Therapy targeting malat1

Targeting m6A-epigenetically marked MALAT1 regions in cancer cells with siRNA and lipid nanoparticles disrupts R-body formation, effectively inhibiting invadopodia and metastasis, providing a targeted therapy for cancer.

WO2025208215A1PCT designated stage Publication Date: 2025-10-09SUNNYBROOK RES INST +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CA2025/050471
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-03
Filing Date
2025-04-02
Publication Date
2025-10-09

AI Technical Summary

Technical Problem

Current pharmacologic targeting of MT1-MMP for cancer metastasis is ineffective and produces significant side effects, while the role of noncoding RNA, such as MALAT1, in invadopodia formation and metastasis remains unexplored.

Method used

Therapeutic targeting of m6A-epigenetically marked MALAT1, specifically at positions 965-1934, 1255-1269, or 1311-1316 of SEQ ID NO.1, using inhibitors like siRNA, prevents R-body formation, disrupting invadopodia and metastasis by inhibiting MALAT1 with a delivery vehicle like lipid nanoparticles.

Benefits of technology

Inhibiting MALAT1 through RNA therapy or small molecules effectively ablates metastatic dynamics by preventing invadopodia formation and cancer cell extravasation, offering a targeted approach with reduced side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CA2025050471_09102025_PF_FP_ABST
    Figure CA2025050471_09102025_PF_FP_ABST
Patent Text Reader

Abstract

There is described herein a combination of an inhibitor of MALAT1 with a delivery vehicle for targeting the inhibitor to the cytoplasm.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] THERAPY TARGETING MALAT1

[0002] CROSS REFERENCE TO RELATES APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application No. 63 / 573989, filed on April 3, 2024, the entirety of which is hereby incorporated by reference.

[0004] FIELD OF THE INVENTION

[0005] The invention relates to cancer treatment, including the targeting of MALAT 1 to prevent metastasis.

[0006] BACKGROUND OF THE INVENTION

[0007] In metastasis, cancer cells acquire various invasive qualities that enable them to pass through layers of extracellular matrix (ECM) and stromal cells in order to intravasate and extravasate through vasculature (1). Invadopodia formation by metastatic cancer cells is crucial during these dynamic manoeuvres around vessel walls. Invadopodia are subcellular protrusions formed by metastatic cancer cells which extend 2-5 pm into extracellular space during cell invasion in vitro and cancer cell extravasation in vivo (2). Mechanical and chemical stimuli often cue invadopodia formation, leading to cancer cell extravasation which precedes metastatic colony formation (3, 4).

[0008] MT1-MMP is a membrane bound protease that plays a significant role in cancer progression due its localization at invadopodia (5). At the invasive front, MT1-MMP is continuously recycled at invadopodia to maintain proteolysis needed for metastasis (6). However, pharmacologic targeting of MT1-MMP is ineffective and produces significant negative side effects (7). Given its central role in invasion and within invadopodia, identifying cancer-specific interactors with MT1-MMP could be more therapeutically effective. Such cancer-specific interactors include noncoding RNA, some of which are already known to be involved in metastasis, i.e., MALAT1 (Metastasis Associated Lung Adenocarcinoma Transcript D (8, 9). Noncoding RNA (ncRNA) is functional due to its secondary structure; this is sequence dependent but also epigenetically regulated, primarily through m6A methylation of adenosine. Moreover, m6A epigenetic RNA modification has been implicated in metastatic progression (10, 11). Aside from ncRNA’s roles in transcriptomic reprogramming, their role in metastasis might also be achieved via interactions with RNA Binding Proteins (RBPs) which is dependent on ncRNA secondary structure. Recent proteomics analysis of invadopodia isolated via laser dissection has revealed that RBPs are a large constituent of invadopodia (60 out of 230 proteins) alongside canonical invadopodia proteins such as cortactin, Arp2 / 3, Tks4 / 5, and vimentin (12). RBPs were speculated to be facilitative for invadopodia-specific translation of proteins. However, an aggregation of RBPs of this magnitude suggests something other than protein translation is involved in invadopodia formation. It is conceivable that specific ncRNA bound to RBPs at invadopodia could have a regulatory role in invadopodia formation. If ncRNA is a linchpin for RPB congregation at invadopodia, it would be a previously untested target for invadopodia inhibition and a straightforward therapy prospect.

[0009] SUMMARY OF THE INVENTION

[0010] There is described herein a therapeutically targetable mechanism that congregates MT1-MMP, RBPs, and m6A epigenetically marked ncRNA to promote invadopodia and metastasis in breast cancer. In short, cancer cells recycle and internalize MT1-MMP which goes onto to form large cytoplasmic bodies composed of several RBPs and RNA. These RNA species were long noncoding RNAs, namely MALAT 1 , which is also known as NEAT2. MALAT1 was previously thought to exert most of its pro-metastatic effects via regulation of transcription. The tight congregation of MALAT1 IncRNA, several RNA binding proteins (hnRNPC, RALY, RBMX, etc.), and MT1-MMP were termed “R-bodies” and through cooperation in the cytoplasm, orchestrated invadopodia formation needed for cancer cell extravasation. Epigenetic marks of m6A on MALAT 1 were the dominant form of MALAT 1 within R-bodies. We subsequently determined that m6A epigenetically marked MALAT1 was essential for R-body formation, which controls invadopodia formation, which in turn regulates cancer cell extravasation. We identified the exact regions of MALAT1 that possess these m6A epigenetic marks that exist in these metastatic cells and these are described below. Therapeutic targeting of m6A, whether via RNA therapy or small molecule approaches, were successful in ablating metastatic dynamics.

[0011] In an aspect, there is provided a combination of an inhibitor of MALAT1 with a delivery vehicle for targeting the inhibitor to the cytoplasm.

[0012] In an aspect, there is provided an inhibitor to MALAT1 , wherein the inhibitor targets positions 965-1934 of SEQ ID No.1. In some embodiments, the inhibitor targets positions 1255-1269 of SEQ ID NO.1., positions 1311-1316 of SEQ ID NO.1 , or positions 1884-1899 of SEQ ID NO.1.

[0013] In an aspect, there is provided a pharmaceutical composition comprising the combination described herein or the inhibitor described herein along with a pharmaceutically acceptable carrier.

[0014] In an aspect, there is provided a method of treating cancer in a patient comprising administering to the patient a therapeutically effective amount of the combination described herein or the inhibitor described herein.

[0015] In an aspect, there is provided a method of preventing cancer metastasis in a patient comprising administering to the patient a therapeutically effective amount of the combination described herein or the inhibitor described herein.

[0016] In an aspect, there is provided the combination described herein or the inhibitor described herein for use in the treatment of cancer or for the prevention of cancer metastasis in a patient.

[0017] In an aspect, there is provided a use of the combination described herein or the inhibitor described herein, in the manufacture of a medicament for the treatment of cancer or for the prevention of cancer metastasis in a patient.

[0018] BRIEF DESCRIPTION OF FIGURES

[0019] These and other features of the preferred embodiments of the invention will become more apparent in the following detailed description in which reference is made to the appended drawings wherein: Figure 1: MT1-MMP Associates with RNA Binding Proteins and RNA to Assemble “R-Bodies” in the Cytoplasm of Metastatic Breast Cancer Cells. A) Immunofluorescence detection of MT1-MMP (cyan), cytoskeleton (red), and Hoechst (blue) in b1 integrin activated cells (upper panel) reveals formation of extra-nuclear “R- bodies” (arrowhead). B) siMT1-MMP knockdown in integrin activated cells results in a loss of extra-nuclear bodies (arrowheads). C) Volcano plot for mass spectrometry analysis of immunoprecipitates with anti-MT1-MMP mAb from integrin-activated or control cells. D) Principal component analysis. E) GO analysis of high avidity protein partners. F) Ontology analysis reveals that RBPs such as hnRPNC, RALY, RMBX, SRRM2, and PNN in a tight protein binding network. G) Co-Immunoprecipitation with anti-MT1-MMP mAb followed by immunoblot analysis for RALY and hnRPNC protein levels. H-J) Immunofluorescence detection of R-bodies in integrin-activated metastatic breast cancer cells (arrowheads) by various staining methods: (H) RNA (green), hnRNPC (red), MT1-MMP (cyan); (I) RNA (green), hnRNPC (red), RALY (cyan); (J) RNA (green), MT1-MMP (red), RALY (cyan). K) Quantification of cytoplasmic bodies following b1 activation, ‘denotes p<0.05 over control IgG treated cells. For micrographs, scale bar = 10 pm.

[0020] Figure 2: RBPs and MALAT IncRNA are Required for “R-body” Formation, Functional Invadopodia, and Cancer Cell Extravasation in Metastatic Breast Cancer Cells. A) Confocal microscopy on invadopodia formation (green signal represents gelatin, dark voids represent degradation by invadopodia) following sihnRNPC treatment. White square=inset image. Scale bar=10 pm. B) Quantification of Cellular invasion following downregulation of hnRNPC. Percent of cells extravasated (C) and metastatic colony formation (D). E) Left; Immunoblot of hnRNPC immunoprecipitation using aMT1-MMP in conjunction with Benzonase (RNAase) treatment. Right; Quantification of the bands after normalization to input. F) Whole chromosome view of RIP sequencing indicating MALAT1 and RNVU1 signals. Relative position of the peak is indicated by the grey diagram of the chromosome above. G) Zoomed-in view of the MALAT1 locus with adjacent genes indicated. H) aMT1-MMP RIP qPCR for MALAT 1 . Amplified region is indicated by the black bar. I) MALAT 1 RNA FISH showing overlap with hnRNPC and RALY. J) Confocal image following KD of MALAT1 indicating its effect on invadopodia formation. MAL1=MALAT1 , CON=Control scrambled. K) Intravital image quantification of cells following extravasation (K) and metastatic colony formation (M). L) Quantification of cells forming invadopodia following siMALI treatment. aE7 and aG11 indicates control and b1 activation respectively.

[0021] Figure 3: m6A Epigenetically Regulates MALAT1 and its Incorporation into R- Bodies. A) m6A RIPseq showing MALAT1 region Chr11 :65499975-65500875. Reads were normalized to FPKM and input subtracted. Cancer cell lines: PC3 and V16A. B) Diagram depicting the region in (A) as secondary structure plotted using RNAfold. Arrows point to M6A methylation site (Red: DRA*CH) and hnRNPC site (blue). Cytoplasmic meRIP-qPCR (C) for MALAT1 and following shRNA KD of GFP, METTL3, and ALKBH5. Black horizontal bar below gene diagram (green) represents the approximate region amplified. Bars to the right of dashed line (D and E) indicates treatment with activating antibody. E) Cytoplasmic MT1-MMP RIP qPCR for MALAT1. F) Representative confocal fluorescence microscope images of hnRNPC and RALY localization following shRNA knockdown of GFP (control), METTL3 and ALKBH5. Scale bar = 10 pm. G) Quantification of cytoplasmic bodies consisting of hnRNPC / RALY (G) and invadopodia formation (I) following KD of METTL3 / ALKBH5. H) Representative confocal images of invadopodia formation following KD of METTL3 / ALKBH5. Intravital imaging quantification of cancer cell extravasation (J) and metastatic colony formation (K) after KD of METTL3. Extravasation efficiency is presented as the percentage of cells that extravasated at t=24 h ±SEM. For F-H), all conditions represent b1 activated state.

[0022] Figure 4: RNA Therapy for Targeting MALAT1 Abrogates Cancer Cell Extravasation and Metastasis Dynamics. A) Schematic of RNA therapy for targeting MALAT1. Lipid nanoparticles with porphyrin label containing cargo with siRNA for MALAT1 (siMAL) with or without a 6-FAM fluorescent label. B) RIP qPCR for MALAT1 in nuclear extracts reveals no changes in nuclear MALAT1 levels but decreases in cytoplasmic levels of MALAT 1 IncRNA. Red-bar on diagram indicates position of siRNA. (C). -25 denotes 25 pg / chick embryo, -50 denotes 50 pg / embryo. D) Internalization of lipid nanoparticles (LNPs) carrying siCON or siMAL that both possess the 6-FAM fluorescent label. E) In vitro imaging of LNP pre-loaded cells (siRNA - green signal; LNPs - red signal; nuclei - cyan signal) that arrested within the capillary bed prior to extravasation. Intravital imaging of LNP pre-loaded cells with siCON (F) and siMAL (G) reveals increase in siRNA signal within the cytoplasm over time. RNA therapy with LNP:siMAL or LNP:siCON reveals significant internalization and surface binding (H), resulting in inhibition on cancer cell extravasation rates (I), and metastatic colony formation (J), ‘denotes p<0.05. K) Intravital imaging of LNPs on the surface and within the cytoplasm of cells, demonstrating uptake of LNPs within 1 hour of injection.

[0023] Figure 5: Pharmacologic and Genetic Targeting of METTL3 Abrogates Cancer Cell Extravasation and Metastasis Dynamics. A) Cytoplasmic meRIP qPCR of MALAT1 following 48 hr treatment with 10 pM of SMT2457 drug. E7: control (red), G11 : b1 activating (blue) antibodies. B) Cytoplasmic MT1-MMP-RIP qPCR of MALAT1 following treatment with STM2457. Quantitation of R-bodies (C) and invadopodia (D) in STM2457 treated cells. Intravital imaging for quantitation of cancer cell extravasation rates (E) and metastatic colony formation (F) in STM2457. G) Model of R-body formation prior and during integrin activation and its subsequent impact on invadopodia formation and metastasis dynamics.

[0024] Figure 6 shows MALAT 1 mRNA annotation.

[0025] Figure 7: Total RIPseq Analysis with m6A Antibody on MALAT1. Analysis of PC3 and V16A cell lines with a focus on immunoprecipitated MALAT1 IncRNA. This figure corresponds to Fig. 3A. Red shaded region contains the m6A and hnRNPC binding sites..

[0026] Figure 8 Secondary Structure of MALAT1. Secondary structure analysis of the broad peak region encompassing the m6A methylation site and hnRNPC binding site. This figure corresponds to Fig. 3B. Shaded region (grey box) indicates m6A site and hnRNPC binding site.

[0027] Figure 9 M6A Deletion Abrogates R-body Formation and Invadopodia. Shows the deletion of M6A and it’s consequence. A) Confirmation of the 300bp deletion in the mutant strains compared to WT. B) Pictorial representation of the M6A deletion on MALAT1. C) RNA immunoprecipitation of the MT1-MMP14 protein followed by QPCR for MALAT 1 of MDA-231 cells treated with control antibody (E7), MDA-231 cells treated with activating antibody G11 and the MALAT1-M6A deleted cell lines (1G4 and 1 F4). D) Same as (C) but immunoprecipitated using hnRNPC. E) Left - R-body formation and detection in the cytoplasm of MDA-231 cells in WT or the MALAT1-M6A deleted cell lines (1G4 and 1 F4). Right- Confocal microscopy image showing a representation of R- body formation in the WT and the lack of in the mutant cell lines. F) Left - Percent of cells forming invadopodia in WT and the mutant cell lines. Right - Confocal microscopy image showing a representation of invadopodia formation in the WT and the lack of in the mutant cell lines.

[0028] DETAILED DESCRIPTION

[0029] In the following description, numerous specific details are set forth to provide a thorough understanding of the invention. However, it is understood that the invention may be practiced without these specific details.

[0030] Metastatic cancer cells form invadopodia which physically mediate cancer cell extravasation but their “call to action” mechanisms during metastasis were unclear until now. Here, we show that MT1-MMP, an invadopodia specific protease, forms large cytoplasmic complexes with RNA and RNA binding proteins called “R-bodies”. m6A- epigenetically marked MALAT 1 was exclusively found in the R-bodies. Depletion of any component of R-bodies and inhibition of m6A epigenetic marking of MALAT 1 halted R-body formation. This subsequently disabled invadopodia formation, culminating in major losses of cancer cell extravasation rates. Pharmacologic targeting of METTL3 and RNA therapy against m6A-MALAT1 abrogated metastasis. In summary, invadopodia requires RNA and RNA binding proteins to form R-bodies within the cytoplasm. m6A epigenetic regulation of R-bodies is required for cancer cell extravasation which dictates metastasis dynamics.

[0031] In an aspect, there is provided a combination of an inhibitor of MALAT1 with a delivery vehicle for targeting the inhibitor to the cytoplasm.

[0032] R-bodies reside in the cytoplasm and promote their effects on cancer cell extravasation. Advantageously therefore, in some embodiments, the formation of RNA, RNA binding proteins, MT1-MMP, and other components of R-bodies is prevented. Inhibition of R- bodies with this approach can inhibit cancer cell extravasation, which is a key step of the cancer metastatic cascade.

[0033] MALAT1 (metastasis associated lung adenocarcinoma transcript 1) also known as NEAT2 (noncoding nuclear-enriched abundant transcript 2) is a large, infrequently spliced non-coding RNA, which is highly conserved amongst mammals and highly expressed in the nucleus.

[0034] In some embodiments, the inhibitor is an antisense oligonucleotide, siRNA, miRNA or shRNA. Preferably, the inhibitor is an siRNA. In some embodiments, the MALAT1 has SEQ ID NO. 1 :

[0035] AGGCATTGAGGCAGCCAGCGCAGGGGCTTCTGCTGAGGGGGCAGGCGGAGCTT GAGGAAACCGCAGATAAGTTTTTTTCTCTTTGAAAGATAGAGATTAATACAACTAC TTAAAAAATATAGTCAATAGGTTACTAAGATATTGCTTAGCGTTAAGTTTTTAACGT AATTTTAATAGCTTAAGATTTTAAGAGAAAATATGAAGACTTAGAAGAGTAGCATG AGG AAG G AAAAG ATAAAAG GTTTCTAAAACATG ACG G AG GTTG AG ATG AAG CTTC TTCATGGAGTAAAAAATGTATTTAAAAGAAAATTGAGAGAAAGGACTACAGAGCCC CGAATTAATACCAATAGAAGGGCAATGCTTTTAGATTAAAATGAAGGTGACTTAAA CAGCTTAAAGTTTAGTTTAAAAGTTGTAGGTGATTAAAATAATTTGAAGGCGATCTT TTAAAAAGAGATTAAACCGAAGGTGATTAAAAGACCTTGAAATCCATGACGCAGG GAGAATTGCGTCATTTAAAGCCTAGTTAACGCATTTACTAAACGCAGACGAAAATG GAAAGATTAATTGGGAGTGGTAGGATGAAACAATTTGGAGAAGATAGAAGTTTGA AGTG G AAAACTG G AAG ACAG AAGTACG GG AAG GCG AAG AAAAG AATAG AG AAG A TAGGGAAATTAGAAGATAAAAACATACTTTTAGAAGAAAAAAGATAAATTTAAACCT GAAAAGTAGGAAGCAGAAGAAAAAAGACAAGCTAGGAAACAAAAAGCTAAGGGC AAAATGTACAAACTTAGAAGAAAATTGGAAGATAGAAACAAGATAGAAAATGAAAA TATTGTCAAGAGTTTCAGATAGAAAATGAAAAACAAGCTAAGACAAGTATTGGAGA AGTATAGAAGATAGAAAAATATAAAGCCAAAAATTGGATAAAATAGCACTGAAAAA ATGAGGAAATTATTGGTAACCAATTTATTTTAAAAGCCCATCAATTTAATTTCTGGT GGTGCAGAAGTTAGAAGGTAAAGCTTGAGAAGATGAGGGTGTTTACGTAGACCA GAACCAATTTAGAAGAATACTTGAAGCTAGAAGGGGAAGTTGGTTAAAAATCACAT CAAAAAGCTACTAAAAGGACTGGTGTAATTTAAAAAAAACTAAGGCAGAAGGCTTT TGGAAGAGTTAGAAGAATTTGGAAGGCCTTAAATATAGTAGCTTAGTTTGAAAAAT GTGAAGGACTTTCGTAACGGAAGTAATTCAAGATCAAGAGTAATTACCAACTTAAT GTTTTTGCATTGGACTTTGAGTTAAGATTATTTTTTAAATCCTGAGGACTAGCATTA ATTGACAGCTGACCCAGGTGCTACACAGAAGTGGATTCAGTGAATCTAGGAAGAC AGCAGCAGACAGGATTCCAGGAACCAGTGTTTGATGAAGCTAGGACTGAGGAGC AAGCGAGCAAGCAGCAGTTCGTGGTGAAGATAGGAAAAGAGTCCAGGAGCCAGT GCGATTTGGTGAAGGAAGCTAGGAAGAAGGAAGGAGCGCTAACGATTTGGTGGT GAAGCTAGGAAAAAGGATTCCAGGAAGGAGCGAGTGCAATTTGGTGATGAAGGT AGCAGGCGGCTTGGCTTGGCAACCACACGGAGGAGGCGAGCAGGCGTTGTGCG TAG AG G ATCCTAG ACCAG CATG CCAGTGTGCCAAGG CCACAGG G AAAGCG AGTG GTTGGTAAAAATCCGTGAGGTCGGCAATATGTTGTTTTTCTGGAACTTACTTATGG

[0036] TAACCTTTTATTTATTTTCTAATATAATGGGGGAGTTTCGTACTGAGGTGTAAAGG GATTTATATGGGGACGTAGGCCGATTTCCGGGTGTTGTAGGTTTCTCTTTTTCAG GCTTATACTCATGAATCTTGTCTGAAGCTTTTGAGGGCAGACTGCCAAGTCCTGG AGAAATAGTAGATGGCAAGTTTGTGGGTTTTTTTTTTTTACACGAATTTGAGGAAA ACCAAATGAATTTGATAGCCAAATTGAGACAATTTCAGCAAATCTGTAAGCAGTTT GTATGTTTAGTTGGGGTAATGAAGTATTTCAGTTTTGTGAATAGATGACCTGTTTTT ACTTCCTCACCCTGAATTCGTTTTGTAAATGTAGAGTTTGGATGTGTAACTGAGGC GGGGGGGAGTTTTCAGTATTTTTTTTTGTGGGGGTGGGGGCAAAATATGTTTTCA GTTCTTTTTCCCTTAG GTCTGTCTAG AATCCTAAAGG CAAATG ACTCAAG GTGTAA CAG AAAAC AAG AAAATCCAATATCAG G ATAATCAG ACCACC ACAG GTTTACAGTTT ATAGAAACTAGAGCAGTTCTCACGTTGAGGTCTGTGGAAGAGATGTCCATTGGAG AAATGGCTGGTAGTTACTCTTTTTTCCCCCCACCCCCTTAATCAGACTTTAAAAGT GCTTAACCCCTTAAACTTGTTATTTTTTACTTGAAGCATTTTGGGATGGTCTTAACA GGGAAGAGAGAGGGTGGGGGAGAAAATGTTTTTTTCTAAGATTTTCCACAGATGC TATAGTACTATTGACAAACTGGGTTAGAGAAGGAGTGTACCGCTGTGCTGTTGGC ACG AACACCTTCAG G G ACTG G AG CTG CTTTTATCCTTG G AAG AGTATTCCCAGTT GAAGCTGAAAAGTACAGCACAGTGCAGCTTTGGTTCATATTCAGTCATCTCAGGA GAACTTCAGAAGAGCTTGAGTAGGCCAAATGTTGAAGTTAAGTTTTCCAATAATGT GACTTCTTAAAAGTTTTATTAAAGGGGAGGGGCAAATATTGGCAATTAGTTGGCA GTGGCCTGTTACGGTTGGGATTGGTGGGGTGGGTTTAGGTAATTGTTTAGTTTAT GATTGCAGATAAACTCATGCCAGAGAACTTAAAGTCTTAGAATGGAAAAAGTAAAG AAATATCAACTTCCAAGTTGGCAAGTAACTCCCAATGATTTAGTTTTTTTCCCCCC AGTTTGAATTGGGAAGCTGGGGGAAGTTAAATATGAGCCACTGGGTGTACCAGT GCATTAATTTGGGCAAGGAAAGTGTCATAATTTGATACTGTATCTGTTTTCCTTCA AAGTATAGAGCTTTTGGGGAAGGAAAGTATTGAACTGGGGGTTGGTCTGGCCTAC TGGGCTGACATTAACTACAATTATGGGAAATGCAAAAGTTGTTTGGATATGGTAGT GTGTGGTTCTCTTTTGGAATTTTTTTCAGGTGATTTAATAATAATTTAAAACTACTAT AGAAACTGCAGAGCAAAGGAAGTGGCTTAATGATCCTGAAGGGATTTCTTCTGAT GGTAGCTTTTGTATTATCAAGTAAGATTCTATTTTCAGTTGTGTGTAAGCAAGTTTT TTTTTAGTGTAGGAGAAATACTTTTCCATTGTTTAACTGCAAAACAAGATGTTAAGG

[0037] TATGCTTCAAAAATTTTGTAAATTGTTTATTTTAAACTTATCTGTTTGTAAATTGTAA CTGATTAAGAATTGTGATAGTTCAGCTTGAATGTCTCTTAGAGGGTGGGCTTTTGT TGATGAGGGAGGGGAAACTTTTTTTTTTTCTATAGACTTTTTTCAGATAACATCTTC TGAGTCATAACCAGCCTGGCAGTATGATGGCCTAGATGCAGAGAAAACAGCTCCT TGGTGAATTGATAAGTAAAGGCAGAAAAGATTATATGTCATACCTCCATTGGGGAA TAAGCATAACCCTGAGATTCTTACTACTGATGAGAACATTATCTGCATATGCCAAA AAATTTTAAG CAAATG AAAG CTACCAATTTAAAGTTACG G AATCTACCATTTTAAAG TTAATTGCTTGTCAAGCTATAACCACAAAAATAATGAATTGATGAGAAATACAATGA AG AGG CAATGTCCATCTCAAAATACTG CTTTTACAAAAG CAG AATAAAAG CG AAAA GAAATGAAAATGTTACACTACATTAATCCTGGAATAAAAGAAGCCGAAATAAATGA GAGATGAGTTGGGATCAAGTGGATTGAGGAGGCTGTGCTGTGTGCCAATGTTTC GTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGG GAG CAG AAAACAG CAGG CAG CTGTTAACAG ATAAGTTTAACTTG CATCTG CAGTA TTGCATGTTAGGGATAAGTGCTTATTTTTAAGAGCTGTGGAGTTCTTAAATATCAA CCATGGCACTTTCTCCTGACCCCTTCCCTAGGGGATTTCAGGATTGAGAAATTTTT CCATCGAGCCTTTTTAAAATTGTAGGACTTGTTCCTGTGGGCTTCAGTGATGGGA TAGTACACTTCACTCAGAGGCATTTGCATCTTTAAATAATTTCTTAAAAGCCTCTAA AGTGATCAGTGCCTTGATGCCAACTAAGGAAATTTGTTTAGCATTGAATCTCTGAA GGCTCTATGAAAGGAATAGCATGATGTGCTGTTAGAATCAGATGTTACTGCTAAAA TTTACATGTTGTGATGTAAATTGTGTAGAAAACCATTAAATCATTCAAAATAATAAA CTATTTTTATTAGAGAATGTATACTTTTAGAAAGCTGTCTCCTTATTTAAATAAAATA GTGTTTGTCTGTAGTTCAGTGTTGGGGCAATCTTGGGGGGGATTCTTCTCTAATC TTTCAGAAACTTTGTCTGCGAACACTCTTTAATGGACCAGATCAGGATTTGAGCG G AAG AACG AATGTAACTTTAAG G CAG G AAAG ACAAATTTTATTCTTCATAAAGTG A TG AG CATATAATAATTCCAG GCACATG G CAATAG AG GCCCTCTAAATAAG G AATA AATAACCTCTTAGACAGGTGGGAGATTATGATCAGAGTAAAAGGTAATTACACATT TTATTTCCAGAAAGTCAGGGGTCTATAAATTGACAGTGATTAGAGTAATACTTTTT CACATTTCCAAAGTTTGCATGTTAACTTTAAATGCTTACAATCTTAGAGTGGTAGG CAATGTTTTACACTATTGACCTTATATAGGGAAGGGAGGGGGTGCCTGTGGGGTT TTAAAGAATTTTCCTTTGCAGAGGCATTTCATCCTTCATGAAGCCATTCAGGATTTT GAATTGCATATGAGTGCTTGGCTCTTCCTTCTGTTCTAGTGAGTGTATGAGACCTT GCAGTG AGTTTATCAG CATACTCAAAATTTTTTTCCTG G AATTTG GAG G G ATG G GA GGAGGGGGTGGGGCTTACTTGTTGTAGCTTTTTTTTTTTTTACAGACTTCACAGAG AATGCAGTTGTCTTGACTTCAGGTCTGTCTGTTCTGTTGGCAAGTAAATGCAGTAC TGTTCTGATCCCGCTGCTATTAGAATGCATTGTGAAACGACTGGAGTATGATTAAA AGTTGTGTTCCCCAATGCTTGGAGTAGTGATTGTTGAAGGAAAAAATCCAGCTGA GTGATAAAGGCTGAGTGTTGAGGAAATTTCTGCAGTTTTAAGCAGTCGTATTTGTG ATTGAAGCTGAGTACATTTTGCTGGTGTATTTTTAGGTAAAATGCTTTTTGTTCATT TCTGGTGGTGGGAGGGGACTGAAGCCTTTAGTCTTTTCCAGATGCAACCTTAAAA TCAGTG ACAAG AAACATTCCAAACAAG CAACAGTCTTCAAG AAATTAAACTG G CAA GTGGAAATGTTTAAACAGTTCAGTGATCTTTAGTGCATTGTTTATGTGTGGGTTTC TCTCTCCCCTCCCTTGGTCTTAATTCTTACATGCAGGAACACTCAGCAGACACAC GTATGCGAAGGGCCAGAGAAGCCAGACCCAGTAAGAAAAAATAGCCTATTTACTT TAAATAAACCAAACATTCCATTTTAAATGTGGGGATTGGGAACCACTAGTTCTTTC AGATGGTATTCTTCAGACTATAGAAGGAGCTTCCAGTTGAATTCACCAGTGGACA AAATGAGGAAAACAGGTGAACAAGCTTTTTCTGTATTTACATACAAAGTCAGATCA GTTATGGGACAATAGTATTGAATAGATTTCAGCTTTATGCTGGAGTAACTGGCATG TGAGCAAACTGTGTTGGCGTGGGGGTGGAGGGGTGAGGTGGGCGCTAAGCCTT TTTTTAAGATTTTTCAGGTACCCCTCACTAAAGGCACCGAAGGCTTAAAGTAGGAC AACC ATGG AGCCTTCCTGTG G CAG G AG AG ACAAC AAAG CGCTATTATCCTAAG GT CAAGAGAAGTGTCAGCCTCACCTGATTTTTATTAGTAATGAGGACTTGCCTCAACT CCCTCTTTCTGGAGTGAAGCATCCGAAGGAATGCTTGAAGTACCCCTGGGCTTCT CTT AAC ATTTAAG C AAG CTG TTTTT AT AG CAG CTCTT AAT AAT AAAG C CC AAATCTC AAGCGGTGCTTGAAGGGGAGGGAAAGGGGGAAAGCGGGCAACCACTTTTCCCT AGCTTTTCCAGAAGCCTGTTAAAAGCAAGGTCTCCCCACAAGCAACTTCTCTGCC ACATCGCCACCCCGTGCCTTTTGATCTAGCACAGACCCTTCACCCCTCACCTCGA TGCAGCCAGTAGCTTGGATCCTTGTGGGCATGATCCATAATCGGTTTCAAGGTAA CGATGGTGTCGAGGTCTTTGGTGGGTTGAACTATGTTAGAAAAGGCCATTAATTT GCCTGCAAATTGTTAACAGAAGGGTATTAAAACCACAGCTAAGTAGCTCTATTATA ATACTTATCCAGTGACTAAAACCAACTTAAACCAGTAAGTGGAGAAATAACATGTT CAAGAACTGTAATGCTGGGTGGGAACATGTAACTTGTAGACTGGAGAAGATAGGC ATTTG AGTGG CTG AG AG GG CTTTTG G GTG G G AATGCAAAAATTCTCTGCTAAG AC TTTTTCAGGTGAACATAACAGACTTGGCCAAGCTAGCATCTTAGCGGAAGCTGAT CTCCAATGCTCTTCAGTAGGGTCATGAAGGTTTTTCTTTTCCTGAGAAAACAACAC GTATTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTTTCTAGCTTAAAAAAAAAAAAAG CAAAA (SEQ ID NO.1)

[0038] In some embodiments, the inhibitor targets regions of MALAT1 with adenosine methylation potential.

[0039] The M6A peak is at positions 965-1934 of SEQ ID NO. 1. The DRACH methylation site is at positions 1255-1269 of SEQ ID NO.1. The hnRNPC binding site is at positions 131 1-1316 of SEQ ID NO.1. The siRNA binding site is at positions 1884-1899 of SEQ ID NO.1. Accordingly, in some embodiments, the inhibitor targets positions 965-1934 of SEQ ID NO.1. Preferably, the inhibitor targets positions 1255-1269 of SEQ ID NO.1 ; positions 1311-1316 of SEQ ID NO.1 ; or positions 1884-1899 of SEQ ID NO.1.

[0040] In some embodiments, the inhibitor is 5' GGCUUAUACUCAUGAAUCUtt 3' (SEQ ID NO. 2).

[0041] In some embodiments, the delivery vehicle is a lipid nanoparticle. Lipid nanoparticles are described in the art and may be suitable for use in the presently claimed combination. Lipid nanoparticles (LNPs) are nanoparticles composed of lipids and typically spherical with an average diameter between 10 and 1000 nanometers. Solid lipid nanoparticles possess a solid lipid core matrix that can solubilize lipophilic molecules. The lipid core may be stabilized by surfactants (emulsifiers). The emulsifier used depends on administration routes and is more limited for parenteral administrations. The term lipid is used herein in a broader sense and includes triglycerides (e.g. tristearin), diglycerides (e.g. glycerol bahenate), monoglycerides (e.g. glycerol monostearate), fatty acids (e.g. stearic acid), steroids (e.g. cholesterol), and waxes (e.g. cetyl palmitate). Preferably LNPs can contain porphyrin, such as those described in U.S. Provisional Patent Application No. 63 / 445773, which is incorporated herein in its entirety.

[0042] Preferably, the lipid nanoparticle is a porphyrin-lipid nanoparticle.

[0043] In some embodiments, the porphyrin lipid nanoparticle comprises DLin-MC3-DMA, Porphyrin-lipid, cholesterol, and DMG-PEG2000.

[0044] In some embodiments, the combination is in combination further with a METTL3 inhibitor.

[0045] In an aspect, there is provided an inhibitor to MALAT1 , wherein the inhibitor targets positions 965-1934 of SEQ ID No.1. In some embodiments, the inhibitor targets positions 1255-1269 of SEQ ID NO.1., positions 1311-1316 of SEQ ID NO.1 , or positions 1884-1899 of SEQ ID NO.1.

[0046] In some embodiments, the inhibitor is 5' GGCUUAUACUCAUGAAUCUtt 3' (SEQ ID NO. 2). In an aspect, there is provided a pharmaceutical composition comprising the combination described herein or the inhibitor described herein along with a pharmaceutically acceptable carrier.

[0047] As used herein, “pharmaceutically acceptable carrier1' means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the pharmacological agent.

[0048] In an aspect, there is provided a method of treating cancer in a patient comprising administering to the patient a therapeutically effective amount of the combination described herein or the inhibitor described herein.

[0049] As used herein, “therapeutically effective amount' refers to an amount effective, at dosages and for a particular period of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount of the pharmacological agent may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the pharmacological agent to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the pharmacological agent are outweighed by the therapeutically beneficial effects.

[0050] In an aspect, there is provided a method of preventing cancer metastasis in a patient comprising administering to the patient a therapeutically effective amount of the combination described herein or the inhibitor described herein.

[0051] In an aspect, there is provided the combination described herein or the inhibitor described herein for use in the treatment of cancer or for the prevention of cancer metastasis in a patient. In an aspect, there is provided a use of the combination described herein or the inhibitor described herein, in the manufacture of a medicament for the treatment of cancer or for the prevention of cancer metastasis in a patient.

[0052] The advantages of the present invention are further illustrated by the following examples. The examples and their particular details set forth herein are presented for illustration only and should not be construed as a limitation on the claims of the present invention.

[0053] EXAMPLES

[0054] MATERIALS & METHODS

[0055] Reagents

[0056] Reagents and chemicals were purchased from Sigma-Aldrich Co. (St. Louis, MO) or Fisher Scientific Ltd. (Nepean, ON, Canada) unless otherwise indicated. Antibodies to the following proteins were obtained from the indicated suppliers: MT1-MMP (ab51074; Abeam, Toronto, Canada); P4G11 pi Integrin, E7-s (Developmental Systems Hybridoma Bank, Iowa City, IA); RALY (PA5-83671 ; Thermo Fisher Scientific; Nepean, ON); hnRNPC1 / C2 (4F4) (sc-32308; Santa Cruz Biotechnology; Santa Cruz, CA); m6A (ab151230; Abeam, Toronto, Canada). All fluorescently labeled secondary antibodies, Hoechst 33342, Alexa Fluor 594-conjugated phalloidin, and SYTO RNASelect green fluorescent cell stain were purchased from Life Technologies (Mississauga, ON, Canada). The pre-designed MALAT 1 ViewRNA Cell Plus probe set was purchased from Thermo Fisher Scientific (VA6-14180-VCP). HnRNPC, RALY, MALAT1 , and control siRNA were purchased from Thermo Fisher Scientific (s6719, S22655, n511399, 4390843, respectively). METTL3, ALKBH5, and GFP shRNA were constructed using the pLKO.1 plasmid backbone. STM2457 was purchased from MedChemExpress (HY- 134836) and reconstituted in DMSO at 10 mM concentration. Cell Culture and Transfection

[0057] MDA-MB-231 cells were obtained from the American Type Culture Collection (Manassas, A) and cultured in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. Growth conditions were 37°C with humidity and 5% CO2. Cells were lifted using 5 mM EDTA / PBS (pH 7.4). Cells were plated in serum-free DMEM for 16 h prior to plating onto 0.2%-gelatin-coated coverslips or culture plates in serum-free medium. Cells were treated with P4G11 (10 mg / mL) where indicated. Control conditions for all experiments were cells treated with the same concentration of a nonspecific IgG (E7-s). Cells were transfected using jetPRIME Polyplus (VWR International) according to the protocol of the manufacturer. All transiently transfected constructs were expressed for 72 h. A zsGreen- MDA-MB-231 stable cell line was generated by transduction with zsGreen encoding lentivirus. Cells were continuously selected using puromycin to maintain expression.

[0058] Immunoprecipitation

[0059] Immunoprecipitation was performed as described previously (6). Antibodies were coupled to protein G Dynabeads (Invitrogen) according to the manufacturer’s instructions. Cells were lysed in situ with cold RIPA buffer (150 mM NaCI, 2 mM EDTA, 1% sodium deoxycholate, 0.1% SDS, 1% Triton X-100, 10% glycerol, 50 mM HEPES, pH 7.5) containing protease inhibitor cocktail, and lysate was incubated with antibodybound Dynabeads overnight at 4°C, then washed three times with ice-cold PBS. Proteins bound to the beads were eluted with 2.5* Laemmli loading buffer heated to 95°C. Immunoprecipitates were separated using SDS-PAGE and analyzed by western blot.

[0060] Boyden Chamber Invasion Assay

[0061] Cell culture inserts were prepared as described previously (32). Briefly, the bottoms of transwell inserts (8 mm pore diameter, Corning Inc.) were coated with 20 mg / mL fibronectin / PBS. The top of the chamber was coated with 0.125 mg / mL growth factor- reduced Matrigel (Corning). MDA-MB-231 cells were serum-starved for 24 h, lifted, seeded into chambers with simultaneous antibody treatment, and allowed to migrate for 20 h. The cells that invaded towards the lower chamber (10% FBS / 0.1% BSA in DMEM) were fixed in 4% paraformaldehyde, stained with Hoechst for nuclear visualization, and counted. Cells that did not migrate through the membrane were removed with a cotton swab prior to fixation. Ten fields of cells per membrane were counted per treatment. Data is presented as percent of control.

[0062] Invadopodia In Vitro Formation Assay

[0063] Invadopodium formation was performed as described previously (32). Glass coverslips were coated with 50 mg / mL poly-L-lysine / PBS, followed by 0.5% glutaraldehyde / PBS. Coverslips were then inverted onto a 70 mL drop of Alexa Fluor 488-labeled gelatin (Thermo Fisher Scientific). The coverslips were then incubated with 5 mg / mL sodium borohydride (Sigma-Aldrich) and then washed extensively in PBS. Tissue culture plates were coated similarly, with the exception being that 0.2% unlabelled gelatin / PBS was used. Cells were plated onto coverslips at 50% confluency and incubated for 4 h. Cells were fixed, permeabilized, and stained for an invadopodia marker (e.g. F-actin). Invadopodia were counted as spots of gelatin degradation overlayed by F-actin punctae as visualized by epifluorescence microscopy. Fifty cells per coverslip per treatment were scored for their ability to form invadopodia. Image processing and analysis was carried out using Imaged software (National Institutes of Health). In cases of uneven background illumination, the “Subtract background” plugin was run with a rolling ball radius of 50.0 pixels.

[0064] Confocal Immunofluorescence Microscopy

[0065] Cells were serum-starved overnight and plated for 4 hrs onto 0.2% gelatin-coated glass coverslips (as described in “Invadopodia Formation Assay”). Cells were fixed in 4% formalin (ACP Chemicals) and then washed in 150 mM glycine / PBS. Cells were permeabilized in 0.1% Triton X-100 / PBS and blocked in 5% (w / v) BSA / PBS prior to antibody staining. Samples were imaged using a Nikon Fast A1 R upright confocal microscope. Images were captured using Nikon confocal software, and image processing and analysis was done using Imaged software (National Institutes of Health, Bethesda, MD). The ViewRNA Cell Plus Assay kit (Thermo Fisher Scientific) was used for simultaneous fluorescent in situ hybridization (FISH) and immunofluorescent staining, according to the protocol of the manufacturer.

[0066] Immunoprecipitation

[0067] Antibodies were coupled to protein G Dynabeads (Invitrogen) according to the manufacturer’s instructions. Cells were lysed in situ with cold RIPA buffer (20 mM Tris- HCI [pH 7.4], 150 mM NaCI, 0.1% SDS, 1% Triton X-100, 1% Deoxycholate, 1% NP40) with 1x protease inhibitor cocktail (Thermo Fisher Scientific). Lysate was incubated with antibody-bound Dynabeads overnight at 4°C, then washed three times with ice-cold PBS. Proteins bound to the beads were eluted with 2x Laemmli loading buffer (BioRad) heated to 95°C. Immunoprecipitates were separated using SDS-PAGE and analyzed by Western Blot.

[0068] Cytoplasmic RNA Immunoprecipitation and Sequencing

[0069] Cytoplasmic protocol was derived from previously described RNA immunoprecipitation protocol (27). MDA-231 cells were grown to 80% confluency on two 10 cm plates. Cells were then crosslinked by adding formaldehyde to a final concentration of 1% for 10 min with gentle shaking. Cells were washed 3X with ice-cold PBS and was lysed in 1 mL cytoplasmic lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCI, 1 mM EDTA, 10% glycerol, 0.5% NP-40 / lgepal CA-630 and 0.25% Triton X-100) supplemented with complete EDTA-free proteinase inhibitor cocktail (Thermo) and RNase inhibitors (Thermo Fisher Scientific, am2694). The lysate was incubated on at 4C for 20 mins followed by shearing using 18G needle 3 times. The nuclear pellet was removed by centrifugation at 2000 x g’s at 4°C for 5 min. Retain supernatant and repeat spin once more leaving 100 pL behind. Lysate was sonicated 8 times using the Bioruptor sonicator at 30 sec ON and 30 sec OFF setting. 10% (vol / vol) Triton X-100 was added to the lysate and then clarified by centrifugation at 20,000 g’s for 10 min at 4°C. 50 pL of the lysate was set aside as input. 1.5 mg of Protein-G magnetic beads were blocked using 5% BSA and conjugated to antibody (Thermo Fisher Scientific: Dynabeads 10003D) for 2 hrs at room temperature using standard protocol. Cytoplasmic lysates were divided in two (IP with specific antibody and IgG using mock antibody) and incubated with preconjugated magnetic beads overnight at 4°C. Beads were washed one time each in: 1 mL of cytoplasmic lysis buffer, wash buffer I (50 mM HEPES-KOH pH 7.5, 140 mM NaCI, 1 mM EDTA, 10% glycerol, 0.5% NP-40 / lgepal CA-630 and 0.25% Triton X-100), wash buffer II (50 mM HEPES-KOH pH 7.5, 300 mM NaCI, 1 mM EDTA, 10% glycerol, 0.5% NP-40 / lgepal CA-630 and 0.25% Triton X-100), and 3 times in wash buffer III (50 mM HEPES pH 7.6, 1 mM EDTA, 0.7% (wt / vol) sodium deoxycholate, 1% NP-40 and 0.5 M LiCI) and 1X TE pH 7. Beads were eluted twice in 75 pL of RIP elution buffer (50 mM Tris pH 8, 10 mM EDTA, 300 mM NaCI, 1 % SDS) at 37 °C for 10 min. To the 50 pL input samples, 100 pL of RIP elution buffer was added to a final volume of 150 pL. Then, 20 pg of proteinase K (Thermo Fisher Scientific, am2548) was added to both IP and input samples, and the mixtures were incubated at 37°C for 1 h and then at 65°C for 1 h to de-crosslink. The samples were extracted one time with phenol-chloroform and one time with chloroform and precipitated with ethanol. The pellet was resuspended in 80 pL of DEPC treated water and treated with 20 units of RNase-free DNase I (Thermo Fisher Scientific, am2222) for 1 h at 37°C, extracted with RNeasy kit (Qiagen cat# 74004). IP and input samples were eluted using 50 pL and 100 pL water, respectively. RT-qPCRs were conducted using gene specific primers to assess RNA enrichment. For sequencing, RNA concentration and distribution was determined using Qubit and TAPE station and used for library preparation. Libraries were constructed for IP and mock control using NEBnext Ultra (New England Biolabs: E7760S). Multiplexed samples were run on NEXTseq 550 using 75bp High output V2 Illumina sequencing kit (Donnelly Sequencing Centre).

[0070] On-bead Digestion for Mass Spectrometry Analysis

[0071] On-bead digestion was performed as described previously (14). Briefly, cells were lysed and 1 mg of lysate was incubated with protein G Dynabeads (Invitrogen) coupled with an anti-MT1-MMP antibody for 2 h at 4°C. The beads were washed 2x with cold lysis buffer and samples were reduced with 10 mM DTT, alkylated with 55 mM IAA, followed by enzymatic digestion with LysC / Trypin mix (Thermo Fisher Scientific) overnight at RT. Samples were then loaded onto Stop and Go Extraction (STAGE) tips (consisting of three layers of C18) to desalt and purify.

[0072] Mass Spectrometry

[0073] Mass spectrometry was performed as described previously (14). Samples were eluted from STAGE-tips with 50 pL buffer B (80% acetonitrile [ACN] and 0.5% acetic acid), dried, and resuspended in 12 pL buffer A (0.1% TFA). Nanoflow liquid chromatography on an Ulti-mate 3000 LC system (ThermoFisher Scientific) through a nano- electrospray flex-iron source (ThermoFisher Scientific) was used to analyze 6 pL fractions from each sample. Samples were loaded onto a 5 mm p-precolumn (ThermoFisher Scientific) with 300 pm inner diameter filled with 5 pm C18 PepMapI 00 beads. A 15 cm column with 75 pm inner diameter with 2 pm reverse-phase silica beads was used to separate peptides, and were electrosprayed directly into the high-resolution Thermo Fusion Lumos mass spectrometer using a 4%-30% ACN linear gradient in 0.1% formic acid at a constant flow of 300 nL / min for 45 min. A washout with up to 95% ACN was then used to clean the column followed by an equilibrium stage. The Fusion Lumos was operated in data- dependent mode, switching automatically between one fill scan and subsequent MS / MS scans of the most abundant peaks with a cycle time of 3 s. The Orbitrap analyzer acquired full scan MS1s with a resolution of 120,000 and a scan range of 400-1600 m / z. Maximum injection time was set to 50 ms with an automatic gain control of 4e5. The fragment ion scan was done in the Orbitrap using a Quadrupole isolation window of 1 .6 m / z and HOD fragmentation energy of 30 eV. Orbitrap resolution was set to 30,000 with a maximum ion injection time of 50 ms and an automatic gain control target set to 5e4.

[0074] Raw Data Processing

[0075] Raw data processing was performed as described previously (14). Raw files were analyzed together using MaxQuant software (version1.6.0.26) (33). The derived peak list was searched with the built-in Andromeda search engine against the reference Homo sapiens proteome (July 2019; 74,811 sequences) from Uniprot (http: / / www.uniprot.org) (34). The parameters were as follows: strict trypsin specificity, allowing up to two missed cleavages, minimum peptide length was seven amino acids. A minimum of two peptides required for protein identification and peptide spectral matches and protein identifications were filtered using a target-decoy approach at a false discovery rate (FDR) of 5%. ‘Match between runs’ was enabled with a match time window of 0.7 min and an alignment time window of 20 min. Relative, label-free quantification (LFQ) of proteins used the MaxLFQ algorithm integrated into MaxQuant using a minimum ratio count of one.

[0076] Bioinformatics

[0077] Bioinformatic analysis was performed as described previously (14). Perseus (REF) and VolcaNoseR (https: / / huygens.science.uva.nl / VolcaNoseR / ) were used to further analyze the MaxQuant-processed data. Hits to the reverse database, contaminants, and proteins only identified with modified peptides were eliminated. LFQ intensities were converted to a log scale (log2), and only those proteins present in triplicate within at least one sample set were used for further statistical processing (valid-value filter of 3 in at least one group). Missing values were imputed from a normal distribution (downshift of 1.8 S.D. and a width of 0.3 S.D.). A Student’s t-test identified proteins with significant changes in abundance (p-value < 0.05) with multiple hypothesis testing correction using the Benjamini-Hochberg FDR cutoff at 0.05. A principal component analysis (PCA) was performed. The STRING: functional protein association networks provided visualization of protein networks (https: / / string-db.org). RNA immunoprecipitated sequences were aligned to the genome using HISAT2 (35). Analysis and normalization of the sequencing data was done as previously described (27). Analysis was partly done on the high- performance computing platforms Graham (https: / / docs.alliancecan.ca / wiki / Graham) and Niagra (https: / / docs.alliancecan.ca / wiki / Niagra) in support with Compute Canada (www.computecanada.ca).

[0078] Avian Embryo CAM Extravasation Efficiency Assay

[0079] Extravasation efficiency performed as described previously (2). Briefly, MDA-MB-231 cells were labelled with CellTracker Green dye and treated with P4G11 or E7 antibody for 20 min on ice prior to being injected intravenously into the CAM (n>5 per group). The number of intravascular cells at t=0 post injection was enumerated in a marked 1 cm x 1 cm area (note: at t=0 all cells were assumed to be intravascular). 24 h post injection, extravasated cells were enumerated in the same marked area (note: any cells that were visualized by the CellTracker dye at this timepoint were considered extravasated, as any intravascular cells were assumed dead with a resulting loss of signal (34). Extravasation efficiency was calculated as the number of cells at t=0 divided by the # of cells extravasated at t=24 h. For the metastatic colony formation assay, MDA-MB-231 - zsGreen cells were injected intravenously into CAMs and evaluated at t=7 days postinjection. The number of metastatic colonies (>10 cells) were enumerated across the entire CAM of the avian embryo.

[0080] Intravital Imaging of Cancer Cell Extravasation in the Avian Embryo CAM

[0081] Intravital imaging of cell extravasation was performed as described in “Avian Embryo CAM Extravasation Efficiency Assay”. Briefly, prepared cells expressing zsGreen protein were pre-treated with antibodies / compounds for 15 minutes on ice and then intravenously injected into embryonic day 13 (ED13) avian embryos. Embryos were incubated at 38°C for approximately 3 hrs to allow cells to circulate, arrest, and form invadopodia. Embryos were then injected with fluorescent dyes to label the endothelium (lectin) and the vessel lumen (dextran). Embryos were then imaged using a Nikon Fast A1R upright confocal microscope with an intravital imaging setup. Image capture and analysis were performed as described previously (36).

[0082] Synthesis of Lipid Nanoparticles and Loading of siRNA Cargo Porphyrin-LNPs were prepared using microfluidic rapid mixing method as previously reported (37). Lipids were mixed in ethanol at a molar ratio of 50 / 10 / 38.5 / 1.5 (DLin- MC3-DMA / Porphyrin-lipid / Cholesterol / DMG-PEG2000). siRNA was dissolved in 25 mM sodium acetate buffer (pH = 4.0). The two phases were mixed through herringbone microfluidic chips (microfluidic ChipShop, Germany) at a volumetric flow rate ratio of 3: 1 (aqueous to ethanol) and total flow rate of 10 mL / min. The mixed solution was dialyzed against PBS 7.4 overnight. Afterwards LNPs were concentrated using ultra centrifuge filters (Amicon®, Sigma-Aldrich) and passed through 0.22 pm filter before use.

[0083] Regarding siRNA encapsulation, siRNA concentration and encapsulation efficiency were measured by Quant-it™ RiboGreen RNA Assay based on manufacturer’s protocol (Thermofisher), typically the encapsulation efficiency is >90%. The hydrodynamic size and poly dispersity of porphyrin-LNPs were characterized using a Zetasizer Nano ZS (Malvern Instruments) and Hitachi HT7800 transmission electron microscopy (Nanoscale Biomedical Imaging facility, Peter Gilgan Centre for Research and Learning, Toronto).

[0084] Table 1 : Primers, siRNA and shRNA sequences used siRNA: si-Control Thermo Fisch er silencer select: 4390843 si-MALAT1 (siMAL) 5’ GGCUUAUACUCAUGAAUCUtt 3‘ si-MALAT1 (si MALI ) Thermo Fisch er sil ncer select: 4390827 si-hnRNPC Thermo Fisch er silencer select: 4392420 ID: s6719 si-RALY Thermo Fisch er sil ncer select: 4392420 ID: s22E55 si-MT1-MMP Thermo Fisch er silencer select: 4390824 ID: s8879 qPCR:

[0085] MA LAT I -Forward G AATTG CGTC ATTTAAAG CCTAGTT

[0086] MALAT I -Reverse GTTTCATCCTACCACTCCCAATTAAT ETTL3 Forward AA GCTGC ACTT C AG AC G AAT ETTL3 Reverse G G AATC ACCTC CGACACTC

[0087] ALKBH5 Forward CC CG AG G GCTTC GTC AAC A

[0088] ALKBH5 Reverse C G AC ACC CG AATA G G CTT GA

[0089] Actin Forward GGGACCTGACTGACTACCTC

[0090] Actin Reverse TCATACTCCTGCTTGCTGAT shRNA oligo sequences: shGFP shALKBH5-1 GAAAGGCTGTTGGCATCAATA shALKBH5-2 CCACCCAGCTATGCTTCAGAT shMETTL3-1 GCCAAGGAACAATCCATTGTT shMETTL3-2 GCAAGTATGTTCACTATGAAA

[0091] FISH probe:

[0092] MALATI VX-06: ThermoFischer Scientific

[0093] Assay Kit 88-19000-99: Thermo Fischer Scientific

[0094] Statistical Analysis

[0095] The percent of controls for three independent experimental replicates is shown with error bars representing the standard deviation. The mean is represented by the horizontal bar. Analysis of western blot densitometry was performed as described previously (6) using Imaged software (National Institutes of Health, Bethesda, MD). For all experiments, each treatment group was compared to the control treatment by Students t-test, with a statistical significance threshold of p=0.05. Treatments that differed significantly from the control (p>0.05) are indicated by an asterisk in the figures. Statistical analysis for all data was completed using Microsoft Excel. Graphs were prepared using GraphPad Prism 9.4.1 (GraphPad Software, La Jolla, CA).

[0096] RESULTS

[0097] MT1-MMP Associates with RNA Binding Proteins and RNA to Assemble “R-Bodies”

[0098] MT1-MMP is a protease involved in invadopodia function and is involved in cancer cell extravasation (2), also known as transendothelial migration of cancer cells across the vessel wall at distant sites (1). pi integrin activation by the P4G11 antibody clone (13) is a potent stimulant for downstream invadopodia formation, in particular through regulation of MT1-MMP phosphorylation and intracellular recycling (6, 14). This antibody-mediated approach allows us to analyze invadopodia formation dynamics in a highly reliable and reproducible manner.

[0099] Under these conditions we observed colocalization of MT1-MMP with Hoechst-stained punctae outside of the nucleus (Fig. 1A). To confirm that MT1-MMP is a required component of these extranuclear punctae or cytoplasmic bodies, we knocked down MT1-MMP using siRNA and observed a subsequent loss of their formation (Fig. 1B). Mass spectrometry analysis of immunoprecipitated MT1-MMP revealed a wide range of high avidity protein binding partners (Fig. 1C,D), namely RNA-binding proteins (RBPs) (Fig. 1E,F). Binding association between MT1-MMP and the RBPs hnRNPC and RALY were confirmed through co-immunoprecipitation (Fig. 1G) as well as immunofluorescence microscopy (Fig. 1 H,I,J). RNA was also observed within these aggregates of RBPs (hnRNPC, RALY) and MT1-MMP; leading us to coin the term “R- bodies” (RNA, RBPs, protease). Interestingly, R-bodies were observed in patient- derived metastatic breast cancer cells (Fig. H,l, J bottom panels). Quantification of R- bodies in MDA-MB-231 cells indicated their elevated presence in 40.6 ± 3.1% of cells treated with the pi integrin-activating antibody (Fig. 1K), demonstrating their immediate mobilization upon integrin engagement. In terms of their relationship to invadopodia, R- bodies were not immediately associated but instead adjacent to invadopodia formed in vitro, suggesting a signalling mechanism rather than a biophysical role in invadopodia formation. RBPs and MALAT IncRN A are Required for “R-body” Formation, Functional Invadopodia, and Cancer Cell Extravasation

[0100] Depletion of RBPs, hnRPNC and RALY, were performed to assess their role in R-body formation and signalling impact on invadopodia formation in vitro. siRNA knockdown of hnRNPC and RALY was 82.14 ± 9.98 % and 53.98 ± 4.41% respectively. This genetic manipulation resulted in a loss of invasive function manifest as a reduction of >65% in invadopodia formation with both siRNA targets (Fig. 2A), and a subsequent decrease in transwell assays of cell invasion even under conditions of integrin activation (due to aG11 mAb pretreatment) (Fig. 2B). Cancer cell extravasation assays revealed a subsequent decrease in transendothelial migration capabilities that reached basal levels of cancer cell extravasation 31.1 ± 4.2 (hnRNPC) and 29.9 ± 3.7% (RALY) compared to control (81.7 ± 9.6%) (Fig. 2C). Across these functional assays, it was noted that targeting RBPs also led to decreases that did not exceed basal levels of invadopodia formation, transwell invasion, or cancer cell extravasation rates (siControl + Control IgG). This consistency between in vitro and in vivo invasion readouts pointed to the complementary nature of the assays. Consequently, metastatic colony formation was also abrogated with siRNAs targeting hnRPNC and RALY, revealing an increase of metastatic inefficiency by 20.6X compared to siControl (Fig. 2D).

[0101] To elucidate the role and abundance of RNA in R-body formation, immunoprecipitants with the anti-MT1-MMP antibody were retreated with benzonase, a potent RNAse, prior to western immunoblotting for levels of hnRNPC. RNAse treatment led to a significant decrease in hnRPNC that immunoprecipitated with MT1-MMP (Fig. 2E) revealing a linchpin-like requirement of RNA for the formation of R-bodies. This prompted RIPseq of immunoprecipitants with the anti-MT1-MMP antibody but with only cytoplasmic portions of [31 integrin activated cells, a modified technique called ‘cytoplasmic RIPseq’. This approach enables us to focus on R-bodies that contain RNA and minimizes RNA from the nucleus of pi integrin activated cells. Cytoplasmic RIPseq revealed an enrichment of MALAT1 (8 kb), RPVU1 , and RPU1 (both 164 bp) over mock antibody control, all of which are ncRNAs (Fig. 2F,G).

[0102] MALAT1 IncRNA binding to MT1-MMP was confirmed via cytoplasmic RIP-qPCR for MALAT1 when using the same anti-MT1-MMP antibody immunoprecipitates. MALAT1 levels were elevated in pi integrin activated cell cytosols compared to control (Fig. 2H). To visually confirm the localization of MALAT1 to R-bodies within the cytoplasm of pi integrin activated cells, FISH probes for MALAT 1 revealed extra-nuclear punctate signal that co-localized with RNA / DNA, hnRNPC, and RALY signal (Fig. 2I) that did not exist in controls. These results confirmed the presence of MALAT 1 IncRNA within R-bodies, establishing the presence of a ternary complex composed of MALAT1 IncRNA, RBPs, and MT1-MMP.

[0103] To determine the functional impact of MALAT1 loss, we performed siRNA genetic manipulations that achieved 57.7 ± 0.8% total knockdown of MALAT1 levels with siMALI . In these loss of function experiments, we observed a loss in invadopodia formation in vitro (Fig. 2J,K) and a subsequent abrogation in cancer cell extravasation rates (Fig. 2L). This, as expected, resulted in a significant reduction in metastatic colony formation in vivo (Fig. 2M) under integrin activation conditions. These cells were used for intravital imaging to visually understand the effect of MALAT 1 loss during cancer cell extravasation. Cells arrested within the intravascular space during the early stages of cancer cell extravasation were tracked and those with the siMALATI knockdown revealed significantly smaller cell volumes compared to siCON. Most importantly, no cell protrusions such as invadopodia were observed in cells that received siMALI treatment whereas siCON treated cells continued to form cell protrusions. This data suggests that components of R-bodies (RNA, RBPs, MT1-MMP) require each other’s co-operation for functional invadopodia and subsequent capability to undergo cancer cell extravasation. m6A Epigenetically Regulates MALAT1 and its Incorporation into R-Bodies

[0104] MALAT1 is known to have m6A epigenetic marks on various adenosine residues (15). These m6A methyl groups on RNA have been shown to alter secondary structure of the methylated IncRNA, which opens up various binding sites for RPBs (16-18). Total cell RIPseq was performed on various cancer cell lines such as PC3, LnCAP, MDA-MB-468, etc. using the anti-m6A antibody revealing MALAT1 IncRNA regions possessing the same m6A epigenetic patterning (Fig. 7). When viewing these regions at higher resolution, specific portions of MALAT1 immunoprecipitated with the anti-m6A antibody revealing the exact regions that possess the m6A mark (Fig. 3A, Fig. 7). With this understanding, we determined the change in secondary structure of MALAT1 due to m6A epigenetic marks utilizing the RNAfold algorithm for predicting secondary structure of RNA (19) (Fig. 3B). This algorithm predicts shape based on minimum free energy (MFE: optimal structure) and also in conjunction with the partition function algorithm (sub-optimal), representing two likely forms of the RNA structure for this region. Within these two forms, we located an hnRNPC binding site (highlighted in blue) that is directly base pairing with an m6A modification site (DRA*CH; IUPAC nucleotide code - highlighted in red) based on the MFE structure compared to MFE+ Partition function (Fig. 8). m6A modification can potentially promote a suboptimal conformation, thus freeing the hnRNPC binding site for association.

[0105] We sought to determine if the MALAT 1 within RBPs was m6A methylated. Cytoplasmic RIP qPCR for MALAT1 using the anti-m6A antibody showed significant enrichment for MALAT1 in the cytoplasm of [31 integrin activated cancer cells compared to control, suggesting MALAT1 found in the cytoplasm is predominantly m6A methylated (Fig. 3C). The same anti-m6A antibody was used to immunohistochemically to determine if any m6A signal existed within the cytoplasm. There was a general increase of m6A signal within the cytoplasm of pi integrin activated cancer cells compared to control; however, distinct colocalization of m6A signal to Hoechst-positive R-bodies was absent, likely due to these regions being buried within the complex. m6A methylation on RNA is added by methyl transferase METTL3 and removed by the demethylase ALKBH5 / FTO (20-22). To understand the importance of this modification on these phenotypes, lentiviral shRNA vectors were used to knockdown (KD) these enzymes (90-95% knockdown) followed by meRIP. METTL3 KD led to a drastic drop in cytoplasmic meRIP’d MALAT1. The opposing roles that METTL3 and ALKBH5 play on m6A modification was apparent as ALKBH5 showed a slight increase compared to control (Fig. 3D) and the double KD did not show any cooperative effect. To confirm if association of MALAT1 with the R-bodies requires m6A, we conducted RIP using the MT1-MMP antibody. MT1-MMP failed to immunoprecipitate MALAT1 following METTL3 KD unlike the ALKBH5 KD demonstrating the requirement of m6A methylation on MALAT1 for R-body formation (Fig. 3E).

[0106] Further, the effect of MALAT 1 m6A methylation on R-bodies and invadopodia formation was investigated immunohistochemically. Loss of METTL3 expression inhibited R-body formation (69.1 ± 11.7% decrease) whereas loss of ALKBH5 did not (19.2 ± 5.1 increase). Dual knockdown was detrimental to R-body formation, with an observed decrease of 69.9 ± 7.7% from the control (Fig. 3F,G). Loss of METTL3 expression had a negative effect on invadopodia formation, with a decrease of 79.7 ± 2.8% compared to the control condition (Fig. 3H,I). When ALKBH5 was knocked down, invadopodia formation increased by 18.6 ± 11.8% over the control, consistent with the notion that METTL3 and ALKBH5 play opposite roles in m6A methylation. Interestingly, dual knockdown of METTL3 and ALKBH5 resulted in a 61 .3 ± 6.9% decrease in invadopodia formation, indicating that METTL3 expression is of higher importance in mediating this phenotype. Further, KD of METTL3 also demonstrated ~50% reduction in cancer cell extravasation (Fig. 3J) and a significant drop in metastatic colony formation (Fig. 3K).

[0107] RNA Therapy for Targeting MALAT1 Abrogates Cancer Cell Extravasation and Metastasis Dynamics

[0108] For RNA Therapy of MALAT 1 , we sought to only target its m6A region as opposed to a pooled approach used in Fig. 2 and Fig. 3. We designed siMAL to target the portion of MALAT1 614 bp downstream of its m6A methylation region. siMAL was used for RNA Therapy which consisted of porphyrin labelled lipid nanoparticles (LNPs) (23-25); some versions possessed a fluorescent 6-FAM label for confirmation of cargo loading and unloading into cells during treatment (Fig. 4A). To confirm the genetic targeting efficacy of this RNA therapy, cells were pre-treated with various doses and then submitted to cytoplasmic RIP qPCR for MALAT1 using anti-MT1-MMP antibody. Nuclear portions of pi integrin activated cells did not impact MALAT1 levels regardless of dose (Fig. 4B). However, cytoplasmic portions of pi integrin activated cells revealed a 60% decrease in MALAT1 levels (Fig. 4C), demonstrating the specificity of this RNA therapy for MALAT1 localized to R-bodies in the cytosol while exhibiting no impact on the nuclear pool of MALAT1 .

[0109] The 6-FAM fluorescent version of siMAL and siCON (scrambled control) was used to understand the offloading kinetics of RNA therapy cargo into the cell cytoplasm in vitro and during intravital imaging of cancer cell extravasation in vivo. In vitro incubation revealed rapid uptake of LNPs (porphyrin fluorescent label) and the majority of endocytosed LNPs contained the 6-FAM labelled RNA (Fig. 4D). This was consistent with other measurements that confirmed efficient loading of siRNA into the LNPs. Intravenous injection of vacant LNPs and LNP-preloaded cancer cells was submitted to intravital imaging to confirm their detection with this method. LNP-preloaded cancer cells were arrested in the lumen of the CAM microvasculature immediately after intravenous injection, revealing cytoplasmic accumulation of 6-FAM signal released by internalized LNPs. Majority of the preloaded cells revealed increasing levels of siMAL or siCON in the cytoplasm over time presumably due to cargo release by the LNPs (Fig. 4E,F). After confirming successful offloading of RNA cargo into the cytoplasm of recipient cells in vivo we then performed cancer cell extravasation assays in which RNA therapy (LNPs containing siMAL or siCON; LNP:siMAL and LNP:siCON respectively) was injected 1 hour after cancer cells were intravenously injected. We observed a strong affinity of the LNPs to the surface of the cells that interfaced plasma and more importantly, uptake of LNPs into the cytoplasm with no nuclear uptake observed (Fig. 4G). RNA therapy treatment with LNPs containing siMAL cargo produced a 33% decrease in cancer cell extravasation rates (Fig. 4H), followed by a 77% decrease in metastatic colony formation (Fig. 4I). Hence, RNA therapy for MALAT1 (LNP:siMAL) led to a cumulative 7.5 fold increase in metastatic inefficiency rates compared to LNP:siCON.

[0110] Intravital imaging yielded important pharmacological insights regarding the nature of the RNA therapy and its affinity for cancer cells. Within 4 hours, all if not the majority of intravascular cancer cells prior to cancer cell extravasation exhibited an abundant coating of LNPs on their cell surface and internalization of LNPs (Fig. 4G; Fig. 4J). No LNPs were observed to be within the nucleus. Throughout the entire time course, LNPs were also observed to be in the microcirculation at high velocities whilst minimal uptake of LNPs by the stroma was observed. LNPs were only internalized by cancer cells or immune cells.

[0111] Pharmacologic Targeting of METTL3 Abrogates Cancer Cell Extravasation and Metastasis Dynamics

[0112] To determine whether pharmacological targeting of the m6A methylation region of MALAT1 is sufficient to abrogate R-body formation and subsequent metastasis dynamics, we utilized the SMT2457 small molecule inhibitor of METTL3 (26) at 10 mM concentration. Using this drug, we conducted cytoplasmic meRIP and found that there was a significant reduction in MALAT1 enrichment following pi integrin activation (Fig. 5A) suggesting that SMT2457 successfully inhibited METTL3 and reduced the levels of m6A on MALAT 1 . Indeed, the loss of m6A epigenetic marks on MALAT 1 IncRNA due to SMT2457 treatment prevented immunoprecipitation of MALAT1 when using MT1-MMP antibody (Fig. 5B), strengthening our earlier findings following KD of METTL3. Using this concentration, significant decreases in R-bodies (Fig. 5C) and invadopodia formation (Fig. 5D) were observed. This treatment also led to decreases in cancer cell extravasation (Fig. 5E) and as expected, significant decreases in metastatic colony formation (Fig. 5F). The effects observed in metastatic colony formation were particularly striking, inferring that SMT2457 has additional anti-metastatic effects beyond that of antagonizing R-bodies and invadopodia that additionally contribute to the high increases (8. Ox fold) in metastatic inefficiency.

[0113] Deletion of M6A demonstrates crucial impact

[0114] Four out of the 5 predicted M6A sites occur within a tight cluster of 308bp within the MALAT1 IncRNA. Deletion of the M6A region, using Crispr-CAS9, significantly impacted R-body and invadopodia formation in MDA-231 cells. As shown in Fig. 9A, a 300 bp deletion was successfully confirmed in the mutant cell lines relative to wild-type (WT) via agarose gel electrophoresis. A schematic depicting the M6A deletion site within MALAT1 is presented in Fig. 9B. RNA immunoprecipitation of MT1-MMP14 followed by qPCR for MALAT 1 demonstrated increased enrichment in activated cells (G11 antibody- treated), whereas this signal was completely abrogated in the M6A-deleted lines (1G4 and 1 F4) (Fig. 9C). Similar results were observed with RIP using hnRNPC (Fig. 9D). Cytoplasmic R-body formation, visualized by microscopy, was evident in WT cells but absent in the M6A deletion mutants (Fig. 9E). Furthermore, invadopodia formation, both in quantification and in confocal images, was observed in WT cells but not in the MSA- deleted lines (Fig. 9F).

[0115] Discussion

[0116] In summary, invadopodia formation upcycles cytoplasmic MT1-MMP to form large ternary complexes consisting of: 1) RNA binding proteins (i.e., hnRNPC, etc.), and 2) MALAT 1 IncRNA. These grow in size to form large aggregates called R-bodies that are extranuclear and not adjacent to invadopodia in 2D. Our findings point to the role of the epitranscriptome, wherein m6A methylation of MALAT 1 is required for R-body formation (Fig. 5G). Disruption of any component of R-bodies (hnRNPC / MALATI) leads to loss of invadopodia formation, which has cascade-like consequences on metastasis dynamics. Targeting METTL3, the enzyme responsible for m6A methylation on MALAT1 , established the role of the epitranscriptome in metastasis and its potential as a promising drug target. Our RNA Therapy for siMAL revealed the greatest inhibitory impact on R-body formation and invadopodia formation. However, the small molecule inhibitor for METTL3 (STM2457) had the greatest inhibitory impact on metastatic colony formation. The increases in metastatic inefficiency caused by these two different therapies strongly underscores the potential of targeting invadopodia via the epitranscriptome to thwart metastatic progression. RNA binding proteins (RBPs) play a significant role in R-bodies. Upon binding to m6A- methylated MALAT1 , RBPs transition into a well described structural conformation which enables additional protein binding sites on hnRNPC. This was the case for hnRNPC to bind to MT1-MMP but we do not know the corresponding binding / docking sites as of yet. The most striking finding was that benzonase treatment of immunoprecipitates of MT1-MMP (Fig. 2E) revealed the linchpin-like importance of MALAT 1 IncRNA to integrity of the ternary complex. The opposite is likely not true for MT1-MMP complex formation with hnRNPC to enable MALAT1 binding to occur. What is novel in the field of invadopodia is that m6A methylation of MALAT 1 is essential for R-body formation, by inducing secondary structure changes to enable hnRNPC to bind to it, eventually leading to invadopodia formation and cancer cell extravasation. Indeed, deletion of the core M6A site of MALAT1 diminishes binding of hnRNPC and MT1 binding to MALAT1 (Fig. 9C and 9D) in the cytoplasm which lead to decreased R-body formation and the consequent invadopodia. It is possible that m6A methylated MALAT1 is already in complex with hnRNPC but diffusely spread throughout the cytoplasm prior to MT1-MMP endocytosis. Timing and the nature of the distribution of all R-body components upon integrin activation will require future investigation.

[0117] The RNA therapy described here for targeting m6A methylated MALAT1 has promising therapeutic potential because intravital imaging revealed a strong affinity of these LNPs to the surface of cancer cells and intracellular uptake. Moreover, the gradual release of 6-FAM labelled siRNA into the cancer cell cytosol was encouraging and will promote more effort into designing RNA therapy for targeting “pathogenic RNA” in cancer cells. The appeal of this RNA therapy is that the therapeutic objective is to neutralize cytosolic pools of MALAT1 due to their role in R-bodies. This makes it more plausible for an effective form of RNA therapy since targeting MALAT1 in the nucleus would require more design considerations. Fortunately, this is not the case as the therapeutically relevant pool of MALAT 1 is cytosolic and hence more easily targetable.

[0118] LncRNAs have numerous functions in the nucleus but primarily act transcriptionally and post-transcriptionally (27) to regulate genes. Similarly, MALAT 1 is retained exclusively in the nucleus where it has been described to position transcription factors, associate with nuclear speckles to regulate mRNA splicing, and regulate genes by acting as a microRNA sponge (28-30). Similarly, its associated RBPs such as hnRNPC, have mainly been described in splicing regulation within the nucleus (31). Current understanding of RBPs and their IncRNA binding partners has been dominantly focused on their role in controlling transcription and other intra-nuclear interactions. The cytosolic abundance of RBPs and MALAT 1 in the cytoplasm in a disease context is novel, in that this is mobilized to the cytosol upon integrin engagement. To our knowledge, this is the first mechanism to describe their presence if any in the cytosol of cancer cells. Indeed, we employed a unique cytoplasmic RIP protocol which allowed us to identify the key RNA constituents and to decipher the mechanism of R-bodies. Implementing this novel protocol and identification of additional ways to interrogate the dynamics within the cytosol will be crucial to completely understand the physiology of the cell.

[0119] The actual function of R-bodies remains to be understood within the context of invadopodia formation. Loss of function experiments when depleting hnRNPC / RALY / MALAT1 levels in metastatic cancer cells demonstrates loss of sensitivity to integrin engagement, leading to a loss of invadopodia formation and impacts on metastatic colony formation. However, the distance of R-bodies to invadopodia formation in vitro implies that their role could be signalling based rather than contributing to the structural integrity of invadopodia. R-bodies could also be sequestering other components related to signalling and transport of factors to invadopodia. Ezzoukhry and colleagues (12) showed that translation machinery was present to facilitate rapid protein production at sites of invadopodia formation.

[0120] Although preferred embodiments of the invention have been described herein, it will be understood by those skilled in the art that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims. All documents disclosed herein, including those in the following reference list, are incorporated by reference.

[0121] Reference List

[0122] 1. A. F. Chambers, A. C. Groom, and I. C. MacDonald, “Dissemination and growth of cancer cells in metastatic sites,” Nat Rev Cancer, vol. 2, no. 8, pp. 563-572, Aug. 2002, doi: 10.1038 / nrc865.

[0123] 2. H. S. Leong et al., “Invadopodia Are Required for Cancer Cell Extravasation and Are a Therapeutic Target for Metastasis,” Cell Rep, vol. 8, no. 5, pp. 1558-1570, Sep. 2014, doi: 10.1016 / j.celrep.2014.07.050.

[0124] 3. K. M. Stroka and K. Konstantopoulos, “Physical Biology in Cancer. 4. Physical cues guide tumor cell adhesion and migration,” American Journal of Physiology-Cell Physiology, vol. 306, no. 2, pp. C98-C109, Jan. 2014, doi: 10.1152 / ajpcell.00289.2013.

[0125] 4. K. C. Williams et al., “Invadopodia are chemosensing protrusions that guide cancer cell extravasation to promote brain tropism in metastasis,” Oncogene, vol. 38, no. 19, pp. 3598-3615, May 2019, doi: 10.1038 / S41388-018-0667-4.

[0126] 5. A. Watanabe, D. Hosino, N. Koshikawa, M. Seiki, T. Suzuki, and K. Ichikawa, “Critical Role of Transient Activity of MT1-MMP for ECM Degradation in Invadopodia,” PLoS Comput Biol, vol. 9, no. 5, p. e1003086, May 2013, doi: 10.1371 / journal.pcbi.1003086.

[0127] 6. O. R. Grafinger, G. Gorshtein, T. Stirling, M. I. Brasher, and M. G. Coppolino, “P1 integrin-mediated signaling regulates MT1-MMP phosphorylation to promote tumour cell invasion,” J Cell Sci, vol. 133, no. 9, Mar. 2020, doi: 10.1242 / jcs.239152.

[0128] 7. J. Cathcart, A. Pulkoski-Gross, and J. Cao, “Targeting matrix metalloproteinases in cancer: Bringing new life to old ideas,” Genes Dis, vol. 2, no. 1 , pp. 26-34, Mar. 2015, doi: 10.1016 / j.gendis.2014.12.002.

[0129] 8. P. Ji et al., “MALAT-1 , a novel noncoding RNA, and thymosin [34 predict metastasis and survival in early-stage non-small cell lung cancer,” Oncogene, vol. 22, no. 39, pp. 8031-8041 , Sep. 2003, doi: 10.1038 / sj.onc.1206928.

[0130] 9. S. J. Liu, H. X. Dang, D. A. Lim, F. Y. Feng, and C. A. Maher, “Long noncoding RNAs in cancer metastasis,” Nat Rev Cancer, vol. 21 , no. 7, pp. 446-460, Jul. 2021 , doi: 10.1038 / S41568-021 -00353-1. 10. X. Li et al., “Inhibition of METTL3 / m6A / miR126 promotes the migration and invasion of endometrial stromal cells in endometriosis,” Biol Reprod, vol. 105, no. 5, pp. 1221-1233, Nov. 2021 , doi: 10.1093 / biolre / ioab152.

[0131] 11. W. Zhou et al., “m6A Methyltransferase 3 Promotes the Proliferation and Migration of Gastric Cancer Cells through the m6A Modification of YAP1 ,” J Oncol, vol. 2021 , pp. 1-11 , Aug. 2021 , doi: 10.1155 / 2021 / 8875424.

[0132] 12. Z. Ezzoukhry et al., “Combining laser capture microdissection and proteomics reveals an active translation machinery controlling invadosome formation,” Nat Commun, vol. 9, no. 1 , p. 2031 , May 2018, doi: 10.1038 / S41467-018-04461-9.

[0133] 13. S. Vijayakumar, H. Erdjument-Bromage, P. Tempst, and Q. Al-Awqati, “Role of Integrins in the Assembly and Function of Hensin in Intercalated Cells,” Journal of the American Society of Nephrology, vol. 19, no. 6, pp. 1079-1091 , Jun. 2008, doi: 10.1681 / ASN.2007070737.

[0134] 14. O. R. Grafinger, G. Gorshtein, T. Stirling, J. Geddes-McAlister, and M. G. Coppolino, “Inhibition of pi integrin induces its association with MT1-MMP and decreases MT1-MMP internalization and cellular invasiveness,” Cell Signal, vol. 83, p. 109984, Jul. 2021 , doi: 10.1016 / j.cellsig.2021 .109984.

[0135] 15. X. Wang et al., “N6-methyladenosine modification of MALAT1 promotes metastasis via reshaping nuclear speckles,” Dev Cell, vol. 56, no. 5, pp. 702-715. e8, Mar. 2021 , doi: 10.1016 / j.devcel.2021 .01 .015.

[0136] 16. N. Liu, Q. Dai, G. Zheng, C. He, M. Parisien, and T. Pan, “N6-methyladenosine- dependent RNA structural switches regulate RNA-protein interactions,” Nature, vol. 518, no. 7540, pp. 560-564, Feb. 2015, doi: 10.1038 / nature14234.

[0137] 17. B. Wu et al., “Molecular basis for the specific and multivariant recognitions of RNA substrates by human hnRNP A2 / B1 ,” Nat Commun, vol. 9, no. 1 , p. 420, Jan. 2018, doi: 10.1038 / S41467-017-02770-z.

[0138] 18. N. Liu, K. I. Zhou, M. Parisien, Q. Dai, L. Diatchenko, and T. Pan, “N 6- methyladenosine alters RNA structure to regulate binding of a low-complexity protein,” Nucleic Acids Res, vol. 45, no. 10, pp. 6051-6063, Jun. 2017, doi: 10.1093 / nar / gkx141 . 19. A. R. Gruber, R. Lorenz, S. H. Bernhart, R. Neubock, and I. L. Hofacker, “The Vienna RNA Websuite,” Nucleic Acids Res, vol. 36, no. Web Server, pp. W70-W74, May 2008, doi: 10.1093 / nar / gkn188.

[0139] 20. J. Qu et al., “RNA demethylase ALKBH5 in cancer: from mechanisms to therapeutic potential,” J Hematol Oncol, vol. 15, no. 1 , p. 8, Jan. 2022, doi: 10.1186 / S13045-022-01224-4.

[0140] 21. J. Wang etal., “The biological function of m6A demethylase ALKBH5 and its role in human disease,” Cancer Cell Int, vol. 20, no. 1 , p. 347, Dec. 2020, doi: 10.1186 / S12935-020-01450- 1 .

[0141] 22. Y. Cai, R. Feng, T. Lu, X. Chen, X. Zhou, and X. Wang, “Novel insights into the m6A-RNA methyltransferase METTL3 in cancer,” Biomark Res, vol. 9, no. 1 , p. 27, Dec. 2021 , doi: 10.1186 / S40364-021 -00278-9.

[0142] 23. E. Chang et al. , “Porphyrin- li pid stabilized paclitaxel nanoemulsion for combined photodynamic therapy and chemotherapy,” J Nanobiotechnology, vol. 19, no. 1 , p. 154, Dec. 2021 , doi: 10.1186 / S12951-021-00898-1 .

[0143] 24. N. Muhanna et al., “Phototheranostic Porphyrin Nanoparticles Enable Visualization and Targeted Treatment of Head and Neck Cancer in Clinically Relevant Models,” Theranostics, vol. 5, no. 12, pp. 1428-1443, 2015, doi: 10.7150 / thno.13451 .

[0144] 25. J. F. Lovell et al., “Porphysome nanovesicles generated by porphyrin bilayers for use as multimodal biophotonic contrast agents,” Nat Mater, vol. 10, no. 4, pp. 324-332, Apr. 2011 , doi: 10.1038 / nmat2986.

[0145] 26. E. Yankova et al., “Small-molecule inhibition of METTL3 as a strategy against myeloid leukaemia,” Nature, vol. 593, no. 7860, pp. 597-601 , May 2021 , doi: 10.1038 / S41586-021 -03536-w.

[0146] 27. G. Thillainadesan et al., “Conserved protein Pir2ARS2 mediates gene repression through cryptic introns in IncRNAs,” Nat Commun, vol. 11 , no. 1 , p. 2412, May 2020, doi: 10.1038 / S41467-020-16280-y. 28. L. Yang et al., “ncRNA- and Pc2 Methylation-Dependent Gene Relocation between Nuclear Structures Mediates Gene Activation Programs,” Cell, vol. 147, no. 4, pp. 773-788, Nov. 2011 , doi: 10.1016 / j.cell.2011.08.054.

[0147] 29. Y. Han et al., “Hsa-miR-125b suppresses bladder cancer development by downregulating oncogene SIRT7 and oncogenic long non-coding RNA MALAT 1 ,” FEBS Lett, vol. 587, no. 23, pp. 3875-3882, Nov. 2013, doi: 10.1016 / j.febslet.2O13.10.023.

[0148] 30. X. Wang et al., “N6-methyladenosine modification of MALAT1 promotes metastasis via reshaping nuclear speckles,” Dev Cell, vol. 56, no. 5, pp. 702-715. e8, Mar. 2021 , doi: 10.1016 / j.devcel.2021 .01 .015.

[0149] 31. V. Tripathi et al., “The Nuclear-Retained Noncoding RNA MALAT1 Regulates Alternative Splicing by Modulating SR Splicing Factor Phosphorylation,” Mol Cell, vol.

[0150] 39, no. 6, pp. 925-938, Sep. 2010, doi: 10.1016 / j.molcel.2010.08.011 .

[0151] 32. K. C. Williams and M. G. Coppolino, “SNARE-dependent interaction of Src, EGFR and [31 integrin regulates invadopodia formation and tumor cell invasion,” J Cell Sci, vol. 127, no. 8, pp. 1712-1725, Apr. 2014, doi: 10.1242 / jcs.134734.

[0152] 33. J. Cox and M. Mann, “MaxQuant enables high peptide identification rates, individualized p.p.b. -range mass accuracies and proteome-wide protein quantification,” Nat Biotechnol, vol. 26, no. 12, pp. 1367-1372, Dec. 2008, doi: 10.1038 / nbt.1511 .

[0153] 34. J. Cox, N. Neuhauser, A. Michalski, R. A. Scheltema, J. v. Olsen, and M. Mann, “Andromeda: A Peptide Search Engine Integrated into the MaxQuant Environment,” J Proteome Res, vol. 10, no. 4, pp. 1794-1805, Apr. 2011 , doi: 10.1021 / pr101065j.

[0154] 35. D. Kim, J. M. Paggi, C. Park, C. Bennett, and S. L. Salzberg, “Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype,” Nat Biotechnol, vol. 37, no. 8, pp. 907-915, Aug. 2019, doi: 10.1038 / S41587-019-0201 -4.

[0155] 36. H. S. Leong, A. F. Chambers, and J. D. Lewis, “Assessing Cancer Cell Migration and Metastatic Growth In Vivo in the Chick Embryo Using Fluorescence Intravital Imaging,” in Methods in Molecular Biology, vol. 872, 2012, pp. 1-14. doi: 10.1007 / 978- 1-61779-797-2_1. 37. N. M. Belliveau et al., “Microfluidic Synthesis of Highly Potent Limit-size Lipid Nanoparticles for In Vivo Delivery of siRNA,” Mol Ther Nucleic Acids, vol. 1 , p. e37, 2012, doi: 10.1038 / mtna.2012.28.

Claims

CLAIMS:1 . A combination of an inhibitor of MALAT 1 with a delivery vehicle for targeting the inhibitor to the cytoplasm.

2. The combination of claim 1 , wherein the inhibitor is a small molecule, antisense oligonucleotide, siRNA, miRNA or shRNA.

3. The combination of claim 2, wherein the inhibitor is an siRNA.

4. The combination of any one of claims 1-3, wherein the MALAT 1 has SEQ ID NO. 1.

5. The combination of any one of claims 1 -4, wherein the inhibitor targets regions of MALAT1 with adenosine methylation potential.

6. The combination of any one of claims 1 -4, wherein the inhibitor targets positions 965-1934 of SEQ ID NO.

17. The combination of claim 6, wherein the inhibitor targets positions 1255-1269 of SEQ ID NO.1.

8. The combination of claim 6, wherein the inhibitor targets positions 1311-1316 of SEQ ID NO.1.

9. The combination of claim 6, wherein the inhibitor targets positions 1884-1899 of SEQ ID NO.1.

10. The combination of claim 2, wherein the inhibitor is 5' GGCUUAUACUCAUGAAUCUtt 3' (SEQ ID NO. 2).11 . The combination of any one of claims 1-9, wherein the delivery vehicle is a lipid nanoparticle.

12. The combination of claim 10, wherein the lipid nanoparticle is a porphyrin-lipid nanoparticle.

13. The combination of claim 11 , wherein the porphyrin lipid nanoparticle comprises DLin-MC3-DMA, Porphyrin-lipid, cholesterol, and DMG-PEG2000.

14. The combination of any one of claims 1-13, in combination further with a METTL3 inhibitor, optionally a small molecule, antisense oligonucleotide, siRNA, miRNA or shRNA.

15. An inhibitor to MALAT 1 , wherein the inhibitor targets positions 965-1934 of SEQ ID No.1.

16. The inhibitor of claim 15, wherein the inhibitor targets positions 1255-1269 of SEQ ID NO.1., positions 1311-1316 of SEQ ID NO.1 , or positions 1884-1899 of SEQ ID NO.1.

17. The inhibitor of claim 15, wherein the inhibitor is 5' GGCUUAUACUCAUGAAUCUtt 3' (SEQ ID NO. 2).

18. A pharmaceutical composition comprising the combination of any one of claims 1-14 or the inhibitor of any one of claims 15-17 along with a pharmaceutically acceptable carrier.

19. A method of treating cancer in a patient comprising administering to the patient a therapeutically effective amount of the combination of any one of claims 1-14 or the inhibitor of any one of claims 15-17.

20. A method of preventing cancer metastasis in a patient comprising administering to the patient a therapeutically effective amount of the combination of any one of claims 1-14 or the inhibitor of any one of claims 15- 17.

21. The combination of any one of claims 1-14 or the inhibitor of any one of claims 15-17 for use in the treatment of cancer or for the prevention of cancer metastasis in a patient.

22. Use of the combination of any one of claims 1-14 or the inhibitor of any one of claims 15-17, in the manufacture of a medicament for the treatment of cancer or for the prevention of cancer metastasis in a patient.

23. A gene editing compound that deletes or truncates MALAT 1 in a human subject.

24. The gene editing compound of claim 23, being a CRISPR-CAS9 gene editing compound.

25. The gene editing compound of claim 24, comprising CAS9 complexed with a synthetic guide RNA that deleted or truncates MALAT 1 .

26. The gene editing compound of any one of claims 23-25, in combination with a delivery vehicle for targeting the compound to the cytoplasm.

27. A method of preventing cancer metastasis in a patient comprising administering to the patient a therapeutically effective amount of the compound of any one of claims 23-26.

28. The compound of any one of claims 23-26, for use in the treatment of cancer or for the prevention of cancer metastasis in a patient.

29. Use of the compound of any one of claims 23-26, in the manufacture of a medicament for the treatment of cancer or for the prevention of cancer metastasis in a patient.

Citation Information

Patent Citations

  • Antisense oligonucleotides for modulation of long noncoding rnas

    WO2017211999A1

  • Targeting with fibronectin type iii like domain molecules

    WO2019118818A1

  • Lipid nanoparticle for the delivery of RNA

    WO2023230711A1