stuffer sequence has 30% or greater sequence identity to SEQ ID NO : 47.
[0043] In some embodiments, provided herein is a method of excising or inverting a target nucleic acid molecule from a template nucleic acid molecule in a cell, the method comprising: (a) contacting the cell with an AAV vector provided herein; (b) cutting the template nucleic acid molecule at a first cleavage site; (c) cutting the template nucleic acid molecule at a second cleavage site, thereby excising or inverting a r egion of the template nucleic acid molecule. In certain embodiments, the first cleavage site and the second cleavage site are separated at least 500, at least 750, at least 1 ,000, at least 2,000, at least 5 ,000, or at least 8,000 base pairs. In certain emb odiments, the excised region is at least 500, at least 750, at least 1 ,000, at least 2,000, at least 5 ,000, or at least 8,000 base pairs.
[0044] In some embodiments, the first cleavage site and the second cleavage site are within different genes or within two different regions of two different genes. In some embodiments, the first cleavage site and the second cleavage site are within the coding region of two different genes.
[0045] In some embodiments, the sequence surrounding or within first cleavage site and the sequence surrounding or within the second cut comprise microhomology. In some embodiments, (b) and (c) activates microhomology-mediated end j oining (MMEJ) and the template nucleic acid molecule is rej oined by MMEJ, thereby excising the target nucleic acid molecule.
[0046] In some embodiments, the template nucleic acid molecule is a viral nucleic acid molecule. In some embodiments, the viral nucleic acid molecule is an episomal nucleic acid molecule or integrated nucleic acid molecule. In some embodiments, the viral nucleic acid molecule is a proviral nucleic acid molecule. In certain embodiments, the viral nucleic acid molecule is a HIV nucleic acid molecule. In certain embodiments, the viral nucleic acid molecule is an HSV nucleic acid molecule.
[0047] In some embodiments, provided herein is a method of inactivating a virus in a cell, the method comprising: contacting the cell with the AAV vector provided herein; cutting a viral nucleic acid molecule at a first cleavage site; cutting the viral nucleic acid molecule at a second cleavage site, thereby excising or inverting the region between the first cleavage site and second cleavage site from the template nucleic acid molecule.
[0048] In some embodiments, provided herein is an AAV vector comprising a nucleic acid molecule comprising from 5 ’ to 3 ’ : a first ITR; a pol II promoter, a sequence encoding a CRISPR-Cas endonuclease, and a poly A tail sequence, wherein the pol III promoter is 300 base pairs or less and the polyA tail sequence is 150 base pairs or less; a first pol III promoter and a sequence encoding a first gRNA; a second pol III promoter and asequence encoding a second gRNA, wherein the first pol III promoter and the second pol III promoter are different and the first gRNA and second gRNA are different; and a second ITR.
[0049] In some embodiments, provided herein is an AAV vector comprising a nucleic acid molecule comprising from 5 ’ to 3 ’ : a first ITR; a first pol III promoter and a sequence encoding a first gRNA; a second pol III promoter and a sequence encoding a sec ond gRNA, wherein the first pol III promoter and the second pol III promoter are different and the spacer sequences of the firstgRNA and the second gRNA are different; a pol II promoter, a sequence encoding a CRISPR-Cas endonuclease, and a polyA tail sequence, wherein the pol III promoter is 300 base pairs or less and the polyA tail sequence is 150 base pairs or less; and a second ITR.
[0050] In some embodiments, the first pol III promoter is a U6 promoter or 7SK promoter; the second pol III promoter is a U6 prom oter or 7SK promoter; the pol II promoter is a mini-CMV promoter; and the polyA sequence is SV40 polyA sequence.
[0051] In some embodiments, provided herein is an AAV vector comprising a nucleic acid molecule comprising: a sequence encoding a CRISPR-Cas endonuclease; a first pol III promoter and a sequence encoding a first gRNA; and a second pol III promoter and a sequence encoding a second gRNA, the CRISPR-Cas endonuclease, a first gRNA, and a second gRNA having means for excising or inverting a region of a templ ate nucleic acid when expressed in a cell, and wherein: the first pol III promoter and the second pol III promoter are different; and the first gRNA and second gRNA are different.
[0052] In some embodiments, AAV viral vectors provided herein incorporate elements (e.g. , promoters, guide RNA sequences, and CRISPR-Cas endonuclease sequences) and / or an ordering of the different elements that can maintain an overall compact size of the AAV viral construct while retaining effective transcription of the coding regions provided in said AAV viral vector, promoting efficient excision of viral nucleic acid sequences from a host genome. In some embodiments, elements of the AAV vector construct encoding the endonuclease and the two gRNAs can comprise up to about 5 ,000 bp while maintaining effective transcription and excision of target sequences. Unexpectedly, in some embodiments, when elements encoding an endonuclease and two gRNAs comprise up to about 5 , 000 bp, there is strong expression of the endonuclease and the two gRNAs, particularly when the elements are operably linked to Pol II and Pol III promoters, respectively, and when the elements are arranged in a specific order in the AAV vector construct. In some embodiments, a sequence encoding an endonucleasecomprises a full-length CRISPR-Cas endonuclease coding sequence, which, surprisingly, has strong expression in cells contacted with the AAV vectors provided herein.
[0053] In some embodiments, effective transcription of the endonuclease, the first gRNA, and the second gRNA may result in cleavage of the template nucleic acid at the first and second target sequences of the template nucleic acid. In some embodiments, cleavage at the first and second target sequ ences of the template nucleic acid may result in the excision of the sequence between the first and second target sequences of the template nucleic acid. In some embodiments, cleavage at the first and second target sequences of the template nucleic acid may result in the inversion of the sequence between the first and second target sequences of the template nucleic acid.BRIEF DESCRIPTION OF THE DRAWINGS
[0054] The novel features of this disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which :
[0055] FIG. 1 provides schematics of three adeno-associated virus (AAV) vector designs;
[0056] FIG. 2 provides a schematic of an HIV- 1 knock-in reporter con struct;
[0057] FIG. 3 illustrates the relative excision efficiency in the HIV - 1 knock-in reporter cell line;
[0058] FIG. 4A provides the expression levels of LTR1 guide RNA (gRNA), FIG. 4B provides the expression levels of GagD guide RNA (gRNA), and FIG. 4C provides the expression levels of SaCas9 messenger RNA (mRNA) in Hela cells co-transfected with the HIV pNL4-3 plasmid and an AAV transgene plasmid;
[0059] FIG. 5 A provides a schematic showing the 5G droplet digital polymerase chain reaction (ddPCR) excision assay and G3 ddPCR excision assay;
[0060] FIG. 5B provides the relative excision efficiency, as measured by the 5G ddPCR excision assay, in Hela cells co -transfected with the HIV pNL4-3 plasmid and an AAV transgene plasmid;
[0061] FIG. 5C provides the relative excision efficiency, as measured by the G3 ddPCR excision assay, in Hela cells co -transfected with the HIV pNL4-3 plasmid and an AAV transgene plasmid;
[0062] FIG. 6 illustrates the workflow for designing the stuffer sequence for the AAV plasmid backbone .
[0063] FIG. 7 provides a schematic showing the three AAV9 vectors evaluated in the Tg26 mouse model and the control vector;
[0064] FIG. 8 A shows the AAV copy number per cell in the spleen, FIG. 8B shows the AAV copy number per cell in the trigeminal ganglion, FIG. 8C shows the AAV copy number per cell in the heart, and FIG. 8D shows the AAV copy number per cell in the liver;
[0065] FIG. 9A shows the expression levels of LTR1 gRNA, FIG. 9B shows the expression levels of GagD gRNA, and FIG. 9C shows the expression levels of Cas RNA in the spleen of Tg26 mice;
[0066] FIG. 10A shows the expression levels of LTRl gRNA, FIG. 10B shows the expression levels of GagD gRNA, and FIG. 10C shows the expression levels of Cas RNA in the trigeminal ganglion of Tg26 mice;
[0067] FIG. 11A shows the expression levels of LTRl gRNA, FIG. 11B shows the expression levels of GagD gRNA, and FIG. 11C shows the expression levels of Cas RNA in the heart of Tg26 mice;
[0068] FIG. 12 A shows the expression levels of LTRl gRNA, FIG. 12B shows the expression levels of GagD gRNA, and FIG. 12C shows the expression levels of Cas RNA in the liver of Tg26 mice;
[0069] FIG. 13A provides the HIV copy number per cell in the spleen, FIG. 13B provides the HIV copy number per cell in the trigeminal ganglion, FIG. 13C provides the HIV copy number per cell in the heart, and FIG. 13D provides the HIV copy number per cell in the liver;
[0070] FIG. 14 provides a schematic that illustrates the three A AV9 vectors that were evaluated in the manufacturability test;
[0071] FIG. 15A shows the productivity of un-purified AAV vectors and FIG. 15B shows the productivity of purified AAV vectors;
[0072] FIG. 16 illustrates the infectious titer of the AAV vectors, measured using the standard median tissue culture infectious dose (TCID50) assay;
[0073] FIG. 17 provides the percentage of AAV plasmid backbone packaging;
[0074] FIG. 18A provides the SDS-PAGE / silver staining analysis of AAV9-0327, FIG. 18B provides the SDS-PAGE / silver staining analysis of AAV9 -0367, FIG. 18C provides the SDS-PAGE / silver staining analysis of AAV9 -0380;
[0075] FIG. 19A provides the Western Blot analysis of AAV9 -0327, FIG. 19B provides the Western Blot analysis of AAV9-0367, and FIG. 19C provides the Western Blot analysis of AAV9 -0380;
[0076] FIG. 20A provides the alkaline agarose gel electrophoresis analysis of viral deoxyribonucleic acid (DNA) isolated from AAV9-0327, FIG. 20B provides the alkaline agarose gel electrophoresis analysis of viral DNA isolated from AAV9-0367, and FIG. 20C provides the alkaline agarose gel electrophoresis analysis of viral DNA isolated from AAV9-0380;
[0077] FIG. 21 A shows the distribution of PacBio single molecule, real-time (SMRT) sequencing reads mapped to different categories, and FIG. 2 IB shows the distribution of various AAV genome reads; and
[0078] FIG. 22A provides a sequence logo showing the sequence conservation of nucleotides in individual clades and all clades combined for the LTR1 protospacer + PAM sequence using the LTR U3 sequence query from US patients in the Los Alamos National Laboratory (LANL) online database, and FIG. 22B provides a sequence logo showing the sequence conservation of nucleotides in individual clades and all clades combined for the Global LTR1 + PAM sequence for US patients .
[0079] FIG. 23 illustrates an exemplary sequence logo showing the sequence conservation of nucleotides in ICP0.
[0080] FIG. 24 illustrates an exemplary sequence logo showing the sequence conservation of nucleotides in ICP 27.
[0081] FIG. 25A illustrates an exemplary schematic of the HSV- 1 genome and the location of SaCas9 gRNAs targeting the ICP0 and ICP27 ge nes.
[0082] FIG. 25B and FIG. 25C illustrate an exemplary reduction of HSV- 1 viral load, measured by ddPCR (FIG. 25B), and viral titer, measured by plaque assay (FIG. 25C), in Vero cells co-transfected with the SaCas9 gRNA pairs and then infected with the HSV- 1 strain Syn l 7+ virus .
[0083] FIG. 26A and FIG. 26B illustrate exemplary steps for generating the consensus sequence using Clustal Omega alignment for the HSV - 1 ICP0 and ICP27 coding sequences (FIG. 26A), as well as an example position-specific scoring matrix (PSSM) generated for the ICP0 consensus sequence (FIG. 26B).
[0084] FIG. 27A and FIG. 27B illustrate positions of the conserved gRNAs in the consensus sequences for ICP0 (FIG. 27A) and ICP27 (FIG. 27B).
[0085] FIG. 28 illustrates an exemplary in silico off-target analysis method for the selected conserved gRNAs.
[0086] FIG. 29 illustrates an exemplary overview of the construction process for the LentiCasX2-2xgRNA library .
[0087] FIG. 30A illustrates a schematic of the HSV- 1 gain-of-signal knock-in reporter construct.
[0088] FIG. 30B and FIG. 30C illustrate representative flow cytometry plots demonstrating the enrichment of mTagBFP2 positive cells through Blasticidin selection.
[0089] FIG. 31 illustrates the Volcano plot, which reports Benj amini-Hochberg adjusted p values against fold changes.
[0090] FIG. 32A illustrates a schematic of the HSV- 1 loss-of-signal knock-in reporter construct.
[0091] FIG. 32B illustrates the excision efficiency induced by the SaCas9 M2M1 pair_20nt and the Top 9 CasX2 gRNA pairs in the HSV- 1 loss-of-signal reporter cells .
[0092] FIG. 33A and FIG. 33B illustrate the reduction of HSV- 1 viral load, as measured by ddPCR (FIG. 33 A), and viral titer, as measured by plaque assay (FIG. 33B), in Vero cells infected first with either AAV2-saCas9 scramble vector or AAV2 -SaCas9 M2M1 pair_20nt vector at different multiplicities of infection and second with the HSV - 1 Syn l 7+ virus.
[0093] FIG. 33C and FIG. 33D illustrate the reduction of HSV- 1 viral load, as measured by ddPCR (FIG. 33C), and viral titer, as measured by plaque assay (FIG. 33D), in Vero cells infected first with either AAC2-SaCas9 scramble vector or AAV2 -SaCas9 M2M1 pair_22nt vector at different multiplicities of infection and second with the HSV - 1 Syn l 7+ virus.
[0094] FIG. 33E and FIG. 33F illustrate the reduction of HSV- 1 viral load, as measured by ddPCR (FIG. 33E), and viral titer, as measured by plaque assay (FIG. 33F), in Vero cells infected first with one of AAV2 -CasX2 scramble vector, AAV2-CasX2 g6g9 pair vector, or AAV2-CasX2 g9g9 pair vector and second with the HSV- 1 Synl7+ virus.
[0095] FIG. 34A and FIG. 34B illustrate the reduction of HSV- 1 viral load, as measured by ddPCR (FIG. 34 A), and viral titer, as measured by plaque assay (FIG. 34B), in Vero cells co-transfected with the SaCas9 or CasX2 plasmid and then infected with HSV- 1 Syn l 7+ virus prior to treatment with Valacyclovir.
[0096] FIG. 35 illustrates exemplary nf-createumiconsensus pipeline steps for hybrid capture sequencing analysis.
[0097] FIG. 36 illustrates an exemplary schematic representation of the nf- targetedampliconseq bioinformatics pipeline for hybrid capture sequencing analysis.
[0098] FIG. 37A and FIG. 37B show the percentages of indels at the on-target sites of SaCas9 gRNAs (FIG. 37A) and CasX2 gRNAs (FIG. 37B). The results were obtained from three biological replicates (Rl, R2, and R3 ) and are presented as Indel percentages for each replicate. The targetregion is the location of the gRNA on the HSV - 1 loss-of- signal knock-in reporter construct.
[0099] FIG. 38A and FIG. 38B illustrate the percentages of indels at the on -target and nominated off-target sites for ICP0_SaCas9_M2_22 (FIG. 38A) and ICP27_SaCas9_Ml _22 (FIG. 38B).
[0100] FIG. 39A, FIG. 39B, FIG. 39C, and FIG. 39D illustrate the percentages of indels at the on-target and potential off-target sites for ICP0_CasX_6 (FIG. 39A), ICP0_CasX_9 (FIG. 39B), ICP0_CasX_12 (FIG. 39C), and ICP27_CasX_9 (FIG. 39D).
[0101] FIG. 40 illustrates the percentages of indels determined by Amplicon -seq at the selected GUIDE-seq sites or in silico nominated sites.
[0102] FIG. 41A illustrates an exemplary schematic of the AAV vectors that were tested in the rabbit HSV- 1 keratitis studies.
[0103] FIG. 41B illustrates an exemplary experimental outline for an in vivo proof - of-concept study in a rabbit model of HSV- 1 keratitis.
[0104] FIG. 42A and FIG. 42B illustrate the percentage of rabbit eyes that exhibited positive HSV- 1 shedding (FIG. 42A) and the percentage of positive swabs out of the 12 total swabs collected for each rabbit eye (FIG. 42B) in the corneal scarification study. Each dot represents an individual rabbit eye.
[0105] FIG. 43 A and FIG. 43B illustrate the percentage of rabbit eyes that exhibited positive HSV- 1 shedding (FIG. 43A) and the percentage of positive swabs out of the 12 total swab s collected for each rabbit eye (FIG. 43B) in the IV study .
[0106] FIG. 44A and FIG. 44B illustrate the AAV copy number per cell in the trigeminal ganglion (TG), as measured by digital polymerase chain reaction (dPCR) using the primer / probe sets that target the CMV promoter (FIG. 44A) and the SV40 polyA (FIG. 44B) in the AAV vector genome.
[0107] FIG. 45A and FIG. 45B illustrate the AAV copy number per cell in the cornea, as measured by dPCR using the primer / probe sets thattargetthe CMV promoter (A) and the SV40 polyA (B) in the AAV vector genome.
[0108] FIG. 46 A and FIG. 46B illustrate the HSV- 1 copy number per cell in the TG, as measured by dPCRusing the primer / probe sets that target the HSV- 1 UL28 gene (FIG. 46A) and the HSV- 1 LAT intron sequence (FIG. 46B).
[0109] FIG. 47 illustrates the LAT RNA level in the TG.
[0110] FIG. 48 A and FIG. 48B illustrate the reduction in HSV-1 viral load, quantified by dPCR (FIG. 48A), and viral titer, determined by plaque assay (FIG. 48B), in Vero cells. FIG. 48C and FIG. 48D depict the reduction in HSV -2 viral load, measured by dPCR (FIG. 48C), and viral titer, measured by plaque assay (FIG. 48D), in Vero cells.
[0111] FIG. 49A, FIG. 49B and FIG. 49C illustrate the percentages of indels determined by Amplicon-seq at the selected in silico and GUIDE-seq nominated sites for each of the three HSV- l / HSV-2 shared SaCas9 gRNAs.
[0112] FIG. 50 illustrates the percentage of positive swabs out of the 1 1 total swabs collected from each rabbit eye.
[0113] FIG. 51 A and FIG. 5 IB illustrate the HSV-1 copy number per cell (FIG. 51 A) and the normalized LAT mRNA level (FIG. 51B) in the TG of rabbits intravenously injected with either the AAV buffer control, the AAV9-miniCMV-SaCas9 M2Ml_22nt vector, or the AAV9-CaMKIIaO.4-SaCas9 M2Ml_22nt vector.
[0114] FIG. 52A and FIG. 52B illustrate the indel frequency at the HSV-1 ICP0M2 target site (FIG. 52A) and the ICP27M1 target site (FIG. 52B) in the TG of rabbits intravenously injected with either the AAV buffer control, the AAV9-miniCMV-SaCas9 M2Ml_22nt vector, or the AAV9-CaMKIIaO.4-SaCas9 M2Ml_22nt vector.
[0115] FIG. 53 illustrates the excision analysis of HSV-1 DNA in the TG between the ICP27M1 and ICP0M2 gRNA target sites.
[0116] FIG. 54A and FIG. 54B illustrate the AAV load (FIG. 54A) and SaCas9 mRNA expression (FIG. 54B) in various rabbit tissues following treatment with the AAV9-CaMKIIaO.4-SaCas9 M2Ml_22nt vector.DETAILED DESCRIPTION
[0117] Provided and exemplified herein are AAV (adeno-associated virus) vectors useful and advantages for efficient viral excision using multiplexed CRISPR-Cas systems targeting two differenttarget sites for excision. In certain instances, the vectors use two different pol III promoters to drive the expression of the different gRNAs. Accordingly, in some embodiments, provided herein are AAV vectors comprising:(1) a sequence encoding a CRISPR-Cas endonuclease;(2) a first pol III promoter and a sequence encoding a first gRNA; and(3) a second pol III promoter and a sequence encoding a second gRNA, wherein:(i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter); and(ii) the first gRNA and the second gRNA are different (e.g., having a non-identical sequence).
[0118] In some embodiments, provided herein are AAV vectors comprising:(1) a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease;(2) a first pol III promoter and a sequence encoding a first gRNA; and(3) a second pol III promoter and a sequence encoding a second gRNA, wherein:(i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter); and(ii) the first gRNA and the second gRNA are different (e.g., having a non-identical sequence).
[0119] In some embodiments, provided herein are AAV vectors comprisi ng:(1) a sequence encoding a CRISPR-Cas endonuclease;(2) a first pol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule); and(3 ) a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein:(i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter);(ii) the first gRNA and the second gRNA are different (e.g., having a non-identical sequence);(iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleavesthe template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the first target site and generates a first cleaved region; and(iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the second target site and generates a second cleaved region; thereby excising a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region.
[0120] In some embodiments, provided herein are AAV vectors comprising:(1) a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease;(2) a first pol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule); and(3 ) a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein:(i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter);(ii) the first gRNA and the second gRNA are different (e.g., having a non-identical sequence);(iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the first target site and generates a first cleaved region; and(iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the second target site and generates a second cleaved region; thereby excising a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region.
[0121] In some embodiments, provided herein are AAV vectors comprising:(1) a sequence encoding a CRISPR-Cas endonuclease;(2) a first pol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule); and(3 ) a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein:(i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter);(ii) the first gRNA and the second gRNA are different (e.g., having a non-identical sequence);(iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleavesthe template nucleic acid molecule within or proximal (e.g., within a distance of about1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the first target site and generates a first cleaved region comprising a first nucleic acid sequence; and(iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the second target site and generates a second cleaved region comprising a second nucleic acid sequence having microhomology to the first nucleic acid sequence. In certain embodiments, generating the first cleaved region and the second cleaved region comprising the first and second nucleic acid sequences having microhomology, results in the excision of a region of the template nucleic acid molecule between the first and second nucleic acid sequences having microhomology.
[0122] In some embodiments, provided herein are AAV vectors comprising:(1) a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease;(2) a first pol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule (e.g., viral nucleic acid molecule); and(3 ) a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein:(i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter);(ii) the first gRNA and the second gRNA are different (e.g., having a non-identical sequence);(iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the first target site and generates a first cleaved region comprising a first nucleic acid sequence; and(iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal (e.g., within a distance of about 1, 2, 3, 4, 5, 10, 15 or 20 nucleobase positions) to the second target site and generates a second cleaved region comprising a second nucleic acid sequence having microhomology to the first nucleic acid sequence. In certain embodiments, generating the first cleaved region and the second cleaved region comprising the first and second nucleic acid sequences having microhomology, results in theexcision of a region of the template nucleic acid molecule between the first and second nucleic acid sequences having microhomology.
[0123] In certain instances, the orientation of the elements of the CRISPR-Cas system results in improved excision. For example, having (1 ) first pol III promoter and the sequence encoding the first gRNA adj acent / next to (2) the second pol III promoter and the sequence encoding the second gRNA resulted in improved excision. Thu s, in certain instances, provided are AAV vectors comprising a nucleic acid molecule comprising (1) the first pol III promoter and the sequence encoding the first gRNA adjacently located to (2) the second pol III promoter and the sequence encoding the seco nd gRNA. For example, in certain embodiments, the 1 ) first pol III promoter and the sequence encoding the firstgRNA and (2) the second pol III promoter and the sequence encoding the second gRNA are both located 5 ’ or 3 ’ to (3 ) the sequence encoding the CRISPR-Cas endonuclease or the pol II promoter and the sequence encoding the CRISPR-Cas endonuclease .
[0124] In other instances, improved excision was ob served when (1 ) first pol III promoter and the sequence encoding the first gRNA and (2) the second pol III promoter and the sequence encoding the second gRNA were located at the 5 ’ end of the AAV vector relative to the sequence encoding the CRISPR-Cas endonuclease. Thus, in certain instances, provided herein are AAV vectors comprising a nucleic acid molecule comprising from 5 ’ to 3 ’ : a firstpol III promoter and a sequence encoding a first gRNA; a second pol III promoter and a sequence encoding a second gRNA; and a sequence encoding CRISPR-Cas endonuclease or a pol II promoter and a sequence encoding the CRISPR-Cas endonuclease .
[0125] In certain embodiments, the first pol III promoter is operably linked to the sequence encoding the first gRNA (e.g. , located 5 ’ and capable of promoting transcription); and the second pol III promoter is operably linked to the sequence encoding the second gRNA (e.g., located 5 ’ and capable of promoting transcription).
[0126] In certain embodiments, the nucleic acid molecule comprises a pol II promoter operably linked to the sequence encoding CRISPR-Cas endonuclease. In certain embodiments, the pol II promoter comprises 300 nucleobase pairs or less. In certain embodiments, the nucleic acid molecule further comprises a polyA sequence operably linked to the sequence encoding CRISPR-Cas endonuclease, wherein the polyA sequence is 150 nucleobase pairs or le ss.
[0127] In certain embodiments, the first gRNA comprises a first spacer sequence and a first scaffold sequence; and the second gRNA comprises a second spacer sequence anda second scaffold sequence. In certain embodiments, the first scaffold sequence and the second scaffold sequence are different.
[0128] In some embodiments, provided herein are AAV vectors comprising a nucleic acid molecule comprising from 5 ’ to 3 ’ :(i) a first ITR;(ii) the pol II promoter, the sequence encodingthe CRISPR-Cas endonuclease, and the poly A tailing sequence, wherein the pol II promoter is 300 nucleobase pairs or less and the poly A tailing sequence is 150 nucleobase pairs or less;(iii) the first pol III promoter and the sequence encoding the first gRNA;(iv) the second pol III promoter and the sequence encoding the second gRNA, wherein the first pol III promoter and the second pol III promoter are different and the first gRNA and second gRNA are different; and(v) a second ITR.
[0129] In some embodiments, provided herein are AAV vectors comprising a nucleic acid molecule comprising from 5 ’ to 3 ’ :(i) a first ITR;(ii) the first pol III promoter and the sequence encoding a first gRNA;(iii) the second pol III promoter and the sequence encoding a second gRNA, wherein the first pol III promoter and the second pol III promoter are different and the spacer sequences of the first gRNA and the second gRNA are different;(iv) the pol II promoter, the sequence encodingthe CRISPR-Cas endonuclease, and the poly A tailing sequence, wherein the pol II promoter is 300 nucleobase pairs or less and the poly A tailing sequence is 150 nucleobase pairs or less; and(v) a second ITR.
[0130] In certain embodiments, the AAV vector comprises less than about 4.7 kilobases in size. Generally, an AAV vector comprises a nucleic acid vector and a viral particle made up of AAV capsid proteins. In certain embodiments, an AAV vector described herein can comprise a nucleic acid molecule (e.g., a nucleic acid molecule encoding a CRISPR-Cas gene editing system.) An AAV vector provided herein can comprise a capsid and a cargo (e.g., a nucleic acid molecule or a genome) and can have a viral serotype. In some embodiments, the AAV capsid is a capsid selected from the group of AAV capsid serotypes consisting of: AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, recombinant human (rh) 10, rh74. In some embodiments, the AAV cargo or genome is selected from the group of AAV genome serotypes consisting of: AAV1, AAV2, AAV3 , AAV4, AAV5, AAV6,AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, recombinant human (rh)10, rh74. In some embodiments, an AAV vector provided herein can be pseudotyped. For example, a pseudotyped AAV vector can comprise a capsid of one serotype and a genome of a different serotype (e.g., AAV2 / 5 comprising a capsid from serotype 5 and a genome from serotype 2). The AAV vectors described herein generally comprises a flanking set of inverted terminal repeat (ITR) sequences. ITRs generally refer to the art-recognized regions found at the 5 ' and 3 ' termini of the AAV genome which function in cis as origins of DNA replication and as packaging signals for the viral genome. AAV ITRs, together with the AAV rep coding region, generally provide for efficient integration of a nucleotide sequence interposed between two flanking ITRs into a host cell genome. Sequences of certain AAV-associated ITRs are disclosed by Yan et ah, J. Virol. (2005) vol. 79, pp. 364-379. ITR sequences can be full length, wild-type AAV ITRs or fragments thereof that retain functional capability . AAV ITRs useful in the vectors described herein can be derived from any known AAV serotype and, in certain embodiments, are derived from the AAV2 or AAV5 serotype. In certain embodiments, the ITRs can be pseudotyped relative to the capsid .Promoters
[0131] In some embodiments, AAV vectors provided herein comprise one or more promoters. In some embodiments, each promoter is operably linked to a coding sequence (e.g. , the sequence encoding the CRISPR-Cas endonuclease, the sequence encoding the first gRNA, the sequence encoding the second gRNA). In some embodiments, the one or more promoters include one or more different promoters. In some embodiments, the one or more different promoters may be one or more differenttypes of promoters (e.g., a polII promoter and a pol II promoter). In some embodiments, the one or more different promoters may be the same type of promoter (e.g., two different pol II promoters).
[0132] In some embodiments, the AAV vector comprises three promoters. In some embodiments, the three promoters comprise two different types of promoters. In some embodiments, a first type of promoter is operably linked to the sequence encoding the CRISPR-Cas endonuclease. In some embodiments, a second type of promoter is operably linked to the sequence encoding the first gRNA and / or the sequence encoding the second gRNA. In some embodiments, a first type of promoter of the three promoters is a Pol II promoter. In some embodiments, a second type of promoter of the three promoters is a Pol III promoter. In some embodiments, the first gRNA is operably linked to a first PolIII promoter. In some embodiments, the second gRNA is operably linked to a second PolIII promoter. In some embodiments, the first Pol III promoter and the second Pol III promoter are different Pol III promoters (e.g., promoters having different sequences). pol III promoters
[0133] The AAV vectors described herein generally use two pol III promoters that are different to drive expression of two gRNAs that are different (e.g. , having different spacer sequences). Exemplary pol III promoters are listed in Table 1.Table 1 - pol III promoters
[0134] In certain embodiments, the different pol III promoters are selected from Table 1 . In certain embodiments, the different pol III promoters are U6 and 7 SK. For example, the first pol III promoter is a U6 promoter, and the second pol III promoter is a 7SK promoter. In another example, the first pol III promoter is a 7 SK promoter, and the second pol III promoter is a U6 promoter. In certain embodiments, the different pol III promoter sequences are SEQ ID NO s: 1 and 2.
[0135] As described herein, in certain embodiments, the first pol III promoter is operably linked to the sequence encoding the first gRNA (e.g., located 5 ’ and capable of promoting transcription); and the second pol III promoter is operably linked to the sequence encoding the second gRNA (e.g., located 5 ’ and capable of promoting transcription). The configuration of pol III promoters to drive expression of a target sequence (e.g., a sequence encoding a gRNA) is known in the art, for example : Ma H, Wu Y, Dang Y, Choi JG, Zhang J, Wu H. Pol III Promoters to Express Small RNAs: Delineation of Transcription Initiation. Mol Th er Nucleic Acids. 2014 May 6;3(5):el61 . doi : 10. 1038 / mtna.2014. 12. PMID : 24803291 . pol II promoters
[0136] The AAV vectors described herein generally use a pol II promoter to drive expression of the CRISPR-Cas endonuclease. In some embodiments, the pol II promoter is less than 300 nucleobase pairs, less than 280 nucleobase pairs, less than 270nucleobase pairs, less than 250 nucleobase pairs, or less than 200 nucleobase pairs.Exemplary pol II promoters are listed in Table 2.Table 2 - pol II promoters
[0137] In certain embodiments, the pol Il promoter is selected from Table 2. In certain embodiments, the pol II promoter is miniCMV (268) or miniCMV (180). In certain embodiments, the pol II promoter sequence comprises SEQ ID NO : 9 or 10, wherein the pol II promoter is less than 300 nucleobases. The configuration of pol II promoters to drive expression of a protein are known in the art, for example: Protein Expression Handbook: Recombinant protein expression and purification technologies. Thermo Fisher Scientific.
[0138] In some embodiments, use of the pol II promoter is sufficient to drive strong expression of the CRISPR-Cas endonuclease. In some embodiments, the pol II promoter is sufficient to promote strong expression of the CRISPR-Cas endonuclease in the ab sence of additional elements known to enhance expression (e.g. , inclusion of heterologous or exogenous introns in the coding sequence).CRISPR-Cas systems
[0139] CRISPR system refers to and includes elements involved in the expression of or directing the activity of a CRISPR-associated (Cas) endonuclease, including guide RNA sequences and components thereof, such as a tracr (trans -activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a spacer sequence (also referred to as a guide sequence), or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by such elements that promote the formation of aCRISPR complex atthe site of a target sequence. In the context of formation of a CRISPR complex, a target sequence (protospacer sequence) refers to a sequence to which a spacer sequence is designed to hybridize to, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex.CRISPR-Cas endonucleases
[0140] The CRISPR-Cas systems include Type I CRISPR-Cas system, Type II CRISPR-Cas system, Type III CRISPR-Cas system, and derivatives thereof. CRISPR- Cas systems include engineered and / or programmed nuclease systems derived from naturally occurring CRISPR-Cas systems. CRISPR-Cas systems may contain engineered and / or mutated Cas proteins. In certain embodiments, nucleases generally refer to enzymes capable of cleaving the phosphodiester bonds between the nucleotide subunits of nucleic acids. In certain embodiments, endonucleases are generally capable of cleaving the phosphodiester bond within a polynucleotide chain. Nickases refer to endonucleases that cleave only a single strand of a DNA duplex.
[0141] In some embodiments, the CRISPR-Cas system used herein can be a type I, a type II, or a type III system. Non-limiting examples of suitable CRISPR-Cas endonucleases include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a l, Cas8a2, Cas8b, Cas8c, Cas9, Cas lO, Cas lOd, CasF, CasG, CasH, CasX, Cas , Csy l , Csy2, Csy3, Cse l (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc l , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5 , Csm6, Cmrl , Cmr3, Cmr4, Cmr5, Cmr6, Csb l, Csb2, Csb3, Csx l7, Csx l4, Csxl O, Csxl6, CasX, Csx3, Cszl , Csxl 5, Csfl, Csf2, Csf3, Csf4, and Cu l 966. In certain embodiments, the CRISPR-Cas protein or endonuclease is Cas9. In certain embodiments, the CRISPR-Cas protein or endonuclease is Cas l 2. In certain embodiments, the CRISPR-Cas protein or endonuclease is CasX. In certain embodiments, the CRISPR-Cas protein or endonuclease is Cas .
[0142] In some embodiments, the Cas9 protein can be from or derived from: Staphylococcus aureus, Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp. , Nocardiopsis dassonvillei , Streptomyces pristinae spiralis, Streptomyces viridochromogenes , Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius , Bacillus pseudomycoides , Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp . , Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp. , Acetohalobium arabaticum , Ammonifex degensii, Caldicelulosiruptor becscii , Candidatus Desulforudis, Clostridium botulinum,Clostridium difficile, Fine goldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vino sum, Marinobacter sp . , Nitrosococcus halophilus , Nitrosococcus watsoni, P seudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp . , Arthrospira maxima, Arthrospira platensis, Arthrospira sp . , Lyngbya sp . , Microcoleus chthonoplastes , Oscillatoria sp . , Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina .
[0143] In some embodiments, the gene editing system comprises a CRISPR- associated (Cas) protein, or functional fragment or derivative thereof. In ce rtain embodiments, the Cas protein is an endonuclease, including but not limited to the Cas9 nuclease. In some embodiments, the Cas9 protein comprises an amino acid sequence identical to the wild type Streptococcus pyogenes or Staphylococcus aureus Cas9 amino acid sequence. In some embodiments, the Cas protein may comprise the amino acid sequence of a Cas protein from other species, for example other Streptococcus species, such as therm ophilus; Pseudomonas aeruginosa, Escherichia coli, or other sequenced bacteria genomes and archaea, or other prokaryotic microorganisms. Other Cas proteins, useful for the present disclosure, are known or can be identified, using methods known in the art (see e.g., Esvelt et al. , 2013, Nature Methods, 10 : 1 1 16 - 1121). In certain embodiments, the Cas protein may comprise a modified amino acid sequence, as compared to its natural source.
[0144] CRISPR-Cas proteins comprise at least one RNA recognition and / or RNA binding domain. RNA recognition and / or RNA binding domains interact with guide RNAs (gRNAs). CRISPR-Cas proteins can also comprise nuclease domains (i. e., DNase or RNase domains), DNA binding domains, helicase domains, RNase domains, proteinprotein interaction domains, dimerization domains, as well as other domains.
[0145] In some embodiments, the CRISPR-Cas-like protein can be a wild type CRISPR-Cas protein, a modified CRISPR-Cas protein, or a fragment of a wild type or modified CRISPR-Cas protein. In some embodiments, the CRISPR-Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, alter an enzymatic activity, and / or change another property of the protein. For example, nuclease (i. e. , DNase, RNase) domains of the CRISPR-Cas-like protein can be modified, deleted, or inactivated. Alternatively, in some embodiments, the CRISPR-Cas-like protein can be truncated to remove domains that are not essential forthe function of the Cas protein. Insome embodiments, the CRISPR-Cas-like protein can also be truncated or modified to optimize the activity of the effector domain of the Cas protein.
[0146] In some embodiments, the CRISPR-Cas-like protein can be derived from a wild type Cas protein or fragment thereof. In certain embodiments, the CRISPR-Cas-like protein is a modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein can be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, etc.) of the protein relative to wild-type or another Cas protein. Alternatively, in some embodiments, domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild-type Cas9 protein.
[0147] In some embodiments, the disclosed CRISPR-Cas compositions should also be construed to include any form of a protein having substantial homology to a Cas protein (e.g. , Cas9, SaCas9, Cas9 protein) disclosed herein. Preferably, a protein which is “ sub stantially homologous” is about 50% homologous, more preferably about 70% homologous, even more preferably about 80% homologous, more preferably about 90% homologous, even more preferably, about 95% homologous, and even more preferab ly about 99% homologous to amino acid sequence of a Cas protein disclosed herein.
[0148] In certain embodiments, the CRISPR-Cas endonuclease comprises one or more nuclear localization signals. In certain embodiments, the sequence encoding the CRISPR- Cas endonuclease is attached to a poly A tailing sequence at the 3 ’ end of the sequence encoding the CRISPR-Cas endonuclease. In certain embodiments, the poly A tailing sequence is less than 250 nucleobases, less than 225 nucleobases, less than 200 nucleobases, or less than 175 nucleobases. Table 3 lists exemplary poly A tailing sequences.Guide RNAs (gRNAs)
[0149] The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and targeting sequence (also referred to as a spacer sequence)that defines the template nucleic acid target to be modified. The gRNA functions, in part, by hybridizing to a template nucleic acid molecule (e.g., at a targeted site or protospacer).
[0150] Hybridization, as used herein, generally refers to and includes the capacity and / or ability of a first nucleic acid molecule to non -covalently bind (e.g. , form Watson- Crick-base pairs and / or G / U nucleobase pairs), anneal, and / or hybridize to a second nucleic acid molecule under the appropriate or certain in vitro and / or in vivo conditions of temperature, pH, and / or solution ionic strength. Generally, standard Watson -Crick nucleobase pairing includes: adenine (A) pairing with thymidine (T); adenine (A) pairing with uracil (U); and guanine (G) pairing with cytosine (C). In some embodiments, hybridization comprises at least two nucleic acids comprising complementary sequences (e.g. , fully complementary, substantially complementary, or partially complementary). In certain embodiments, hybridization comprises at least two nucleic acids comprising fully complementary sequences. In certain embodiments, hybridization comprises at least two nucleic acids comprising substantially complementary sequences (e.g., greaterthan about 75%, greaterthan about 80%, greaterthan about 85%, greaterthan about 90%, or greater than about 95% complementary). In certain embodiments, hybridization comprises at least two nucleic acids comprising partially complementary sequences (e.g., greater than about40%, greater than about 50%, greater than about 60%, or greaterthan about 70% complementary). In certain embodiments, partially complementary sequence s comprise one or more regions of fully or sub stantially complementary sequences. In certain embodiments, partially complementary sequences comprise one or more regions of fully or substantially complementary sequences, even if an overall complementarity is low (e.g., a total complementarity lower than about 50%, lowerthan about 40%, lower than about 30%, or lower than about 20%). The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementation, variables well known in the art. For example, the greater the degree of complementation between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g. , complementarity over 35 or less, 30 or less, 25 or less, 22 or less, 20 or less, or 18 or less nucleotides) the position of mismatches becomes important (see Sambrook et al. , supra, 1 1 .7- 1 1 .8).
[0151] Complementary or complementarity, as used herein, generally refers to a polynucleotide that includes a nucleotide sequence capable of selectively annealing to an identifying region of a target polynucleotide under certain conditions. A s used herein, the term substantially complementary and grammatical equivalents is intended to meana polynucleotide that includes a nucleotide sequence capable of specifically annealing to an identifying region of a target polynucleotide under certain conditions. Annealing refers to the nucleotide nucleobase -pairing interaction of one nucleic acid with another nucleic acid that results in the formation of a duplex, triplex, or other high er -ordered structure. The primary interaction is typically nucleotide nucleobase specific, e.g. , A:T, A:U, and G:C, by Watson-Crick and Hoogsteen-type hydrogen bonding. In certain embodiments, nucleobase-stacking and hydrophobic interactions can also contribute to duplex stability. Conditions under which a polynucleotide anneals to complementary or sub stantially complementary regions of target nucleic acids are well known in the art, e.g. , as described in Nucleic Acid Hybridization, A Practical Approach, Hames and Higgins, eds., IRL Press, Washington, D.C. (1985) and Wetmur and Davidson, Mol. Biol. 3 1 :349 (1968). Annealing conditions will depend upon the particular application and can be routinely determined by persons skilled in the art, without undue experimentation. Hybridization generally refers to process in which two sin gle-stranded polynucleotides bind non-covalently to form a stable double -stranded polynucleotide.
[0152] The temperature and solution salt concentration are generally recognized as factors facilitating hybridization, and may be adjusted as necessary according to factors such as length of the region of complementation and the degree of complementarity. Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E: F. and Maniatis, T. Molecular Cloning: A Laboratory Manual - Second Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11 .1 therein; and Sambrook, J. and Russell, W ., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring HarborLaboratory Press, Cold Spring Harbor (2001). The conditions of temperature and ionic strength determine the stringency of the hybridization. In some embodiments, hybridization is measured a under physiological temperature (e.g., 37 degrees Celsius) and salt concentrations (e.g., 0.1 5 molar or 0.9% salt in solution).
[0153] Target specificity can be used in reference to a guide RNA, or a crRNA specific to a target polynucleotide sequence or region and further includes a sequence of nucleotides capable of selectively annealing / hybridizing to a target (sequence or region) of a target polynucleotide, e.g., a target DNA. Target specific nucleotides can have a single species of oligonucleotide, or it can include two or more species with different sequences. Thus, the target specific nucleotide can be two or more sequences, including 3 , 4, 5, 6, 7, 8, 9 or 10 or more different sequences. In certain embodiments, a crRNA or the derivative thereof contains a target-specific nucleotide region complementary to aregion of the target DNA sequence. In certain embodiments, a crRNA or the derivative thereof may contain other nucleotide sequences besides a target-specific nucleotide region. In certain embodiments, the other nucleotide sequences may be from a tracrRNA sequence.
[0154] gRNAs are generally supported by a scaffold, wherein a scaffold refers to the portions of gRNA or crRNA molecules comprising sequences which are sub stantially identical or are highly conserved across natural biological species (e.g. , not conferring target specificity). Scaffolds include the tracrRNA segment and the portion of the crRNA segment otherthan the polynucleotide-targeting guide sequence at or near the 5 ' end of the crRNA segment, excluding any unnatural portions comprising sequences not conserved in native crRNAs and tracrRNAs. In some embodiments, the gRNA comprises a CRISPR RNA (crRNA):trans activating crRNA (tracrRNA) duplex. In some embodiments, the gRNA comprises a stem-loop that mimics the natural duplex between the crRNA and tracrRNA. In some embodiments, the stem-loop comprises a nucleotide sequence comprising non-naturally occurring sequence. For example, in some embodiments, the composition comprises a synthetic or chimeric guide RNA comprising a crRNA, stem, and tracrRNA.
[0155] Generally, a protospacer adj acent motif (PAM) i s also an important sequence element mediating enzymatic activity of a Cas nuclease. A PAM sequence or element also refers to and includes an approximately 2 -6 nucleobase pair DNA sequence that is an important targeting component of a Cas nuclease. The PAM sequence further comprises, in certain instances, a DNA sequence that may be required for a Cas / sgRNA to form an R-loop to interrogate a specific DNA sequence through Watson-Crick pairing of its guide RNA with the genome. In certain instances, the PAM spe cificity can be a function of the DNA-binding specificity of the Cas protein (e.g. , a PAM recognition domain of a Cas), wherein, a protospacer adj acent motif recognition domain refers to a Cas amino acid sequence that comprises a binding site to a DNA target PAM sequence.
[0156] Typically, the PAM sequence is on either strand, and is downstream in the 5' to 3 ' direction of Cas9 cleavage site . The canonical PAM sequence (i. e., the PAM sequence that is associated with the Cas9 nuclease of Streptococcus pyogenes or SpCas9) is 5 '-NGG-3' wherein “N” is any nucleobase followed by two guanine (“G”) nucleobases. Different PAM sequences can be associated with different Cas9 nucleases or equivalent proteins from different organisms. In addition, any given Cas9 nuclease, e.g ., SpCas9, may be modified to alter the PAM specificity of the nuclease such that the nuclease recognizes alternative PAM sequence. In the CRISPR-Cas system derived from S.pyogenes (spCas9), the protospacer region DNA typically immediately precedes a 5 ' - NGG or NAG proto-spacer adj acent motif (PAM). Other Cas9 orthologs can have different PAM specificities. For example, Cas9 from S. thermophilus (stCas9) requires 5 '-NNAGAA for CRISPR 1 and 5 '-NGGNG for CRISPR3 and Neiseria menigiditis (nmCas9) requires 5 '-NNNNGATT. Cas9 from Staphylococcus aureus subsp. aureus (SaCas9) requires 5 '-NNGRRT (R=A or G). In some embodiments, Cas9 enzymes from different bacterial species (i.e. , Cas9 orthologs) can have varying PAM specificities. For example, Cas9 from Staphylococcus aureus (SaCas9) recognizes NNGRRT orNNGRRN. In addition, Cas9 from Neisseria meningitis (NmCas) recognizes NNNNGATT. In another example, Cas9 from Streptococcus thermophilis (StC as9) recognizes NNAGAAW. In still another example, Cas9 from Treponema denticola (TdCas) recognizes NAAAAC. In another example, CasX recognizes TTCN. These are example are not meant to be limiting. It will be further appreciated thatnon-SpCas9s bind a variety of PAM sequences, which makes them useful when no suitable SpCas9 PAM sequence is present at the desired target cleavage site. Furthermore, non-SpCas9s can have other characteristics that make them more useful than SpCas9.
[0157] In some embodiments, the gRNA spacer sequence comprises about 15 nucleotides to about 28 nucleotides. In certain embodiments, the gRNA spacer sequence is 17, 18, 19, 20, 21 , 22, or 23 nucleobases.Template Nucleic Acids
[0158] The AAV vectors described herein are useful in the delivery of CRISPR-Cas systems for excising regions of nucleic acids from a template nucleic acid molecule. In some embodiments, the template nucleic acid molecule can be a viral nucleic acid molecule or a viral genome. For example, exemplified herein are vectors having improved excision outcomes for CRISPR-Cas systems that target two different target sites within a human immunodeficiency virus (HIV) genome (e.g., an HIV nucleic acid molecule) or within a herpes simplex virus (HSV) genome (e.g., an HSV nucleic acid molecule). In some embodiments, the template nucleic acid molecule can be the genomes of two or more related viruses (e.g., an HSV- 1 nucleic acid molecule and an HSV-2 nucleic acid molecule). Additionally, described herein are AAV vectors that may have robust, or even improved, transcription based on the elements and order of the elements included in the AAV vector, therefore resulting in improved excision efficiency. These examples can be extended and applied to improving excision efficacy on other viral template nucleic acid molecules (e.g., viral deoxyribonucleic acid molecules). Thus, the AAV vectors described herein are, in certain instances, useful for excising a targetnucleic acid molecule from a template nucleic acid molecule in a cell. In certain emb odiments, the template nucleic acid molecule is a viral nucleic acid molecule. In certain embodiments, the viral nucleic acid molecule is an episomal nucleic acid. In certain embodiments, the viral nucleic acid molecule is an integrated nucleic acid. In certain embodiments, the viral nucleic acid molecule is an episomal and an integrated nucleic acid. In certain embodiments, the viral nucleic acid molecule is an HIV nucleic acid molecule (e.g., HIV 1 and / or HIV2). In certain embodiments, the viral nucleic acid is an HSV nucleic acid molecule (e.g., HSV- 1 and / or HSV-2).Target Nucleic Acids
[0159] The AAV vectors described herein are useful for improving excision outcomes using CRISPR-Cas systems having two different gRNAs (e.g., having different spacer sequences) for targeting the CRISPR-Cas system to two different target nucleic acid sequences for cleavage at or near the target nucleic acid sequences within a template nucleic acid molecule (e.g., a template deoxyribonucleic acid molecule). Thus, in certain instances, the targeting of CRISPR-Cas endonucleases by hybridization of the two different gRNAs to the template nucleic acid molecule generates two cleaved regions within the template nucleic acid molecule at, within, or near the two different target nucleic acid sequences and excising a region from the template nucleic acid molecule. In some embodiments, the cleaved region is proximate to the target nucleic acid sequence of the template nucleic acid. In some embodiments, the cleavage of the cleaved re gion is within 1 , 2, 3 , 4, 5 , 10, 15 , or 20 nucleobases of the target nucleic acid sequence.
[0160] Compared to indel formation, the excision of larger regions within the viral template nucleic acid molecule, in certain instances, provides for improved viral inactivation. Excision outcomes can readily be determined and / or identified by the in vitro assays described in Examples 1 and 2. In some embodiments, the two different target nucleic acid sequences are separated by a distance of at least 250, at least 500, at least 750, at least 1 ,000, at least 2,000, at least 5 ,000, or at least 8,000 nucleobases. In such embodiments, the first target nucleic acid sequence and the second target nucleic acid sequence are separated by a distance of at least at least 250, at leas t 500, at least 750, at least 1 ,000, at least 2,000, at least 5 ,000, or at least 8,000 nucleobases. Accordingly, in certain embodiments, a first cleaved region and a second cleaved region are separated by at least 500, at least 750, at least 1 ,000, at leas t 2, 000, at least 5,000, or at least 8,000 nucleobases. Furthermore, in certain embodiments, the excised regions comprise at least 500, at least 750, at least 1 ,000, at least 2,000, at least 5 ,000, or at least 8,000 nucleobases.
[0161] As described and exemplified herein, the two different target nucleic acid sequences can be located within different genes or gene regions. In such embodiments, the first target nucleic acid sequence and the second target nucleic acid sequence are located within different genes (e.g. , a first gene and a second gene). Accordingly, in certain embodiments, a first cleaved region and a second cleaved region within different genes and the excised regions comprises the nucleobases between the two different genes. In some embodiments, the one or more of the two different target nucleic acid sequences are repeated within the template nucleic acid molecule (e.g., as exemplified herein by targeting the LTR of HIV).
[0162] In addition to deletion of larger regions of a template nucleic acid molecule, excision outcomes (e.g., as opposed to indel outcomes) also include inversions of the template nucleic acid molecule and / or concatimerization of two or more template nucleic acid molecules.Microhomology
[0163] The AAV vectors described herein are also advantageous for delivering multiplexed CRISPR-Cas systems that can achieve MMEJ-mediated excision between two cleavage sites and / or over large distances (e.g. , >500 base pairs, >1 ,000 base pairs, etc.) separating the two cleaved regions through the delivery of m ultiplexed CRISPR- Cas systems having two different gRNAs. Generally, MMEJ-mediated deletions are considered to be limited to indels at single cleavage sites having smaller distances (e.g., <15 nucleotides) between microhomologous sequences. Moreover, MMEJ prediction algorithms generally reduce MMEJ predictions as a function of the distance between microhomologous sequences (e.g., reducing predicted MMEJ frequencies as the distance between microhomologous sequences increases). However, as described herein, e xcision can be achieved, in certain instances, by generating at least two cleaved regions at different target sites and having microhomology .
[0164] In some embodiments, the sequences surrounding or within cleaved regions comprises sequences having microhomology. In such instances, the target sites are chosen / selected to target sites that will generate cleaved regions having microhomology . For example, the first cleaved region comprises a sequence having microhomology to a sequence within the second cleaved region. In such embodiments, cutting the template nucleic acid molecule at the first cleaved region and cutting the template nucleic acid molecule at the second cleaved region activates microhomology-mediated end j oining (MMEJ) for rej oining template nucleic acid molecule, thereby excising a region of the target nucleic acid molecule .
[0165] In some embodiments, a cleaved region comprises about 5 nucleobase pairs 5' and 3 ' of a cleavage site to about25 nucleobase pairs 5 ' and 3 ' of a cleavage site. In some embodiments, a cleaved or cleavable region comprises about 10 nucleobase pairs 5' and 3 ' of a cleavage site to about 20 nucleobase pairs 5 ' and 3 ' of a cleavage site.
[0166] Microhomology -mediated end j oining (MMEJ), as used herein, generally refers to and includes the mechanism for double stranded breaks in a template nucleic acid molecule (e.g., within a genome), which relies on exposed microhomologous sequences (i. e., sequences having microhomology) flanking broken junction to fix DSBs in a Ku- and ligase IV-independent manner. MMEJ generally involves five steps for repairing a double stranded break: resection of the DSB ends (generally 5 ’ to 3 ’ resection), annealing of region / sequences having microhomology, removal of heterologous flaps, fill-in synthesis (i.e. , polymerase extension), and ligation. Additional pathways for repair of the cleaved or cleavable regions are described herein .
[0167] In some embodiments, microhomology can be determined by various known methods, such as Microhomology-Predictor (Bae, S. , Kweon, J. , Kim, H. et al. Microhomology -based choice of Cas9 nuclease target sites. Nat Methods 1 1 , 705-706 (2014) and MENTHU (Robust Activation of Microhomology -mediated End Joining for Precision Gene Editing Applications . Ata H, Ekstrom TL, Martinez -Galvez G, Mann CM, Dvornikov AV, Schaefbauer KJ, Ma AC, Dobbs D, Clark KJ, Ekker SC. PLOS Genetics 14(9): e l 007652), inDelphi (Max W. Shen, Mandana Arbab, Jonathan Y. Hsu, Daniel Worstell, Sannie J. Culbertson, Olga Krabbe, Christopher A. Cassa, David R. Liu, David K. Gifford, and Richard I. Sherwood. "Predictable and precise template-free editing of pathogenic variants." Nature, 2018), ForCasT (Elrick H, Nelakuditi V, Clark G, Brudno M, Ramani AK, Nutter LM. FORCAST: a fully integrated and open source pipeline to design Cas-mediated mutagenesis experiments) Lindel, and MENdel (Gabriel Martinez- Galvez, Parnal Joshi, Iddo Friedberg, Armando Manduca, Stephen C Ekker, Deploying MMEJ using MENdel in precision gene editing applications for gene therapy and functional genomics, Nucleic Acids Research, Volume 49, Issue 1 , 1 1 January 2021), each of which are herein incorporated by reference for the application of determining and / or identifying microhomology .
[0168] In some embodiments, sequences having microhomology comprise about 3 to about 20 nucleotides. In certain embodiments, the sequences having microhomology comprise greater than 2, greater than 3 , greater than 4, greater than 5 , greater than 10, or greater than 15 nucleotides.
[0169] In some embodiments, sequences having microhomology comprise about 3 to about 20 complementary nucleotides. In certain embodiments, the sequences having microhomology comprise greater than 2, greater than 3 , greater than 4, greater than 5, greater than 10, or greater than 15 complementary nucleotides.
[0170] In some embodiments, sequences having microhomology comprise about 3 to about20 nucleotides capable of annealing. In certain embodiments, the sequences having microhomology comprise greater than 2, greater than 3 , greater than 4, greater than 5, greater than 10, or greater than 15 nucleotides capable of annealing.
[0171] In some embodiments, the first and second sequences having microhomology are located in different genes. In some embodiments, the first and second sequences having microhomology are located in coding regions of different genes. In certain embodiments, the first and second sequences having microhomology are separated by a distance of at least 250, at least 500, at least 750, at least 1 ,000, at least 2,000, at least 5,000, or at least 8,000 nucleobase pairs.
[0172] In some embodiments, the microhomology comprises three or more complementary nucleotides (e.g., in a contiguous sequence) having a GC (guanine or cytosine) content greater than or equal to 50%. In some embodiments, the microhomology comprises at least 3 (e.g., at least 5, at least 10, at least 15, or at least 20) complementary nucleotides. In some embodiments, sequences within (e.g., internal to) the first cleaved region lack microhomology; and sequences within (e.g., internal to) the second cleaved region lack microhomology. In some embodiments, microhomology of sequences within (e.g., internal to) the first cleaved region is less (e.g., in number or degree) than the microhomology of first nucleic acid sequence and the second sequence; and microhomology of sequences within (e.g., internal to) the second cleaved region is less (e.g., in number or degree) than the microhomology of first nucleic acid sequence and the second sequence.
[0173] In certain embodiments, microhomologous sequences are capable of hybridizing to one another. In certain embodiments, hybridization comprises at least two nucleic acids comprising substantially complementary sequences (e.g., greater than about 75%, greater than about 80%, greater than about 85%, greater than about 90%, or greater than about 95% complementary). In certain embodiments, hybridization comprises at least two nucleic acids comprising partially complementary sequences (e.g., greater than about 40%, greater than ab out 50%, greater than about 60%, or greater than about 70% complementary). In certain embodiments, partially complementary sequences comprise one or more regions of fully or substantially complementary sequences. In certainembodiments, partially complementary sequences comprise one or more regions of fully or sub stantially complementary sequences, even if an overall complementarity is low (e.g. , a total complementarity lower than about 50%, lower than about 40%, lower than about 30%, or lower than about 20%). The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementation, variables well known in the art. For example, the greater the degree of complementation between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g. , complementarity over 35 or less, 30 or less, 25 or less, 22 or less, 20 or less, or 18 or less nucleotides) the position of mismatches becomes important (see Sambrook et al. , supra, 1 1 .7 - 1 1 .8). CRISPR-Cas systems targeting HIV or HSV
[0174] The AAV vectors exemplified and described herein are useful for e xcising regions of a template HIV nucleic acid molecule (e.g. , an HIV genome), and / or inactivating HIV. Thus, in some embodiments, provided herein are AAV vectors comprising:(1) a sequence encoding a CRISPR-Cas endonuclease;(2) a first pol III promoter and a sequence encoding a first gRNA, wherein the first gRNA hybridizes to a first target sequence within an HIV nucleic acid molecule; and(3 ) a second pol III promoter and a sequence encoding a second gRNA, wherein the second gRNA hybridizes to a second target sequence within the HIV nucleic acid molecule, wherein:(i) the first pol III promoter and the second pol III promoter are different (e.g., not the same promoter); and(ii) the first gRNA and the second gRNA are different (e.g., having a non-identical sequence).
[0175] In certain embodiments, the first and second target sequence s are adjacent or proximal to a PAM sequence comprising TTCN (CasX PAM) or NNGRRT or NNGRRN (SaCas9 PAM). In certain embodiments, the first and second target sequences are located within different genes of a viral nucleic acid molecule. In certain embodiments, the first and second target sequences are located within different genes of the HIV nucleic acid molecule. For examples, genes within HIV include, LTR, gag, pol, vif, vpr, v pu, tat, rev, env, and nef. In certain embodiments, the first and second target sequences are located within different genes of the HSV nucleic acid molecule. The first and second target sequences can be located in immediate early genes of the HSV nucleic acid molecule. Incertain embodiments, the first and second target sequences are located within different genes of the HSV nucleic acid molecule. The first and second target sequences can be located in immediate early genes of the HSV nucleic acid molecul e. In some embodiments, the first immediate early (alpha) gene region and the second immediate early (alpha) gene region targeted by the first gRNA and the second gRNA, respectively, can be found in Table 16. For example, immediate early genes within HSV include ICPO and ICP27. In certain embodiments, the firstand second target sequences are greater than 500, greaterthan 1000, greater than 1500, greater than 2000, greaterthan 5000, or greater than 7500 nucleobases apart.
[0176] In certain embodiments, the first target sequence is located within an LTRgene region of the HIV nucleic acid molecule, and the second target sequence is located within a gag gene region of the HIV nucleic acid molecule . In certain embodiments, the LTR target sequence of the HIV nucleic acid molecule is selected based on the protospacer sequences of Table 4 (e.g., the reverse complement of the protospacer sequence in Table 4). In certain embodiments, the gag target sequence of the HIV nucleic acid molecule is selected based on the protospacer sequences of Table 5 (e.g., the reverse complement of the protospacer sequence in Table 5).Table 4 - LTR Protospacer and PAM SequencesPAM underlinedTable 5 - Gag Protospacer and PAM SequencesPAM underlined
[0177] The sequences in Tables 4 and 5 generally represent consensus sequence data from the Los Alamos National Laboratory (LANL) online database (US data only). Graphical representations of these sequences are shown in FIGs. 22A and B.
[0178] In certain embodiments, the first target sequence is located within an ICPO gene region of the HSV nucleic acid molecule, and the second target sequence is located within an ICP27 gene region of the HSV nucleic acid molecule. In certain embodiments, the ICPO target sequence is selected from Table 6, and the ICP27 target sequence is selected from Table 7.Table 6Table 7Methods
[0179] Provided and exemplified herein are AAV vectors useful for methods of excising a region of a template nucleic acid. Thus, in certain instances, also provided and exemplified are methods of inactivating a virus that include use the AAV vectors for excising a viral template nucleic acid (e.g., viral genome). Accordingly, in some embodiments, provided herein are methods of excising a target nucleic acid molecule from a template nucleic acid molecule in a cell, the method comprising:(a) contacting the cell with any of the AAV vectors described herein;(b) cutting the template nucleic acid molecule at a first cleavage site;(c) cutting the template nucleic acid molecule at a second cleavage site, thereby excising the target nucleic acid molecule from the template nucleic acid molecule.
[0180] In some embodiments, provided are methods of inactivating a virus in a cell, the method comprising:(a) contacting the cell with any of the AAV vectors described herein;(b) cutting the template nucleic acid molecule at a first cleavage site;(c) cutting the template nucleic acid molecule at a second cleavage site, thereby excising the target nucleic acid molecule from the template nucleic acid molecule and inactivating the virus.
[0181] In certain embodiments, cutting the template nucle ic acid molecule at the first cleavage site generates a first cleaved region and cutting the template nucleic acid molecule at the second cleavage site generates a second cleaved region, wherein the first and second cleaved region each comprise a sequence having microhomology (e.g., to one another). In certain embodiments, generating the first and second cleaved region activates microhomology-mediated end joining (MMEJ), and the template nucleic acid molecule is rejoined by MMEJ, thereby excising the target nucleic acid molecule.
[0182] In some embodiments, the template nucleic acid molecule is a viral nucleic acid molecule (e.g., viral template deoxyribonucleic acid molecule). In some embodiments, the virus is HIV. In some embodiments, the virus is HSV.
[0183] In certain embodiments, the cell is a human cell. In certain embodiments, the cell is in an individual.Exemplary Definitions
[0184] The determination of percent identity or percent similarity between two sequences can be accomplished using a mathematical algorithm. A no n-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Set. USA 87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Set. USA 90 :5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol.Biol. 215 :403-410. Alternatively, PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. Additional algorithms for sequence analysis are known in the art and include ADVANCE and ADAM as described in Torellis and Robotti, 1994, Comput. Appl. Biosci. 10:3-5; and FASTA described in Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85 :2444- 8. Alternatively, sequence alignment may be carried out using the CLUSTAL al gorithm (e.g. , as provided in the program Clustal-omega), as described by Higgins et al., 1996, Methods Enzymol. 266 :383 -402.
[0185] As used herein, the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “include” and “includes”) or “containing” (and any form of containing, such as “contain” and “contains”), are inclusive or open-ended and do not exclude additional, unrecited elements or process steps. As also used herein, in any instance or embodiment described herein, “comprising” may be replaced with “consisting essentially of’ and / or “consisting of’ , used herein, in any instance or embodiment described herein, “comprises” may be replaced with “consists essentially of” and / or “consists of” .
[0186] As used herein, the term “about” in the context of a given value or range includes and / or refers to a value or range that is within 20%, within 10%, and / or within 5% of the given value or range.
[0187] As used herein, the term “and / or” is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, “A and / or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (i ii) A and B, just as if each were set out individually herein.
[0188] As used herein, a “ sample” includes and / or refers to any fluid or liquid sample which is being analyzed in order to detect and / or quantify an analyte. In some embodiments, a sample is a biological sample. Examples of samples include without limitation a bodily fluid, an extract, a solution containing proteins and / or DNA, a cell extract, a cell lysate, or a tissue lysate. Non -limiting examples of bodily fluids includeurine, saliva, blood, serum, plasma, cerebrospinal fluid, tears, semen, sweat, pleural effusion, liquified fecal matter, and lacrimal gland secretion.EXAMPLESExample 1 : Design and Evaluation of Various Configurations in an HIV -1 Knock-in Cell Line.Materials and MethodsDesign of 14 AAV configurations.
[0189] This work considered three AAV vector designs (FIG. 1). Design 1 included the following components in order: a Polymerase III promoter (Pol III 1 ) for expressing the first guide RNA (gRNAl ) and scaffold sequence (Scaffoldl), a Polymerase III promoter (Pol III 2) for expressing the second guide RNA (gRNA2) an d scaffold sequence (Scaffold2), a promoter (e.g. , CMV promoter) for expressing a nucleic acid encoding Cas editor, a nuclear localization signal (NLS 1), a nucleic acid encoding Cas editor (e.g., SaCas9, PlmCasX), a nuclear localization signal (NLS2), and a polyadenylation sequence (e.g., SV40 polyA). Variations of Design 1 are provided in Table 8, including pL-C-0201 , pL-C-0202, pL-C-0204, pL-C-0205, pL-C-0206, pL-C- 0207, pL-C-0208, pL-C-0209.
[0190] Design 2 included the following components in order: a promoter (e.g., CMV promoter) for expressing a nucleic acid encoding Cas editor, a nuclear localization signal (NLS 1 ), a nucleic acid encoding Cas editor (e.g. , SaCas9, PlmCasX), a nuclear localization signal (NLS2), a poly adenylation sequence (e.g., SV40 polyA), a Polymerase III promoter (Pol III 1 ) for expressing the first guide RNA (gRNAl ) and scaffold sequence (Scaffoldl), and a Polymerase III promoter (Pol III 2) for expressing the second guide RNA (gRNA2) and scaffold sequence (Scaffold2). Variations of Design 2 are provided in Table 6, including pL-C-0210, pL-C-021 1 , pL-C-0212.
[0191] Design 3 included the following components in order: the reverse complement of the first gRNA scaffold sequence (Scaffold l), the reverse complement of a nucleic acid encoding the first gRNA guide sequence (gRNAl ), the reverse complement of a Polymerase III promoter (Pol III 1 ) for expressing the first guide RNA, a promoter (e.g., CMV promoter) for expressing a nucleic acid encoding Cas editor, a nuclear localization signal (NLS 1 ), a nucleic acid encoding Cas editor (e.g., SaCas9, PlmCasX), a nuclear localization signal (NLS2), a poly adenylation sequence (e.g., SV40 polyA), a Polymerase III promoter (Pol III 2) for expressing the second guide RNA (gRNA2) and scaffoldsequence (Scaffold2). Variations of Design 3 are provided in Table 6, including pL-C- 0213 , pL-C-0214, pL-C-0215.
[0192] For Type II Cas nucleases (e.g., SaCas9), the gRNA scaffold was located after the guide RNA sequence, while for Type V Cas nucleases (e.g., PlmCasX), the gRNA scaffold was located before the guide RNA sequence.
[0193] The SV40 nuclear localization signal (referred to herein as NLS1 ), and the Nucleoplasmin (referred to herein as NLS2) was evaluated.
[0194] The plasmids expressing the 14 AAV configurations (Table 8) were synthesized and prepared at GenScript.
[0195] The sequences for individual components of the 14 vector configurations are provided in Table 9.Table 8: Summary of the 14 AAV configurations tested in the inventionTable 9: Sequences for different AAV vector components.Designing the HIV-1 knock-in reporter construct.
[0196] The HIV - 1 knock-in reporter construct (FIG. 2) provides two cassettes flanked by two AAVS1 CRISPR target sites. The first cassette was used to generate the knock- in cell line and includes a PGK promoter-driven EGFP reporter, followed by a P2 A self- cleaving peptide (P2A1), a puromycin resistant gene sequence (PuroR), and a human growth hormone polyA signal (hGH pA). The second cassette is a minigene splicing reporter cassette, which was used to evaluate the excision efficiency of gRNA pairs targeting the HIV-1 LTR-U3 region and Gag gene. The LTR-U3 region, an artificial Exon containing multiple stop codons, and Gag gene were inserted into Intron 1 of the rat insulin 2 (Ins2) gene. The potential splicing acceptor and splicing donor sites in the LTR- U3 region and Gag gene sequence were predicted using the BDGP splicing predictor program and then removed. Exon 2 of Ins2 was followed by a P2A self-cleaving peptide(P2A2), an mTagBFP2 reporter, another P2A self-cleaving peptide (P2A3), a blasticidin resistance gene sequence, and a bovine growth hormone poly A signal (BGH pA). Before LTR1 and GagD-induced excision occurred, the exon containing multiple stop codons was spliced into the insulin 2 transcript, resulting in the absence of expression for the downstream mTagBFP2 reporter and blasticidin resistant gene. However, the excision induced by LTR1 gRNA and GagD gRNA removed the exon with stop codons, and allowed for the expression of the downstream mTagBFP2 reporter and blasticidin resistant gene.
[0197] The full construct was synthesized and prepared at GenScript.
[0198] The sequences for components in the HIV-1 knock-in reporter construct are shown in Table 10.Table 10: Sequences for important components in the HIV-1 knock-in reporter construct.Generation of HIV-1 knock-in reporter cell line.
[0199] To generate the HIV- 1 knock-in reporter cell line, 0.5 pg of the HIV-1 knock- in reporter construct and a ribonucleoprotein (RNP) complex were nucleofected into 2.5E+05 human embryonic kidney (HEK) 293FT cells. The RNP complex consisted of 20 pmol of SpCas9 protein (Synthego) and 40 pmol of AAVS 1 guide RNA (Synthego). Nucleofection was performed using the SF Cell Line 4D-Nucleofector X Kit S (Lonza) and the program CM-130 in a 4D-Nucleofector System (Lonza), following the manufacturer's protocol.
[0200] To enrich cells bearing the HIV- 1 knock-in reporter construct, cells were treated with 0.5 pg / mL of puromycin dihydrochloride (Thermo Fisher Scientific) for 10 days, starting at 96 hr post-nucleofection. The enriched cells were then serially diluted to a final concentration of 0.45 cells per 100 ml. Each well of a 96 -well plate was plated with 100 pl of diluted cells. The cells were incubated in a 5% CO2, 37°C incubator for 2 weeks.
[0201] To identify single-cell clones containing the HIV- 1 knock-in reporter construct, the EGFP expression in 293FT cells expanded from individual clones was analyzed using an Attune NxT Flow Cytometer (Thermo Fisher Scientific). A clone containing >94% EGFP-positive cells was selected for further expansi on and used in the later reporter assay .
[0202] The sequence of the AAVS 1 guide RNA was: 5 ’- CCUCUAAGGUUUGCUUACGA-3 ’ (SEQ ID NO : 27).Production of AAV 6 crude lysates.
[0203] AAV6 crude lysates were produced using the triple plasmid transfection method. 7.5E+5 AAVpro 293T cells were seeded in individual wells of a six -well plate and transfected with 0.15 pmol of pALD -HELP (Aldeveron), 0. 15 pmol of pAAV6-RC (Takara), and 0. 15 pmol of AAV transgene plasmid, along with Transporter 5 Transfection Reagent (PEI; Thermo Fisher Scientific) at a 3 : 1 ratio of PEI to DNA. After five hours of transfection, a glucose solution (Thermo Fisher Scientific; 200 g / L) was added to the medium to achieve a final concentration of 3 g / L. The cells were then incubated at 37°C in a 5% CO2 incubator.
[0204] After 48 hours of transfection, the cells from each well were collected using 500 pl of PB S solution (Thermo Fisher Scientific) supplemented with 0.001 % of Pluronic F-68 (Thermo Fisher Scientific). AAV particles were released from the cells through three freeze / thaw cycles using dry ice-ethanol and a 37°C water bath. To degrade the DNA outside of the AAV particles, 50 U / ml of benzonase (Sigma) was added to the virus-released solution and incubated for 30 minutes at a 37°C water bath. The cells were then centrifuged at 13000 rpm for 30 seconds to remove cell debris, and the supernatant was harvested and stored in a -80°C freezer.Excision assay in HIV-1 knock-in reporter cell line.
[0205] The excision assay was conducted in a 96 -well culture plate with HIV-1 knock- in reporter cells seeded at a density of 2E+4 cells per well. After 24 hours of seeding, 30 pl of the AAV6 crude lysates prepared from the small scale packaging assay were added to each well and incubated at 37 oC in a 5% CO2 incubator. The percentage of mTagBFP2 and EGFP double positive cells was quantified using an Attune NxT Flow Cytometer (Thermo Fisher Scientific) at Day 3 and Day 6 post AAV infection. These percentages were used to represent the excision efficiency induced by LTR1 and GagD gRNAs. Results
[0206] Three AAV vector designs were evaluated (FIG. 1). Design 1 featured two guide RNA expression cassettes on the left side and a Cas editor expression cassette on the right side. All three expression cassettes were in the 5 ’ to 3 ’ orientation. Design 2 was featured two gRNA expression cassettes on the right side and a Cas editor expression cassette on the left side. Again, all three expression cassettes were in the 5 ’ to 3 ’ orientation. Design 3 had the two gRNA expression cassettes in a divergent orientation, flanking the Cas editor expression cassette in the middle.
[0207] Based on these three designs, 14 AAV-SaCas9 configurations were further designed and synthesized. The AAV size, including the two ITRs, ranged from 4585 bp to 5083 bp (Table 8).
[0208] For Design 1 , eight different AAV configurations were designed by modifying various components such as the Pol III promoters, guide RNAs, guide RNA scaffold sequences, Pol II promoter for SaCas9 expression, and the polyA signal. The VI guide RNA scaffold was the original SaCas9 guide RNA scaffold, which included four continuous Ts after the guide sequence. These continuous Ts serve as a pause signal for RNA polymerase III. Many of the AAV configurations incorporated the engineered V2 guide RNA scaffold, in which the f ourth T in the sequence of TTTT was mutated to C. To reduce the size of the AAV, different versions of truncated CMV promoters, such as 268CMV (truncated to 268 bp) and 180CMV (truncated to 180 bp), as well as smaller polyA signals like SV40 polyA and synthetic poly A (SPA), were evaluated.
[0209] For Design 2, an AAV configuration called pL-C-0210 was designed. The pL- C-0210 vector utilized two U6 promoters to drive LTR1 and GagD gRNA expression.The vector contained the V 1 guide RNA scaffold sequence, CMV promoter, and BGH polyA signal. The pL-C-0210 did not comprise a 3 X hemagglutinin (HA) tag. Compared to pL-C-0210, the CMV promoter and BGH polyA in pL-C-0211 were replaced with a 346CMV promoter and a short BHG polyA (sBGHpA) signal. pL-C-0212 had the same expression cassettes for guide RNAs and SaCas9 as pL-C-0201, but the positioning of the two guide RNA expression cassettes differed. In pL-C-0201, they were located on the left side of the SaCas9 expression cassette, while in pL -C-0212, they were located on the right side.
[0210] All three AAV configurations in Design 3 utilized two U6 promoters to drive the expression of LTR1 and GagD guide RNAs. However, they differed in the guide RNA scaffold sequence and polyA sequence.
[0211] An HIV- 1 knock-in reporter HEK 293FT cell line was generated to evaluate the excision efficiency induced by SaCas9 and LTR / GagD guide RNAs (FIG. 2). The target sequences in this cell line were the LTR-U3 region and Gag gene (both sequences were from the HIV NL4-3 strain). Before excision occurs, the exon containing multiple stop codons was spliced into the transcript, resulting in the ab sence of expression for the downstream mTagBFP2 and Blasticidin genes. However, the excision induced by the LTR1 gRNA and GagD gRNA removed the exon with stop codons, allowing for the expression of the downstream mTagBFP2 and Blasticidin genes. In this reporter cell line, the PGK promoter -EGFP-P2A-Puromycin cassette was used for single cell clone selection, while the downstream HIV- 1 containing cassette was used to evaluate the excision efficiency. The HIV- 1 LTR-U3 region and Gag gene sequence from the HIV-1 NL4-3 strain flank an exon with multiple stop codons, which was spliced into the rat Insulin 2 transcript at nucleobaseline, resulting in the ab sence of expression for the downstream mTagBFP2 reporter. However, the excision induced by LTR1 and GagD guide RNAs removed the DNA sequence between the LTR1 and GagD target sites, including the exon with stop codons. This allowed for the expression of the downstream mTagBFP2 reporter. The percentage of mTagBFP2+ EGFP+ cells can be used to measure the LTR1 and GagD-induced excision efficiency. Therefore, this HIV- 1 knock-in reporter HEK 293 FT cell line was a valuable tool for evaluating the excision efficiency of guide RNA pairs targeting the LTR and Gag sequences.
[0212] Next, crude lysates of AAV6-SaCas9 vectors were prepared from the 14 AAV- SaCas9 transgene plasmids. These lysates were used to infect the HIV - 1 knock-in reporter cells, and the excision efficiency induced by L TRI and GagD was analyzed at 3 days and 6 days post AAV infection (FIG. 3). FIG. 3 illustrates the relative excisionefficiency in the HIV-1 knock-in reporter cell line on Day 3 and Day 6 when induced by AAV6 crude lysates produced with the 14 AAV transgene plasmids. The data is normalized to AAV6-0210 (Day 3 ) and presented as the fold increase over AAV6-0210 (Day 3 ), with the mean + standard deviation shown (n = 2). Among the 13 AAV6 vectors, all showed higher efficiency than AV6-0210. The AAV6 vectors that performed the best in inducing excision were AAV6-0201, AAV6-0204, AAV6-0205, AAV6-0206, AAV6- 0207, AAV6-0208, AAV6-0209, and AAV6-0212. Out of these eight vectors, only AAV6-0206 had a size larger than 4.7 kb. The other seven AAV vectors had a size smaller than 4.7 kb and were selected for further evaluation.Example 2 : Evaluation of Seven Configurations in Hela Cells.Materials and MethodsTransfection of Hela cells.
[0213] Hela cells (ATCC) were seeded in 60 mm dishes. After 24 hours, the cells were transfected with 6 pl of Lipofectamine 3000 (Thermo Fisher Scientific), 1 .5 pg of HIV- 1 plasmid pNL4-3, and 1 .5 pg of AAV plasmid. Each transfection was conducted with biological replicates. DNA and RNA extraction was performed 72 hours after transfection.Reverse transcription quantitative real-time PCR (RT-qPCR).
[0214] Total RNA was extracted from Hela cells using the Monarch Total RNA Miniprep Kit (New England Biolabs) following the manufacturer's instructions. The residual genomic DNA was removed using Ambion DNase I (Thermo Fisher Scientific). The RNA was then reverse transcribed into cDNAs using M-MLV Reverse Transcriptase (Thermo Fisher Scientific) following the manufacturer's instructions. qPCR assays of gRNA and mRNA expression were carried out in a LightCycler 480 real -time PCR system (Roche), using the Luna Universal Probe qPCR Kit (New England Biolab s). The cycling parameters were as follows: 1 cycle at 95 °C for 1 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec. Each sample was assayed in technical duplicate. The expression levels of LTR1 , GagD, and SaCas9 were normalized to the expression levels of beta-actin. The primer and probe sequences forLTRl , GagD, SaCas9, and beta-actin are listed in Table 11 . The LTR1 and GagD gRNAs share the same reverse primer and probe.Table 11: Primer and probe sequences for RT-qPCR.5G and G3 digital droplet PCR (ddPCR) excision assays.
[0215] The 5G ddPCR excision assay was used to quantify the excision efficiency of the fragment between the 5' LTR1 target site and the GagD target site. Meanwhile, the 3 G ddPCR excision assay was used to quantify the excision efficiency of the fragment between the GagD target site and the 3 ' LTR1 target site. The primers and probes for ddPCR were designed using the online primer design software Primer3Plus. The sequences for the ddPCR primers and probes are listed in Table 12.
[0216] For the ddPCR experiments, the ddPCR supermix for Probes reagents was used in a QX200 Droplet Digital PCR system (Bio-Rad Laboratories). A total of 50-100 ng DNA was used as the template for ddPCR amplifications, and the thermal cycling conditions consisted of 95°C for 10 min, followed by 45 cycles of 94°C for 30 sec and 60°C for 1 min. Data acquisition and analysis were performed using the QX200 droplet reader and the QuantaSoft software provided with the instrument. The on -target ddPCR signals were normalized to human TERT DNA.Table 12: Primer and probe sequences for ddPCR excision assays.Results
[0217] Seven AAV vector configurations were selected from the transduction assay conducted in the HIV- 1 knock-in reporter HEK 293FT cell line. To further refine the AAV vector configurations, Hela cells were co -transfected with each of these seven AAV transgene plasmids along with the HIV - 1 plasmid pNL4-3, which contains the LTR1 and GagD target sites.
[0218] Next, the expression levels of LTR1 , GagD, and SaCas9 were quantified from RNA extracted from the co-transfected cells and normalized to the expression levels of beta-actin (FIG. 4A-C; mean + standard deviation, n = 2). Among the seven AAV transgene plasmids, pL-C-0209 exhibited the highest expression levels of LTR1 , GagD, and SaCas9, followed by pL-C-0212.
[0219] To better quantify the excision efficiency induced by LTR1 and GagD, two gain-of-signal ddPCR excision assays, 5 G and G3, were developed (FIG. 5A). The AAV plasmids expressed both LTR1 gRNA and GagD gRNA, which could excise o ut the fragment between the 5 ' LTR1 target site and the GagD target site (1 .0 kb), or between the GagD target site and the 3 ' LTR1 target site (8.1 kb), or between the 5 ' LTR1 target site and the 3 ' LTR1 target site. The 5 G ddPCR excision assay captured th e first excision event, while the G3 ddPCR excision assay captured the second excision event. The 5G ddPCR excision assay was used to measure the excision efficiency of the fragment between the 5 ' LTR1 target site and the GagD target site. At nucleobaseline, the 5G ddPCR forward and reverse primers were 1 . 1 kb apart and did not produce effective ddPCR signals. However, afterthe excision of the fragment between the 5 ' LTR1 target site and GagD target site, the 5 G ddPCR primers were 149 bp apart (including the primer sequences) and generated effective ddPCR signals. The 3 G ddPCR excision assay measured the excision efficiency of the fragment between the GagD target site and the 3' LTR1 target site. At nucleobaseline, the G3 ddPCR forward and reverse primers were 8.3 kb apart and did not produce ddPCR signals. However, after the excision of the fragment between the GagD target site and 3 ' LTR1 target site, the G3 ddPCR primers amplified a 228 bp amplicon and generated effective ddPCR signals.
[0220] The copy numbers quantified from the 5G and G3 ddPCR assays were normalized to the copy numbers of TERT, which had two copies / alleles per Hela cell. Consistent with the gRNA and SaCas9 expression level data, pL -C-0209 showed thehighest excision efficiency of the fragment b etween the 5' LTR1 target site and the GagD target site (FIG. 5B; mean + standard deviation, n = 2), followed by pL-C-0212. Similarly, pL-C-0209 exhibited the highest excision efficiency of the fragment between the GagD target and the 3 ' LTR1 target site (FIG. 5C; mean + standard deviation, n = 2), followed by pL-C-0212.
[0221] These data showthat pL-C-0209 and pL-C-0212 were the two best -performing AAV expression plasmids among the seven AAV transgene plasmids studied in the cotransfection experiment.
[0222] To mitigate potential AAV backbone packaging, a 2516 bp stuffer sequence derived from the human ACTB gene (NCBI Reference Sequence: NG 007992.1) was engineered (FIG. 6). Firstly, the splicing acceptor (Sa) and splicing donor (Sd) sites in the ACTB gene's sequence were predicted using the BDGP splicing predictor program and then removed to prevent unexpected splicing. Since CpG sites in AAV vectors can be recognized by Toll-like receptor 9 (TLR9), leading to the activation of the innate and adaptive immune system, CG sequences in the ACTB gene were replaced with TG sequences. Additionally, the potential start codons ATG and CTG on both strands of the ACTB gene were replaced with AAG to avoid unexpected translational initiation. Finally, any homopolymeric sequences (>4 nucleobase pairs) were removed to facilitate plasmid amplification. The resulting sequence was the ACTB stuffer sequence, which was added to the AAV plasmid backbone sequences of pL-C-0209 and pL-C-0212. The plasmids with the ACTB stuffer sequence were pL-C-0326 (Configuration 1 ; constructed from pL-C-0209) and pL-C-0327 (Configuration 2; constructed from pL-C-0212). The backbone size (including the two ITRs) in plasmids pL-C-0326 and pL-C-0327 is 5324 bp, which was larger than the 4.7 kb AAV packaging siz e.
[0223] The sequence of the ACTB stuffer sequence is SEQ ID NO: 47 (2516 bp):CTCACCAAGGAAGAAGATATTGAAGTGCTTGTTGTTGACAAAGGCTAAGGCA AGTGCAAGGAAGGCTTTGTGGGTGAAGAAGCCCCAAGGGAAGTGTTCCCCT CCTTTGTGGGGTGCCCCTTGCACCAAGTAGGGGAGAAGGAAGGGTGGGGCTF CCAAGGGAGTGGGTGGGAGGCAAGGGTGCTTTCTAAGCACTTGAGCCTCAA GGTTTAAGGGGTGGTGGAAGTGCAAGTGCTCTTGGCTTCTTGTCCTTTCCTTC CCAAACAGTGAAGGTGGGCAAGGGTCTTAAGGATTCCTAAGTGGGTGAAGA GGCCCTTAGCAAGAGAGGCTTCCTCACCAAGAAGTACCCCTTTGAGCAAGGC TTTGTCACCAAAAGGGAACACAAGGAGAAAATAAGGCACCACACCTTCTAC AAAGAGAAGTGTGTGGCTCAAGAGGAGCACCAAGTGAAGAAGAAAGAGGC CACCAAGAACCCCAAGGCCAAAAGTGAGAAGAACACCCAATTGAGTGGCAA GCTACCTCTTAAGGTGGAAGCCTCCCTCCTTCAAGGCCTCAAGGAGAAGTGC CCTTTCTCAAAGGTTCTCTCTTAAGAAGTTTTAAGTGAGACTCTCTTCTAAGA CAAGAGTCTCCTTTGGAACTAAGCTTGTTCTATTTGCTTAATCCCAAAAGAGC TCTTAATAAGGTGTTTGTCTCTAAGACTAGGTGTCTAAGACTTTGTTGTGGGTGTAGGTACTAACAAAGGCTTGTGTGACAAGGCCAAGAGGAAGGTGTAAAGTGGCCTTGGAGTGTGTATTAAGTAGGTGCACTTTAACTAAGAACTTACTCCCCTTCCCAAGACCCCTTCACACTTAGAAGTGTTCTTTGCACTTTAAGCAAGTCCCAACTAAGGCAAGGAAGTCCCCTTTGGCTTCCCCTTTGTGACAAGGTGTATCTAAGCCTTACAAATCAAGTTTCAGACCTTCAACACCCCTTCCAACTAAGTTGCTATCCTTGAAGTGCTATCCAACTAAGCCTAAGGAAGTACCAAAGGCTTTGTGAAGGACTAAGGTGAAGGGGTCACCCACAAAGTGCCCTTCTAAGAGGGCTAAGCCCTCCACCAAGCCTTCAAGTGTAAGGACAAGGAAGGAAGGGACAAGAAAGACTACCTCAAGAAGATCCTCAAAGAGTGTGGCTACTTCTTCACCACCAAGGAAGAGTGGGAAATTGTGTGTGACTTTAAGGAGAAGAAGTGCTAAGTTGCCAAGGACTTTGAGCAAGAGAAGGCCAAGGAAGCTTCCTTCTCCTCCAAGGAGAAGAGCTAAGAGAAGCAAGAAGGCCTTGTGTTCACCTTTGGCAAAGAGTGGTTAAGAAGCCAAGAGGCACTCTTCCTTCCTTCCTTCAACAGTGAGTGGAGAAAGTCTCAAGGCTAAGCAAGACAAGAGGGTTACCCCTTGGGGAAGTGAAGTGGAAGCTAAGTCAAGCCCTCTTTTCCCTCTCAAGCAAGGAGTCAAGTGGCTTCCAAGAAACTACCTTCAACTCCTTCAAGAAGTGTGAAGTGGACTTAAGCAAAGACAACTAAGCCAACACTTTGAAGTAAGGTGGCACCACCAAGTACCAAGGCTTTGAACACTTGAAGCTTAAGGAGATCAAAGCCAAGGCACCCTTCACAAAGAAGATCAAAGTGGGTGTCTTTCAAGCAAGAGAACACAAGGGCTTGTTGGAAGTGGGGTCAAGTGGTGTGTGGGGAGAAGTCACTTCCTTGGTCCTCAAAGCAAGTCCCCTTCCCTCCTCAAATCTTTGCTCCTCAAGAGTGCAAGTACTAAGTGTGGATTGGTGGCTCCTTCAAGGCCTTGAAGTCCACCTTCCTTCTTAAGTGGATCTTCAAGCTTGAGTAAGAAGAGTAAGGCCCCTCCTTTGTCCAAAGCAAAAGCTTCTAGGTGGACTAAGACTTAGTTGTGTTACACCCTTTCTTGACAAAACCTAACTTGTGCTTAAAACAAGAAGAGATTGGCAAGGCTTTATTTGTTAATTTTGTTTAGTTTAGCTTAGTTAATTAGTTTAGGCTTGACTCTTGATTTAAGAAAAGGAAAGGTGAAGGTGACTTCTTTAGGTTGGAGTGAGCTTCCACCAAAGTTCACAAAGTGGAAGAGGACTTTGATTGCACTTTGTTGTTAATTGAATAGTCTTTCCAAATAAGAGAAGTGTTGTTACTTGAAGTCCCTTGCCTTCCTAAAAGCCACCCCACTTCTCTCTAAGGAGAAAGGCCCTTTCCTCTCCCAAGTCCACACTTGGGAGGTGATAGCTTTGCTTTTGTGTAAATTAAGTAAAGCAAAATTGATTTAATCTTTGCCTTAATACTTAATTATTTAGTTTTATTTTGAAAGAAGAGCCTTTGTGCCACCACTTCCACCTTAATTGTCCACCAACTTGAGAAGTAAGAAGGCTTTTGATCTCCAAGGGAGTGGGTGGAGGCTTCCTTGGCTTACAAGTACAAAGACTTGAGATCTTTAGAATAAAAGTGCACACCTTAAGGAAGAExample 3: Evaluation of Selected AAV-SaCas9 Vectors in HIV-1 Tg26 Mice. Materials and MethodsProduction of AAV9 vectors.
[0224] The AAV9 vectors were prepared at the University of North Carolina Chapel Hill Vector Core. Triple plasmid transfection was performed in suspension HEK 293 cells, and the vectors were subsequently purified by column chromatography. The titer of the AAV9 vectors was determined using QIAcuity digital PCR (Qiagen) with two primer / probe sets. One set targeted the CMV promoter sequence, while the other set targeted the SV40 polyA sequence. The primer and probe sequences can be found inTable 13 The average titers obtained from these two primer / probe sets were used as the AAV titers for the AAV9 vectors.Table 13: Primer and probe sequences for AAV titering.Animals.
[0225] Animal studies were conducted at Temple University and approved by the Institutional Animal Care and Use Committee (IACUC). All procedures were performed in accordance with Temple University' s IACUC policies and the ethical guidelines of the National Institutes of Health (NIH).
[0226] The HIV- 1 Tg26 transgenic mice (Jackson Lab, #022354) used in the study harbor a truncated HIV- 1 NL4-3 genome with a 3.1 kb deletion in the Gag and Pol regions. This deletion renders the latent provirus replication deficient. The original Tg26 mice were on the FVB / NJ background and were backcrossed with C57BL / 6J mice (Jackson Lab, #000664) for at least eight generations. This was done to generate Tg26 mice on a complete C57BL / 6J background, which limits secondary disease and allows the mice to survive up to 12 months of age. For the study, heterozygotes (+ / -) mice between 8 and 12 weeks old were utilized.
[0227] The mice were inj ected with either 200 pl of AAV formulation buffer (PBS + 0.001% Pluronic F-68) or 200 pl of AAV9 vectors at a dose of 3 .66E+11 vector genome (VG) via the tail vein. Four weeks after AAV administration, spleen, trigeminal ganglion (TG), heart, and liver were harvested for DNA and RNA analysis.DNA analysis.
[0228] Genomic DNA was isolated from tissues using the NucleoSpin Tissue kit (Macherey -Nagel) according to the manufacturer's instructions. ddPCR was performed using the ddPCR Supermix for Probes reagents in the QX200 Droplet Digital PCR system (Bio-Rad Laboratories). Two different operators independently extracted genomic DNAand performed ddPCR. The average results from both operators were used for DNA analysis.
[0229] For ddPCR amplifications, 5 -50 ng of DNA was used as a template with thermal cycling conditions of 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 sec and 61 °C for 1 min. Data acquisition and analysis were carried out using the QX200 droplet reader and QuantaSoft software provided with the instrument.
[0230] The number of vector genome copies in individual tissues was quantified using a ddPCR assay and a primer / probe set targeting the U6 promoter region in the AAV vector genome. The number of HIV- 1 genome copies was determined using a ddPCR assay and a primer / probe set targeting the HIV- 1 region. Since the Tg26 mice contain 10-20 copies of the HIV- 1 transgene, restriction digestion was performed with Xho enzyme for the HIV-1 ddPCR to break down the multiple copies of the HIV -1 transgene.
[0231] The U6 and HIV- 1 copy numbers were normalized to the copy number of the mouse Tert DNA sequence to calculate the AAV and HIV- 1 copy numbers per cell.
[0232] The ddPCR primer and probe sequences are listed in Table 14.Table 14: Primer and probe sequences for DNA analysis in Tg26 mice.RNA analysis.
[0233] Total RNA was extracted from tissues using Monarch Total RNA Miniprep Kit (NEB) according to the manufacturer's protocol. Afterwards, DNAse I treatment was performed and RNA cleanup was done using the Monarch RNA Cleanup Kit (NEB). The RNA was then reverse transcribed into cDNA using ProScript II F irst Strand Synthesis Kit (NEB) following the manufacturer's instructions.
[0234] The cDNA was diluted and quantified using ddPCR with the QX200 Droplet Digital PCR system (Bio-Rad Laboratories). Two different operators independentlyextracted total RNA, performed reverse transcription, and conducted ddPCR. The average results from both operators were used for RNA analysis.
[0235] The primer and probe sequences for amplifying the expression of LTRl / GagD gRNAs and SaCas9 for the AAV9 vectors are the same as those listed in Table 11. However, a different probe was used to amplify the expression of LTRl / GagD gRNAs for the control vector (Table 15). Additionally, a differentprimer / probe set was used to amplify the expression of SaCas9 for the control vector (Table 15). The expression of LTRl / GagD gRNAs and SaCas9 was normalized to the expression of the mouse betaactin gene (Table 15)
[0236] The thermal cycling conditions used were 95°C for 5 min, followed by 40 cycles of 95°C for 30 sec and 57°C for 1 min.Table 15: Primer and probe sequences for RNA analysis in Tg26 mice.Results
[0237] The two most successful AAV vector configurations from previous experiments, pL-C-0326 and pL-C-0327, were utilized to generate AAV9 vectors and assessed in HIV-1 Tg26 transgenic mice (FIG. 7). These mice carry a transgene derived from the HIV-1 NL4-3 strain genome, with a 3 . 1 kb deletion spanning the C -terminal of the Gag and the N-terminal of the Pol genes. The control vector was also an AAV9 vector. The plasmid for the control vector contained an Ampicillin resistant gene.
[0238] An AAV9-0387 vector was generated, replacing the 268CMV promoter in AAV9-0327 with the 180CMV promoter (FIG. 7). This vector, also considered as aConfig 2 AAV vector, was also evaluated in the Tg26 mice, along with the other three AAV9 vectors.
[0239] AAV biodistribution was examined in the spleen, trigeminal ganglion (TG), heart, and liver of Tg26 mice treated with either buffer or AAV9 vectors using ddPCR (FIGs. 8A-8D) The spleen contains abundantlymphocytes and macrophages, which are the primary targets of HIV- 1 infection and potential HIV- 1 reservoirs.
[0240] None of these four tissues showed AAV transduction in the co ntrol animals that were inj ected with the AAV formulation buffer (FIGs. 8A-8D). The control vector and the three new AAV9 vectors exhibited similar AAV biodistribution in these four tissues. The liver showed the highest AAV biodistribution, followed by the heart, spleen, and TG. The AAV9-0326 vector corresponds to Configuration 1 (Config 1 ), while the AAV9-0327 and AAV9-0387 vectors correspond to Configuration 2 (Config 2). Data in FIGs. 8A-8D is shown as mean + standard deviation (n = 3 , 4, or 5).
[0241] Next, the expression of LTR1 gRNA, GagD gRNA, and SaCas9 was examined in the spleen (FIGs. 9A-9C), TG (FIGs. 10A-10C), heart (FIGs. 11A-11C), and liver (FIGs. 12A-12C) of Tg26 mice treated with either AAV buffer or A A V9 vectors. In the spleen, all four AAV9 vectors showed similar expression levels of LTR1 gRNA and GagD gRNA (FIGs. 9A-9C). Among the three new AAV9 vectors, only AAV9-0387 exhibited significantly higher expression of SaCas9 compared to the control vector. In the TG, the AAV9-0326, AAV9-0327, and AAV9-0387 AAV9 vectors showed a tendency of increased expression of LTR1 gRNA, GagD gRNA, and SaCas9 compared to the control vector (FIGs. 10A-10C). In the heart, AAV9 -0326 demonstrated significantly higher expression of LTR1 gRNA and GagD gRNA compared to the other three AAV9 vectors (FIGs. 11A-11C) However, all four AAV9 vectors showed comparable expression levels of SaCas9 in the heart. In the liver, although the control vector and AAV9-0326 exhibited a trend of higher expression of LTRl gRNA and GagD gRNA, and lower expression of SaCas9 compared to AAV9-0327 and AAV9-0387(FIGs.12A-12C) In FIGs. 9A-9C, FIGs. 10A-10C, FIGs. 11A-11C, and FIGs. 12A-12C, data are shown as mean + standard deviation (n = 3 , 4, or 5). Comparisons were performed using one-way ANOVA followed by the Tukey's multiple comparison test. Only differences that showed statistical significance (p<0.05) are displayed .
[0242] To assess the reduction of HIV-1 genomic DNA by AAV9 vectors, the number of HIV- 1 genome copies was determined using a ddPCR assay targeting the HIV-1 region (FIGs. 13A-13D). In Tg26 mice inj ected with AAV buffer, the spleen and TG exhibited an average HIV- 1 copy number of 12, while the heart and liver had an averageof 13.5 copies. In the liver, AAV9-0327 and AAV9-0387 significantly reduced the HIV- 1 copy number (FIG. 13D). AAV9-0326 showed a trend of HIV- 1 reduction in the liver. Data in FIGs. 13A-13D are shown as mean + standard deviation (n = 3 , 4, or 5). Comparisons were performed using one-way ANOVA followed by the Tukey’s multiple comparison test. *p < 0.05. Only the differences that showed statistical significance are displayed.
[0243] Overall, these results demonstrate that the AAV9 -0326, AAV9-0327, and AAV9-0387 vectors containing truncated CMV promoters are comparable to the control vector, which contains a full CMV promoter, in terms of in vivo activities. In fact, in certain aspects, the AAV9-0326, AAV9-0327, and AAV9-0387 vectors outperformed the control vector (FIGs. 10A-10C, FIGs. 11A-11 C, FIG. 13D). AAV9-0327 with the 268CMV promoter and AAV9-0387 with the 180CMV promoter exhibited similar gRNA and SaCas9 expression levels, as well as gene editing activities.Example 4 : Manufacturability Assessment of Selected AAV9 -SaCas9 and AAV9- PlmCasX Vectors.Materials and MethodsProduction of AAV9 vectors in small scale bioreactor.
[0244] The plasmids for one AAV9-SaCas9 vector (pL-C-0327) and two AAV9- PlmCasX vectors (pL-C-0367 and pL-C-0380) were constructed in-house and amplified at Aldeveron.
[0245] Two small scale bioreactor runs were performed for each AAV9 vector. AAV9 vectors were generated by triple transfection in suspension cells, which were sub sequently purified using chromatographic and ultracentrifugation steps and diafiltered into the AAV formulation buffer. In process samples and final products were evaluated for productivity (by ITR ddPCR), infectious titer (by TCID50), residual AAV plasmid backbone DNA (by ddPCR targeting Kanamycin resistant gene), AAV purity (by SDS-PAGE / silver staining), and capsid integrity (by Western Blot). In addition, alkaline agarose gel electrophoresis and PacBio Single Molecule Real-Time (SMRT) sequencing were performed to analyze AAV vector genome integrity .PacBio SMRT sequencing and analysis of AAV vector genome.
[0246] PacBio SMRT sequencing and data analysis of AAV9 vector genomes were performed using SMRTbell prep kit 3 . 0 following previously published methods with some modifications. First, the AAV9 vectors underwent DNase I treatment to removeresidual DNA outside of the AAV particles. Sub sequently, AAV vector DNA was extracted from the DNase I-treated AAV9 vectors using the PureLink Viral RNA / DNA Mini Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Thermal annealing was then conducted to pair the (+) and (-) strands of the AAV vector, forming a double-stranded structure for SMRT sequencing. The annealed AAV DNA was cleaned up using 1 , 3X SMRTbell cleanup beads, followed by end repair and A -tailing. SMRTbell barcoded adapters were ligated to the AAV DNA, which was then treated with nuclease, cleaned up, pooled into a single library, concentrated, and finally sequenced on the PacBio Sequel He Systems.
[0247] PacBio HiFi reads generated by Sequel He were analyzed using an analysis pipeline. Briefly, the reads were aligned to reference sequences, consisting of designed AAV genome, plasmid backbone, Rep2 Cap9 plasmid, helper plasmid and human chromosomal DNA (GRCh38 / hg38 analysis set; GCA_000001405. 15), using minimap2. The reads were categorized nucleobased on their matching references using customized python scripts. Chimeric reads are defined as reads th at map to more than one reference sequence. The total number of reads mapped to each category was counted and the relative abundance was calculated by normalizing to the total number of HiFi reads (FIG. 21 A). For the reads mapped to the designed AAV genome, the ITR composition was evaluated and the reads into “both ITR”, “left ITR”, “right ITR”, and “no ITR” were categorized. AAV Rep binding element (RBE), a tetranucleotide repeat of 5 ’ -GNGC-3 ’, has been shown to be essential for viral replication and hence was used to define ITR containing reads. Each left or right ITR contains two RBE sites. If a read contains at least one RBE from both left and right ITR, this read was categorized as “both ITR”. If a read contains RBE sites from only one ITR, the re ad was categorized as either “left ITR” or “right ITR”, depending on whether the RBE(s) were from left or right ITR. A read that was not long enough to cover any RBE site was defined as “no ITR”. The number of HiFi reads from each ITR-containing category was quantified and normalized to the total number of PacBio HiFi reads (FIG. 21B)Results
[0248] The manufacturability of the AAV9 vectors was assessed .
[0249] The manufacturability of one AAV9 vector for SaCas9, AAV9-0327 (Config 2), and two AAV9 vectors for PlmCasX (CasX from Planctomycetes), AAV9-0367 (Config 1 ) and AAV9-0380 (Config 2) were evaluated (FIG. 14). The sizes of these three AAV vectors (including the two ITRs) are 4676 bp, 45 19 bp, and 45 19 bp, respectively.Each of these AAV9 vectors was independently produced in duplicate using small-scale bioreactors.
[0250] From the transfection pool, AAV9 -0327, AAV9-0367, and AAV9-0380 had average AAV yields of 4.3E+14 vg / L, 5 .2E+14 vg / L, and 7.5E+14 vg / L of cell culture, respectively (FIG. 15A). AAV9-0380 (PlmCasX, Config 2) showed a tendency towards a higher yield than AAV9-0327 (SaCas9, Config 2). After the AAV purification process, AAV9-0327, AAV9-0367, and AAV9-0380 had average purified AAV productivities of 9.3E+12 vg / L, 2.4E+13 vg / L, and 2.9E+13 vg / L of cell culture, respectively (FIG. 15B). AAV9-0380 (PlmCasX, Config 2) showed a statistically higher yield than AAV9-0327 (SaCas9, Config 2). AAV9 -0367 (PlmCasX, Config 1 ) showed a tendency towards a higher yield than AAV9-0327 (SaCas9, Config 2). In FIG. 15A and FIG. 15B, each dot represents the productivity from a single small -scale bioreactor. The data is presented as mean + standard deviation (n = 2). Comparison was performed using one -way ANOVA followed by Tukey's multiple comparison test. *p < 0.05. Only the difference that showed statistical significance is displayed.
[0251] The total infectious particles (TCID50) / L cell culture for AAV9-0327, AAV9- 0367, and AAV9-0380 were 6.9E+9, 1 .3E+10, and 2.64E+10, respectively (FIG. 16). There was a tendency for AAV9-0367 (PlmCasX, Config 1 ) and AAV9-0380 (PlmCasX, Config 2) to show higher TCID50 / L cell culture than AAV9-0327 (SaCas9, Config 2). In FIG. 16, the data are presented as mean + standard deviation (n = 2).
[0252] The AAV plasmid backbone packaging for all three AAV9 vectors was below 1 % (FIG. 17). FIG. 17 displays the percentage of AAV plasmid backbone packaging, which is determined by calculating the ratio of kanamycin resistance gene ddPCR titer to the ITR ddPCR titer. The data are presented as the mean + standard deviation (n = 2).
[0253] AAV vector purity was assessed using SDS-PAGE and silver staining (FIGs. 18A-18C). VP1 , VP2, and VP3 were the only visible bands, migrating at approximately 82, 67, and 60 kDa, respectively. These three bands were present in an approximate ratio of 1 : 1 : 10, indicating high purity of the three AAV9 vectors. FIGs. 18A-18C provide the SDS-PAGE / silver staining analysis of AAV9-SaCas9 and A AV9-PlmCasX vectors. Each panel shows the following lanes: Lane 1 , protein ladder; Lane 2, Negative control (AAV formulation buffer); Lane 3 , Reference Standard AAV vector; Lane 4, tested AAV9 vector. One representative SDS-PAGE gel is shown for each vector. The size ranges for VP1 , VP2, VP3 proteins are 82 -89 KDa, 67-75 KDa, and 60-64 KDa, respectively .
[0254] The silver staining analysis was further supported by a Western blot using the mouse monoclonal anti -AAV capsid antibody B l , which specifically binds to the Cterminus of the AAV capsid proteins (FIGs. 19A-19C). Once again, VP1 (82 KDa), VP2 (67 KDa), and VP3 (60 KDa) were the only bands detected, and they maintained the same approximate ratio of 1 : 1 : 10. This confirmed the proper assembly and integrity of the three AAV9 vectors. FIGs. 19A-19C show the Western Blot analysis of AAV9 -SaCas9 and AAV9-PlmCasX vectors. Each panel shows the following lanes: Lane 1 , protein ladder; Lane 2, Negative control (AAV formulation buffer); Lane 3 , Reference Standard AAV vector; Lane 4, tested AAV9 vector. Mouse monoclonal anti -AAV capsid antibody B 1 was used to detect VP1 , VP2, and VP3 proteins. One representative Western Blot analysis is shown for each vector. The size ranges for VP1, VP2, VP3 proteins are 82 -89 KDa, 67-75 KDa, and 60-64 KDa, respectively .
[0255] To analyze the packaged genomes of the three AAV9 vectors, alkaline gel electrophoresis under denaturing conditions was performed on the extracted genomes from the vector preparations (FIGs. 20A-20C). The major bands for all three AAV vectors were ob served at the expected sizes, around 4.7 kb for AAV9 -0327 and around 4.5 kb for AAV9-0367 and AAV9-0380. Thus, the alkaline gel analysis confirmed the genome integrity of the three AAV9 vectors. FIGs. 20A-20C provide the alkaline agarose gel electrophoresis analysis of viral DNA isolated from the AAV9 -SaCas9 and AAV9-PlmCasX vectors. Each panel shows the following lanes : L ane 1 , viral DNA without DNase treatment; Lane 2, viral DNA spiked with a control plasmid (~7 kb) without DNase treatment; Lane 3 , viral DNA with DNase treatment; Lane 4, viral DNA spiked with a control plasmid (~7 kb) with DNase treatment; Lane 5 (M), DNA ladder. One representative alkaline agarose gel electrophoresis result is shown for each vector.
[0256] To accurately profile the entire AAV vector genome (including the two ITRs) as an intact molecule, and capture potential chimeric AAV genome reads, PacBio SMRT sequencing was used. As shown in FIG. 21A, over 90% of the PacBio SMRT sequencing reads were mapped to the vector genomes for all three AAV9 vectors. Specifically, for AAV9-0327 (SaCas9, Config 2), 1 .8%, 1 .6%, 0.2%, and 0.7% of all SMRT sequencing reads were mapped to the AAV plasmid backbone, Rep2Cap9 plasmid, pHelper plasmid, and human chromosomal DNA, respectively. Additionally, 2. 1%, 0.6%, 0.3 %, and 0.1% of the SMRT sequencing reads were chimeric reads between AAV vector genomes and the AAV plasmid backbone, Rep2Cap9 plasmid, pHelper plasmid, and human chromosomal DNA, respectively . Finally, 1 .5% of all SMRT sequencing reads could not be mapped to any of these sources. For AAV9-0367 (PlmCasX, Config 1 ) and AAV9- 0380 (PlmCasX, Config 2), the percentages of SMRT sequencing reads mapped to each of these categories, other than AAV vector genomes, were below 1 % .
[0257] Next, the distribution of reads mapped to vector genomes was further investigated (FIG. 2 IB). For all three A A V9 vectors, 70% to 80% of all PacBio SMRT sequencing reads contained the Rep binding element (RBE) sequence for both ITRs. The maj ority of the remaining vector genome -containing SMRT sequencing reads either contained the Left ITR only or the Right ITR only. For AAV9-0367 (PlmCasX, Config 1 ), 80.2% of the SMRT sequencing reads contained both ITRs, while only 6.2%, 8.6%, and 1 .2% of all SMRT sequencing reads contained the Left ITR only, the Right ITR only, and No ITR, respectively .
[0258] FIG. 21 A and FIG. 21 B provide the PacBio SMRT sequencing analysis results for the three AAV9 -SaCas9 and AAV9-PlmCasX vectors. FIG. 21A shows the distribution of sequencing reads mapped to different categories, with the majority of reads mapped to the AAV genomes. FIG. 21B shows the distribution of various AAV genome reads. "Both ITR" refers to reads containing both the left and right ITRs. "Left ITR only" indicates reads containing only the left ITR, while "Right ITR only" denotes reads containing only the right ITR. "No ITR" signifies reads containing the AAV genome sequence but not the ITR. To be considered as containing the ITR, a read must include at least one Rep binding element (RBE) site. The data is normalized to total number of PacBio SMRT sequencing reads.
[0259] In summary, nucleobased on various analyses, the three selected AAV9- SaCas9 and AAV9-PlmCasX vectors exhibited good AAV manufacturability attributes, including high yield, high purity, and high vector genome integrity.
[0260] Additionally, highly conserved regions of the HIV genome across different strains were identified. As illustrated in FIG. 22A, the sequence conservation of nucleotides in individual clades and all clades combined for the LTR1 protospacer + PAM sequence using the LTR U3 sequence query from US patients in the Los Alamos National Laboratory (LANL) online database was shown in sequence logos. FIG. 22B provides a sequence logo showing the sequence conservation of nucleotides in individual clades and all clades combined forthe Global LTR1 + PAM sequence forUS patients.Example 5 : Design of AAV Vectors for Excision of an HSV Nucleic AcidDesign of AAV configurations.
[0261] The AAV vectors described in Example 1 and exemplified in FIG. 1 were modified foruse in targeting HSV nucleic acid sequences. Variations of the th ree designs as provided in Table 8 and having exemplary sequences as provided in Table 9 weresynthesized and prepared by GenScript foruse in targeting, cleaving, and excising HSV nucleic acid sequences.Identification ofICPO and ICP27 Consensus Sequences.
[0262] The HSV-1 genome consists of two unique regions: the long unique region (UL) and the short unique region (US). The UL region is flanked by inverted repeat regions called TRL and IRL. The US region is flanked by another set of inverted repeat regions called IRS and TRS. The a’ sequence is repeated at both ends of the HSV-1 genome and at the internal L-S junction. There are two copies of the immediate early (alpha) ICPO gene. One copy is located in TRL, and the other copy is located in IRL, where it overlaps with the LAT gene.
[0263] Highly conserved regions of the HSV genome across different strains were identified in the HSV immediate early (alpha) genes ICPO (FIG. 23 and FIG. 25A) and ICP27 (FIG. 24 and FIG. 25A). Table 16 provides consensus sequences forHSV-1 ICPO and ICP27 genes. The CasXprotospacer sequences (shown are 22 nucleotides in length) are highlighted in grey. Some protospacer sequences overlap with each other. The Protospacer Adjacent Motif (PAM) sequences for CasX gRNAs are bolded and underlined. If the protospacer sequence is located on the sense strand, the PAM sequence is TTCN. If it's on the antisense strand, the PAM sequence is NGAA. Protospacer sequences that are <70% conserved are italicized and listed in Table 17.Table 16: Consensus sequences for HSV-1 ICPO and ICP27 genes.
[0264] The protospacer sequences of the CasX gRNAs provided in Table 17 are present in ICPO and ICP27 consensus sequences, and they are found in greater than 70% of the HSV-1 strains.Table 17: Summary of >70% conserved CasX gRNA information.
[0265] Table 18 provides a summary of SaCas9 protospacer sequences that are greater than 70% conserved for HSV-1 ICPO and ICP27 genes.Table 18: Summary of >70% conserved SaCas9 gRNA information.
[0266] Table 19 provides a summary of SaCas9 protospacerand PAM sequences for HSV-1 ICPO and ICP27 genes for the gRNAs evaluated in the current work.
[0267] Guide spacer sequences were selected from the identified highly conserved regions:ICP0_SaCas9_M2, CTCAGGCCGCGAACCAAGAA (Seq ID NO: 173) ICP27_SaCas9_Ml, AATCCTAGACACGCACCGCC (Seq ID NO: 174) ICP0_SaCas9_M2_22, GGCTCAGGCCGCGAACCAAGAA (Seq ID NO: 176) ICP27_SaCas9_Ml_22, GAAATCCTAGACACGCACCGCC (Seq ID NO: 177) ICP0_CasX_6, CGATCGGGATGGTGCTGAACGA (Seq ID NO: 77) ICP0_CasX_9, TCGGACGCACCGCCGCCTCCTG (Seq ID NO: 80) ICP27_CasX_9, TCGTCGGACGAGGACATGGAAG (Seq ID NO: 102)
[0268] Guide RNA pairs (gRNAl and gRNA2) are provided below: SaCas9 pairs:ICP0_SaCas9_M2 (Seq ID NO: 173) + ICP27_SaCas9_Ml(Seq ID NO: 174)ICP0_SaCas9_M2_22 (Seq ID NO: 176) + ICP27_SaCas9_Ml_22 (Seq ID NO: 177)CasX2 pairs:ICP0_CasX_6 (Seq ID NO: 77) + ICP27_CasX_9 (Seq ID NO: 102)ICP0_CasX_9 (Seq ID NO: 80) + ICP27_CasX_9 (Seq ID NO: 102)Example 6: Targeting both the ICP0 and ICP27 genes with paired gRNAs to eliminate HSV-1 virus.Materials and Methods1. SaCas9 gRNAs targeting HSV-1 ICP0 gene and ICP27 gene.
[0269] The ICP0_SaCas9_M2_22 is similar to ICP0_SaCas9_M2, except that its spacer is 22-nt in length. The ICP27_SaCas9_Ml_22 is similar to ICP27_SaCas9_Ml, except that its spacer is 22-nt in length.
[0270] The SaCas9 gRNA information is listed in Table 20.Table 20: Summary of SaCas9 gRNA information.2. Plasmid transfection and HSV-1 infection in Vero cells.
[0271] Vero E6 cells (American Type Culture Collection) were seeded in 60 mm dishes. After 24 hours, the cells were transfected with 4 pg of plasmid DNA and 10 pl of Lipofectamine 3000 (Thermo Fisher Scientific), following the manufacturer's protocol. 48 hours post transfection, the Vero cells were treated with HSV- 1 strain Syn l 7+ virus at a MOI of one plaque forming unit (pfu) per 2000 cells. After two hours of HSV- 1 treatment, the HSV- l-containing media was removed and replaced with culture media. 48 hours post HSV- 1 infection, the Vero cell lysate was harvested for ddPCR analysis, and the Vero cell culture supernatant was used for plaque assay analysis. 3. Digital droplet PCR (ddPCR) analysis.
[0272] Genomic DNA was isolated from Vero cells using the NucleoSpin Tissue, Mini kit for DNA from cells and tissue (MACHEREY-NAGEL) following the provided instructions. ddPCR was performed using the 2X ddPCR Supermix for Probes (No dUTP) in the QX200 Droplet Digital PCR system (Bio-Rad Laboratories). 500 pg of gDNA was used as a template with the following thermal cycling conditions: 95 °C for 10 min, followed by 40 cycles of 94°C for 30 sec and 60°C for 1 min, and final incubation at 98 °C for 10 min. Data acquisition and analysis were conducted using the QX200 droplet reader and QuantaSoft software provided with the i nstrument.
[0273] The number of HSV- 1 copies in the Vero cells was quantified using a primer / probe set targeting the HSV- 1 UL28 gene (Aubert, et al. 2014). The HSV-1 copy numbers were normalized to the copy number of the African green monkeys (Agm; the origin source of Vero cells) TERT DNA sequence to calculate the HSV-1 copy numbers per cell.
[0274] The ddPCR primer and probe sequences are listed in Table 21.Table 21 : Primer and probe sequences for ddPCR analysis.4. Plaque assay.
[0275] The infectious titers of HSV- 1 were determined using plaque assays. Vero cells were grown in a 24-well plate until they reached 100% confluence. The cells were then treated with HSV- 1 virus-containing supernatant at different dilutions. After a two-hour incubation with the virus, the viral inoculum was removed, and the cells were overlaid with 500 pl of a 0.4% Methyl cellulose (Millip ore Sigma) in complete culture medium to allow only cell-to-cell spread of the virus. Two days after HSV- 1 infection, the Vero cells were fixed with 5% Trichloroacetic acid (TCA; MilliporeSigma) for 10 minutes at room temperature. The cells were then stained with 0.05% crystal violet in a mixture of 25% methanol and 75% water for 15 minutes at room temperature. The staining was washed off with running water, and the 24-well plate was left to dry overnight at room temperature. The plaques in each well were counted individually . The dilutions that resulted in less than 100 plaques per well were used to determine the infectious titers.Results
[0276] The HSV- 1 genome and the locations of these four SaCas9 gRNAs are shown in FIG. 25A. There are two copies of the ICP0 gene in the HSV- 1 genome, so each gRNA targeting ICP0 has the potential to cut the HSV- 1 genome at two locations.
[0277] All four of these SaCas9 gRNAs have 20-nt long spacers. The ICP0_SaCas9_M2_22 and ICP27_SaCas9_Ml_22, which are the 22 -nt versions of ICP0_SaCas9_M2 and ICP27_SaCas9_Ml , respectively, were also evaluated.
[0278] To test the hypothesis that targeting both the ICP0 and ICP27 genes with paired gRNAs would be an effective therapeutic strategy for HSV- 1 diseases, Vero cells were co-transfected with paired 20 -nt gRNAs targeting either ICP0 or ICP27 individually, or targeting both ICP0 and ICP27 genes simultaneously. For comparison, Vero cells were also co-transfected with ICP0_SaCas9_M2_22 and ICP27_SaCas9_Ml_22. After 48 hours of transfection, the Vero cells were infected with the HSV -1 strain Syn l7+ virus for two hours. Then, 48 hours after HSV- 1 infection, the Vero cell lysate was harvested for ddPCR analysis, and the supernatant was used for plaque assay analysis (FIGs. 25B- 25C). The results provided in FIGs. 25B and 25C are the mean + standard deviation (n = 2), and only the differences that showed statistical significance are displayed. Statistical comparisons were performed using one-way ANOVA followed by Tukey’s multiple comparison test. *p < 0.05 ; * *p < 0.01 .
[0279] C ompared to the HSV- 1 strain Syn l7+ alone control, different SaCas9 gRNA pairs reduced HSV- 1 viral load by 54% to 76% (FIG. 25B). Among the seven gRNApairs tested, two pairs, ICP0_SaCas9_M2 + ICP27_SaCas9_Ml and ICP0_SaCas9_M2_22 + ICP27_SaCas9_Ml_22, showed statistically significant reduction of HSV- 1 viral load. These two gRNA pairs are referred to as SaCas9 M2M1 pair_20nt and SaCas9 M2M1 pair_22nt, respectively, for simplicity .
[0280] Next, the infectious titer of HSV- 1 in the supernatant of infected cells was measured using a plaque assay (FIG. 25C). Individually targeting ICPO or ICP27 with paired gRNAs did not result in a statistically significant reduction of HSV- 1 titer. However, all gRNA pairs targeting both ICPO and ICP27 showed statistically significant reduction of HSV- 1 viral titer. Consistent with the ddPCR results, the SaCas9 M2M1 pair_20nt and SaCas9 M2M1 pair_22nt demonstrated the greatest reduction of HSV-1 viral titer. These two gRNA pairs were selected for further evaluation.
[0281] The Vero cell results above demonstrate that targeting both the ICPO and ICP27 genes with paired gRNAs can be a more effective therapy for reducing HSV-1 viral load and infectious viral titer compared to targeting ICPO and ICP27 individually .Example 7 : Design of highly conserved CasX guide RNAs targeting HSV-1 ICPO and ICP27 genes.Materials and Methods1. HSV-1 genome library construction.
[0282] Strain information and coding sequence (CDS) fasta sequences for the Herpesviridae family were downloaded from the Virus Pathogen Resource (ViPR) database (https: / / www.bv-brc. org / view / Virus / 10239; version Feb, 2022; 46,027 strains and 62, 554 GenBank IDs). The GenBank IDs and CDS fasta sequences were filtered using the 9,409 GenBank IDs obtained from the NCBI Nucleotide database using the keyword "human alphaherpesvirus 1 " . An internal HSV- 1 genome library was created, containing the descriptions for Species, Organism, Strain name, GenBank ID, Protein name, Gene symbol, Segment, and CDS sequence.
[0283] To identify the CDS sequences for the ICPO and ICP27 genes in different HSV- 1 strains, the HSV- 1 strains and GenBank IDs containing 'ICP0$|ICP0. |RL2$|RL2.' and TCP27$|ICP27.|UL54$|UL54.' were identified from the HSV- 1 genome library and labeled as ICPO and ICP27, respectively (Table 22).Table 22. Description of the searched patterns for ICPO and ICP27 CDS sequences and the total counts of strains and GenBank IDs containing the searched patterns.2. Consensus sequence generation.
[0284] All CDS fasta sequences for ICPO and ICP27 genes were fetched and a multiple sequence alignment (MSA) was built separately for ICPO and ICP27 using the Clustal Omega alignment (ClustalOmegaCommandLine package of BioPython). A consensus sequence was built based on the MSA using the AlignlO package of BioPython. The threshold parameter was set to 0.5, which determines the base to be added per position of the consensus sequence. If the percentage of the most common base was greaterthan 50%, then that base was added, otherwise an ambiguous character (N) was added. A position-specific scoring matrix (PSSM) was generated and the consensus bases that were observed in at least 25% of CDS sequences were selected to form the final consensus sequences (Table 16 and 23).Table 23. HSV-1 ICPO and ICP27 consensus sequences.3. Selection of conserved gRNAs.
[0285] All matching PAM sequences with downstream 22 -nt sequences were identified using Python regex algorithm by searching the PAM + 22 -nt [ATGC] pattern in all the CDS sequences of all GenBank IDs for ICPO and ICP27 genes. PAM sequence for the CasX enzyme was defined as ‘TTCN’ and spacer orientation was defined as ‘right of pam’ during the guide sequence search. Flags for allowing overlapping matches and ignoring letter case were set, and reverse complement of the pattern was also searched to find all possible exact matches to the PAM sequence with 22 -nt downstream sequences.
[0286] The output table of the guide design was aggregated to include strain and GenBank ID counts for each identified guide sequence. The percent guide conservation was calculated by dividing the strain counts for each guide by the total strain counts of the ICPO or ICP27 CDS sequences in the database. Table 24 displays the numbers ofgRNAs targeting ICPO or ICP27 that show perfect match in over 70%, 80%, or 90% of the total HSV- 1 strains.Table 24. The numbers of conserved CasX guide RNA sequences for HSV-1 ICPO and ICP27 genes at 70%, 80% and 90% conservation levels.4. In silico off-target analysis for the >70% conserved CasX gRNAs.
[0287] In silico off-target analysis of the selected CasX guide RNA sequences were obtained using an in house developed Nextflow pipeline. A prefiltering step for the in silico sites was performed using BWA aln tool to select for genomic sites in the hg38 genome with up to 5 mismatches (mm) and 1 bulge distance to the 22 nt guide sequence. A fasta file was generated for the selected sites per guide RNA and processed using the CasOffinder tool. The tool utilized the ‘ TTCN’ PAM sequence and allowed for up to 5 mm and 1 bulge. This process resulted in obtaining alignments between the guide sequence and the homologous target sequence, as well as the mm / bulge values. CasOffinder results were post-processed using a Python script that:1) Prepares alignment string and mm / bulge counts for the guide sequence vs target sequence alignment.2) Filters the results to keep the target sites which have up to o 1 mm + 1 bulge in guide sequence, 3 mm + 0 bulge in PAM sequ ence o 2 mm + 1 bulge in guide sequence, 2 mm + 0 bulge in PAM sequence o 3 mm + 1 bulge in guide sequence, 1 mm + 0 bulge in PAM sequence o 4 mm + 0 bulge in guide sequence, 0 mm + 0 bulge in PAM sequence o 5 mm + 0 bulge in guide sequence, 0 mm + 0 bulge in PAM sequ ence3) Clusters sites by assigning a cluster ID based on PAM position if the identified genomic coordinates of the in silico site PAM start positions are within 5 bp distance.4) Deduplicate the clustered sites based on the cluster ID based on the lowest total mm / bulge in guide sequence, lowest mm in PAM sequence, lowest bulge in guide sequence and lowest mm in guide sequence.Results
[0288] The conserved and efficient CasX2 gRNAs that co -target the HSV-1 ICPO and ICP27 genes were identified. To accomplish this, an HSV - 1 genome library wasconstructed based on sequences archived in the ViPR database and NCBI Nucleotide database, which included a total of 267 HSV-1 strains (from ViPR) and 278 GenBank IDs (from NCBI) covering the ICPO gene, as well 283 HSV -1 strains (from ViPR) and 296 GenBank IDs (from NCBI) covering the ICP27 gene (Table 22).
[0289] Next, the consensus sequences for ICPO and ICP27 were generated using the CDS sequences of these two genes in different HSV -1 strains (FIGs. 26A and 26B). The ICPO consensus sequence spans 2372 bp (Table 23) and shares 97% sequence identity with the ICPO gene in the commonly used HSV-1 strain Syn l 7+ virus. The ICP27 consensus sequence spans 1539 bp (Table 23) and shares 99% sequence identity with the ICP27 gene in the HSV-1 strain Synl 7+ virus.
[0290] With the HSV- 1 genome library, the conserved CasX gRNAs were identified. DpbCasX and PlmCasX / CasX2 share the same PAM motif and protospacer sequences, and all the identified CasX gRNAs can be used for both DpbCasX and PlmCasX / CasX2.
[0291] Individual CasX gRNAs with a 'TTCN' PAM and a 22-ntprotospacer in each of the CDS sequences of all GenBank IDs for ICPO and ICP27 genes. These gRNAs were then checked for conservation across all HSV-1 strains. The gRNAs that target ICPO or ICP27 and are conserved in over 70% of the total HSV-1 strains are summarized in Table 25.Table 25: Summary of >70% conserved CasX gRNA information.
[0292] The conservation percentage for individual CasX gRNAs may be underestimated. For instance, out of the 267 HSV-1 strains, 242 strains (90.64%) have the correct protospacer sequence of ICP0_CasX_6. Nine strains (3 .37%) have a single mismatch in the protospacer sequence (Table 26), and the sequences of the remaining 16 strains (5.99%) are too short to cover the ICP0_CasX_6 protospacer region. It is likely that these 16 HSV-1 strains also have the correct protospacer sequence of ICP0_CasX_6.Table 26: Homology analysis of ICP0_CasX_6.
[0293] All these 42 gRNAs are found to be present in the HSV-1 strain Synl7+ virus. The locations of these >70% conserved gRNAs in the ICPO and ICP27 genes are shown in FIGs. 27A and 27B. There is a strong correlation between the conservation percentage of the CasX gRNAs and the conservation of consensus bases / regions (FIGs. 27A and 27B).
[0294] Furthermore, the 42 CasX gRNAs with over 70% conservation for potential off-target effects using the internal CasOffinder tool were analyzed (FIG. 28). Except for ICP27_CasX_20, all the 42 CasX gRNAs had less than 100 nominated sites with up to 3 mismatches and 1 bulge or up to 5 mismatches and no bulges (Table 27). Only oneout of the 42 CasX gRNAs showed a nominated site in the low number of mismatch / bulge combinations, including 0 mm + 1 bulge, 1 mm + 0 bulge, 1 mm + 1 bulge, and 2 mm + 0 bulge (Table 27). The remaining 41 CasX gRNAs do not have any nominated site with these mismatch / bulge combinations.Table 27: Summary of in silico off-target analysis for the >70% conserved ICPO and ICP27 gRNAs.
[0295] In summary, consensus sequences for the HSV- 1 ICPO and ICP27 genes were built and conserved CasX gRNAs targeting the ICPO and ICP27 genes were identified. These conserved CasX gRNAs have a low number of predicted off-target sites based on in silico analysis.Example 8: Screening for highly efficient CasX2 gRNA pairs targeting ICPO and ICP27 using pooled lentiviral vectors.Materials and Methods1 . Construction of LentiCasX2-2xgRNA library.
[0296] To construct the LentiCasX2-2xgRNA library (FIG. 29), ssDNA oligo pools were ordered from Twist Bioscience. These oligos were 1 16-nt long and contained the sequences of paired gRNAs, with one gRNA targeting the HSV- 1 ICPO gene and the other gRNA targeting the HSV- 1 ICP27 gene. The oligos also included two Bb sI sites. The oligo pools were amplified using Q5 high-fidelity DNA polymerase (New England Biolab s), using the CasX2 scaffold forward primer and 7 SK reverse primer to convert the single-stranded oligo DNA to double-stranded DNA that contained 40 bp homologies to the CasX2 gRNA scaffold and the 7 SK promoter. The resulting PCR amplicons, which were 156-bp long, were purified and ligated through a Gibson reaction to a 344-bp Donor fragment. The Donor fragment contained the full 7SK promoter and the full CasX2 gRNA scaffold sequence, and it was synthesized at Integrated DNA Technologies. The assembly was done using the Gib son Assembly Master Mix (New England Biolabs). The reaction generated an intermediate circular DNA. The unligated fragments were removed using Plasmid-Safe exonuclease (Lucigen). To generate the final construct expressing CasX2 and paired CasX2 gRNAs, the purified circular DNA was then digested and linearized with Bb sI (New England Biolabs). The resulting linearized intermediate fragments were gel purified and cloned into the Esp3 I-digested LentiCasX2 vector. The LentiCasX2 vector contained a U6 promoter-CasX2 gRNA scaffold-EF lalpha (EFS) promoter- CasX2-Nucleoplasmin nuclear localization signal (NLS) -P2A-mCherry fragment, and it was synthesized and prepared at GenScript. The final product was the pooled LentiCasX2-2xgRNA vectors.
[0297] The sequences used in constructing the LentiCasX2-2xgRNA library are listed in Table 28.Table 28: Sequences used in constructing LentiCasX2-2xgRNA library.2. Production of lentiviral vectors with the LentiCasX2-2xgRNA library.
[0298] To produce lentiviral vectors with the LentiCasX2-2xgRNA library, the library was co-transfected with ViraPower lentiviral packaging mix (Thermo Fisher Scientific) into human embryonic kidney (HEK) 293 T cells (American Type Culture Collection) using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific), following the manufacturer's protocol. The supernatant containing the lentiviral ve ctors was harvested at 64 hours post-transfection, filtered through a 0.45 -mm pore-size filter (Millipore Sigma), and then titered using Lenti-X GoStix Plus (Takara Bio).3. Design of HSV-1 gain-of-signal knock-in reporter construct.
[0299] The HSV-1 knock-in reporter construct (FIG. 30A) consists of two main cassettes flanked by two AAVS1 CRISPR target sites. The first cassette is used to generate the knock-in cell line and includes a PGK promoter-driven EGFP reporter, followed by a P2A self-cleaving peptide (P2A1), a puromycin resistant gene sequence (PuroR), and a human growth hormone polyA signal (hGHpA). The second cassette is a minigene splicing reporter cassette, which is used to evaluate the excision efficiency of gRNA pairs targeting the HSV-1 ICP27 and ICP0 gene. The ICP27 gene (from 5 ’ to 3’), an artificial Exon containing multiple stop codons, and the ICP0 gene (from 3 ’ to 5 ’, to mimic the orientation of the ICP0 gene in the IRL region) are inserted into Intron 1 of the rat insulin 2 (Ins2) gene. The potential splicing acceptor and splicing donor sites in the ICP27 gene and ICP0 gene sequence were predicted using the BDGP splicing predictor program (fruitfly.org / seq tools / splice.html) and then removed. Following Exon 2 of Ins2 is a P2A self-cleaving peptide (P2A2), an mTagBFP2 reporter, another P2A self-cleaving peptide (P2A3), a Blasticidin resistance gene sequence, and a bovine growth hormone polyA signal (BGH pA). Before paired gRNAs-induced excision occurs,the exon containing multiple stop codons is spliced into the insulin 2 transcript, resulting in the absence of expression from the downstream mTagBFP2 reporter and Blasticidin resistant gene. However, the excision induced by paired gRNAs targeting ICP27 and ICPO will remove the exon with stop codons, allowing for the expression of the downstream mTagBFP2 reporter and Blasticidin resistant gene.
[0300] The full construct was synthesized and prepared at GenScript.
[0301] The sequences for components in the HSV-1 gain-of-signal knock-in reporter construct are listed in Table 29.Table 29: Sequences for components in the HSV-1 gain-of-signal knock-in reporter construct.4. Generation of HSV-1 gain-of-signal knock-in reporter cell line.
[0302] To generate the HSV-1 gain-of-signal knock-in reporter cell line, 0.5 pg of the HSV-1 knock-in reporter construct and a ribonucleoprotein (RNP) complex were nucleofected into 2.5E+05 HEK 293FT cells. The RNP complex consisted of 20 pmol of SpCas9 protein (Synthego) and 40 pmol of AAVS1 guide RNA (Synthego). Nucleofection was performed using the SF Cell Line 4D-Nucleofector X Kit S (Lonza) and the CM-130 program in a 4D-Nucleofector System (Lonza), following the manufacturer's protocol.
[0303] To enrich cells containing the HSV-1 knock-in reporter construct, cells were treated with 0.5 pg / mL of puromycin dihydrochloride (Thermo Fisher Scientific) for 10 days, starting at 96 hours post-nucleofection. The enriched cells were then serially diluted to a final concentration of 0.45 cells per 100 pL. Each well of a 96-well platewas plated with 100 pL of diluted cells. The cells were incubated in a 5% CO2, 37°C incubator for 2 weeks .
[0304] To identify single-cell clones containing the HSV- 1 knock-in reporter construct, the EGFP expression in 293FT cells expanded from individual clones was analyzed using an Attune NxT Flow Cytometer (Thermo Fisher Scientific). A clone containing over 95% EGFP-positive cells was selected for further expansion and used in the later reporter assay .5. Screening of lentiviral gRNA pairs.
[0305] To screen efficient CasX2 gRNAs for excising ICP27 and ICP0 genes, the HSV- 1 gain-of-signal knock-in cells were transduced with lentiviral vectors containing the LentiCasX2-2xgRNA library at a MOI of 0.3 virus per cell. Three days after infection, mCherry positive cells were sorted by fluorescence-activated cell sorting (FACS) and replated with or without 20 pg / ml of Blasticidin S (Thermo Fisher Scientific). Seven days after Blasticidin selection, cells were harvested and analyzed with flow cytometry. The mCherry+mTagBFP2+ cells in the Blasticidin-treated cells were FACS sorted for DNA analysis. Control cells that did not receive Blasticidin treatment were also harvested for DNA analysis as a control.6. Nanopore sequencing and analysis.
[0306] To identify the top CasX2 gRNAs enriched in Blasticidin-treated cells, genomic DNA was extracted from control cells (- Blasticidin) and mCherry+mTagBFP2+ cells (+ Blasticidin) using the DNeasy Blood & Tissue Kit (Qiagen). The extracted DNA was then subjected to Nanopore long-range sequencing (Oxford Nanopore Technologies).
[0307] The paired CasX2 gRNAs in the integrated lentiviral vectors were amplified using the Q5 high-fidelity DNA polymerase (New England Biolab s), with a forward primer located in the U6 promoter and a reverse primer located in the EFS promoter (Table 30). The PCR amplicons were cleaned up using the Monarch PCR & DNA cleanup kit (New England Biolabs). Nanopore barcodes were added to the PCR amplicons using the PCR Barcoding Kit (SQK-PBK004; Oxford Nanopore Technologies), following the manufacturer's protocol. The barcoded fragments were then purified with AMPure XP beads (Beckman Coulter), pooled together, and Rapid Sequencing Adapters (Oxford Nanopore Technologies) were added. Finally, the samples were sequenced using the MinlON SpotON R9.4. 1 flow cells (FLO-MIN106; Oxford Nanopore Technologies), following the manufacturer's protocol.
[0308] For Nanopore sequencing analysis, the fast5 files containing the sequencing reads were basecalled and demultiplexed using bonito basecaller (Oxford Nanopore Technologies). The raw fastq reads were filtered using length between I kb and lOkb and quality over 10, then mapped to the LentiCasX2-2xgRNA reference sequences using Minim ap2 (Li 2018). For each mapped read, the regions that were mapped to the gRNA sites were extracted and analyzed using customized python script. To identify which gRNA this read contains, the extracted regions were analyzed againstthe designed gRNA pools: each region was pairwise aligned to each gRNA sequence, followed by calculation of the edit distance, and the designed gRNA sequence with edit distance less than or equal to 5 was assigned. The choice of edit distance of 5 was based on pairwise edit distance among the designed gRNA pools were at least 7 and mismatches were expected in Nanopore sequencing at a higher error rate than Illuminam sequencing. After each region was assigned a designed gRNA, the reads were further filtered based on having proper combinations of gRNA pairs as designed. For each designed gRNA pair, the number of reads supporting its presence was calculated. To identify the enriched gRNA pairs, DESeq2 (Love, et al. 2014) was used to normalize the read counts across replicates in different conditions and calculate fold change after Blasticidin treatment. Those with fold change >2 and adjusted p -value <0.01 were considered highly enriched, indicating fitness benefit in the cells with corresponding paired gRNAs due to successful excision.Table 30: Primer sequences for amplifying the paired CasX2 gRNAs.Results
[0309] 22 conserved gRNAs that target the HSV- 1 ICP0 gene and 20 conserved gRNAs that target the HSV- 1 ICP27 gene were identified. The paired gRNAs that target both ICP0 and ICP27 can excise the ICP27 gene and ICP0 gene in the IRL region. To screen the most efficient gRNA pairs for excising ICP27 and ICP0, the 440 CasX2 gRNA pairs (formed with the 22 gRNAs targeting the ICP0 gene and the 20 gRNAs targeting the HSV- 1 ICP27 gene) were cloned into a LentiCasX2-2xgRNA library, following a previously described protocol (Vidigal and Ventura 2015) with some modifications. In the final lentiviral vectors, a U6 promoter drives the expression of one of the 22 gRNAs targeting the ICP0 gene, a 7 SK promoter drives the expression of one of the 20 gRNAstargeting the ICP27 gene, and an EFS promoter drives the expression of CasX2. A mCherry reporter is also included to facilitate FACS sorting.
[0310] Next, an HSV- 1 gain-of-signal knock-in reporter HEK 293FT cell line was generated to examine the excision induced by paired gRNAs targeting ICPO and ICP27 (FIG. 30A). In this reporter cell line, the PGK promoter-EGFP-P2A-Puromycin cassette is used for single-cell clone selection. The downstream cassette containing ICP27-ICP0 is used to evaluate the excision efficiency. The consensus ICP27 sequence (5 ’ -3’) and ICPO sequence (3 ’ -5’) flank an exon with multiple stop codons. This exon is spliced into the rat Insulin 2 transcript at baseline, resulting in the ab sence of expression for the downstream mTagBFP2 reporter and Blasticidin resi stant gene. However, when the paired gRNAs targeting ICPO and ICP27 induce excision, the DNA sequence between the two gRNA target sites, including the exon with stop codons, is removed. This allows for the expression of the downstream mTagBFP2 reporter and Blasticidin resistant gene.
[0311] Lentiviral vectors produced from the LentiCasX2-2xgRNA library were used to infect the HSV- 1 gain-of-signal knock-in reporter HEK 293FT cells. Three days after lentiviral infection, cells with lentivirus integration were enriched by sorting mCherry positive cells using FACS. The sorted cells were then replated and maintained in media with either vehicle or Blasticidin.
[0312] Only cells with successful ICP27-ICP0 excision would remove the exon with stop codons, allowing the expression of the downstream mTagBFP2 and Blasticidin- resistant gene. After seven days of vehicle or Blasticidin treatment, the expression of mCherry and mTagBFP2 was analyzed using flow cytometry (FIGs. 30B-30C). In vehicle treated samples, only background levels of mTagBFP2 expression were observed. In Blasticidin-enriched samples, more than 50% of the cells exhibited mTagBFP2 expression, and approximately 30% of the Bia sti ci din -treated cells showed both mCherry and mTagBFP2 expression. The mCherry+mTagBFP2+ cells i n the Blasticidin-enriched samples were subsequently sorted for sequencing of the enriched CasX2 gRNA pairs.
[0313] To identify the enriched CasX2 gRNA pairs in the mCherry+mTagBFP2+ cells, the region containing the paired CasX2 gRNAs in the integrated lentiviral vectors were PCR amplified and sequenced using Nanopore long-range sequencing. A volcano plot was created to present the enriched gRNA pairs with Blasticidin selection in LentiCasX2-2xgRNA-treated HSV- 1 knock-in cells (FIG. 31). Compared to vehicle- treated cells, presented in grey, 23 gRNA pairs, presented in black, showed greater than 2-fold enrichment and a statistical difference lower than 0.01 in the mCherry+mTagBFP2+ cells, and they were categorized as Table 31 gRNA pairs. Out ofthe 23 Table 31 gRNA pairs, 20 of them contained the ICP27_CasX_9 gRNA, indicating the high editing efficiency of this gRNA. The remaining three gRNA pairs involved different ICP27-targeting gRNAs (Table 31).
[0314] All of the top nine gRNA pairs in the Table 31 gRNA pairs contained the ICP27_CasX_9 gRNA and exhibited greater than three -fold enrichment in the mCherry+mTagBFP2+ cells compared to the control cells. These nine gRNA pairs were selected for further analysis.Table 31: gRNA pairs with greater than 2-fold enrichment and less than 0.01 statistical difference between the control group and mCherry+mTagBFP2+ group.Example 9 : In vitro evaluation of lead SaCas9 and CasX2 gRNA pairs in Vero cells. Materials and Methods1. Design of HSV-1 loss-of-signal knock-in reporter construct.
[0315] The HSV-1 loss-of-signal knock-in reporter construct consists of two main cassettes flanked by two AAVS1 CRISPR target sites (FIG. 32A). The first cassette is used to generate the knock-in cell line and includes a PGK promoter -driven EGFPreporter, followed by a P2A self-cleaving peptide, a puromycin resistant gene sequence (PuroR), and a human growth hormone polyA signal (hGH pA).
[0316] For the second cassette, the HSV-1 consensus sequences for ICP27 (5’ to 3’ orientation) and ICPO (3 ’ to 5’ orientation) flank a miniCMV-mTagBFP2-PEST-BGHpA expression cassette. mTagBFP2 is expressed at baseline. However, the excision induced by gRNAs targeting ICP27 and ICPO will remove the DNA fragment between the two gRNAs, including the mTagBFP2-PEST expression cassette. Consequently, this will lead to reduced mTagBFP2 expression.
[0317] The full construct was synthesized and prepared at GenScript.
[0318] Most of the components in the HSV-1 loss-of-signal knock-in reporter construct have the same sequences as the gain -of-signal knock-in reporter construct (FIG. 30A). The unique sequences for the HSV-1 loss-of-signal construct are listed in Table 32Table 32: Sequences for unique components in the HSV-1 loss-of-signal knock-in reporter construct.2. Evaluation of lead CasX2 gRNA pairs in HSV-1 loss-of-signal knock-in cells.
[0319] HSV-1 loss-of-signal knock-in cells were seeded in a 24-well plate. After 24 hours, the cells were transfected with 400 ng of plasmid DNA and 1 pl of Lip of ectamine 3000 (Thermo Fisher Scientific), following the manufacturer's protocol. 48 hours posttransfection, the HSV knock-in cells were harvested and analyzed using a MACSQuant VYB flow cytometer (Miltenyi Biotec), and the data were analyzed using FlowJo software (BD Biosciences).3. Design of scramble gRNA controls.
[0320] The scramble gRNA protospacer sequences were designed by shuffling the protospacer sequences of the lead SaCas9 gRNAs (ICP0_SaCas9_M2 and ICP27_SaCas9_Ml ) and lead CasX2 gRNAs (ICP0_CasX2_9 and ICP27_CasX2_9) (Table 33). The internal CasOffinder tool was used to confirm that there was no genomic target site within two mismatches plus one bulge or within three mismatches without a bulge against the genomes of human, African green monkey (the origin source of Vero cells), and rabbit. The gRNA pair ICP0_SaCas9_M2_scramble + ICP27_SaCas9_Ml scramble was used as a non-targeting control for the SaCas9 M2M1 gRNA pairs, and the gRNA pair ICP0_CasX2_9_scramble + ICP27_CasX2_9_scramble was used as a non-targeting control for the lead CasX2 gRNA pairs.Table 33: Summary of SaCas9 and CasX2 scramble gRNA information.4. Production of AAV2 vectors.
[0321] The AAV2 vectors were produced at PackGene Biotech. Triple plasmid transfection was performed in adherent HEK 293 cells. Subsequently, the AAV vectors were purified using iodixanol density gradient centrifugation and formulated in phosphate-buffered saline (PBS) containing 0.001% pluronic F-68. The titers of the AAV2 vectors were determined using QIAcuity digital PCR (Qiagen) with two primer / probe sets. One set targeted the CMV promoter sequence, while the other set targeted the SV40 poly A sequence. The primer and probe sequences are listed in Table 34. The average titers obtained from these two primer / probe sets were used as the AAV titers for the AAV2 vectors.Table 34: Primer and probe sequences for AAV2 titering.5. Evaluation of AAV2-SaCas9 and AAV2-CasX2 vectors in Vero cells.
[0322] Vero cells were seeded in individual wells of a 12 -well plate. After 24 hours, the cells were transduced with AAV2 vectors at different MOIs. 48 hours after transduction, the Vero cells were treated with HSV- 1 strain Syn l7+ virus at an MOI of one pfu per 500 cells. After three hours of HSV- 1 treatment, the HSV- 1 -containing media was removed and replaced with culture media. 48 hours afterHSV- 1 infection, the Vero cell lysate was harvested for ddPCR analysis, and the Vero cell culture supernatant was used for plaque assay analysis.6. Evaluation of SaCas9 and CasX2 plasmids in Vero cells.
[0323] Vero cells were seeded in individual wells of a 6 -well plate. After 24 hours, the cells were transfected with 1 .5 pg of either SaCas9 or CasX2 plasmid DNA and 3 pl of Lipofectamine 3000 (Thermo Fisher Scientific), following the manufacturer's protocol. 48 hours after transfection, the Vero cells were treated with HSV- 1 strain Syn l 7+ virus at a MOI of one pfu per 500 cells. After three hours of HSV -1 treatment, the HSV- 1 -containing media was removed and replaced with culture media containing 300 pg / ml of the HSV- 1 replication inhibitor Valacyclovir (MilliporeSigma). 24 hours later, the Valacyclovir-containing media was removed and replaced with fresh culture media. The Vero cells were then cultured for another four days. The Vero cell lysate was harvested for ddPCR analysis, and the Vero cell culture supernatant was used for plaque assay analysis.Results
[0324] An HSV- 1 loss-of-signal knock-in reporter HEK 293FT cell line was generated to examine the excision efficiency induced by the top CasX2 gRNAs identified from the lentiviral gRNA pair screening (FIG. 32A). The target sequences in this cell line were the HSV- 1 consensus sequences for ICP27 and ICP0 , which flanked a miniCMV- mTagBFP2-PEST-BGH pA expression cassette. mTagBFP2 -PEST is expressed at baseline. However, the excision induced by gRNAs targeting ICP27 and ICP0 will remove the DNA fragment between the two gRNAs, including the mTagBFP2 -PEST expression cassette. As a result, the expression of mTagBFP2-PEST will be reduced. Additionally, the PEST motif facilitates rapid d egradation of the mTagBFP2 -PEST fusion protein, allowing faithful reporting of the excision using mTagBFP2 fluorescence (Vidigal and Ventura 2015 ).
[0325] The HSV- 1 loss-of-signal knock-in reporter cells were co-transfected with two plasmids expressing the SaCas9 scramble gRNA pair (Table 33), SaCas9 M2M1 pair_20nt, CasX2 scramble gRNA pair (Table 33), or the top nine CasX2 gRNA pairs identified from the lentiviral gRNA pair screening (Table 31). All nine CasX2 gRNA pairs contain the ICP27_CasX_9 gRNA and different ICPO CasX gRNAs (g3 , g6, g9, gl 2, gl 3 , gl 4, gl 6, gl 9, g20). The excision efficiency was analyzed by quantifying the percentage of mTagBFP2-negative cells using flow cytometry analysis. The percentage of mTagBFP2-negative cells in scramble gRNA pair-transfected cells served as the assay baseline and was subtracted from the percentages of mTagBFP2-negative cells obtained with different gRNA pairs, and the mean + standard deviation data for the n of 3 was presented in FIG. 32B.
[0326] The SaCas9 M2M1 pair_20nt induced approximately 36% excision. Three CasX2 gRNA pairs, g6g9, g9g9, and gl 2g9, induced more than 20% excisi on and were selected for further studies (FIG. 32B)
[0327] Next, in vitro proof-of-concept studies using AAV2 -SaCas9 or AAV2-CasX2 vectors in Vero cells were performed. The AAV2 serotype was chosen because of its high transducibility in Vero cells.
[0328] In the first experiment, Vero cells were infected with either AAV2-SaCas9 M2M1 scramble vector or AAV2-SaCas9 M2M1 pair_20nt vector at a multiplicity of infection (MOI) of 20K, 100K, or 500K vector genomes (VGs) / cell. Sub sequently, the cells were infected with the HSV- 1 Syn l7+ virus. 48 hours post HSV- 1 infection, the impact of the AAV2 vectors on HSV- 1, presented as the mean + standard deviation (n = 2), was assessed using ddPCR and plaque assay (FIGs. 33A and 33B).
[0329] Compared to the scramble vector control, the AAV2 -SaCas9 M2M1 pair_20nt vector substantially reduced the HSV-1 viral load and infectious titer in a dose-dependent manner. Specifically, at the MOI of 20K, 100K, and 500K VGs / cell, the AAV2-SaCas9 M2M1 pair_20nt vector reduced the HSV- 1 viral load by 91 .8%, 96.7%, and 99.9%, respectively (FIG. 33A). It also decreased the HSV-1 viral titer by 96.3%, 99.7%, and 99.97% at the same MOIs (FIG. 33B).
[0330] Next, the effect of the AAV2 -SaCas9 M2M1 pair_22nt on HSV- 1 viral load and infectious titer was examined and presented as the mean + standard deviation for the n of 2 (FIGs. 33C-33D). Compared to the AAV2-SaCas9 M2M1 pair_20nt vector, the AAV2-SaCas9 M2M1 pair_22nt vector showed a more potent HSV- 1 inhibition. Compared to the corresponding scramble vector co ntrols, the AAV2-SaCas9 M2M1 pair_22nt vector reduced HSV- 1 viral load by 2 logs and 4 logs at the MOI of 100K and50 OK VGs / cell, respectively (FIG. 33 C), and reduced HSV- 1 viral titer by 5 logs and 6 logs at the MOI of 100K and 500K VGs / cell, respectively (FIG. 33D).
[0331] Next, the effect of the AAV2-CasX2 g6g9 pair and AAV2-CasX2 g9g9 pair on HSV- 1 viral load and infectious titer at the highest MOI used in the AAV2 -SaCas9 experiments, which is 500K VGs / cell, was examined and presented as the mean + standard deviation for the n of 2 . Compared to the scramble vector control, the AAV2- CasX2 g6g9 pair vector and AAV2-CasX2 g9g9 pair vector only reduced HSV- 1 viral load by 53.3% and 49.8%, respectively (FIG. 33E), and reduced HSV- 1 viral titer by 60.9% and 43.5%, respectively (FIG. 33F).
[0332] CasX2 demonstrated lower efficacy than SaCas9 in reducing HSV-1 replication. In Vero cells, the replication cycle of HSV- 1 takes approximately four hours, and the HSV- 1 DNA level increases by about 100 times in 24 hours (data not shown). To evaluate the effect of SaCas9 and CasX2 on replication-inhibited HSV-1 virus, Vero cells were transfected with SaCas9 or CasX2 plasmid DNA, and then infected with HSV-1 strain Syn l 7+ virus. Sub sequently, the Vero cells were treated with the HSV-1 replication inhibitor Valacyclovir (300 pg / ml) for 24 hours, and then cultured for another four days to allow HSV- 1 to replicate after withdrawal of Valacyclovir. The data was presented as the mean + standard deviations for the n of 2.
[0333] C ompared to the scramble control, the SaCas9 M2M1 pair_20nt and SaCas9 M2M1 pair_22nt reduced HSV- 1 viral load by 88.7% and 94.0%, respectively (FIG. 34A), and reduced HSV- 1 viral titer by 84.7% and 93.0%, respectively (FIG. 34B). Compared to the pCasX2 empty vector control, the CasX2 g6g9 pair and g9g9 pair reduced HSV- 1 viral load by 96.2% and 99.5%, respectively (FIG. 34A), and reduced HSV- 1 viral titerby 98.8% and 99.2%, respectively (FIG. 34B). Therefore, when HSV- 1 replication is suppressed, the lead CasX2 gRNA pairs dem onstrated more potent inhibition of the HSV- 1 virus than the lead SaCas9 gRNA pairs.
[0334] Taken together, these data suggest that both SaCas9 gRNA pairs and CasX2 gRNA pairs can sub stantially inactivate the HSV- 1 virus. Thus, these results indicate that the AAV vectors described herein can effectively be used to inactivate viruses generally and are not limited to one specific virus.Example 10 : Off-target analysis for lead SaCas9 and CasX2 gRNAs.Materials and Methods.1. GUIDE-seq experiment.
[0335] GUIDE-seq was performed with minor adjustments to the original protocol (Tsai, et al. 2015). Briefly, the HSV- 1 loss-of-signal knock-in reporter cells (FIG. 32A) were transfected using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific) according to the manufacturer’ s suggested protocol with 7.5 pmol of annealed double-stranded oligodeoxynucleotides (dsODN) and 400 ng of plasmid DNA expressing nuclease and guide RNA. 72 hours after transfection, the genomic DNA was extracted with the Maxwell RSC Cultured Cells DNA Kit (Promega) according to the manufacturer’ s suggested protocol. The GUIDE-seq library was prepared with the original adaptors according to protocols described by Joung and colleagues (Tsai, et al. 2015 ). Each library was indexed within the P5 and P7 adaptors for multiplex sequencing. Completed libraries were quantified by 4150 Tapestation System (Agilent) and Qubit 4.0 (Thermo Fisher), pooled with equal moles and sequenced on the MiSeq in strument using a MiSeq reagent kit v2 (300 cycles; Illumina).2. GUIDE-seq analysis.
[0336] The raw sequencing data were analyzed using an in -house developed Nextflow bioinformatics pipeline, which is based on the GUIDE-seq analysis code (Tsai et al., 2015) with modifications, as described below.
[0337] The modules for the Nextflow pipeline for GUIDE-seq data analysis include:• Demultiplexing: A pooled multi-sample sequencing run is demultiplexed into sample-specific read files based on sample-specific dual-indexed barcodes. Different from the published pipeline, this module uses deML tool (https: / / github.com / grenaud / deML) for demultiplexing the fastq files, which allows errors in the barcode sequences (allowed mismatches = 2).• Umitagging: Given the demultiplexed files 'tag' the reads by adding the 8bp Unique Molecular Identifier (UMI) barcode sequence and first six bases of genomic sequence to the FASTQ read name header in preparation for the sub sequent PCR duplicate read consolidation step .• Consolidation: Reads that share the same UMI and the same first six bases of genomic sequence are presumed to originate from the same pre -PCR molecule and are thus consolidated into a single consensus read to improve quantitative interpretation of GUIDE-seq read counts.• Read alignment: The demultiplexed, consolidated paired end reads are aligned to a reference genome using the BWA-MEM algorithm with default parameters (Li. H, 2009).• Identify dsODN integration sites: The start mapping positions of the read amplified with the tag-specific primer (second of pair) are tabulated on a genome-wide basis. Start mapping positions are consolidated using a 10- bp sliding window. Windows with reads mapping to both + and - strands, or to the same strand but amplified with both forward and reverse tagspecific primers, are flagged as sites of potential DSBs. Different from the published pipeline, dsODN primers with 2 mismatch allowance are searched across the reads, instead of only end of the read. This approach allows to identify primer sequences, which have sequencing errors and / or are masked by adapter sequences at the ends.• Realign identified sites: Different from the published pipeline, identified sites are realigned using Calitas tool, but using ±20bp window at the identified dsODN integration genomic co ordinate.• Genome coverage : Mosdepth package is used to calculate base coverage at the identified sites and provided in silico off -target sites.• Prepare target annotations: Annotations, such as gene names, descriptions, phenotypes, TSG overlaps, locations are prepared for the identified sites.
[0338] The results of identified sites, target annotations, calitas alignments and read QC and genome coverage were sent to AWS S3 bucket locations. An AWS Athena database and corresponding tables were created for the output results. The downstream analysis was performed using Tableau software by connecting to AWS Athena database.
[0339] All identified sites with up to 6mm were selected for further evaluation using hybrid capture sequencing.3. Hybrid capture experiment.
[0340] The HSV- 1 loss-of-signal knock-in reporter cells (FIG. 32A) were transfected using Lipofectamine 3000 transfection reagent (Thermo Fisher) according to the manufacturer’ s suggested protocol with 400 ng of plasmid DNA expressing nuclease and guide RNA. 72 hours after transfection, the genomic DNA was extracted with the Maxwell RSC Cultured Cells DNA Kit (Promega) according to the manufacturer’s suggested protocol. Hybrid capture library construction was performed with minor adjustments to the original protocol ( SureSelect XT HS2; Agilent) (Chaudhari, et al. 2020). Briefly, -200 ng of genomic DNA per sample was fragmented to 180 to 250 bp using the SureSelect Enzymatic Fragmentation Kit for ILM (Agilent). The fragmentedI l lgenomic DNA was end repaired, dA-tailed, and ligated to molecular -barcoded adaptors. The adaptor-ligated library was PCR amplified and purified with AMPure XP beads. The prepared DNA libraries were hybridized with the Probe Capture Library using SureSelect XT HS2 DNA Target Enrichment reagents (Agilent). The Probe / DNA hybrids were captured on magnetic beads, PCR amplified, dual-indexed, and pooled. The final pooled libraries were quality control te sted for size on a 4150 Tapestation (Agilent) and concentration on a Quibit4.0 (Thermo Fisher Scientific), and then sequenced with 20% PhiX on a NovaSeq X Plus PEI 50 system (Illumina).4. Hybrid capture analysis.
[0341] Hybrid capture allows for enrichment and deep sequencing of the genomic regions of interest. Hybrid capture method has the advantage of Duplex UMI sequencing, which leverages the sequence complementarity of double stranded DNA to filter out false variants showing up in one but not the other strand of the original dsDNA fragment, and to gain further confidence of variants showing up in both strands of the original fragment. Several studies have combined duplex UMI sequencing with hybridization capture enrichment to detect as low as 0.1 % tumor derived cell free DNA with over 85-90% sensitivity and over 95% specificity (Lanman, et al. 2015 ; Newman, et al. 2016).
[0342] The in-house developed bioinformatics pipelines, nf-createumiconsensus (FIG. 35) and nf-targetedampliconseq (FIG. 36), are bioinformatics best-practice analysis pipelines for UMI consensus building based on duplex sequencing and analysis of hybrid capture data for genome editing. Both pipelines were built using Nextflow, a workflow tool to run tasks across multiple compute infrastructures in a very portable manner.
[0343] The hybrid capture analysis was divided into a few major stages:UMI consensus building with nf-createumiconsensus pipeline1. Automated data ingestion of raw fastq reads using AWS S3 links defined in the sample sheet.2. Raw fastq read preprocessing using FASTP (adapter, quality and poly-G trimming) (raw fastq file analysis).3. BWA MEM alignment of trimmed reads to the reference genome (raw fastq file analysis).4. Generating UMI consensus alignment files using fgbio tools.Small indel / SNV detection using nf-targetedampliconseq pipeline5. Small indel / SNV calling using CRISPRessoWGS.6. Structural variant calling using fgsv.7. Preparing annotations for nominated site genomic regions.8. QC reporting.9. Statistical modeling to identify significant events.5. Hybrid capture analysis pipeline inputs.
[0344] The inputs for the bioinformatics analysis are: samplesheet, nominated site list, reference genome and bwa index, and genome annotations.• Samplesheet: Sample sheet {experiment id }. samplesheet. csv records information about samples, the corresponding AWS S3 links for the fastq files, and other information that dictates the behavior of the pipeline . Same samplesheet structure is used for both nf-createumi consensus and nf- targetedampliconseq pipelines.• Nominated Sites: In silico off-target profile of the selected CasX2 and SaCas9 guide RNA sequences were obtained using an in house developed Nextflow pipeline, as described in Example 2 section of this patent application. Additionally, the sites that were identified using the GUIDEseq pipeline were concatenated to this list. The resulting nominated chromosomal sites has been compiled to generate the {experiment_id j.predicted_sites.txt input file for the nf- targetedampliconseq pipeline.• Reference genome: The human hg38 genome was used as the reference genome for the nomination of sites and all the described bioinformatics pipelines. pL0816 plasmid sequence with ICPO and ICP27 consensus sequences was amended to hg38 genome for hybrid capture sequencing analysis.• Annotations of the human genome reference: Genomic positions are annotated using GTF files provided by EMBL-EBI through Ensembl. Annotations are mapped to the reference using the annotation s.nf module of the nf-targetedampliconseq pipeline.6. FASTP pre-processing for hybrid capture sequencing reads.
[0345] Raw paired end fastq reads for hybrid capture are adapter, poly-G and quality trimmed using FASTP (Chen, et al. 2018 ) tool in nf-createumiconsensus. Universal Illumina adapter sequences that were used for adapter trimming a re shown below.• R1 : AGATCGGAAGAGCACACGTCTGAACTCCAGTCA• R2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
[0346] During nf-createumiconsensus fastp pre-processing step, reads shorter than 70bp, reads with low quality (the number of bases with phred quality <Q 15 is >40% of the read length) and reads with number of N bases more than 10 were removed.
[0347] The paired reads were base corrected at the overlapping region using FASTP tool, which uses local pairwise alignments of forward and reverse reads to correct bases at the overlapping regions. If a base is corrected, the quality of its paired base is assigned to it so that they will share the same quality. This function is based on overlapping detection parameters, which should meet these three conditions simultaneously :• the minimum length to detect overlapped region of PE reads = 20bp• the maximum number of mismatched bases to detect overlapped region of PE reads = 3 bases• the maximum percentage of mismatched bases to detect overlapped region of PE reads = 15%7. BWA MEM alignment.
[0348] The preprocessed and UMI tagged reads were aligned to the reference genome (hg38 amended with HSV-1 knock-in construct) using BWA MEM. The nf- createumiconsensus pipeline uses the default alignment parameters and uses soft- clipping for supplementary alignments (-Y). For reproducibility of the alignment results input bases parameter (-K) was set to 150M. The BWA MEM alignment was repeated after the CallDuplexConsensusReads step of nf -createumiconsensus pipeline using the same parameters.8. UMI consensus generation using fgbio tools.
[0349] Duplex UMI sequencing leverages the sequence complementarity of double stranded DNA to filter out false variants showing up in one but not the other strand of the original dsDNA fragment, and to gain further confidence of variants showing up in both strands of the original fragment. During hybrid capture library preparation both strands of the DNA were tagged by ligation of adapters with a random 3 bp barcode. The paired-end reads were then grouped into families or single strand consensus sequences (SSCS) representing the forward (ab -SSCS) or reverse (ba-SSCS) strand that were then re-united into the original duplex consensus sequence (DCS).
[0350] To build the consensus sequences, the in-house nf-createumiconsensus pipeline (FIG. 35) was developed based on fgbio toolkit (Fulcrum Genomics) following the recommended best practice protocol(github .com / fulcrumgenomics / fgbio / blob / main / docs / best-practice-consensus-pipeline. md). During the UMI read grouping step, one mismatch was allowed between UMIs to account for sequencing errors in the UMIs. At the consensus re ad filtering, -M 1 0 0 parameter was used to select for consensus reads that come from both unique and PCR amplified reads from single strand or duplex consensus sequences.
[0351] The sequencing quality, alignment and UMI metrics were collected throughout the pipeline, and channeled into the qc results.nf and multiqc.nf modules to produce reports about quality of the reads / bases, alignment percentages (primary, secondary, supplementary), deduplication rates, PCR amplification rates of the library and ab -SSCS, ba-SSCS, DCS rates.
[0352] The aligned reads (bam files) emitted by the filterconsensusreads. nf module were sent to AWS S3 , and the nf-targetedampliconseq pipeline was run using input is bam = true parameter to process these bam files using CRISPRessoWGS and fgsv for variant detection analysis.9. Identification of small indel / SNV profiles.
[0353] The BWA MEM aligned reads were channeled into the CRISPRessoWGS. nf module of nf-targetedampliconseq pipeline (FIG. 36) together with a file (--region file) that defined the parameters of amplicon size to be extracted (50bp sequence: expected cut-site ± 25bp sequence), quantification window center (--qwc -3) and quantification window size (--qws 5). CRISPResso2 extracted the reads thatfully overlapped with the genomic coordinates of the defined amplicon, trimmed the reads to the defined amplicon genomic coordinates, and wrote a trimmed fastq file for each nominated site. The fastq files were then subjected to a global sequence alignment using a Needleman-wunsch based algorithm that took into account biological knowledge of nuclease function. The following parameters were used for cut-site aware alignments to better place putative editing events closer to the cut site (set to default values in nf-targetedampliconse pipeline):• needleman wunsch gap open: Gap open option for Needleman -Wunsch alignment (default: -20)• needleman wunsch gap extend: Gap extend option for Needleman -Wunsch alignment (default: -2)• needleman wunsch gap incentive: Gap incentive value for inserting indels at cut sites (default: 1)
[0354] The output of CRISPResso2 consisted of a set of informative read depth, editing frequency (cumulative variation frequency per cut-site ± 5bp quantificationwindow), and allele frequency tables that allowed forthe quantification and visualization of the position and type of outcomes within the 5Obp sequence (expected cut -site ± 25bp).
[0355] In hybrid capture, the cut sites of the nominated sites might be closer to the end of the reads due to staggered reads obtained during sonication and probe capture. To be able to process all cut sites even if the flank size was not sufficient to cover cut-site ± 25bp window, the CRISPRessoWGSCORE.py code was modified to include a read merging step for the reads at each extracted nominated site region. The merged and unmerged reads were concatenated and processed by CRISPResso2. Additionally, to avoid double counting unmerged reads, the CRISPRessoWGSCORE.py code was modified to keep track of the read names that overlap with cut-site ± 25bp window and avoid processing them a second time. All these changes are verified for correctness using synthetic fastq files.10. Amplicon-seq experiment.
[0356] The HSV- 1 loss-of-signal knock-in reporter cells (FIG. 32A) were transfected using Lipofectamine 3000 transfection reagent (Thermo Fisher) according to the manufacturer’ s suggested protocol with 400 ng of plasmid DNA expressing nuclease and guide RNA. 72 hours after transfection, the genomic DNA was extracted with the Maxwell RSC Cultured Cells DNA Kit (Promega) according to the manufacturer’s suggested protocol. Regions flanking each target site were PCR amplified using locusspecific primers bearing tails complementary to the TruSeq Illumina adapters as described previously . 50 ng of input genomic DNA was PCR amplified with the Q5 High Fidelity DNA Polymerase (New England Biolab s) with 30 cycles of 98°C for 15 sec, 65 °C for 30 sec, and 72 °C for 30 sec. Following completion of the first step, each sample was run on an agarose gel to check for amplification and diluted 1 Ox with water. 0.5 pl of each PCR reaction was amplified with barcoded primers to reconstitute the TruSeq adaptors using the Q5 High Fidelity DNA Polymerase (New England Biolabs) with 10 cycles of 98°C for 15 sec, 65°C for 30 sec, and 72 °C for 30 sec . Equal amounts of the barcoded PCR products were pooled and purified with 0.7x SPRIselect bead-based reagent (Beckman Coulter), washed twice with 80% ethanol, and eluted in 30 pl of lx TE buffer. The purified library was deep sequenced on MiSeq using a MiSeq reagent kit v2 (500 cycles; Illumina).11 . Amplicon-seq analysis.
[0357] MiSeq data analysis for indel frequencies at the on-target and off-target sites was performed using the CRISPResso2 software (CRISPResso --fastq rl --fastq_r2 —amplicon seq --guide seq --cut offset 1 --ignore substitutions --plot window size 20 - -window_around_sgrna 5 (Clement, et al. 2019). fastq_rl” and “--fastq_r2“ denote the rl and r2 Fastq files that are output from the MiSeq machine, “--amplicon seq” and“-- guide seq” are the input anticipated amplicon and guide RNA sequence. “ --cut offset” is the center of quantification window to use within respect to the 3 ' end of the provided sgRNA sequence. A +1 position is the default parameter for Cas l2a, which produces a similar 5 ’ overhang as CasX2. “ --ignore substitutions” is used to ignore subtitutions around the cut positions as these may be caused by sequencing error. “ — plot window size” defines the size of the window extending from the quantification window center to plot. “ --window around sgrna” defines the size (in bp) of the quantification window extending from the position specified by the " --cut offset" parameter in relation to the provided guide RNA sequence(s) ( --guide seq). Mutations within this number of bp from the quantification window center are used in classifying reads as modified or unmodified.Results
[0358] Although it was demonstrated that both SaCas9 gRNA pairs and CasX2 gRNA pairs could induce reduction of HSV- 1 infection in in vitro proof-of-concept experiments, it was also verified that these potent cargos did not create undesired gene editing outcomes. To characterize the specificity of the nucleases with their respective gRNAs, the cell-based unbiased off-target discovery method GUIDE-seq (Tsai, et al. 2015 ) was conducted to assay for potential off-target sites in 293FT cells. This tag-based method relies on NHEJ-mediated integration of exogenously supplied blunt, doublestranded oligodeoxynucleotides (dsODN) of defined sequence into double -stranded breaks (DSBs) within the cellular genome. GUIDE-seq analysis identified very few nominated off-target sites for both the SaCas9 gRNAs and CasX2 gRNAs as determined by Unique Molecular Identifier (UMI) read count (Table 35). Sites in Table 35 were categorized based on number of mismatches and bulges between the spacer sequence of interest and the genome target site. 0 total mismatch plus bulge is the intended on -target site in the HSV- 1 loss-of-signal knock-in reporter construct. No sites with < 6 total mismatches plus bulges were identified for ICP0_CasX_6. No sites with < 3 total mismatches plus bulges were identified for any of the tested gRNAs.Table 35: Summary of GUIDE-seq data.
[0359] Total read counts at the on-target sites were high, except for ICP0_SaCas9_M2 and ICP0_SaCas9_M2_22 (Table 36), potentially due to the >85% GC-content in the surrounding region of these two gRNAs. Read counts were combined from two or three biological replicates. For ICP0_SaCas9_M2 and ICP27_SaCas9_Ml, only nominated sites with < 5 total mismatches plus bulges are listed. The read counts at the GUIDE-seq nominated sites were significantly lower than the read counts at the on-target sites.
[0360] Together, the GUIDE-seq results suggested that the lead SaCas9 and CasX2 gRNAs may pose minimal risk for off-target activity.Table 36: Summary of unique read counts for sites nominated by GUIDE-seq for selected SaCas9 and CasX2 gRNAs.
[0361] Next, Hybrid Capture-Based Next Generation Sequencing (HC-NGS) (Chaudhari, et al. 2020) was performed to examine the activity at the GUIDE-seq nominated off-target sites (< 6 mismatches plus bulges) and in silico nominated off-target sites (< 5 mismatches plus bulges) (Table 37). The SaCas9 and CasX2 nominated sites were divided into groups based on each nuclease and hybrid capture probes were designed according to Agilent’ s SureDesign program. For the ICP0_SaCas9_M2 and ICP27_SaCas9_Ml gRNAs, the probe design and HC-NGS experiments were only produced and conducted for the 22-nt guide RNA variant as the SaCas9 M2M1 pair_22nt showed higher activity than the M2M1 pair_20nt in Vero cells (FIGs. 33A-33D). The results were obtained from three biological replicates (Rl, R2, and R3) and are presented as indel percentages for each replicate. The target region is the location of the gRNA on the HSV-1 loss-of-signal knock-in reporter construct. Forthe nominated off-target sites, only nominated sites with < 5 total mismatches and bulges were listed, and ICP27_SaCas9_Ml_22_gRNA in FIG. 38 A and ICP0_M2_22_gRNA in FIG. 38B served as controls. For the potential off-target sites, these sites include GUIDE-seq sites and in silico nominated sites with a maximum of six total mismatches + bulges, and in each panel in FIGs. 39A-39D, both the control samples and the other three gRNA samples served as controls.Table 37: Summary of hybrid capture probe design.
[0362] The HC-NGS analysis indicated robust editing activity (> 10% Indel) at the on-target sites (FIGs. 37A and 37B). The editing activity at all nominated off-target sites was near background levels compared to negative controls for all the tested SaCas9 gRNAs (FIGs. 38A and 38B) and CasX2 gRNAs (FIGs. 39A-39D).
[0363] The off-target activity for CasX2 has not been well studied. As a secondary confirmation of the HC-NGS results, amplicon-seq was performed at a selection of GUIDE-seq or in silico nominated off-target sites for CasX2 gRNAs. The results were obtained from three independentbiological replicates and were represented as the mean + standard error. Statistical significance was determined using a two -tailed Student’s t- test (ns, p > 0.05). Near background levels of editing were ob served at the nominated off-target sites for the selected CasX2 gRNAs (FIG. 40).
[0364] Taken together, these off-target analyses suggested that the lead gRNAs for SaCas9 and CasX2, which target the HSV- 1 ICP0 and ICP27 genes, demonstrate high specificity with minimal off-target activity . These results provide us with the confidence to proceed with the in vivo proof-of-concept experiments for SaCas9 and CasX2.Example 11: In vivo evaluation of a SaCas9 gRNA pair in a latent rabbit keratitis model.Materials and Methods1 . Production of AAV vectors.
[0365] The AAV vectors that express both the SaCas9 or CasX2 (SaCas9 / CasX2) nuclease and paired gRNAs (FIG. 41A) were used in the rabbit HSV- 1 keratitis studies. The AAV-SaCas9 M2M1 pair_20nt vectors were tested in both a corneal scarification study and an IV study, while the AAV9 -CasX2 g6g9 pair vector and the AAV9-CasX2 g9g9 pair vector were tested in the IV study. In both cores, triple plasmid transfectionwas performed in HEK 293 cells to produce the AAV vectors. The purified AAV vectors were formulated in PB S containing 0.001% pluronic F -68. The titers of the AAV vectors were determined using QIAcuity digital PCR (Qiagen) with two primer / probe sets. One set targeted the CMV promoter sequence, while the other set targeted the SV40 polyA sequence (Table 32). The average titers obtained from these two primer / probe sets were used as the AAV titers for the AAV vectors.2. In vivo evaluation of a lead SaCas9 gRNA pair in a latent rabbit keratitis model.
[0366] Rabbit studies were approved by the Institutional Animal Care and Use Committee (IACUC). All procedures were performed in accordance with the IACUC policies of the University of Wisconsin -Madison and the ethical guidelines of the National Institutes of Health (NIH).
[0367] The rabbit keratitis study was performed as previously described (Washington, et al. 2018) with some modifications (FIG. 41 B). New Zealand White (NZW) rabbits were anesthetized using intramuscular injections of ketamine (MilliporeSigma; 30 to 45 mg / kg) and xylazine (MilliporeSigma; 7.5 to 1 1 .5 mg / kg). Rabbits were then infected with the HSV- 1 strain 17Syn+ virus at a concentration of 150,000 pfu / eye in a volume of 15 pl directly onto the cornea following light corneal scarification in a 2X2 crosshatch pattern.
[0368] Rabbits were monitored daily for health and signs of blepharitis and conjunctivitis. Eyes were cleaned daily with saline solution. Slit lamp exams were performed every 2-3 days during this acute infection stage to assess ocular lesions. Rabbits that exhibited acute lesions with subsequent recovery were considered latently infected and included in the further procedures.
[0369] After the establishment of latency (four weeks post HSV- 1 infection), the AAV vectors were administered to the latent rabbits. For the corneal scarification study, the AAV vectors were applied to the corneal surface of rabbits following corneal abrasion at an inoculum of 5E+10 Vector Genomes / eye for each AAV vector in a total volume of 30 pl. For the IV study, the AAV vectors were inj ected into the ear vein of the latent rabbits. The low dose of AAV vectors used in the IV study was 6E+12 Vector genomes / kg rabbit weight, and the high dose of AAV vectors used in the IV study was 3E+13 Vector genomes / kg rabbit weight.
[0370] Four weeks after AAV administration, HSV- 1 reactivation was induced by transcorneal iontophoresis of epinephrine (TCIE) using previously described methods on both corneas of latently infected rabbits (Washington, et al. 2018). Briefly, rabbits latently infected with HSV- 1 were anesthetized with intramuscular injections ofketamine / xylazine. TCIE was performed on both eyes using a 0.015% epinephrine solution in water at 0.8 mA for eight minutes per eye. This procedure was repeated on three consecutive days.
[0371] Sterile cotton-tipped applicators were used to swab the corneal surface and under the eyelids of the rabbits. Swabbing was conducted twice daily (once in the morning and once in the afternoon) from each eye, starting on the first day of TCIE and continuing for 12 consecutive day s. On the days of TCIE, one ocular swab was collected before the procedure, and another ocular swab was collected after the procedure. The applicators containing the ocular swabs were placed in a tube containing 1 ml of sterile DMEM supplemented with 1 % fetal bovine serum and 1 % antibiotic / antimycotics. The swab s from the same day were combined for sub sequent plaque assays.
[0372] Animals were humanely euthanized 14 days after the last TCIE, and tissues were collected and snap frozen for further analysis.3. Plaque assay.
[0373] Vero cells were seeded in a 24-well plate and incubated for 24 hours until they reached approximately 90% confluence. The tubes containing the ocular swab s were placed on a rocker at room temperature for one hour. Next, the normal growth medium was removed from the Vero cells, and the medium from each ocular swab tube was transferred to individual wells in the 24 -well plate. The plate was then incubated at 37°C with 5% CO2for seven days. Finally, the individual wells were examined under a microscope to determine the presence or ab sence of plaques.4. DNA analysis.
[0374] The genomic DNA was extracted from the frozen trigeminal ganglion (TG) and cornea tissues of the treated rabbits using a Maxwell RSC 48 Instrument (Promega) and the Maxwell RSC Tissue DNA Kit (Promega) according to the manufacturer’s instructions. In short, the frozen ti ssue samples were thawed in lysis buffer on ice for 2 hours and then were mechanically homogenized in the Bead Ruptor 12 homogenizer (Omni International). Tissue homogenate was loaded onto the prepared Maxwell RSC 48 cartridge for genomic DNA extraction an d purification.
[0375] Digital PCR (dPCR) was performed using the QIAcuity digital PCR system (Qiagen). For dPCR amplifications, approximately 50 ng of genomic DNA was used as template with thermal cycling conditions of 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 sec and 60°C for 1 min.
[0376] The number of AAV vector genome copies in the TG and cornea tissues was quantified using one primer / probe settargeting the CMV promoter sequence and another primer / probe set targeting the SV40 polyA sequence in the AAV vector genome (Table 34). The HSV- 1 viral load in the TG was quantified using one primer / probe set targeting the UL28 gene (Table 21) and another primer / probe set targeting the HSV- 1 LAT intron region . The AAV and HSV- 1 copy numbers were normalized to the copy number of the rabbit Tert DNA to calculate the AAV and HSV- 1 copy numbers per cell.
[0377] The new dPCR primer and probe sequences used for rabbitDNA analysis are listed in Table 38.Table 38: Primer and probe sequences for DNA analysis in rabbit studies.5. RNA analysis.
[0378] The total RNA was extracted from the frozen rabbit TG tissues using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer' s protocol. The RNA was then reverse transcribed into cDNA using the SuperScript IV VILO Kit (Thermo Fisher Scientific) following the manufacturer's instructions. The cDNA was d iluted and quantified using the QIAcuity digital PCR system (Qiagen). The thermal cycling conditions used were 95 °C for 2 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min.
[0379] The level of HSV- 1 LAT RNA was normalized to the level of rabbit Hrptl mRNA. The LAT primer and probe sequences used for the RNA analysis are the same as the sequences used for the DNA analysis (Table 38). The primer and probe sequences for the rabbit Hrptl gene are listed in Table 39.Table 39: Primer and probe sequences for the rabbit Hprtl gene.Results
[0380] To evaluate the effect of CRISPR-Cas9 gene editing in the latent rabbit keratitis model, a corneal scarification administration route was first used to deliver the AAV-SaCas9 M2M1 pair_20nt vectors into rabbits. The NZW rabbits were first infected bilaterally with HSV-1 strain 17Syn+ virus via corneal scarification. After four weeks post HSV-1 infection, when latency was established, the rabbits were administered via corneal scarification with the control AAV vectors or the AAV8-Y733F or AAV9 vectors expressing both SaCas9 and M2M1 pair_20nt. AAV9 had not been previously evaluated in the latent rabbit keratitis model. In this study, AAV9 preps from two different vector cores (UFL and UNC) were evaluated.
[0381] After four weeks of AAV administration, the HSV -1 virus was reactivated via transcorneal iontophoresis of epinephrine (TCIE) . To examine viral shedding, ocular swabs were collected from each eye starting on the first day of TCIE and continued for 12 consecutive days. HSV-1 viral shedding was determined by plaque assay of daily ocular swabs (Table 40). Any cells in Table 40 marked with x indicate a positive result for the plaque assay, which is indicative of infectious virus.Table 40: Summary of plaque assay results for ocular swab samples in the corneal scarification study.
[0382] The rabbit eyes administered with the AAV8-Y733F-EGFP vector exhibited viral shedding in all eyes (Table 40 and FIG. 42A). In contrast, only 50% of rabbit eyes administered with the AAV8-Y733F-SaCas9 M2M1 pair vector showed viral shedding (Table 40 and FIG. 42A). Similarly, the rabbit eyes administered with the AAV9-SaCas9 scramble control vector showed viral shedding in all eyes (Table 23 and FIG. 42A). In contrast, only 40% of rabbit eyes administered with the AAV9-SaCas9 M2M1 pair vector(UFL prep) and 37.5% of rabbit eyes administered with the AAV9-SaCas9 M2M1 pair vector (UNC prep) showed viral shedding (Table 40 and FIG. 42A).
[0383] The CRISPR-Cas treatment also resulted in a decreased number of HSV-1 positive swabs out of the 12 total swabs collected form each rabbit eye , as represented by the mean + standard deviation (n = 6- 10). The percentages of positive swabs in rabbit eyes treated with AAV8 -Y733F-EGFP, AAV8 -Y733F-SaCas9 M2M1 pair, AAV9- SaCas9 scramble, AAV9-SaCas9 M2M1 pair (UFL prep), and AAV9-SaCas9 M2M1 pair (UNC prep) were 3 1%, 9.4%, 22%, 10%, and 9.4% respectively (FIG. 42B). Four out of eight eyes treated with AAV8-Y733F-SaCas9 M2M1 pair, six out of ten eyes treated with AAV9-SaCas9 M2M1 pair (UFL prep), and five out of eight eyes treated with AAV9 - SaCas9 M2M1 pair (UNC prep) showed no viral shedding in all 12 ocular swabs examined (FIG. 42B), indicating that CRISPR-Cas treatment eliminated latent virus in these rabbit eyes.
[0384] In summary, both the AAV8 -Y733F vector and the AAV9 vector-packaged SaCas9 M2Ml pair, when administered with corneal scarification, gre atly reduced viral shedding in the latent rabbit keratitis model.
[0385] After successfully conducting the proof-of-concept study in the latent rabbit keratitis model via corneal scarification administration route, the use of the intravenous (IV) administration route to evaluate the efficacy of the AAV9-SaCas9 M2M1 pair_20nt vector was further explored, as well as the AAV9-CasX2 g6g9 pair and AAV9-CasX2 g9g9 pair vectors in this rabbit model.
[0386] The AAV9-SaCas9 M2M1 pair_20nt vector was tested at both a low (6E+12 VG / kg) and a high AAV dose (3E+13 VG / kg), whereas the AAV9-CasX2 vectors were only tested at the high AAV dose (3 E+ 13 VG / kg). Any cells in Table 41 marked with x indicate a positive resultfor the plaque assay, which is indicative of infectious virus.
[0387] All rabbit eyes in the three control groups (AAV buffer, AAV9-SaCas9 scramble, AAV9-CasX2 scramble) exhibited viral shedding following reactivation using epinephrine, except for one eye in the AAV9-SaCas9 scramble group (Table 41 and FIG. 43 A). Each dot in FIG. 43 represents an individual rabbit eye. None of the rabbit eyes in the AAV9-SaCas9 M2M1 pair (low dose) group showed viral shedding, and only one eye in the AAV9-SaCas9 M2M1 pair (high dose) group showed viral shedding (Table 41 an d FIG. 43A) SaCas9 and gRNA expression was not detected in the TG of the eye that showed shedding in the high dose group. Additionally, two out of fourrabbit eyes in th e AAV9-CasX2 g6g9 pair group and one out of six rabbit eyes in the AAV9 -CasX2 g9g9pair group did not exhibit viral shedding (Table 41 and FIG. 43A). Rabbit 2’ s OD eye did not receive TCIE due to corneal opacity .
[0388] Similar to the corneal scarification study, the CRISPR-Cas treatment in the IV study also resulted in a decreased number of HSV- 1 positive swabs out of the 12 total swab s collected from each rabbit eye. The data were presented as the mean + standard deviation (n = 3 -6). The percentages of positive swabs perrabbit eye in the AAVbuffer, AAV9-SaCas9 scramble, AAV9-SaCas9 M2M1 pair (low dose, 6E+12 VG / kg), AAV9- SaCas9 M2M1 pair (high dose, 3E+13 VG / kg), AAV9-CasX2 scramble, AAV9-CasX2 g6g9 pair, and AAV9-CasX2 g9g9 pair groups were 38.9%, 3 1.3%, 0%, 6.9%, 37.5%, 10.4%, and 18.1 %, respectively (FIG. 43B).Table 41: Summary of plaque assay results for ocular swab samples in the IV study.
[0389] Next, AAV biodistribution, as presented by mean + standard deviation for the n of 2, 3 , or 5 , was examined in the TG (FIGs. 44A and 44B) and cornea (FIG. 45A and 45B) of the rabbits from the IV study using dPCR analysis. The copy number of AAV vector genome was quantified by dPCR using two primer / probe sets. One set targeted the CMV promoter sequence, and the other set targeted the SV40 polyA sequence in the AAV vector genome. The AAV copy number was normalized to the rabbit Tert copy number to determine the AAV copy number per cell.
[0390] In the TG, rabbits that received a low dose of AAV vectors had approximately one AAV copy per cell, while rabbits that received a high dose had 5 - 12 AAV copies per cell (FIGs. 44A an d 44B). In the cornea, rabbits that received a low dose had approximately 0.4-0.6 AAV copies per cell, while rabbits that received a high dose had 0.6- 1 . 8 AAV copies per cell (FIGs. 45A and 45B).
[0391] The HSV- 1 viral load in the TG of the rabbits from the IV stu dy was also examined and presented by mean + standard deviation for the n of 2, 3 , or 5 (FIGs. 46A an d 46B) The HSV- 1 copy number was quantified by dPCRusing two primer / probe sets. One set targeted the UL28 gene (FIG. 46A), and the other set targeted the HSV- 1 LAT intron region (FIG. 46B). The HSV- 1 copy number was normalized to the rabbit Tert copy number to determine the HSV- 1 copy number per cell.
[0392] Compared to the AAV9-SaCas9 scramble control, both AAV9 -SaCas9 M2M1 pair (low dose) and AAV9-SaCas9 M2M1 pair (high dose) showed a reduction in HSV- 1 copy number per cell (FIGs. 46A and 46B). Additionally, compared to the AAV9-CasX2 scramble control, the AAV9 -CasX2 g9g9 pair group also showed a trend of reduction in HSV- 1 copy number per cell (FIGs. 46A and 46B).
[0393] During HSV- 1 latent infection, the only highly expressed HSV- 1 viral gene product is the latency-associated transcript (LAT). The LAT is an 8.3 kb primary transcript, which is further spliced into stable 1 .5 and 2 kb major LAT introns, as well as a 6.3 kb minor LAT exon that is processed into a number of microRNAs (Nicoll, et al. 2016). The reduction in HSV- 1 viral load in the trigeminal ganglia (TG) induced by the AAV9-SaCas9 M2M1 pair vectors should also lead to reduced LAT intron RNA. To test this hypothesis, the level of LAT intron RNA in the TG was quantified using RT -dPCR analysis and normalized using rabbitHprtl mRNA. Consistent with the LAT DNA data, the LAT intron RNA, presented as mean + standard deviation for n of 2, 3 , or 5 , was greatly reduced by the AAV9-SaCas9 M2M1 pair (low dose) treatment and the AAV9- SaCas9 M2M1 pair (high dose) treatment (FIG. 47).
[0394] Taken together, the intravenous administration of AAV9-SaCas9 M2M1 pair vector, along with AAV9 -CasX2 g6g9 pair and g9g9 pair vectors, was effective in reducing viral shedding and HSV- 1 viral load in the latent rabbit keratitis model.Example 12: Co-targeting ICPO and ICP4 genes with HSV-l / HSV-2 shared SaCas9 gRNA pairs to inactivate both HSV-1 and HSV-2 viruses.A. Materials and Methods1. HSV genome library construction and ICP0 / ICP4 CDS sequence identification.
[0395] The internal HSV- 1 genome library was created as described in Example 7. The internal HSV-2 genome library was created in a similar way . Strain information and coding sequence (CDS) fasta sequences for the Herpesviridae family were downloaded from the Virus Pathogen Resource (ViPR) database (https : / / www.bv- brc. org / view / Virus / 548681 ); version Feb, 2022; 46,027 strains and 62,554 GenBank IDs. The GenBank IDs and CDS fasta sequences were filtered using the 8,665 GenBank IDs obtained from the NCBI Nucleotide database using the keyword "human alphaherpesvirus 2" .
[0396] The CDS sequences for the ICPO gene in different HSV - 1 strains were identified as described in Example 7. The CDS sequences for the ICPO gene in different HSV-2 strains were identified in a same way as in HSV- 1 (Table 42).
[0397] To identify the CDS sequences for the ICP4 gene in different HSV -1 and HSV- 2 strains, the HSV- 1 and HSV-2 strains and GenBank IDs containing' ICP4 $ |ICP4_|RS 1. *' were identified from the HSV-1 and HSV-2 genome libraries and labeled as ICP4 (Table 42).Table 42. Description of the searched patterns for ICPO and ICP4 CDS sequences and the total counts of strains and GenBank IDs containing the searched patterns.2. Selection of SaCas9 gRNAs that are conserved for both HSV-1 and HSV-2.
[0398] All matching NNGRRT PAM sequences with upstream 22-nt sequences were identified using Python regex algorithm by searching the 22 -nt [ATGC] + PAM patternin all the CDS sequences of all GenBank IDs for the lCPO and ICP4 genes in both HSV- 1 and HSV-2 genome libraries. Flags for allowing overlapping matches and ignoring letter case were set, and reverse complement of the pattern was also searched to find all possible exact matches to the PAM sequence with 22 -nt upstream sequences.
[0399] The output table of the guide design was aggregated to include strain and GenBank ID counts for each identified guide sequence. The percent guide conservation was calculated by dividing the strain counts for each guide by the total strain counts of the ICPO or ICP4 CDS sequences in the genome library.B. Results
[0400] Herein, a strategy for targeting two essential HSV-1 genes, ICPO and ICP27, to inactivate the HSV-1 virus is provided. In this example, the feasibility of using SaCas9 gRNA pairs that are conserved in both HSV-1 and HSV-2 to inactivate both viruses was evaluated. This approach has the potential to facilitate the development of a single gene therapy product for treating all herpes-related diseases.
[0401] Although no ICP27 -targeting SaCas9 gRNAs were identified as conserved across both viruses, one ICPO-targeting gRNA and two ICP4 -targeting gRNAs conserved for both HSV-1 and HSV-2 were identified (Table 43). Each of the three gRNAs showed >90% conservation for both HSV-1 and HSV-2 viruses. These three gRNAs can form two gRNA pairs capable of co-targeting ICPO and ICP4 for both HSV-1 and HSV-2, suggesting a gene editing strategy for treating all herpes -related diseases.Table 43: Summary of the ICPO or ICP4 targeting SaCas9 gRNAs that are conserved in both HSV-1 and HSV-2.
[0402] The efficacy of targeting both the ICPO and ICP4 genes with paired gRNAs as a therapeutic strategy for treating diseases caused by HSV - 1 and HSV-2 was assayed. There are two copies of both the ICPO and ICP4 genes in the HSV- 1 and HSV-2 genomes. Thus, paired gRNAs co-targeting ICPO and ICP4 can introduce double-strand breaks at four distinct locations within the HSV genome.
[0403] To evaluate the efficacy of two HSV- l / HSV-2 shared SaCas9 gRNA pairs targeting ICPO and ICP4 in inactivating HSV- 1 and HSV-2 viruses, Vero cells were transfected with an all-in-one AAV plasmid expressing SaCas9 and either HSV- 1 / HSV- 2 Pair 1 (ICP0_SaCas9_2 + ICP4_SaCas9_l) or HSV- l / HSV-2 Pair 2 (ICP0_SaCas9_2 + ICP4_SaCas9_2). After 72 hours, the transfected cells were infected with either the HSV- 1 strain 17 Syn+ virus (MOI: 2.0E -5) or the HSV-2 strain MS virus (MOI: 6.6E-5) for two hours. 48 hours post-infection, cell lysates were collected for HSV DNA analysis using dPCR (FIGs. 48A and 48C), and the supernatants were analyzed for HSV titers using a plaque assay (FIGs. 48B and 48D). The data were presented as the mean + standard deviation for the n of 2, with the numbers above the bars indicating the reduction achieved by the treatment compared to the scrambled gRNA pair control.
[0404] For HSV- 1 , Pair 1 and Pair 2 reduced HSV- 1 viral DNA levels by 58% and 79%, respectively, compared to the scrambled gRNA pair (FIG. 48A). Similarly, the viral titers of HSV- 1 were reduced by 77% and 95%, respectively (FIG. 48B). These results indicate that both pairs are effective at reducing HSV - 1 viral load .
[0405] For HSV-2, Pair 1 and Pair 2 reduced viral DNA levels by 77% and 94%, respectively, compared to the scrambled gRNA pair (FIG. 48C). Furthermore, HSV-2 viral titers were reduced by 93 % and 99%, respectively (FIG. 48D). These results demonstrate the strong efficacy of both pairs in targeting HSV-2. Note that one data point in FIG. 48D is zero and is not displayed on the logarithmic scale plot.
[0406] In summary, the Vero cell results demonstrate that co-targeting ICPO and ICP4 with paired gRNAs conserved across HSV- 1 and HSV-2 is a potentially effective therapeutic approach for inactivating both HSV- 1 and HSV-2 viruses.
[0407] To evaluate the specificity of the three identified HSV- l / HSV-2 shared SaCas9 gRNAs, the potential off-target effects of the three gRNAs was analyzed using the internal CasOffinder tool. These three gRNAs had up to 209 nominated off -target sites with up to 3 mismatches and 1 bulge, or up to 5 mismatches with no bulge ( Table 44). None of the gRNAs exhibited off-target sites in low mismatch / bulge combinations, including 0 mismatches + 1 bulge, 1 mismatch + 0 bulge, 1 mismatch + 1 bulge, or 2mismatches + 0 bulge (Table 44). These findings demonstrate a high degree of specificity for the selected SaCas9 gRNAs, supporting their potential for therapeutic a pplication. Table 44: Summary of in silico off-target analysis for the >70% conserved ICPO and ICP27 gRNAs.
[0408] To further characterize the specificity of the three HSV - l / HSV-2 shared gRNAs, GUIDE-seq analysis was performed in the HSV- 1 knock-in 293FT cells. The analysis revealed a minimal number of potential off-target sites for all three gRNAs (Table 45) Sites were categorized based on number of mismatches and bulges between the spacer sequence and the genome target site. 0 total mismatch plus bulge was the intended on-target site in the HSV- 1 knock-in reporter construct. No off-target sites with fewer than three total mismatches plus bulges were identified for any of the tested gRNAs.Table 45: Summary of GUIDE-seq data.
[0409] The read counts at the GUIDE-seq nominated off-target sites were significantly lower compared to the on-target sites (Table 46), indicating that the three HSV- l / HSV-2 shared SaCas9 gRNAs are likely to pose minimal risk for off -target activity. Read counts in Table 46 were combined from two biological replicates. Nominated sites with < 5 total mismatches plus bulges were listed.Table 46: Summary of unique read counts for sites nominated by GUIDE-seq for HSV- l / HSV-2 shared SaCas9 gRNAs.
[0410] To further characterize the potential off-target activity of the HSV-l / HSV-2 shared SaCas9 gRNAs, Amplicon-seq was performed at the on-target site and a subset of GUIDE-seq and in silico nominated off-target sites. The results were obtained from three independent biological replicates and were represented as the mean + standard deviation. Selected in silico sites with < 4 total mismatches plus bulges were combined with selected GUIDE-seq sites with < 6 total mismatches for further Amplicon-seq analysis (Table 47). All three HSV-l / HSV-2 shared SaCas9 gRNAs demonstrated robust activity at the on-target site (>30%). Compared to the negative control, none of the three gRNAs demonstrated significantly higher activity at the tested off-target sites (FIGs. 49A, 49B, and 49C), demonstrating the specificity of these three HSV-l / HSV-2 shared gRNAs.Table 47: Information on nominated off-target sites assayed by Amplicon-seq.
[0411] These off-target analyses suggested that thatthe HSV- l / HSV-2 shared SaCas9 gRNAs, which co-target the ICPO and ICP4 genes, demonstrate high specificity with minimal off-target activity .Example 13 : In vivo evaluation of the CaMKIIa0.4 promoter and HSV-l / HSV-2 shared gRNAs in the latent rabbit keratitis model.A. Materials and Methods1 . Production of AAV9 vectors.
[0412] All-in-one AAV9 vectors, designed to co-express SaCas9 and paired gRNAs, were produced at SAB Tech Inc. The production utilized triple plasmid transfection in HEK 293 cells. Purified AAV9 vectors were formulated in PB S containing 0.001% Pluronic F-68. The titers of the AAV9 vectors were quantified using QIAcuity digital PCR (Qiagen) with two distinct primer / probe sets: one targeting the CMV promoter sequence and the other targeting the SV40 polyA s equence (Table 13). The average titer values obtained from these two primer / probe sets were used as the final titer for the AAV9 vectors.2. Targeted amplicon deep sequencing for indel analysis.
[0413] The genomic DNA was extracted from the frozen rabbit tissues usi ng a Maxwell RSC 48 Instrument (Promega) and the Maxwell RSC Tissue DNA Kit (Promega) according to the manufacturer’ s instructions. Regions flanking the ICP0M2 gRNA and ICP27M1 gRNA target sites were PCR-amplified using Q5 High-Fidelity 2x Master Mix (New England Biolabs) for 30 cycles of 98° C for 15 sec, 65° C for 30 sec, and 72°C for 30 sec, using the primers listed in Table 48. The PCR product was run on an agarose gel to check for amplification and diluted 1 Ox with water. 0.5 pl of each PCR reaction was amplified with barcoded primers to reconstitute the TruSeq adaptors using the Q5 High Fidelity DNA Polymerase (New England Biolabs) with 10 cycles of 98°C for 15 sec, 65°C for 30 sec, and 72°C for 30 sec. Equal amounts of the barcoded PCR products were pooled and purified with 0.7x SPRIselect bead-based reagent (Beckman Coulter), washed twice with 80% ethanol, and eluted in 30 pl of lx TEbuffer. Sequencing of the pooled amplicons was performed using MiSeq reagent kit v2 (500 cycles; Illumina) following the manufacturer’ s protocol. MiSeq data analysis for Indel frequencies at theon-target sites was performed using the CRISPResso2 software, as described in Example10Table 48: Primer sequences for Indel analysis.3. Excision PCR with nested PCR.
[0414] Nested PCR was performed in two rounds. In the first round, 200 ng of rabbit TG DNA was amplified using PrimeSTAR GXL DNA Polymerase (Takara Bio) under the following conditions: 30 cycles of 98°C for l 5 sec, 56°C for l 5 sec, and 72°C for 3 min and 30 sec. The amplified product was then purified using the QIAquick PCR Purification Kit (Qiagen). For the second round of PCR, 2 pL of the purified DNA was used as the template, along with PrimeSTAR GXL DNA Polymerase (Takara Bio). The cycling conditions for the second round were 30 cycles of 98 °C for 15 sec, 67 °C for 15 sec, and 72 °C for 3 min and 30 sec. The sequences of the primers used in both rounds of PCR are listed in Table 49. A 10 pL aliquot of the PCR products was analyzed by agarose gel electrophoresis.Table 49: Primer sequences for nested PCR.B. Results
[0415] The results indicate that intravenous administration of the AAV9-miniCMV- SaCas9 M2Ml_20nt vector effectively reduced viral shedding and HSV -1 viral load in the latent rabbit keratitis model. In the current example, those findings were built upon by evaluating the AAV9-miniCMV-SaCas9 M2Ml_22nt vector, as it was shown to be equally effective as the M2Ml_20nt vector in in vitro evaluations (FIGs. 25A-25C and33A-33F). Hybrid capture-based off-target analysis confirmed that the M2Ml_22nt pair did not exhibit off-target editing (FIG. 38), demonstrating its high targeting specificity.
[0416] To evaluate promoter efficacy, the miniCMV promoter and the neuron-specific CaMKIIa0.4 promoter (Dittgen, et al. 2004) (SEQ ID NO 261 ) for driving SaCas9 expression in the latent rabbit keratitis model were compared. Additionally, the AAV9- miniCMV-SaCas9 HSV-l / HSV-2 Pair 1 vector in the rabbit model was evaluated, as this shared HSV-l / HSV-2 Pair 1 exhibited high activity and specificity in previous in vitro studies (FIGs. 48 and 49).
[0417] In addition to these AAV9 vectors, the AAV9-miniCMV-SaCas9 M2Ml_20nt vectorused in Example 1 1 was also injected into two rabbits to serve as positive controls. This setup allowed for a direct comparison of efficacy and specificity between the different promoter systems and gRNA pairs.SEQ ID NO 261: CaMKIIa0.4 promoter sequence (364bp).ACTTGTGGACTAAGTTTGTTCGCATCCCCTTCTCCAACCCCCTCAGTACATCA CCCTGGGGGAACAGGGTCCACTTGCTCCTGGGCCCACACAGTCCTGCAGTAT TGTGTATATAAGGCCAGGGCAAAGAGGAGCAGGTTTTAAAGTGAAAGGCAG GCAGGTGTTGGGGAGGCAGTTACCGGGGCAACGGGAACAGGGCGTTTCGGA GGTGGTTGCCATGGGGACCTGGATGCTGACGAAGGCTCGCGAGGCTGTGAG CAGCCACAGTGCCCTGCTCAGAAGCCCCAAGCTCGTCAGTCAAGCCGGTTCT CCGTTTGCACTCAGGAGCACGGGCAGGCGAGTGGCCCCTAGTTCTGGGGGCA GC
[0418] The latent rabbit keratitis model study was conducted as described in Example 1 1 . AAV9 vectors were administered intravenously at a dose of 6E+12 VG / kg to HSV- 1 -infected rabbits. Four weeks after AAV administration, HSV-1 reactivation was induced via transcorneal iontophoresis of epinephrine (TCIE). To assess viral shedding, ocular swabs were collected from both eyes daily, starting on the first day of TCIE and continuing for 1 1 consecutive days. HSV-1 viral shedding was quantified using a plaque assay on the collected swabs. Any cells in Table 50 marked with x indicate a positive result for the plaque assay, which is indicative of infectious virus.
[0419] In the AAV buffer control group, all but one rabbit eye exhibited viral shedding following HSV-1 reactivation via epinephrine (Table 50). None of the four rabbit eyes in the AAV9-miniCMV-SaCas9 M2M_20nt group showed any viral shedding (Table 50). In the AAV9-miniCMV-SaCas9 M2M_22nt group, two out of eight rabbit eyes did not exhibit viral shedding (Table 50). In contrast, nine out of ten rabbiteyes inthe AAV9-CaMKIIaO.4-SaCas9 M2M_22nt group did not show viral shedding (Table 50). Finally, nine out of twelve rabbit eyes in the AAV9-miniCMV-SaCas9 HSV-l / HSV- 2 Pair 1 group did not show viral shedding (Table 50).
[0420] These results demonstrate that both the AAV9 -CaMKIIaO.4-SaCas9 M2M_22nt vector and the AAV9-miniCMV-SaCas9 HSV-l / HSV-2 Pair 1 vector are effective in significantly reducing HSV-1 viral shedding in the latent rabbit keratitis model. This demonstrates their potential as therapeutic candidates for treating HSV-1 latency.Table 50: Summary of plaque assay results for daily ocular swab samples.
[0421] The CRISPR-Cas treatment in this rabbit study reduced the number of HSV-1- positive swabs among the 1 1 swabs collected from each rabbit eye. The percentages of positive swabs per rabbit eye were 37.1% in the AAV buffer group, 0% in the miniCMV- SaCas9 M2Ml_20nt group, 1 1 .4% in the miniCMV-SaCas9 M2Ml_22nt group, 0.9% in the CaMKIIaO.4-SaCas9 M2Ml_22nt group, and 4.6% in the miniCMV-SaCas9 HSV-l / HSV-2 Pair 1 group (FIG. 50). Each dot represented an individual rabbit eye, and the data were represented as the mean + standard deviation (n = 4 - 12).
[0422] To further evaluate the efficacy of the treatment, HSV- 1 viral DNA load in the trigeminal ganglia (TG) was measured using dPCRwith a primer / probe set targeting the UL28 gene of HSV- 1, and the levels of LAT mRNA in the TG were assessed using dPCR with a primer / probe set targeting the LAT gene. The data were shown as the mean + standard deviation (n = 8 or 10), with the numbers above the bars indicating the reduction achieved by each treatment compared to the AAV buffer control. Compared to the AAV buffer control, the miniCMV-SaCas9 M2Ml _22nt group and the CaMKIIaO.4-SaCas9 M2Ml _22nt group showed reductions in HSV- 1 DNA by 4% and 29%, respectively (FIG. 51A). Reductions in LAT mRNA levels were 76% and 65%, respectively (FIG.51 B)
[0423] Indel analysis at the gRNA target sites in the remaining HSV- 1 DNA within the TG was conducted using Amplicon-seq analysis and presented as the mean + standard deviation (n = 8 or 10) . At the ICP0M2 gRNA target site, the mean indel percentages were 1 1. 1% and 14. 1% in the miniCMV-SaCas9 M2Ml_22nt group and the CaMKIIa0.4- SaCas9 M2Ml_22nt group, respectively (FIG. 52A). At the ICP27M1 gRNA target site, the mean indel percentages were 0.5% and 0.2% in the same respective groups (FIG. 52B)
[0424] The excision of the remaining HSV- 1 DNA in the TG between the ICP27M1 and ICP0M2 gRNA target sites was assessed using nested PCR with primers flanking the two target sites and gel electrophoresis, with a DNA ladder is displayed on the left side of the gel image to indicate band size. The full-length HSV- 1 genome was expected to produce a 7308 bp band, while CRISPR / Cas9-mediated excision of the 6689 bp fragment between the two target sites would result in a 619 bp band. Most TG samples from the AAV buffer control group showed the wild -type 7308 bp bands (FIG. 53). In three samples from the control group, PCR products were slightly smaller than 7308 bp. Sequencing these products revealed deletions unrelated to CRISPR / Cas9 activity. In contrast, all but two TG samples from the miniCMV-SaCas9 M2Ml _22nt group and the CaMKHaO.4-SaCas9 M2Ml_22nt group exhibited the 619 bp excision band (FIG. 53). These results demonstrate that the all -in-one AAV9 vectors are capable of inducing ICP27-to-ICP0 excision of HSV- 1 DNA in the latent HSV- 1 reservoir.
[0425] To confirm the neuron-specific expression of the CaMKIIa0.4 promoter, AAV load and SaCas9 expression in the TG and other tissues of rabbits treated with the AAV9 - CaMKHaO.4-SaCas9 M2Ml _22nt vector were evaluated (FIGs. 54A and 54B). AAVloads in the liver, spleen, TG, and cornea were more than 1 log higher than those in the lung, kidney, heart, and brain cortex (FIG. 54A). Among all tissues examined, the TG exhibited the highestlevel of SaCas9 expression, followed by the cornea and liver (FIG. 54B) SaCas9 mRNA levels in other tissues were at least 3 logs lower than in the TG, confirming that the CaMKIIa0.4 promoter demonstrated strong neuron -specific expression.
[0426] The AAV9-miniCMV-SaCas9 M2Ml _20nt vector, AAV9 -CaMKIIa0.4- SaCas9 M2Ml _22nt vector, and the AAV9 -miniCMV-SaCas9 HSV- l / HSV-2 Pair 1 vector all reduced viral shedding in the latent rabbit keratitis model. Additionally, the AAV9-CaMKIIaO.4-SaCas9 M2Ml _22nt vector effectively reduced HSV- 1 DNA and LAT mRNA levels in the TG. Residual HSV- 1 DNA in the TG treated with this vector exhibited indel mutations at the targeted HSV- 1 sites, along with large genomic deletions of the HSV- 1 genome, indicating disruption of the latent HSV- 1 reservoir. Finally, the neuron-specific CaMKHa0.4 promoter demonstrated tissue -specific expression.
[0427] Taken together, the examples set forth above suggest that the AAV vectors described herein are effective in promoting excision of both HIV and HSV viral nucleic acid sequences. These results indicate that the AAV vectors are likely useful for the treatment of various viruses by effectively promoting transcription of the various coding regions of the vector to facilitate excision of the viral nucleic acid sequences.
Claims
CLAIMSWhat is Claimed Is:1 . An AAV vector comprising a nucleic acid molecule comprising: a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease; a first pol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule; and a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein:(i) the first pol III promoter and the second pol III promoter are different pol III promoters;(ii) the first gRNA and the second gRNA are different gRNAs;(iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal to the first target site and generates a first cleaved region; and(iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal to the second target site and generates a second cleaved region; thereby excising or inverting a region of the template nucleic acid molecule between the first cleaved region and the second cleaved region.
2. An AAV vector comprising a nucleic acid molecule comprising: a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease; a first pol III promoter and a sequence encoding a first gRNA comprising a spacer sequence that hybridizes to a first target site on a template nucleic acid molecule; and a second pol III promoter and a sequence encoding a second gRNA comprising a spacer sequence that hybridizes to a second target site on the template nucleic acid molecule, wherein:(i) the first pol III promoter and the second pol III promoter are different;(ii) the first gRNA and the second gRNA are different;(iii) expression of the first gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal to the first target site and generates a first cleaved region comprising a first nucleic acid sequence; and(iv) expression of the second gRNA and the CRISPR-Cas endonuclease cleaves the template nucleic acid molecule within or proximal to the second target site and generates a second cleaved region comprising a second nucleic acid sequence having microhomology to the first nucleic acid sequence.
3. The AAV vector of claim 2, wherein the first cleaved region and the second cleaved region comprising the first and second nucleic acid sequences having microhomology, results in the excision of a region of the template nucleic acid molecule between the first and second nucleic acid sequences having microhomology.
4. An AAV vector comprising a nucleic acid molecule comprising: a pol II and a sequence encoding a CRISPR-Cas endonuclease; a first pol III promoter and a sequence encoding a first gRNA; and a second pol III promoter and a sequence encoding a second gRNA, wherein: the first pol III promoter and the second pol III promoter are different; and the first gRNA and second gRNA are different.
5. An AAV vector comprising a nucleic acid molecule comprising from 5’ to 3’ : a first pol III promoter and a sequence encoding a first gRNA; a second pol III promoter and a sequence encoding a second gRNA; and a pol II and a sequence encoding CRISPR-Cas endonuclease, wherein the first gRNA and second gRNA are different.
6. The AAV vector of claim 2, wherein the first pol III promoter and the second pol III promoter are different.
7. The AAV vector of any one of claims 1 -6, wherein: the first pol III promoter is operably linked to the sequence encoding the first gRNA; and the second pol III promoter is operably linked to the sequence encoding the second gRNA.
8. The AAV vector of any one of claims 1 -7, wherein nucleic acid molecule comprises a pol II promoter operably linked to the sequence encoding CRISPR-Cas endonuclease.
9. The AAV vector of claim 6, wherein the pol III promoter comprises 300 base pairs or less.
10. The AAV vector of any one of claims claim 1-9, wherein the pol II promoter is selected from Table 1 .
11. The AAV vector of claim 10, wherein the pol II promoter comprises a mini CMV promoter.
12. The AAV vector of any one of claims 1 -11, wherein the first pol III promoter and second pol III promoter are selected from Table 2.
13. The AAV vector of any one of claims 1-12, wherein: the first pol III promoter is a U6 promoter or 7SK promoter; and the second pol III promoter is a U6 promoter or 7SK promoter.
14. The AAV vector of any one of claims 1 -13, wherein the nucleic acid molecule further comprises a polyA sequence operably linked to the sequence encoding CRISPR-Cas endonuclease, wherein the polyA sequence is 150 base pairs or less.
15. The AAV vector of any one of claims 1 -14, wherein: the first gRNA comprises a first spacer sequence and a first scaffold sequence; the second gRNA comprises a second spacer sequence and a second scaffold sequence.
16. The AAV vector of claim 15, wherein: the first spacer sequence and the second spacer sequence are different; and the first scaffold sequence and the second scaffold sequence are the same sequence.
17. The AAV vector of claim 15, wherein: the first spacer sequence and the second spacer sequence are different; and the first scaffold sequence and the second scaffold sequence are different.
18. The AAV vector of any one of claim 1 -17, wherein the CRISPR-Cas endonuclease is a Type 2 CRISPR-Cas endonuclease.
19. The AAV vector of any one of claim 1 -18, wherein the CRISPR-Cas endonuclease is a Type 2-II CRISPR-Cas endonuclease or Type 2-V CRISPR-Cas endonuclease.
20. The AAV vector of any one of claim 1-19, wherein the CRISPR-Cas endonuclease is a Cas9 or CasX.
21. The AAV vector of any one of claims 1 -16, wherein: the first gRNA hybridizes to a first target nucleic acid sequence within the LTR of an HIV nucleic acid molecule; and the second gRNA hybridizes to a second target nucleic acid sequence within the gag gene of the HIV nucleic acid molecule.
22. The AAV vector of any one of claims 1 -16, wherein:the first gRNA hybridizes to a sequence within a first immediate early (alpha) gene region of an HSV nucleic acid molecule; and the second gRNA hybridizes to a sequence within a second immediate early (alpha) gene region of the HSV nucleic acid molecule.
23. The AAV vector of claim 22, wherein the first immediate early (alpha) gene is selected from Table 16 and the second immediate early (alpha) gene is selected from Table 16.
24. The AAV vector of claim 23, wherein the first immediate early (alpha) gene is ICPO, and the second immediate early (alpha) gene is ICP27.
25. A plasmid comprising the nucleic acid molecule of any one of claims 1 -24 and a stuffer sequence, wherein the plasmid has at least 5,000 or greater base pairs.
26. The plasmid of claim 25, wherein the stuffer sequence has at least 2,500 base pairs.
27. The plasmid of any one of claims 25-26, wherein the stuffer sequence has 30% or greater sequence identity to SEQ ID NO: 4728. A method of excising or inverting a target nucleic acid molecule from a template nucleic acid molecule in a cell, the method comprising:(a) contacting the cell with the AAV vector of any one of claims 1 -20;(b) cutting the template nucleic acid molecule at a first cleavage site;(c) cuttingthe template nucleic acid molecule ata second cleavage site, thereby excising or inverting a region of the template nucleic acid molecule.
29. The method of claim 28, wherein the first cleavage site and the second cleavage site are separated at least 500, at least 750, atleast 1,000, atleast2,000, atleast 5,000, or atleast 8,000 base pairs.
30. The method of any one of claims 28-29, wherein the excised region is atleast 500, atleast 750, at least 1,000, at least 2,000, at least 5,000, or at least 8,000 base pairs.31 . The method of any one of claims 28-30, wherein the first cleavage site and the second cleavage site are within different genes or within two different regions of two different genes.
32. The method of any one of claims 28-31, wherein the first cleavage site and the second cleavage site are within the coding region of two different genes.
33. The method of any one of claims 28-32, wherein the sequence surrounding or within the first cleavage site and the sequence surrounding or within the second cut comprise microhomology.
34. The method of any one of claims 28-33, wherein (b) and (c) activates microhomology- mediated end joining (MMEJ) and the template nucleic acid molecule is rejoined by MMEJ, thereby excising the target nucleic acid molecule.
35. The method of any one of claims 28-34, wherein the template nucleic acid molecule is a viral nucleic acid molecule.
36. The method of claim 35, wherein the viral nucleic acid molecule is an episomal nucleic acid or integrated nucleic acid molecule.
37. The method of claim 35, wherein the viral nucleic acid molecule is a HIV nucleic acid molecule.
38. The method of claim 35 , wherein the viral nucleic acid molecule is an HS V nucleic acid molecule.
39. A method of inactivating a virus in a cell, the method comprising:(a) contacting the cell with the AAV vector of any one of claims 1 -20;(b) cutting a viral nucleic acid molecule at a first cleavage site;(c) cutting the viral nucleic acid molecule at a second cleavage site, thereby excising or invertingthe region between the first cleavage site and second cleavage site from the template nucleic acid molecule.
40. An AAV vector comprising a nucleic acid molecule comprising from 5’ to 3 ’ :(i) a first ITR;(ii) a pol II promoter, a sequence encoding a CRISPR-Cas endonuclease, and a poly A tail sequence, wherein the pol III promoter is 300 base pairs or less and the polyA tail sequence is 150 base pairs or less;(iii) a first pol III promoter and a sequence encoding a first gRNA;(iv) a second pol III promoter and a sequence encoding a second gRNA, wherein the first pol III promoter and the second pol III promoter are different and the first gRNA and second gRNA are different; and(v) a second ITR.
41. An AAV vector comprising a nucleic acid molecule comprising from 5’ to 3’ :(i) a first ITR;(ii) a first pol III promoter and a sequence encoding a first gRNA;(iii) a second pol III promoter and a sequence encoding a second gRNA, wherein the first pol III promoter and the second pol III promoter are different and the spacer sequences of the first gRNA and the second gRNA are different;(iv) a pol II promoter, a sequence encoding a CRISPR-Cas endonuclease, and a polyA tail sequence, wherein the pol III promoter is 300 base pairs or less and the polyA tail sequence is 150 base pairs or less; and(v) a second ITR.
42. The AAV vector of any one of claims 40-41, wherein:the first pol III promoter is a U6 promoter or 7SK promoter; the second pol III promoter is a U6 promoter or 7SK promoter; the pol II promoter is a mini-CMV promoter; and the polyA sequence is SV40 polyA sequence.
43. An AAV vector comprising a nucleic acid molecule comprising: a pol II promoter and a sequence encoding a CRISPR-Cas endonuclease; a first pol III promoter and a sequence encoding a first gRNA; and a second pol III promoter and a sequence encoding a second gRNA, the CRISPR-Cas endonuclease, a first gRNA, and a second gRNA having means for excising or inverting a region of a template nucleic acid when expressed in a cell, and wherein: the first pol III promoter and the second pol III promoter are different; and the first gRNA and second gRNA are different.
Citation Information
Patent Citations
Compositions for the inactivation of virus replication and methods of making and using the same
WO2015126927A2
Compositions and methods for treatment of duchenne muscular dystrophy
WO2022056000A1
RNA guided eradication of herpes simplex type i and other related human herpesviruses
WO2022071974A1