New hericium erinaceus he015 strain of hericium erinaceus, and molecular marker and use thereof

Abstract

Provided are a new Hericium erinaceus HE015 strain of Hericium erinaceus, and a molecular marker and the use thereof. By means of extensive wild strain collection and systematic breeding, a high-quality new Hericium erinaceus HE015 strain of Hericium erinaceus is obtained. The strain is deposited in the Guangdong Microbial Culture Collection Center on 12 May 2022, with the deposit number of GDMCC No: 62464. The new Hericium erinaceus HE015 strain has a different genetic background from existing Hericium erinaceus strains, and therefore a high-quality Hericium erinaceus cultivar is supplemented, meeting market demands. Further provided are a specific molecular marker and a rapid detection method for detecting and identifying Hericium erinaceus HE015. The mother culture of Hericium erinaceus HE015 has dense and strong mycelium, fast mycelial growth rate, and strong resistance to contamination by foreign bacteria. The strain has advantages such as high yield and a short growth cycle, and also has a relatively high content of active ingredients such as polysaccharides. Extracts of the strain can protect gastric mucosa and ameliorate alcoholic gastric mucosal damage, with the fruiting body extract thereof showing especially significant effects. Therefore, the strain has industrialization prospects.

Description

A new strain of Hericium erinaceus HE015 and its molecular marker and application Technical Field

[0001] The present invention belongs to the technical field of microbial edible fungi, and specifically relates to a new strain of Hericium erinaceus, Monkey HE015, its molecular marker, and Monkey HE015 extract and its application. Background Art

[0002] Hericium erinaceus (Bull.ex Fr.) Pers., also known as Hericium erinaceus, Hericium erinaceus, and Hedgehog Mushroom, belongs to the kingdom Fungi, phylum Basidiomycetes, class Basidiomycetes, order Russulales, family Hericium, and genus Hericium. Hericium erinaceus is a valuable edible mushroom with both edible and medicinal value, with a long history of consumption. Known as "mountain delicacy Hericium erinaceus and seafood bird's nest," it contains a variety of nutrients. Traditional medicine believes that Hericium erinaceus is mild in nature, sweet in taste, and aids digestion and benefits the five internal organs. It has stomach-tonifying, tonifying, anti-cancer, and kidney-strengthening properties, making it an effective remedy for digestive system disorders and stomachaches. Experimental studies have shown that Hericium erinaceus polysaccharides have the potential to enhance immunity, inhibit digestive system tumors, combat gastric ulcers, and lower blood sugar. It has become an important raw material for the development of functional foods, health products, and pharmaceuticals.

[0003] Germplasm resources are the foundation of industrial development. However, compared with major edible mushroom species such as Lentinus edodes and Pleurotus ostreatus, the current reserves of Hericium erinaceus germplasm resources are relatively small and there are few cultivated varieties. Most new varieties are bred through methods such as mutagenesis breeding and hybrid breeding, with similar genetic backgrounds. The new strains are similar to the starting strains or parents in most traits. Moreover, Hericium erinaceus was mainly sold in the form of fresh and dried products in the early days, and the target traits of breeding were mostly good mushroom shape and high yield. Since there is always a contradictory relationship between yield and quality, existing varieties have the problem of high yield but low quality or high quality but low yield. In addition, in large-scale production, the degradation of strain vitality and the problem of contamination by foreign bacteria are also thorny problems that plague the Hericium erinaceus cultivation industry, which will bring great economic losses to farmers and enterprises.

[0004] In recent years, with the development of the deep processing industry of Hericium erinaceus, the demand for high-quality Hericium erinaceus has continued to grow. It is urgently necessary to select and breed high-quality new germplasm with high yield, short production cycle, strong resistance to bacterial contamination, and high content of active ingredients to meet the needs of the deep processing industry of Hericium erinaceus and improve the production efficiency of enterprises.

[0005] Summary of the Invention

[0006] The present invention aims to provide a new strain of high-quality Hericium erinaceus. After extensive research, the inventors' team isolated and purified a high-quality strain of Hericium erinaceus from wild Hericium erinaceus samples in Arxan, Inner Mongolia. This Hericium erinaceus strain has a significantly different genetic background from existing varieties. It boasts dense and robust mycelium from its parent strain, rapid spawning, a short first-batch harvest time, and strong resistance to bacterial contamination. It also boasts high yield, a short growth cycle, and a high content of active ingredients. Its extract is also highly effective in improving alcohol-induced gastric mucosal damage.

[0007] The present invention aims to provide a new strain of Hericium erinaceus HE015 and its bacterial agent product.

[0008] Another object of the present invention is to provide specific molecular markers and identification applications of the monkey HE015.

[0009] Another object of the present invention is to provide the extract of monkey HE015 and its application.

[0010] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0011] The present invention widely collects wild mushrooms in 26 provinces (autonomous regions) and more than 100 nature reserves (forest parks) across the country, and collects wild Hericium erinaceus strains in Inner Mongolia, Hunan, Guizhou, Henan, Heilongjiang, Shandong and other provinces (autonomous regions). Through systematic breeding, a new Hericium erinaceus strain Monkey HE015 is obtained, which has high yield and its fruiting body polysaccharide has a significant protective effect on chronic gastric mucosal damage caused by alcohol. This strain has high yield and short growth cycle. The extract can increase the body weight of mice with chronic gastric mucosal damage caused by alcohol, reduce the effect of chronic gastric mucosal damage caused by alcohol on the body weight of mice, and improve the gastric mucosa of mice with chronic gastric mucosal damage caused by alcohol.

[0012] Therefore, the present invention provides the following application scheme:

[0013] A new strain of Hericium erinaceus, Monkey HE015, was deposited in the Guangdong Provincial Microbiological Culture Collection on May 12, 2022, with the deposit number GDMCC No: 62464.

[0014] A Hericium erinaceus fungus agent containing the above-mentioned new strain Hericium erinaceus HE015.

[0015] Furthermore, the Hericium erinaceus inoculum may contain mother culture medium in addition to Hericium HE015.

[0016] The mother culture medium can be PDA culture medium, which is composed of 200 g / L potato, 20 g / L glucose, 20 g / L agar, and the balance water.

[0017] A molecular marker for detecting or identifying the monkey HE015, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0018] A molecular marker combination for detecting or identifying the monkey HE015, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0019] The above molecular markers or molecular marker combinations can be used as targets to detect and identify monkey HE015, which is of great significance for the quality control of monkey HE015 after industrialization.

[0020] In addition, the use of reagents for detecting the above-mentioned molecular markers or molecular marker combinations in the preparation of monkey HE015 detection or identification kits, as well as kit products containing the reagents for detecting the above-mentioned molecular markers or molecular marker combinations, should also be within the scope of protection of the present invention.

[0021] The reagents for detecting the above-mentioned molecular markers or molecular marker combinations, such as molecular detection primers.

[0022] Specifically, as one of the optional preferred solutions, the primers for detecting or identifying monkey HE015, such as the primer pair HE015-F8 / R8,

[0023] As one of the optional preferred solutions, primers for detecting or identifying monkey HE015 are a combination of primer pair HE015-F2 / R2 and primer pair HE015-F4 / R4;

[0024] The nucleotide sequence of the primer pair HE015-F8 / R8 is shown in SEQ ID NO.8-9.

[0025] The nucleotide sequence of the primer pair HE015-F2 / R2 is shown in SEQ ID NO.4-5.

[0026] The nucleotide sequence of the primer pair HE015-F4 / R4 is shown in SEQ ID NO.6-7.

[0027] Based on this, the present invention also provides a method for detecting or identifying monkey HE015, which uses the DNA of the sample to be tested as a template and uses a kit containing the above-mentioned molecular marker detection reagent for detection.

[0028] As an optional preferred embodiment, the detection and identification method is a molecular identification technique, specifically using the DNA of the sample to be tested as a template and using the above primers to perform PCR amplification. A positive amplification result identifies the monkey HE015.

[0029] Specifically, if the amplification result of primer pair HE015-F8 / R8 is positive, it is identified as monkey HE015;

[0030] Or if the amplification results of primer pair HE015-F2 / R2 and primer pair HE015-F4 / R4 are both positive, it is identified as monkey HE015.

[0031] Further optionally, the reaction system for PCR amplification is: 15 μL of 2×Taq Master Mix, 2 μL of DNA template (50 ng / μL), 1 μL of forward primer (10 μmol / L), 1 μL of reverse primer (10 μmol / L), and 11 μL of ddH2O.

[0032] The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C, denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 15 seconds, GOTO step 2, 32 cycles, and extension at 72°C for 10 minutes.

[0033] Our research data shows that monkey HE015 not only has a high yield and a short growth cycle, but its extract can also increase the weight of mice with chronic gastric mucosal damage caused by alcohol, reduce the impact of chronic gastric mucosal damage on the weight of mice, and improve the gastric mucosa of mice with chronic gastric mucosal damage caused by alcohol, with the effect of the fruiting body extract being more significant.

[0034] Therefore, the present invention also provides Hericium erinaceus HE015 polysaccharide extract, which is a precipitate obtained by water extraction and alcohol precipitation of the fruiting body of Hericium erinaceus HE015.

[0035] The present invention also provides a Hericium erinaceus HE015 small molecule extract, which is a supernatant obtained by water extraction and alcohol precipitation of the fruiting body of Hericium erinaceus HE015.

[0036] Specifically, as an optional solution, the extraction method of the extract is as follows:

[0037] (1) After the fruiting body of monkey HE015 is crushed, 10-30 times the amount of water is added and the mixture is stirred and extracted at 90-99°C for 1-3 hours; filtered, the filtrate is concentrated under reduced pressure to a relative density of 1-1.5, and then ethanol is added to make the alcohol concentration reach 70-90%, and the mixture is allowed to stand at 2-10°C for 12-48 hours;

[0038] (2) The lower precipitate after standing in step (1) was redissolved with 5 times water, and ethanol was added to adjust the alcohol concentration to 70-90%, and the mixture was allowed to stand at 2-10°C for 12-48 hours; the lower precipitate was washed with 70-90% ethanol and acetone, freeze-dried, and crushed to obtain the monkey HE015 fruiting body polysaccharide extract;

[0039] (3) The supernatant after standing in step (1) was concentrated under reduced pressure, freeze-dried, and crushed to obtain the small molecule extract of monkey HE015 fruiting body.

[0040] Among them, the more specific optional operating conditions are as follows: after the monkey HE015 fruiting body is crushed, 20 times the amount of pure water is added, and the mixture is stirred and extracted at 95°C for 2 hours; filtered, the filtrate is concentrated under reduced pressure to a relative density of 1.10, 95% ethanol is added to make the alcohol concentration reach 80%, and the mixture is allowed to stand at 4°C for 24 hours.

[0041] More specifically, the optional operating conditions are as follows: the lower precipitate is redissolved with 5 times pure water, 95% ethanol is added to adjust the alcohol concentration to 80%, and the mixture is allowed to stand at 4°C for 24 hours; the lower precipitate is washed with 80% ethanol and acetone, freeze-dried, and crushed to obtain the monkey HE015 fruiting body polysaccharide extract.

[0042] Finally, the use of monkey HE015, the bacterial agent containing monkey HE015, and the extract of monkey HE015 (especially the fruiting body extract) in the preparation of products that have the effect of protecting gastric mucosa or treating or improving alcoholic gastric mucosal damage should also be within the scope of protection of the present invention.

[0043] Products containing the Hericium erinaceus polysaccharide extract and / or the Hericium erinaceus small molecule extract for protecting gastric mucosa or improving alcoholic gastric mucosal damage should also be within the scope of protection of the present invention.

[0044] As one of the industrial applications, specifically, the fruiting body extract cultivated from the monkey HE015 strain can be used in functional foods. For example, it can be compounded with raw materials such as galangal, tangerine peel, fig, daidai hua, oligofructose or oligoxylose to prepare products with the function of protecting gastric mucosa and improving intestinal flora. The dosage form can be solid beverages, liquid strips, etc.

[0045] In actual industry, the cultivation of the high-quality new strain of Hericium erinaceus HE015 of the present invention can adopt the existing Hericium erinaceus cultivation technology.

[0046] The present invention has the following beneficial effects:

[0047] The present invention widely collects wild mushrooms from across the country, and obtains a high-quality new strain of Hericium erinaceus with high yield and short growth cycle through systematic breeding and screening. The strain, Monkey HE015, has a genetic background that is significantly different from existing Hericium erinaceus strains. It has important value and significance for supplementing high-quality Hericium erinaceus cultivars to meet market demand and enhance enterprise development space.

[0048] Our research data shows that the mother strain of Monkey HE015 boasts dense and robust mycelium, rapid spawning, a short first-batch harvest time, and strong resistance to bacterial contamination. It boasts high yields and a short growth cycle, and is also high in active ingredients such as polysaccharides. Its extracts can increase the body weight of mice with chronic gastric mucosal damage caused by alcohol, reduce the effects of chronic gastric mucosal damage on mice, and improve the gastric mucosa of mice with chronic gastric mucosal damage. The effects are particularly pronounced in extracts from the fruiting bodies, suggesting broad prospects for industrialization.

[0049] At the same time, the present invention provides specific molecular markers and detection products for monkey HE015, providing a technical basis for the identification of monkey HE015 and quality control of related industries. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 shows a photo of the Hericium erinaceus specimen (top) and growth environment (bottom) from the new strain Monkey HE015.

[0051] Figure 2 shows the fruiting body phenotype of monkey HE015 after domestication.

[0052] FIG3 shows the amplification results of the HE015-F8 / R8 primer pair in monkey HE015 and market species.

[0053] Figure 4 shows the results of primer-specific amplification; A: polymorphism analysis of HE015-F4 / R4 primers; B: polymorphism analysis of HE015-F2 / R2 primers.

[0054] Figure 5 shows the effects of monkey HE015 extract on the body weight (A) and survival curve (B) of mice with chronic alcoholic gastric mucosal injury; Control: normal group; Model: model group; Positive: positive drug group; HEF: monkey HE015 liquid fermentation culture group; HEFP: monkey HE015 fruiting body polysaccharide extract group; HEFX: monkey HE015 fruiting body small molecule extract group; HESP: monkey HE015 solid culture mycelium polysaccharide extract group; HESX: monkey HE015 solid culture mycelium small molecule extract group.

[0055] FIG6 shows the effect of monkey HE015 extract on the pathology of chronic alcoholic gastric mucosal injury. DETAILED DESCRIPTION

[0056] The present invention will be further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this area. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0057] The enriched comprehensive PDA medium used in the examples comprises, by mass, 20% potatoes, 2% glucose, 1% peptone, 2% agar, 0.3% potassium dihydrogen phosphate, 0.15% magnesium sulfate, and 0.001% vitamin B1, with the remainder being water. The preparation method is as follows: wash and peel the potatoes, weigh 200 g of potatoes, cut them into small pieces, add water and boil until soft (boil for 20-30 minutes, until pierced by a glass rod), filter through eight layers of gauze, add 20 g of glucose, 10 g of peptone, 20 g of agar, 3 g potassium dihydrogen phosphate, 1.5 g of magnesium sulfate, and 0.01 g of vitamin B1 to the filtrate, stir evenly, cool slightly, add water to 1000 ml, and sterilize under high temperature and high pressure at 0.11 MPa and 121°C for 30 min.

[0058] The mother culture medium (PDA culture medium) used in the embodiment: potato 200g / L, glucose 20g / L, agar 20g / L, surplus is water.Its compound method is: peel potato and weigh 200g, cut into small pieces and put into pot, add water 1000mL, heat and boil on electromagnetic oven, keep 20-30min, filter with 2 layers of gauze, discard, filtrate is added to 1000mL, add glucose 20g, agar 20g in the filtrate, low fire heats, and constantly stirs with glass rod to prevent that agar from sticking to the bottom or overflowing, after agar dissolves fully, rehydrate to required. Subpackaging sterilization: solid culture medium is about 1 / 5 of test tube height, can use triangular funnel during subpackaging to avoid making culture medium be stained on the mouth of pipe or bottle mouth and cause pollution. Add stopper after subpackaging, bandage 7 test tubes, 121 ℃ of sterilization 20min, when treating that the temperature is reduced to about 80 ℃, take out and swing the test tube inclined surface.

[0059] Stock culture medium: by weight, sorghum 98%, calcium carbonate 2%. Preparation method: Boil sorghum with water until it reaches the standard of "no white core and no flowers", then drain the water, add calcium carbonate, mix well, and autoclave at 126℃ for 90 minutes.

[0060] Cultivation material: by weight, cottonseed hulls 58%, broadleaf sawdust 30%, wheat bran 10%, gypsum 2%. Moisture content is approximately 65%.

[0061] The information and sources of other Hericium erinaceus market species and wild species used in the examples are shown in Table 1:

[0062] Table 1 Strain information

[0063] Example 1 Isolation and identification of a new strain of Hericium erinaceus HE015

[0064] 1. Sample: In August 2017, our research team collected and investigated macrofungal resources in Arxan, Inner Mongolia, and obtained a sample of Hericium erinaceus (Figure 1). The Hericium erinaceus grew in clusters on sunny dead wood.

[0065] 2. Isolation process: A pure strain was isolated and purified from the fruiting body of the Hericium erinaceus sample obtained above through tissue separation, and was recorded as Monkey HE015.

[0066] The specific method is to wipe the surface of Hericium erinaceus fruiting bodies collected from the wild with 75% alcohol, tear open the inner flesh of the mushroom under a sterile environment, and pinch off a 0.2-0.5 mm x 0.2-0.5 mm piece of flesh. This is then inoculated into PDA culture medium. Incubate in a 25°C incubator in the dark. Once the mycelium has fully grown on the slope, remove the tip of the mycelium and transfer it to a purified culture to obtain a pure strain.

[0067] 3. Identification of Monkey HE015

[0068] (1) Morphological identification: Observe the macroscopic morphology and microscopic characteristics of the monkey HE015 mushroom:

[0069] The fruiting body is sessile or has very short lateral stalks. It is fleshy when fresh, soft and leathery later, odorless and tasteless, and becomes cheesy or corky after drying, with a slightly rancid smell.

[0070] The cap is nearly spherical; the surface is snow-white to milky white, light milky yellow in the later stage, and turns into wood color after drying. It has slight hairs and becomes rough after drying without concentric rings.

[0071] The surface of the denticles is snow-white or cream-colored when fresh, turns yellow-brown after drying, and shrinks strongly; it is cylindrical, gradually tapering from the base to the top, fleshy when fresh, and hard and fibrous after drying, up to 10 mm long, with 1 to 2 per millimeter.

[0072] After drying, the flesh of the mushroom is wood color, cheese or corky, with holes and no ring area.

[0073] The stipe is white to milky white and becomes corky when dry.

[0074] Basidiospores are 5.8-7×4.8-5.9 μm, oval, colorless, thick-walled, with small tubercles on the surface, starchy, and bluish.

[0075] (2) Molecular identification: The purified mycelium of monkey HE015 was transferred to a plate culture medium (enriched PDA medium) covered with a thin film of serofen and cultured at 25°C in the dark. After the mycelium had grown all over the plate, fresh mycelium was collected and ground at room temperature. The DNA genome was extracted using a fully automatic nucleic acid extractor equipped with a magnetic bead-based genomic DNA extraction kit (Guangzhou Maibao Biotechnology Co., Ltd., product number DNF628-05B). The obtained DNA solution (DNA template) was refrigerated at -20°C for later use.

[0076] ITS-PCR detection was performed using the DNA template obtained above with universal primers ITS1 / ITS4 for the fungal ribosomal intergenic region (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGAT ATGC, synthesized by Sangon Biotech (Shanghai) Co., Ltd.).

[0077] The composition of the PCR reaction system (30 μl in total) is shown in Table 2. The PCR amplification program is shown in Table 3.

[0078] PCR-related reagents were purchased from Nanjing Novozymes Biotechnology Co., Ltd.

[0079] Table 2 Fungal ITS PCR system

[0080] Table 3 Fungal ITS PCR amplification procedures

[0081] The PCR product was directly sent to BGI for bidirectional sequencing, and the sequencing result is shown in SEQ ID NO.10.

[0082] ITS sequence of monkey HE015 (SEQ ID NO.10):

[0083] The sequencing results were compared with the NCBI GenBank, and it was found that the similarity with Hericium erinaceus was as high as 100%.

[0084] Based on the above macroscopic and microscopic characteristics and the results of ITS sequence identification, Monkey HE015 was determined to be Hericium erinaceus and was deposited in the Guangdong Provincial Microbiological Culture Collection on May 12, 2022, with the deposit number GDMCC No: 62464. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0085] Example 2 Cultivation and quality comparison of monkey HE015

[0086] In this study, the cultivation and comparison of Hericium erinaceus strains from two common market species (I044, MC-HE-1) and four wild species (Monkey HE015, M178, W461, and E108) were conducted.

[0087] 1. Experimental methods:

[0088] 1. Culture medium configuration

[0089] (1) Mother culture medium (PDA medium): Peel the potato and weigh 200g, cut into small pieces and put into a pot, add 1000mL of water, heat on an induction cooker and boil for 20-30min, filter with 2 layers of gauze, discard the residue, and add the filtrate to 1000mL. Add 20g of glucose and 20g of agar to the filtrate, heat on low heat, and stir continuously with a glass rod to prevent the agar from sticking to the bottom or overflowing. After the agar is completely dissolved, add water to the required amount. Packaging and sterilization: The solid culture medium is about 1 / 5 of the height of the test tube. When packaging, use a triangular funnel to prevent the culture medium from sticking to the tube or bottle mouth and causing contamination. After packaging, add a stopper, wrap 7 test tubes together, and sterilize at 121℃ for 20min. When the temperature drops to about 80℃, remove the test tube and place it on the inclined surface.

[0090] (2) Seed culture medium: weight ratio, sorghum 98%, calcium carbonate 2%. On the afternoon before seed production, weigh the ingredients of the formula, rinse the sorghum with clean water 2-3 times, and soak it in clean water overnight. After soaking, rinse the sorghum with clean water, remove the sorghum, add water and boil, while stirring continuously to prevent the sorghum from sticking to the bottom. When the sorghum is cooked to the standard of "no white heart and no flowers", stop heating, pour the sorghum into a sieve, rinse with clean water to remove sticky substances, spread the sorghum, dry the surface moisture, add calcium carbonate, stir it manually, and bag it. Autoclave at 126℃ for 90 minutes, cool naturally, and place the culture medium in the inoculation room for inoculation.

[0091] (3) Cultivation material: by weight, cottonseed hulls 58%, broadleaf sawdust 30%, wheat bran 10%, gypsum 2%. Weigh the raw materials according to the formula, add water at a material-to-water ratio of 1:(1.4-1.5), let it sit for 2 hours to fully absorb water, and finally adjust the moisture content to about 65%.

[0092] 2. Plate inoculation method (determination of mycelial growth rate):

[0093] Pour approximately 15 mL of autoclaved PDA medium onto a sterile plate. Once the medium solidifies and cools to room temperature, inoculate a 2 mm x 2 mm stock culture block in the center of the plate and incubate at 25°C. Set up six replicates for each culture and incubate for 7-8 days. Observe and record mycelial growth, color, and growth rate daily.

[0094] 3. Cultivation bag method:

[0095] Use 15 x 56 x 0.05 cm polypropylene plastic bags, packing 2 kg of culture medium per bag. Compress the material appropriately and securely tie the bag. Autoclave at 126°C for 90 minutes, allow to cool naturally, remove the autoclave lid, and place in the inoculation room. After inoculation, place the stock culture block in a dark incubator at 25°C. Observe mycelial growth weekly, recording mycelial growth, color, growth rate, and presence of contaminants. Prepare 20 bags for each variety.

[0096] 4. Fruiting Body Yield Comparison: Once the mycelium has fully grown into the bags and primordia have appeared, the mushrooms can be moved into the fruiting room and placed on racks standing on the ground. The temperature should be maintained between 16°C and 20°C, never dropping below 12°C or rising above 23°C, and the humidity should be around 90%. Ground watering or air misting can be used, but avoid spraying water directly on the fruiting bodies. During the fruiting body growth stage, ensure diffuse light (200-400 lx is ideal) and good ventilation. After fruiting, record the morphology, average yield, and other indicators of each variety in detail.

[0097] 5. Analysis of active ingredients in fruiting bodies

[0098] The harvested fruiting bodies of various varieties of Hericium erinaceus were dried and crushed, and the polysaccharide content in Hericium erinaceus was determined according to the Ministry of Agriculture standard "NY / T1676-2008 Determination of crude polysaccharide content in edible fungi".

[0099] 2. Experimental results:

[0100] 1. Mycelial growth

[0101] The experimental results (Table 4) show that the average mycelial growth rate of the mother strain of monkey HE015 is the fastest, and its growth is comparable to that of the market strain MC-HE-1. M178 has the sparsest growth and the slowest growth rate.

[0102] As shown in Table 5, the six Hericium erinaceus varieties can grow full mycelium after 21-30 days of inoculation and cultivation. There is no significant difference in the growth speed and mycelial color. Among them, Monkey HE015 has the fastest growth speed, growing full mycelium in only 21 days. The mycelium growth of each variety is good, among which Monkey HE015 and MC-HE-1 are relatively better. Except for W461 and MC-HE-1, which have mycelial bag contamination with foreign bacteria, the other varieties are not contaminated by foreign bacteria.

[0103] Table 4 Mycelial growth and growth rate of mother culture of each Hericium erinaceus variety

[0104] Note: The mycelial growth is evaluated by the whiteness and density of the mycelium. +, ++, +++, and ++++ indicate that the mycelial growth is gradually increasing.

[0105] Table 5 Mycelial growth and growth rate of each Hericium erinaceus variety during cultivation stage

[0106] Note: The mycelial growth is evaluated by the whiteness and density of the mycelium. +, ++, +++, and ++++ indicate that the mycelial growth is gradually increasing.

[0107] 2. Fruiting body growth

[0108] Table 6 shows that there are significant differences in the appearance, biological characteristics, and yield of the fruiting bodies of the different strains. The first harvest of the six Hericium erinaceus varieties ranged from 14 to 18 days, with horizontal diameters ranging from 7.8 to 10.6 cm and vertical diameters between 6.5 and 8.2 cm. The average yield per bag ranged from 0.525 to 0.706 kg.

[0109] Among them, the first-batch mushroom had the shortest harvesting time, the largest single mushroom body (horizontal and vertical diameters), and the highest average yield, which was nearly 10% (8.6%) higher than that of MC-HE-1.

[0110] The first batch of M178 mushrooms took the longest time to harvest, the individual mushroom bodies (horizontal diameter, outer diameter) were at a relatively low level, and the average yield was the lowest.

[0111] Table 6 Biological characteristics and yield of different varieties of Hericium erinaceus

[0112] 3. Analysis of active ingredients in fruiting bodies

[0113] As shown in Table 7, the polysaccharide contents in the fruiting bodies of the six Hericium erinaceus varieties are as follows from high to low: M178>MC-HE-1>W461>Monkey HE015>E108>I044.

[0114] Table 7 Determination results of polysaccharide content in fruiting bodies of various varieties of Hericium erinaceus

[0115] In summary, the experiments employed a plate inoculation method to initially assess the quality of different production strains by measuring the mycelial growth rate and vigor of the candidate strains. Subsequently, a bag culture method was used to prepare fungus bags and inoculate the strains. The quality and production performance of the candidate strains were further evaluated by observing the spawning rate, mycelial growth, fruiting body yield, and the determination of the main active ingredients in the fruiting bodies. The optimal Hericium erinaceus production strain (thick and robust mycelium, rapid spawning, high yield, and high content of the target active ingredient in the fruiting bodies) was selected. The results showed that the average mycelial growth rate of the six collected strains was 6.3-7.2 mm / d, the time it took for the mycelium bags to fully grow was 21-30 days, the first batch of mushrooms was harvested in 14-18 days, the average yield was 0.525-0.706 kg, and the polysaccharide content of the fruiting bodies ranged from 4.85% to 5.68%. Significant differences existed between the different strains in terms of quality and production performance. During the strain selection process, based on currently collected data, we focused on strains with dense and robust mycelium, rapid growth, strong resistance to bacterial contamination, high fruiting body yields, and high polysaccharide content. Comprehensive analysis showed that the strain Monkey HE015 has advantages such as dense and robust mycelium, rapid growth of the original strain, strong resistance to bacterial contamination, a short first-crop harvest time, and high fruiting body yields. Although its polysaccharide content is slightly lower than that of other strains, Monkey HE015 is the optimal production strain overall.

[0116] The fruiting body phenotype of monkey HE015 is shown in Figure 2 .

[0117] Example 3 Monkey HE015 genome sequencing and specific molecular marker development

[0118] The present invention utilizes a third-generation (Nanopore) + second-generation sequencing strategy to obtain the genome sequence information of monkey HE015. The genome size is 39.45Mb, the N50 is 2.79Mb, of which 17.23% of the sequence is repetitive, and 11,756 functional genes, 367 tRNAs, and 25 rRNAs are annotated. In addition, whole-genome resequencing technology is used to obtain genome sequence information of a wide range of commercially cultivated strains and wild species collected in the wild. The obtained data is aligned to the monkey HE015 genome to obtain a set of InDel variant sites. Specific primers are designed in a targeted manner, and specific DNA fragments of the wild Hericium erinaceus strain monkey HE015 are obtained through PCR amplification, which is the molecular marker of the Hericium erinaceus strain monkey HE015. The specific experiments are as follows:

[0119] 1. Genome sequencing and assembly

[0120] Spines from mature fruiting bodies of the monkey HE015 strain were collected, spores were washed off the spikes with sterile water, and monokaryotic hyphae from basidiospores were screened for high-quality DNA extraction. Sequencing was performed using both Illumina second-generation sequencing platforms and Nanopore third-generation sequencing platforms. For the second-generation sequencing library, the insert size was 350 bp, and the paired-end sequencing length was 150 bp. 300 ng of genomic DNA was fragmented using enzyme digestion. The fragmented DNA was filtered using magnetic beads to an average size of 200-400 bp. The selected fragments were end-repaired, 3' adenylated, and adapter-ligated, and the PCR products were purified using magnetic beads. For the third-generation sequencing library, genomic DNA was fragmented using a 26G needle, and fragments larger than 20 kb were selected using BluePippin. After end-repair and A-tailing, adapters were ligated to each end of the fragments to prepare the DNA library. The constructed library was quantified using Qubit. After passing quality control, the library was sequenced using the Nanopore platform based on the effective concentration and data output requirements.

[0121] The assembly of the third-generation sequencing data using Nextdenovo and Necat software can be roughly divided into three steps: ① Nanopore data were assembled using Nextdenovo and Necat, respectively. Nextdenovo used the following parameters: read cuffoff = 3k, seed-cutoff = 9k; Necat used the following parameters: GENOME_SIZE = 45000000, MIN_READ_LENGTH = 2000, PREP_OUTPUT_COVERAGE = 40, NUM_ITER = 3, and all other parameters were default. ② The output was polished using Medaka with default parameters; ③ The assembly was corrected using the second-generation data using Pilon with default parameters. The assembly results from different software were statistically analyzed, and alignment of the assembled sequences with homologous sequences was evaluated. The best assembly was selected as the monkey HE015 genome sequence.

[0122] 2. Whole-genome resequencing and indel variant site set selection

[0123] The widely collected market species and wild species of Hericium erinaceus strains (Monkey HE015, W461, I044, 793, E108, MC-JN-1, MC-HE-1, M178) were inoculated on a flat culture medium (enriched comprehensive PDA medium), the mycelium was collected and the total DNA was extracted. After the genomic DNA test was qualified, the DNA was fragmented by enzyme digestion, and then the fragmented DNA was purified, end-repaired, 3'-end A was added, and sequencing adapters were connected. Magnetic beads were used for fragment size selection, and PCR amplification was performed to form a sequencing library. The constructed library was first subjected to library quality inspection. The library that passed the quality inspection was sequenced with Illumina for double-end sequencing. The sequencing sequence read length was 150bp, generating more than 5G of data.

[0124] The raw sequencing sequences (Raw Reads) obtained by sequencing were filtered to obtain Clean Reads for subsequent information analysis. The main steps of data filtering are as follows: (1) remove reads with adapters; (2) filter reads with N content exceeding 10%; (3) remove reads with bases with a quality value below 10 exceeding 50%. The clean reads were mapped to the Hericium erinaceus HE015 genome using BWA software, and InDel mutation detection was performed using the HaplotypeCaller (local haplotype assembly) algorithm of GATK to obtain the final set of variant sites. From these, sites with high coverage and genotype quality values ​​of the variant sites were selected for primer design.

[0125] 3. Specific primer design and PCR amplification

[0126] From the Indel variant site set, we selected sites with high coverage and genotype quality values ​​for primer design. We designed and screened three primer pairs (HE015-F2 / R2, HE015-F4 / R4, and HE015-F8 / R8). The primer information is as follows:

[0127] HE015-F2(SEQ ID NO.4):GCAGTGGTCTCAAAGGCCAT,

[0128] HE015-R2 (SEQ ID NO.5):GAAACTTGGTGCTGCAGAGC;

[0129] HE015-F4(SEQ ID NO.6):CGGGGTCTGGGATGAGACC,

[0130] HE015-R4 (SEQ ID NO.7):GAATGGGCAAATGAGGTCGGG;

[0131] HE015-F8 (SEQ ID NO.8): CCTGCAAGCCATCGGACGTA,

[0132] HE015-R8 (SEQ ID NO. 9): CTTGGTCTACGCTACGTCC.

[0133] The primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd. PCR amplification was performed on a BioRad PCR instrument, and the composition of the PCR reaction solution (30 μl in total) is shown in Table 8.

[0134] Table 8 Monkey HE015 molecular marker PCR system

[0135] The PCR program was as follows: pre-denaturation at 95°C, denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 15 seconds, GOTO step 2, 32 cycles, and extension at 72°C for 10 minutes.

[0136] The PCR products were electrophoresed on a 1-1.5% agarose gel (5 v / cm) for 25 min and photographed in a gel imaging system.

[0137] 4. PCR amplification results and analysis

[0138] (1) The amplification results of primer pair HE015-F8 / R8 are shown in Figure 3:

[0139] As shown in Figure 3 , HE015-F8 / R8 primers amplified a single amplified band in monkey HE015, with a size between 400 and 500 bp. No bands were found in other market strains or wild strains ( Figure 3 ).

[0140] The PCR product obtained by amplifying HE015-F8 / R8 was sent to BGI for bidirectional sequencing, and the specific sequence information was obtained as shown in the following SEQ ID NO.1, with a size of 457 bp. This specific DNA fragment is the InDel molecular marker of the new Hericium erinaceus strain Monkey HE015 of the present invention.

[0141] SEQ ID NO.1 sequence (HE015-F8 / R8 amplified product sequence):

[0142] (2) The amplification results of primer pairs HE015-F2 / R2 and HE015-F4 / R4 are shown in Figure 4:

[0143] As shown in Figure 4A, the band amplified by HE015-F4 / R4 in Hericium erinaceus MC-JN-1 is similar in size to that of monkey HE015 (the product of monkey HE015 amplified by HE015-F4 / R4 was sequenced, and the sequence information is shown in SEQ ID NO.2). The other six control strains had no bands or had bands of different sizes. Therefore, this primer can distinguish monkey HE015 from the six Hericium erinaceus strains other than MC-JN-1.

[0144] As shown in Figure 4B, the band amplified by HE015-F2 / R2 in Hericium erinaceus M178 is similar in size to that of monkey HE015 (the product of monkey HE015 amplified by HE015-F2 / R2 was sequenced, and the sequence information is shown in SEQ ID NO.3). The other control strains had no effective amplification or the band sizes were different. Therefore, this primer can distinguish monkey HE015 from the six Hericium erinaceus strains other than M178.

[0145] The combined use of HE015-F2 / R2 and HE015-F4 / R4 can effectively distinguish monkey HE015 from other strains.

[0146] SEQ ID NO.2 sequence (HE015-F4 / R4 amplified product sequence):

[0147] SEQ ID NO.3 sequence (HE015-F2 / R2 amplified product sequence):

[0148] In summary:

[0149] (1) Using the primer pair HE015-F8 / R8 (corresponding to the molecular marker SEQ ID NO. 1) alone, monkey HE015 can be distinguished from all other Hericium erinaceus fungi.

[0150] (2) Using HE015-F2 / R2 and HE015-F4 / R4 (corresponding molecular markers SEQ ID NO.3 and SEQ ID NO.2) simultaneously can also distinguish monkey HE015 from all other Hericium erinaceus fungi; the two sets of primers can simultaneously amplify the corresponding identical bands for monkey HE015.

[0151] Based on the above results, the present invention provides a detection or identification product for monkey HE015, which provides a technical basis for quality control of monkey HE015.

[0152] Example 4 Preparation of Monkey HE015 Extract

[0153] 1. Preparation of monkey HE015 liquid fermentation culture (HEF):

[0154] The monkey HE015 mother culture was expanded step by step and inoculated into a sterilized liquid PDA medium. The culture was placed in a shaker at 25°C and 150 rpm and cultured until the medium turned yellow-brown and covered with mycelium. The culture was then stopped and the mycelium was obtained by centrifugation. The culture solution was concentrated under reduced pressure using a rotary evaporator. The mycelium and fermentation concentrate were mixed and homogenized, freeze-dried, and pulverized to obtain the monkey HE015 liquid fermentation culture (HEF).

[0155] 2. Preparation of monkey HE015 fruiting body small molecule extract (HEFX) and monkey HE015 fruiting body polysaccharide extract (HEFP):

[0156] After the monkey HE015 fruiting body is crushed, 20 times the amount of purified water is added, and the mixture is stirred and extracted at 95°C for 2 hours; the filtrate is filtered, and the filtrate is concentrated under reduced pressure to a relative density of 1.10, and 95% ethanol is slowly added to make the alcohol concentration reach 80%, and the mixture is allowed to stand at 4°C for 24 hours; the supernatant is concentrated under reduced pressure, freeze-dried, and crushed to obtain the monkey HE015 fruiting body small molecule extract (HEFX); the lower precipitate is re-dissolved with 5 times the amount of water, and 95% ethanol is added to adjust the alcohol concentration to 80%, and the mixture is allowed to stand at 4°C for 24 hours; the lower precipitate is washed with 80% ethanol and acetone, freeze-dried, and crushed to obtain the monkey HE015 fruiting body polysaccharide extract (HEFP).

[0157] 3. Preparation of small molecule extract from monkey HE015 solid culture mycelium (HESX) and polysaccharide extract from monkey HE015 solid culture mycelium (HESP):

[0158] The mother culture of monkey HE015 was inoculated into sterilized solid PDA medium after stepwise expansion culture and placed in a culture room at 25°C until full of mycelium; the culture was removed, the densely growing mycelium part was selected, torn into small pieces, and then added with 20-fold volume of pure water, and extracted with stirring at 95°C for 2 hours; the filtrate was filtered, and concentrated under reduced pressure to a relative density of 1.10, 95% ethanol was slowly added to adjust the alcohol concentration to 80%, and the mixture was allowed to stand at 4°C for 24 hours; the supernatant was concentrated under reduced pressure, freeze-dried, and pulverized to obtain the small molecule extract (HESX) of monkey HE015 solid culture mycelium; the lower precipitate was re-dissolved with 5-fold water, and the alcohol concentration was adjusted to 80% by adding 95% ethanol, and the mixture was allowed to stand at 4°C for 24 hours; the lower precipitate was washed with 80% ethanol and acetone, freeze-dried, and pulverized to obtain the monkey HE015 solid culture mycelium polysaccharide extract (HESP).

[0159] Example 5 Monkey HE015 extract has an improving effect on alcoholic gastric mucosal damage

[0160] 1. Experimental Animals

[0161] Male KM mice, SPF grade, weighing 18-22 g, 5-6 weeks old, were housed at a temperature and humidity of 23 ± 1°C, 55 ± 10%, and a 12-hour daylight cycle. The housing conditions were maintained consistently to ensure the reliability of the experimental results. Mice had free access to food and water.

[0162] 2. Experimental Grouping

[0163] After 7 days of adaptive feeding, male KM mice were randomly divided into the following 8 groups:

[0164] Blank control group 1: normal group (Control),

[0165] Model control group 1: Model group (Model),

[0166] Dosage group 1: Positive drug group (Positive),

[0167] Dosage group 2: monkey HE015 liquid fermentation culture group (HEF),

[0168] Group 3: monkey HE015 fruiting body polysaccharide extract group (HEFP),

[0169] Dosage group 4: monkey HE015 fruiting body small molecule extract group (HEFX),

[0170] Group 5: monkey HE015 solid culture mycelium polysaccharide extract group (HESP),

[0171] Dosage group 6: monkey HE015 solid culture mycelium small molecule extract group (HESX),

[0172] There were 14 mice in the model group and 13 mice in the other groups, which were fed with normal feed.

[0173] 3. Experimental process

[0174] The experiment lasted for 2 weeks:

[0175] Week 1: The mice in each treatment group were given preventive medication by gavage once a day. The dosage concentrations are shown in Table 9. At the same time, the mice in the normal group and the model group were given 0.3 mL of pure water by gavage.

[0176] Week 2: The model group and each drug-treated group were given 0.3 mL of 60% ethanol by gavage once a day to induce a chronic alcoholic gastric mucosal injury model in mice for 1 week. At the same time, the drug-treated groups continued to receive drug treatment (dosage concentration and dosage were the same as in week 1) to observe the protective effect of different drug-treated groups on the gastric mucosa.

[0177] Table 9 Concentration and dosage of each group

[0178] The night before the end of the experiment, drug administration was stopped and the mice were fasted but not watered. Eyeballs were removed to collect blood, and then the mice were killed by cervical dislocation. Gastric tissue was fixed in 4% paraformaldehyde for pathological examination.

[0179] 4. Experimental results

[0180] (1) Effect of Hericium erinaceus HE015 extract on body weight in mice with chronic alcoholic gastric mucosal injury

[0181] As shown in Figure 5A, during the preventive administration period, there was no significant difference in the body weight of mice in each group (P>0.05), showing an increasing trend. During the modeling period, the body weight of mice in the normal group continued to increase, while the body weight of mice in the other groups showed a decreasing trend. The body weights of mice in the model group, the drug group, and the positive drug group were significantly lower than those in the normal group (P<0.01), indicating that modeling has a significant impact on body weight.

[0182] At the end of the experiment, the weight of mice in all drug-treated groups was higher than that in the model group. The weight of mice in the drug-treated groups HESX, HEFX, HEFP, and the positive drug group was significantly higher than that in the model group (P<0.05). The weight of mice in the drug-treated groups HESX and HEFP was higher than that in the positive drug group, but the difference was not significant (P>0.05). The results indicate that monkey HE015 extract can reduce the effect on the body weight of mice with chronic alcoholic gastric mucosal injury, especially the small molecule extract from the solid culture mycelium of monkey HE015 (HESX), the polysaccharide extract from the fruiting body of monkey HE015 (HEFP), and the small molecule extract from the fruiting body of monkey HE015 (HEFX), which was even more effective than the positive drug.

[0183] (2) Effect of Hericium erinaceus HE015 extract on the survival curve of mice with chronic alcoholic gastric mucosal injury

[0184] As shown in Figure 5 B, compared with the normal group, the survival rates of mice in the other groups showed a downward trend, indicating that modeling had a significant effect on the survival rate.

[0185] At the end of the experiment, the number of deaths of mice in the model group, positive drug group and HESP group of the drug administration group was significantly higher than that in other groups, and the positive drug group and HESP group of the drug administration group were only slightly higher than that in the model group; while the survival rates of mice in the HEF, HEFP, HEFX and HESX groups were significantly higher than those in the model group, indicating that the monkey HE015 liquid fermentation culture (HEF), monkey HE015 fruiting body polysaccharide extract (HEFP), monkey HE015 fruiting body small molecule extract (HEFX) and monkey HE015 solid culture mycelium small molecule extract (HESX) have good efficacy and can prolong individual survival time.

[0186] (3) HE staining results of mouse gastric tissue

[0187] Figure 6 shows the results of HE staining of mouse gastric tissue. The gastric mucosal structure of the normal group mice was intact and clear, with intact cell morphology and regular glandular arrangement. No abnormalities such as tissue defects, hemorrhage, or inflammation were observed. The model group mice showed severe diffuse necrosis and exfoliation of gastric mucosal cells, with enlarged and loosely arranged cells and inflammatory cell infiltration. In the positive drug group mice, some mucosal epithelial cells in the stomach tissue were necrotic and exfoliated, and some cells were loosely arranged, with a small amount of inflammatory cell infiltration. Compared with the model group, the gastric mucosal morphology of the mice in the groups treated with monkey HE015 extract improved to varying degrees, and was superior to that of the positive drug group.

[0188] In summary, the results showed that the monkey HE015 extracts HESX, HEFX, and HEFP, as well as the positive drug lansoprazole, increased the body weight of mice with chronic alcohol-induced gastric mucosal damage and reduced the effects of chronic alcohol-induced gastric mucosal damage on mouse body weight. The extracts HEF, HEFP, HEFX, and HESX prolonged survival. The extracts HEF, HEFP, HEFX, HESP, and HESX improved the gastric mucosa of mice with chronic alcohol-induced gastric mucosal damage. These results indicate that the monkey HE015 extracts of the present invention can be used to improve chronic alcohol-induced gastric mucosal damage, with the fruiting body extract being more effective.

[0189] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A new strain of Hericium erinaceus, HE015, characterized in that: This strain was deposited in Guangdong Provincial Microbiological Culture Collection on May 12, 2022, with the deposit number GDMCC No: 62464.

2. A Hericium erinaceus inoculum agent, characterized in that: Contains the new strain monkey HE015 described in claim 1.

3. A molecular marker for detecting or identifying the monkey HE015 according to claim 1, characterized in that: The molecular marker is: a molecular marker having a nucleotide sequence as shown in SEQ ID NO.1; or a combination of molecular markers having nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. Use of a reagent for detecting the molecular marker of claim 3 in the preparation of a kit for detecting or identifying monkey HE015 of claim 1.

5. A primer for detecting or identifying the monkey HE015 according to claim 1, characterized in that: The primers are primer pair HE015-F8 / R8, or a combination of primer pair HE015-F2 / R2 and primer pair HE015-F4 / R4; the nucleotide sequence of the primer pair HE015-F8 / R8 is shown in SEQ ID NO.8-9, The nucleotide sequence of the primer pair HE015-F2 / R2 is shown in SEQ ID NO.4-5. The nucleotide sequence of the primer pair HE015-F4 / R4 is shown in SEQ ID NO.6-7.

6. A kit for detecting or identifying the monkey HE015 according to claim 1, characterized in that: Contains a reagent for detecting the molecular marker according to claim 3.

7. A kit for detecting or identifying the monkey HE015 according to claim 1, characterized in that: Contains the primer according to claim 5.

8. A method for detecting or identifying the monkey HE015 according to claim 1, characterized in that: The test kit according to claim 6 or 7 is used to detect the DNA of the sample to be tested as a template.

9. A Hericium erinaceus polysaccharide extract, characterized in that The precipitate is obtained by water extraction and alcohol precipitation of the fruiting body of monkey HE015 as claimed in claim 1.

10. A Hericium erinaceus small molecule extract, characterized in that: The supernatant obtained by water extraction and alcohol precipitation of the fruiting body of monkey HE015 as claimed in claim 1.

11. Use of the monkey HE015 described in claim 1, the bacterial agent described in claim 2, the Hericium erinaceus polysaccharide extract described in claim 9, or the Hericium erinaceus small molecule extract described in claim 10 in the preparation of a product having the effect of protecting gastric mucosa or treating or improving alcoholic gastric mucosal damage.

12. A product for protecting gastric mucosa or improving alcoholic gastric mucosal damage, characterized in that: Contains the Hericium erinaceus polysaccharide extract according to claim 9 and / or the Hericium erinaceus small molecule extract according to claim 10.

Images