A sorghum gamma kafirin mutant with improved protein digestibility in the grain

A mutant y-kafirin gene mutation in sorghum enhances protein digestibility and content, overcoming genetic and regulatory challenges, offering a non-GMO solution for improved sorghum breeding.

WO2025207804A1PCT designated stage Publication Date: 2025-10-02TEXAS TECH UNIV SYST +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/021601
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-26
Filing Date
2025-03-26
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Current sorghum breeding methods fail to enhance both protein digestibility and content due to limitations in genetic materials and regulatory constraints on genetically modified organisms, leading to low nutritional value and limited use in human and animal consumption.

Method used

Introduction of a mutant y-kafirin gene, specifically a homozygous or heterozygous mutation in the y-kafirin gene, such as Sobic.002G211700, which results in a stop codon mutation at specific positions, enhancing protein digestibility and content through methods like floral-dip transformation and CRISPR/Cas system.

Benefits of technology

The mutant y-kafirin gene increases protein digestibility by at least 30% and content by at least 20%, addressing the limitations of existing sorghum varieties and facilitating breeding programs without GMO constraints.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025021601_02102025_PF_FP_ABST
    Figure US2025021601_02102025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure pertains to a sorghum plant or seed that includes a mutant y-kafirin gene that enhances sorghum protein digestibility, sorghum protein content, or combinations thereof. The present disclosure also pertains to methods of altering a sorghum plant or seed by introducing a y-kafirin gene mutation into the sorghum plant or seed. Additionally, the present disclosure pertains to methods of growing a sorghum plant or seed in a field by applying a sorghum plant or seed of the present disclosure to the field.
Need to check novelty before this filing date? Find Prior Art

Description

TITLEA SORGHUM GAMMA KAFIRIN MUTANT WITH IMPROVED PROTEIN DIGESTIBILITY IN THE GRAIN STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0001] This invention was made with government support under 58-3020-2-024 awarded by the U.S. Department of Agriculture. The government has certain rights in this invention.CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 570,107, filed on March 26, 2024. The entirety of the aforementioned application is incorporated herein by reference.SEQUENCE DISCLOSURE STATEMENT

[0003] Pursuant to 37 C.F.R. § 1.834, Applicants have submitted a sequence listing in XML format (“Sequence Listing”). The name of the file containing the Sequence Listing is “AF 13368. P067WO”. The date of the creation of the Sequence Listing is March 26, 2025. The size of the Sequence Listing is 12,000 bytes. Applicants hereby incorporate by reference the material in the Sequence Listing.BACKGROUND

[0004] A need exists for improving the digestibility and protein content of sorghum grain. Numerous embodiments of the present disclosure aim to address the aforementioned need.SUMMARY

[0005] In some embodiments, the present disclosure pertains to a sorghum plant or seed that includes a mutant y-kafirin gene. In some embodiments, the mutant y-kafirin gene enhances sorghum protein digestibility, sorghum protein content, or combinations thereof. Additional embodiments of the present disclosure pertain to methods of altering a sorghum plant or seed by introducing a y-kafirin gene mutation into the sorghum plant or seed. In some embodiments, the mutation enhances sorghum protein digestibility, sorghum protein content, or combinations thereof. Further embodiments of the present disclosure pertain to methods of growing a sorghum plant or a seed in a field by applying a sorghum plant or seed of the present disclosure to the field.

[0006] In some embodiments, the mutant y-kafirin gene includes a mutation of an endogenous y- kafirin gene, such as a homozygous or heterozygous mutation of the endogenous y-kafirin gene. In some embodiments, the mutant y-kafirin gene includes a mutant y-kafirin transgene.

[0007] In some embodiments, the mutant y-kafirin gene includes a mutation of a y-kafirin gene, where the original gene is represented by the following gene identification: Sobic.002G211700. In some embodiments, the original y-kafirin gene includes a genomic DNA sequence that includes SEQ ID NO: 1. In some embodiments, the mutant y-kafirin gene includes a mutation of the genomic DNA sequence, which results in a change of the coding sequence for glutamine (Q) at positions 480-482 of SEQ ID NO: 1 (i.e., CAG) to a stop codon (i.e., TAG). In some of such embodiments, the mutant y-kafirin gene includes SEQ ID NO: 2.

[0008] In some embodiments, the original y-kafirin gene includes a coding DNA sequence that includes SEQ ID NO: 3. In some embodiments, the mutant y-kafirin gene includes a mutation of the coding DNA sequence, which results in a change of the coding sequence for glutamine (Q) at positions 421-423 of SEQ ID NO: 3 (i.e., CAG) to a stop codon (i.e., TAG). In some of such embodiments, the mutant y-kafirin gene includes SEQ ID NO: 4.

[0009] In some embodiments, the original y-kafirin gene encodes an amino acid sequence that includes SEQ ID NO: 5. In some embodiments, the mutant y-kafirin gene encodes an amino acid sequence that includes SEQ ID NO: 6.

[0010] In some embodiments, a plant with a mutant y-kafirin gene of the present disclosure exhibits enhanced protein digestibility. For instance, in some embodiments, the sorghum plant or seed exhibits enhanced protein digestibility by at least 30% relative to sorghum plants or seeds without the mutant y-kafirin gene (i.e., a y-kafirin gene with a mutation in Sobic.002G211700).

[0011] In some embodiments, a plant or seed with a mutant y-kafirin gene of the present disclosure exhibits enhanced protein content. For instance, in some embodiments, the sorghum plant or seed exhibits enhanced protein content by at least 20% relative to sorghum plants or seeds without the mutant y-kafirin gene.DRAWINGS

[0012] FIGS. 1A-1B provide images of wild type (FIG. 1A) and kaf-23 mutant (FIG. IB) sorghum seeds.

[0013] FIGS. 2A-2C provide protein analysis of kaf-23 mutant and wild type sorghum. FIG. 2A shows increased uncooked and cooked in vitro pepsin digestibility (IVPD) in kaf-23 mutant sorghum when compared to wildtype sorghum. FIG. 2B shows a high-performance liquid chromatography (HPLC) analysis showing reduced gamma kafirin in kaf-23 mutant sorghum. FIG. 2C provides a comparison of the content of kaf-1 and kaf-2 in wild type and kaf-23 mutant sorghum.DETAILED DESCRIPTION

[0014] It is to be understood that both the foregoing general description and the following detailed description are illustrative and explanatory, and are not restrictive of the subject matter, as claimed. In this application, the use of the singular includes the plural, the word “a” or “an” means “at least one”, and the use of “or” means “and / or”, unless specifically stated otherwise. Furthermore, the use of the term “including”, as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements or components that includes one unit and elements or components that include more than one unit unless specifically stated otherwise.

[0015] The section headings used herein are for organizational purposes and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated herein by reference in their entirety for any purpose. In the event that one or more of the incorporated literature and similar materials defines a term in a manner that contradicts the definition of that term in this application, this application controls.

[0016] Sorghum is a versatile and resilient cereal crop that plays a pivotal role in global food security. Originating in Africa, sorghum has transcended geographical boundaries to become a staple food source in various parts of the world. Its adaptability to diverse climates and resilience to harsh growing conditions position it as a vital crop for both traditional and modern agricultural systems. As a cereal grain, sorghum holds significance not only for its role in human nutrition but also as a key component in animal feed and industrial applications.

[0017] Even though sorghum is predominantly cultivated for food and animal feed, it is often perceived to have limited nutritional value and lower caloric content, largely due to the quality of its storage proteins and its low digestibility. Kafirin, the predominant (i.e., 77-82%) storage protein found in sorghum, plays a crucial role in determining sorghum’s quality characteristics. Kafirin proteins can be further categorized into distinct classes, each with its unique characteristics and prevalence within the sorghum grain. These include a-kafirin (with a molecular weight of 22- 26 kDa), P-kafirin (18 kDa), y-kafirin (28 and 50 kDa), and 8-kafirin (13 kDa).

[0018] Despite studies aimed at improving sorghum digestibility by focusing on its kafirin content, there is currently no genetic material available to enhance both protein digestibility and content. For instance, chemical mutagenesis using diethyl sulfate was employed to produce the highly digestible, high-lysine mutant P721Q. However, this mutation resulted in lower protein content and soft kernels, which were not favorable for sorghum breeding. Although genome editing technology has been utilized to modify sorghum kafirins, such as editing the Alpha-kafirin gene clusters to increase protein digestibility, it has also led to a decrease in protein content. Furthermore, regulatory constraints on genetically modified organisms (GMOs) render these approaches unsuitable for immediate sorghum breeding. Thus, there exists a significant gap in genetic materials with high protein content and digestibility in sorghum.

[0019] In sum, improving the digestibility of sorghum grain is one of the major goals for sorghum breeding to meet market needs. In particular, the low digestibility of proteins in sorghum grains, such as kafirin, hamper their use for animals and humans. Numerous embodiments of the present disclosure aim to address the aforementioned needs.

[0020] In some embodiments, the present disclosure pertains to a sorghum plant or seed that includes a mutant y-kafirin gene. In some embodiments, the mutant y-kafirin gene enhances sorghum protein digestibility, sorghum protein content, or combinations thereof. In some embodiments, the mutant y-kafirin gene enhances sorghum protein digestibility and sorghum protein content. Additional embodiments of the present disclosure pertain to methods of altering a sorghum plant or seed by introducing a y-kafirin gene mutation into the sorghum plant or seed. In some embodiments, the mutation enhances sorghum protein digestibility, sorghum protein content, or combinations thereof. Further embodiments of the present disclosure pertain to methods of growing a sorghum plant or seed in a field by applying a sorghum plant or seed of the present disclosure to the field. As set forth in more detail herein, the present disclosure can have numerous embodiments.

[0021] Mutant y-kafirin genes

[0022] The sorghum plants and seeds of the present disclosure can include various mutant y-kafirin genes. Additionally, the methods of the present disclosure may be utilized to form various mutant y-kafirin genes.

[0023] For instance, in some embodiments, the mutant y-kafirin gene includes a mutation of an endogenous y-kafirin gene. In some embodiments, the mutant y-kafirin gene includes a homozygous mutation of the endogenous y-kafirin gene. In some embodiments, the mutant y- kafirin gene includes a heterozygous mutation of the endogenous y-kafirin gene. In some embodiments, the mutant y-kafirin gene includes a mutant y-kafirin transgene.

[0024] The mutant y-kafirin genes of the present disclosure can include various types of mutations. For instance, in some embodiments, the mutation includes, without limitation, a point mutation, a missense mutation, a non-sense mutation, a frame shift mutation, a null mutation, a splice site mutation, or combinations thereof. In some embodiments, the mutation includes a point mutation.

[0025] In some embodiments, the mutant y-kafirin gene includes a mutation of a y-kafirin gene, where the original gene is represented by the following gene identification: Sobic.002G211700. In some embodiments, the original y-kafirin gene includes a genomic DNA sequence that includes SEQ ID NO: 1. In some embodiments, the mutant y-kafirin gene includes a mutation of the genomic DNA sequence, which results in a change of the coding sequence for glutamine (Q) at positions 480-482 of SEQ ID NO: 1 (i.e., CAG) to a stop codon (i.e., TAG). In some of such embodiments, the mutant y-kafirin gene includes SEQ ID NO: 2.

[0026] In some embodiments, the original y-kafirin gene includes a coding DNA sequence that includes SEQ ID NO: 3. In some embodiments, the mutant y-kafirin gene includes a mutation of the coding DNA sequence, which results in a change of the coding sequence for glutamine (Q) at positions 421-423 of SEQ ID NO: 3 (i.e., CAG) to a stop codon (i.e., TAG). In some of such embodiments, the mutant y-kafirin gene includes SEQ ID NO: 4.

[0027] In some embodiments, the original y-kafirin gene encodes an amino acid sequence that includes SEQ ID NO: 5. In some embodiments, the mutant y-kafirin gene encodes an amino acid sequence that includes SEQ ID NO: 6.

[0028] Introduction of -kafirin gene mutations

[0029] The methods of the present disclosure may be utilized to introduce mutant y-kafirin genes into sorghum plants and seeds in various manners. For instance, in some embodiments, the introduction includes transforming a sorghum plant or seed with the mutated y-kafirin transgene. In some embodiments, the transforming occurs by a method that includes, without limitation, floral-dip transformation, callus transformation, tissue transformation, particle bombardment, transferred DNA insertion, enhancer trap insertion, mobile genetic elements insertion, activation tagging insertion, fox hunting insertion, or combinations thereof.

[0030] In some embodiments, the introduction of a mutated y-kafirin gene into a sorghum plant or seed occurs by floral-dip transformation. In some embodiments, the floral-dip transformation includes positioning a mutated y-kafirin gene in a recombinant vector, placing the recombinant vector in bacterial cells (e.g., Agrobacterhim lumefaciens). and transforming the bacterial cells into the sorghum plant or seed.

[0031] In some embodiments, the introduction of a mutated y-kafirin gene into a sorghum plant or seed occurs by callus transformation. In some embodiments, the callus transformation occurs by utilizing bacterial cells (e.g., Agrobacterium).

[0032] In some embodiments, the introduction of a mutated y-kafirin gene into a sorghum plant or seed includes mutating an endogenous y-kafirin gene in the sorghum plant or seed. In some embodiments, the mutating occurs by a method that includes, without limitation, chemical mutation, site directed mutagenesis, irradiation, introduction of a gene editing system, or combinations thereof.

[0033] In some embodiments, the mutating of an endogenous y-kafirin gene includes chemical mutation. In some embodiments, the chemical mutation includes introduction of a chemical. In some embodiments, the chemical includes, without limitation, ethyl methane sulfonate (EMS), aminopurine, nitrosoguanidine, bisulfite, or combinations thereof. In some embodiments, the chemical includes ethyl methane sulfonate (EMS).

[0034] In some embodiments, the mutating of an endogenous y-kafirin gene includes introduction of a gene editing system. In some embodiments, the gene editing system includes a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas nuclease (Cas) system (CRISPR / Cas system). In some embodiments, the CRISPR / Cas system includes at least one Cas nuclease and at least one guide RNA. In some embodiments, the Cas nuclease includes, without limitation, class 2 of Cas nucleases, Cas 9, Cas d , Casd>2, Cpfl, or combinations thereof. In some embodiments, the CRISPR / Cas system includes a CRISPR / Cas9 system.

[0035] The y-kafirin gene mutations of the present disclosure can be introduced into sorghum plants and seeds at various stages. For instance, in some embodiments, a y-kafirin gene mutation is introduced at a seedling stage of a plant. In some embodiments, a y-kafirin gene mutation is introduced at an adult stage of a plant.

[0036] Effects of y-kafirin gene mutations

[0037] The mutant y-kafirin genes of the present disclosure can have various effects on sorghum plants and seeds. For instance, in some embodiments, the sorghum plant or seed exhibits reduced Y-kafirin expression relative to sorghum plants or seeds without the mutant y-kafirin gene. In some embodiments, the sorghum plant or seed exhibits enhanced kafirin 1 expression relative to sorghum plants or seeds without the mutant y-kafirin gene.

[0038] In some embodiments, a plant or seed with a mutant y-kafirin gene of the present disclosure exhibits enhanced protein digestibility. For instance, in some embodiments, the sorghum plant or seed exhibits enhanced protein digestibility by at least 30% relative to sorghum plants or seeds without the mutant y-kafirin gene. In some embodiments, the sorghum plant or seed exhibits enhanced protein digestibility by at least 40% relative to sorghum plants or seeds without the mutant y-kafirin gene. In some embodiments, the sorghum plant or seed exhibits enhanced protein digestibility by at least 50% relative to sorghum plants or seeds without the mutant y-kafirin gene.

[0039] In some embodiments, the enhanced protein digestibility is represented by an enhanced uncooked in vitro pepsin digestibility (IVPD) relative to sorghum plants or seeds without the mutant y-kafirin gene. In some embodiments, the enhanced protein digestibility is represented by an enhanced cooked in vitro pepsin digestibility (IVPD) relative to sorghum plants or seeds without the mutant y-kafirin gene.

[0040] In some embodiments, the enhanced protein digestibility is represented by enhanced protein digestibility of sorghum grain proteins. In some embodiments, the enhanced protein digestibility is represented by enhanced protein digestibility of sorghum seed proteins.

[0041] In some embodiments, a plant or seed with a mutant y-kafirin gene of the present disclosure exhibits enhanced protein content. For instance, in some embodiments, the sorghum plant or seed exhibits enhanced protein content by at least 20% relative to sorghum plants or seeds without the mutant y-kafirin gene.

[0042] Methods of growing sorghum plants and seeds

[0043] Additional embodiments of the present disclosure pertain to methods of growing a sorghum plant or seed of the present disclosure by applying the sorghum plant or seed to a field. As set forth in more detail herein, the growth methods of the present disclosure can have numerous embodiments.

[0044] Various methods may be utilized to apply sorghum plants and seeds of the present disclosure to a field. For instance, in some embodiments, the application occurs by planting the sorghum plant or seed in the field. In some embodiments, the application occurs in a controlled growth environment, such as a greenhouse or growth chamber.

[0045] The methods of the present disclosure may apply plants and seeds of the present disclosure to various fields. For instance, in some embodiments, the field includes an agricultural field. In some embodiments, the field includes a controlled growth environment, such as a greenhouse or growth chamber.

[0046] Applications

[0047] The sorghum plants and seeds of the present disclosure can have various advantageous applications. For instance, in some embodiments, the sorghum plants and seeds of the present disclosure are suitable for use as human food. In some embodiments, the sorghum plants and seeds of the present disclosure are suitable for breeding to create new sorghum varieties for use as human food. In some embodiments, the sorghum plants and seeds of the present disclosure are suitable for use as animal feed. In some embodiments, the sorghum plants and seeds of the present disclosure are suitable for breeding to create new sorghum varieties for use as animal feed.

[0048] Additional Embodiments

[0049] Reference will now be made to more specific embodiments of the present disclosure and experimental results that provide support for such embodiments. However, Applicant notes that the disclosure below is for illustrative purposes only and is not intended to limit the scope of the claimed subject matter in any way.

[0050] Example 1. Enhanced Protein Digestibility in Sorghum Grain through GammaKafirin Mutation

[0051] Sorghum (sorghum bicolor) holds global agricultural significance, predominantly utilized for animal feed and biofuel production. However, its viability as a food source for both humans and animals is hindered by the low content and digestibility of grain storage proteins, particularly kafirin, a major component of the protein bodies in sorghum endosperm.

[0052] Through screening mutant variants of kafirin genes, Applicant identified a sorghum y- kafirin mutant capable of enhancing uncooked and cooked protein digestibility by approximately 50%, alongside a 22% increase in protein content. This ethyl methane sulfonate (EMS)-induced mutant line presents an immediate opportunity for integration into sorghum breeding programs. Additionally, Applicant’s developed molecular marker facilitates the expedited selection of protein digestibility traits, overcoming challenges associated with conventional phenotyping methods.

[0053] Example 1.1. Isolation of the gamma-kafirin mutant

[0054] The mutant harboring mutations in the gamma-kafirin gene Sobic.002G211700, denoted as kaf-23, was isolated from the ethyl methane sulfonate (EMS)-induced mutant population within the sorghum line BTx623 background (referred to as wild type herein). The specific mutation in this line occurred at Chr02:60423921, resulting in the change of the amino acid glutamine (Q) with a stop codon.

[0055] To identify the homozygous plants in this mutation, genotyping was performed using allele-specific competitive-extension PCR approach in the M3 generation seeds of kaf-23. The primer sequences are detailed in Table 1.Primer Sequence kaf-23B-l GAAGGTGACCAAGTTCATGCTCCACCTGCCTGAGCTG (SEQ ID NO: 7) kaf-23B-2 GAAGGTCGGAGTCAACGGATTGGCTCCACCTGCCTGAGCTA (SEQ IDNO: 8) kaf-23B-C GTTGCGGCAGCAGTGCTGTCA (SEQ ID NO: 9)Table 1. Primers for screening gamma-kafirin mutations.

[0056] Subsequently, seeds from homozygous plants of kaf-23 and the wild type were harvested for further characterization. The marker Applicant used for selecting the homozygous mutants was the molecular marker to facilitate the breeding using this mutation.

[0057] Example 1.2, The physical and nutrition characterizations of the kaf-23 grain

[0058] Through physical characterization, Applicant observed an 83.37% reduction in vitreous endosperm in kaf-23 compared to the wild type (Table 2).Table 2. The physical and nutrition comparison of the wild type and kaf-23 grains.

[0059] The reduction in vitreous endosperm was further confirmed by scanning electron microscopy (SEM) images (FIGS. 1A-1B), illustrating the changed endosperm structure of the mutant line Kaf-23. Additionally, the floury endosperm of kaf-23 showed a high concentration of protein bodies with a modified structure that includes pores and channels. The large change in the endosperm structure and protein-starch matrix are all features of the improved protein digestibility.

[0060] Despite the floury endosperm, the hardness of kaf-23 decreased by 25.14%. However, it is noteworthy that, even with this reduction, the hardness of the kernel of kaf-23 remains in optimal range. Moreover, the kaf-23 line exhibited an increase in seed size, with a 17.90% larger kernel diameter. This enlargement contributed to an 18.71% increase in the average seed weight. Based on the nutritional analysis, the kaf-23 line exhibited no significant alteration in starch and lysine content, while the protein content showed increase of 22.11%. This finding aligns with the characteristics of gamma-kafirin, which typically accounts for only about 6% of the total protein in sorghum grain.

[0061] Example 1.3, Improved protein digestibility of kaf-23

[0062] To assess the protein digestibility of kaf-23, both cooked and uncooked in vitro pepsin digestibility (IVPD) tests were conducted (FIG. 2A). The uncooked IVPD increased significantly from 45.83% in the wild type to 70.09% in kaf-23. Similarly, the cooked IVPD analysis also revealed a notable increase of 45.71%. These results strongly confirm the enhanced protein digestibility in kaf-23.

[0063] Furthermore, high-performance liquid chromatography (HPLC) analysis (FIG. 2B) revealed a conspicuous reduction in the peak corresponding to gamma kafirin in kaf-23 compared to the wild type, consistent with the knockout mutation in the gamma-kafirin gene in the kaf-23 line. In sorghum, a higher percentage of kafirin 1 suggests that there is less disulfide cross-linking in the overall kafirin complexes, whereas a higher percentage of kafirin 2 suggests more disulfide cross-links in these complexes. Notably, the kaf-23 line exhibits a substantially higher percentage of kafirin 1 than the wild type (FIG. 2C), aligning with the increased IVPD observed in this line.

[0064] Example 1.4, Summary

[0065] The long-standing challenge in the sorghum industry has been the low protein digestibility of sorghum grain. Applicant’s groundbreaking discovery introduces the first gamma-kafirin nonGMO mutant, demonstrating a large enhancement in protein digestibility. This finding opens up opportunities to address the longstanding limitations in sorghum breeding.

[0066] While the P721Q mutant line, with a mutation in the alpha-kafirin gene, has shown potential in improving sorghum grain digestibility, it comes with three significant breeding challenges. These challenges include reduced protein content, soft kernel texture, and the complexity of the genomic sequence, making it difficult to design molecular markers for efficient breeding. In contrast, Applicant’s newly developed gamma-kafirin line exhibits high protein content, a slightly reduced hardness, and the incorporation of well-designed molecular markers. These advantages position Applicant’s discovery as a superior choice, effectively addressing all three breeding challenges, as outlined herein.

[0067] Without further elaboration, it is believed that one skilled in the art can, using the description herein, utilize the present disclosure to its fullest extent. The embodiments described herein are to be construed as illustrative and not as constraining the remainder of the disclosure in any way whatsoever. While the embodiments have been shown and described, many variations and modifications thereof can be made by one skilled in the art without departing from the spirit and teachings of the invention. Accordingly, the scope of protection is not limited by the description set out above, but is only limited by the claims, including all equivalents of the subject matter of the claims. The disclosures of all patents, patent applications and publications cited herein are hereby incorporated herein by reference, to the extent that they provide procedural or other details consistent with and supplementary to those set forth herein.

Claims

WHAT IS CLAIMED IS1. A sorghum plant or seed comprising a mutant y-kafirin gene, wherein the original y-kafirin gene is represented by the following gene identification: Sobic.002G211700, and wherein the mutant y-kafirin gene enhances sorghum protein digestibility, sorghum protein content, or combinations thereof.

2. The sorghum plant or seed of claim 1, wherein the mutant y-kafirin gene comprises a mutation of an endogenous y-kafirin gene.

3. The sorghum plant or seed of claim 2, wherein the mutant y-kafirin gene comprises a homozygous mutation of the endogenous y-kafirin gene.

4. The sorghum plant or seed of claim 2, wherein the mutant y-kafirin gene comprises a heterozygous mutation of the endogenous y-kafirin gene.

5. The sorghum plant or seed of claim 1, wherein the mutant y-kafirin gene comprises a mutant y-kafirin transgene.

6. The sorghum plant or seed of claim 1, wherein the mutant y-kafirin gene comprises SEQ ID NO: 2.

7. The sorghum plant or seed of claim 1, wherein the mutant y-kafirin gene comprises SEQ ID NO: 4.

8. The sorghum plant or seed of claim 1, wherein the mutant y-kafirin gene encodes an amino acid sequence comprising SEQ ID NO: 6.

9. The sorghum plant or seed of claim 1, wherein the sorghum plant or seed exhibits enhanced protein digestibility.

10. The sorghum plant or seed of claim 9, wherein the sorghum plant or seed exhibits enhanced protein digestibility by at least 30% relative to sorghum plants or seeds without the mutant y- kafirin gene.

11. The sorghum plant or seed of claim 1, wherein the sorghum plant or seed exhibits enhanced protein content.

12. The sorghum plant or seed of claim 11, wherein the sorghum plant or seed exhibits enhanced protein content by at least 20% relative to sorghum plants or seeds without the mutant y-kafirin gene.

13. A method of altering a sorghum plant or seed, said method comprising introducing a y- kafiriii gene mutation into the sorghum plant or seed, wherein the original y-kafirin gene is represented by the following gene identification: Sobic.002G211700, and wherein the mutation enhances sorghum protein digestibility, sorghum protein content, or combinations thereof.

14. The method of claim 13, wherein the introducing comprises transforming the sorghum plant or seed with the mutated y-kafirin transgene.

15. The method of claim 14, wherein the transforming occurs by a method selected from the group consisting of floral-dip transformation, callus transformation, tissue transformation, particle bombardment, transferred DNA insertion, enhancer trap insertion, mobile genetic elements insertion, activation tagging insertion, fox hunting insertion, or combinations thereof.

16. The method of claim 13, wherein the introducing comprises mutating an endogenous y- kafirin gene in the sorghum plant or seed.

17. The method of claim 16, wherein the mutant y-kafirin gene comprises a homozygous mutation of the endogenous y-kafirin gene.

18. The method of claim 16, wherein the mutant y-kafirin gene comprises a heterozygous mutation of the endogenous y-kafirin gene.

19. The method of claim 16, wherein the mutating occurs by a method selected from the group consisting of chemical mutation, site directed mutagenesis, irradiation, introduction of a gene editing system, or combinations thereof.

20. The method of claim 16, wherein the mutating comprises introduction of a gene editing system.

21. The method of claim 20, wherein the gene editing system comprises a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas nuclease (Cas) system (CRISPR / Cas system), wherein the CRISPR / Cas system comprises at least one Cas nuclease and at least one guide RNA.

22. The method of claim 13, wherein the mutant y-kafirin gene comprises SEQ ID NO: 2.

23. The method of claim 13, wherein the mutant y-kafirin gene comprises SEQ ID NO: 4.

24. The method of claim 13, wherein the mutant y-kafirin gene encodes an amino acid sequence comprising SEQ ID NO: 6.

25. The method of claim 13, wherein the sorghum plant or seed exhibits enhanced protein digestibility by at least 30% relative to sorghum plants or seeds without the mutant y-kafirin gene.

26. The method of claim 13, wherein the sorghum plant or seed exhibits enhanced protein content by at least 20% relative to sorghum plants or seeds without the mutant y-kafirin gene.

27. A method of growing a sorghum plant or seed in a field, said method comprising: applying the sorghum plant or seed to the field, wherein the sorghum plant or seed comprises a mutant y-kafirin gene, wherein the original y-kafirin gene is represented by the following gene identification: Sobic.002G211700, and wherein the mutant y-kafirin gene enhances sorghum protein digestibility, sorghum protein content, or combinations thereof.

28. The method of claim 27, wherein the applying occurs by planting the sorghum plant or seed in the field.

29. The method of claim 27, wherein the field comprises an agricultural field.

30. The method of claim 27, wherein the mutant y-kafirin gene comprises a mutation of an endogenous y-kafirin gene.

31. The method of claim 30, wherein the mutant y-kafirin gene comprises a homozygous mutation of the endogenous y-kafirin gene.

32. The method of claim 30, wherein the mutant y-kafirin gene comprises a heterozygous mutation of the endogenous y-kafirin gene.

33. The method of claim 27, wherein the mutant y-kafirin gene comprises a mutant y-kafirin transgene.

34. The method of claim 27, wherein the mutant y-kafirin gene comprises SEQ ID NO: 2.

35. The method of claim 27, wherein the mutant y-kafirin gene comprises SEQ ID NO: 4.

36. The method of claim 27, wherein the mutant y-kafirin gene encodes an amino acid sequence comprising SEQ ID NO: 6.

37. The method of claim 27, wherein the sorghum plant or seed exhibits enhanced protein digestibility by at least 30% relative to sorghum plants or seeds without the mutant y-kafirin gene.

38. The method of claim 27, wherein the sorghum plant or seed exhibits enhanced protein content by at least 20% relative to sorghum plants or seeds without the mutant y-kafirin gene.

Citation Information

Patent Citations

  • Target site editing sequence of targeted plant prolamin K2G gene and application of target site editing sequence

    CN116121296A

  • Genes for improving nutrient uptake and abiotic stress tolerance in plants

    US20160002648A1