Compositions comprising small extracellular vesicles derived from microalgae, a process for obtaining them and uses thereof

Cultivating microalgae under stress conditions enhances MEV production and properties, addressing yield limitations and enabling effective therapeutic, cosmetic, and nutraceutical applications with improved functional characteristics.

WO2025210558A1PCT designated stage Publication Date: 2025-10-09EXOGENUS THERAPEUTICS SA
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2025/053514
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-05
Filing Date
2025-04-03
Publication Date
2025-10-09

AI Technical Summary

Technical Problem

Existing methods for isolating extracellular vesicles (EV) from microalgae do not account for the influence of abiotic stress conditions such as temperature, salinity, pH, light, and nutrient starvation, which can affect the yield and properties of the produced EVs, limiting their application in therapeutic, cosmetic, and nutraceutical uses.

Method used

A process for cultivating microalgae under stress conditions like light, salinity, pH, temperature, and nutrient starvation to enhance the production of extracellular vesicles (MEVs) with improved functional properties, achieving yields of at least 2.5x10^9 MEVs per liter and sizes between 50-200 nm, suitable for therapeutic, cosmetic, and nutraceutical applications.

Benefits of technology

The process results in MEVs with enhanced functional properties for skin barrier protection, antioxidant, and anti-aging effects, demonstrating high yield and safety for human use, and can be standardized and scaled up under good manufacturing practices.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000037_0000
    Figure 00000037_0000
  • Figure 00000037_0001
    Figure 00000037_0001
  • Figure 00000037_0002
    Figure 00000037_0002
Patent Text Reader

Abstract

The present invention relates to a process for isolating Extracellular Vesicles (EV) secreted by microalgae (MEV – microalgae extracellular vesicle) cultured in basal and stress environment conditions namely pH, salinity, light, nutrient starvation, and temperature. Additionally, microalgae can be cultivated in thermal water classified as bicarbonate, sulphate, sulphide, chloride, or weakly mineralized trace metal. The present invention also relates to compositions comprising said MEV, which are useful to be applied to therapeutic, cosmetic, nutraceutical, phytopharmaceutical and medical including veterinary applications. The present invention lays in the technical domain of pharmaceuticals, medicine, cosmetics, nutraceutical, veterinary and research and development in cellular biology and appliances thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]DESCRIPTION COMPOSITIONS COMPRISING SMALL EXTRACELLULAR VESICLES DERIVED FROM MICROALGAE, A PROCESS FOR OBTAINING THEM AND USES THEREOF Technical field The present invention relates to a process for isolating Extracellular Vesicles (EV) secreted by microalgae (MEV – microalgae extracellular vesicles) cultured in basal and stress environment conditions namely pH, salinity, light, nutrient starvation, and temperature. Additionally, microalgae can be cultivated in thermal water classified as bicarbonate, sulphate, sulphide, chloride, or weakly mineralized trace metal. The present invention also relates to compositions comprising said MEV, which are useful to be applied to therapeutic, cosmetic, nutraceutical, phytopharmaceutical and medical including veterinary applications. The present invention lays in the technical domain of pharmaceuticals, medicine, cosmetics, nutraceutical, veterinary and research and development in cellular biology and appliances thereof. Background of the invention Extracellular vesicles (EV) are small (30-200 nm), membrane- enclosed structures released by cells, including unicellular microorganisms like microalgae. EV play crucial roles in intercellular communication, transferring various biomolecules such as proteins, lipids, and nucleic acids between cells. EV participate in diverse physiological processes, including immune regulation, tissue repair, and signalling. EV hold great promise for revolutionizing diagnostics, therapeutics, cosmetic and phytopharmaceutical across a wide range of fields. Microalgae are a sustainable source of bioactive compounds with a wide range of applications, namely food supplements and cosmetic ingredients. Recently, it was demonstrated that microalgae are EV producers and are a scalable source of EV, known as microalgae extracellular vesicles (MEV). MEV have been isolated from different microalgae species cultured in basal conditions and mainly in autotrophic conditions. Document WO2021 / 122880Al discloses a method for isolation of MEV from microalgae of the following divisions: Euglenophyta, Cryptophyta, Rhodophyta, Glaucophyta, Chromophyta, and Chlorophyta in autotrophic conditions. This document is silent regarding the production of said microalgae under stress conditions or the effect of abiotic stress in the properties of the produced MEVs. Additionally, documents WO2022053689A2 and WO2022053687A2 disclose methods for MEV isolation from Chlorella genus, wherein the MEVs contain small RNAs. In these methods, Chlorella is transformed with siRNA or miRNA, the isolation of those MEVs, and their use as a system for delivering the contained small RNA. This document is silent regarding the production of said microalgae under stress conditions or the effect of abiotic stress in the properties of the produced MEVs. Documents WO2023144127A1 and WO2023001894A1 disclose methods for exogenously loading bioactive molecules into MEV secreted by Chlorella cultivated in autotrophic conditions. Also, it is not disclosed herein, the process of cultivation of said microalga under stress conditions or the effect of the abiotic stress in the properties of the produced MEVs. However, microalgae biomass yield is influenced by abiotic stress environments such as temperature, salinity, pH, light, cultivation in thermal water, and nutrient starvation. Microalgae have developed various mechanisms in order to overcome these threats. They sense the external stress environment, get stimulated and then generate appropriate cellular responses. They do this by stimuli received from the sensors located on the cell surface or cytoplasm and transferred to the transcriptional machinery situated in the nucleus, with the help of various signal transduction pathways. This leads to differential transcriptional changes making the microalgae tolerant against the stress. The signalling pathways act as a connecting link and play an important role between sensing the stress environment and generating an appropriate biochemical and physiological response. In response to stimuli, mammalian cells secrete more extracellular vesicles, and their composition differs from those secreted under non-stressed conditions. This study reveals that microalgae cultivated under environmental stress, such as changes in salinity, pH levels, nutrient deprivation, temperature variations, thermal water exposure, or a combination of these stimuli, secrete increased amounts of extracellular vesicles. It is known that lipid accumulation can increase upon nutrient starvation, high salinity, or strong light. It is also known that Dunaliella sp. produces more β-carotene in higher salinity and strong light conditions. The widespread utilization of the maximum photochemical efficiency of photosystem II (Fv / Fm) has been employed to evaluate the influence of environmental stressors on phytoplankton, like microalgae. Nutrient-starved microalgae exhibited a decreased Fv / Fm, which subsequently increased upon nutrient replenishment. Given the above-mentioned prior art problems, it is the aim of the invention to develop a system that promotes the increase of microalgae extracellular vesicles (MEV) production and to products and compositions thereof to be used in several technical areas, such as therapeutic, cosmetic, nutraceutical, phytopharmaceutical and medical including veterinary applications. For that purpose, it is herein disclosed MEV isolated from different microalgae cultured under various abiotic stress conditions, such as light, salinity, nutrient starvation, temperature, thermal water, or pH stress. Additionally, in this composition, microalgae are grown in autotrophic, heterotrophic, or mixotrophic conditions, and compositions comprising said MEV. Summary of the invention The present invention relates to a process for isolating extracellular vesicles (EV) secreted by microalgae (MEVs), and compositions comprising said MEV, which are useful to be applied to therapeutic, cosmetic, nutraceutical, phytopharmaceutical or veterinary. In a first embodiment, the present invention discloses a process for cultivating microalgae under stress conditions namely light, salinity, pH, temperature, nutrient starvation, thermal water, or a combination of these stimuli according to claim 1. This process achieves MEV with particles sizing between 50 and 200 nm representing >60% of the sample and a high yield of at least 2.5x10^9MEV from each L of microalgae medium with improved functional properties, such as skin barrier protection, antioxidant, anti-aging and anti-wrinkle activity. Moreover, it can be easily standardized and upscaled under good manufacturing practices (GMP). Accordingly, in a second embodiment, the present invention relates to such MEVs, as produced by the process of claim 1, with improved functional characteristics, as described in claim 10. Also, compositions comprising said isolated MEV are disclosed in the scope of the present invention, as described in claim 11. The above-indicated compositions can be used as a cosmetic, nutraceutical, therapeutic, phytopharmaceutical, and medical, including veterinary applications. Description of the figures Figure 1 – Presents growth curves of microalgae grown in autotrophic conditions, to assess the effects of the respective MEV produced in these conditions, wherein: A) Growth curves (OD 440 nm) of Chlorella sp and Phaeodactylum sp for 21 days in autotrophic conditions. B) Growth curves (OD 440 nm) of Seminavis sp and Dunaliella sp for 21 days in autotrophic conditions. Figure 2 – Presents growth curves and Fv / Fm ratio under different light conditions, to assess the effects of this factor in the respective MEV produced, wherein Fv=Fm-Fo and where Fm = maximum fluorescence, and Fo = minimal fluorescence, and the following curves were obtained: A) Growth curves of Chlorella sp (CHL): 7 days in basal light conditions followed by 4 days under high and low light. B) Growth curves of Phaeodactylum sp (PHD): 7 days in basal light conditions followed by 4 days under high and low light. C) Maximum PSII quantum yield (Fv / Fm) measurements of Chlorella sp for 7 days in basal light conditions followed by 4 days under high and low light. D) Maximum PSII quantum yield (Fv / Fm) measurements of Phaeodactylum sp (PHD) for 7 days in basal light conditions followed by 4 days under high and low light. E) Growth curves of Seminavis sp (SMN) 10 days in basal light conditions followed by 3 days under high and low light. F) Maximum PSII quantum yield (Fv / Fm) measurements of Seminavis sp for 10 days in basal light conditions followed by 3 days under high and low light. The growth rate of PHD and SMN was similar between stress and non-stress conditions. However, the growth rate decreased under light stress in CHL conditions. The Fv / Fm ratio decreased when cells (CHL, PHD and SMN) were exposed to low light conditions, indicating that the photosynthetic efficiency of the CHL, PHD and SMN were compromised, thus confirming that the CHL, PHD and SMN microalgae were cultivated under stress. Figure 3 – Presents the toxicity assay results of Chlorella sp MEVs (MEV_CHL) from industrial heterotrophic conditions, to assess the toxicity effects of the respective MEVs produced in these conditions. Optical densities (OD) were measured after 5h incubation with XTT reagents on: (A) NHDF (fibroblasts), and B) HaCaT (keratinocytes) treated with two distinct concentrations of each MEV_CHL obtained from Chlorella sp cultivated in industrial heterotrophic conditions. These results show that MEV_CHL compositions are safe, not presenting cytotoxic effects in vitro, thus indicating that CHL_MEV can be safely used in humans. Figure 4 – Presents the effect of MEV_CHL isolated from industrial medium of heterotrophic cultures on keratinocytes, wherein: A) Keratin 5 (K5) expression by HaCaT (keratinocytes) cells. Expression of K5 increased upon MEV_CHL treatment, B) Involucrin (IVL) expression by HaCaT (keratinocytes) cells. Expression of IVL increased upon MEV_CHL treatment. C) Ocludin (OCL) expression by HaCaT (keratinocytes) cells. Expression of OCL increased upon MEV_CHL treatment. Statistical analyses were performed by One-sample t-test (theoretical mean of 1) and statistically significant differences were represented (* p<0.05). Data represent mean ± SD of at least 2 independent experiments. Figure 5 – Presents the effect of MEV_CHL isolated from industrial medium of heterotrophic cultures on skin fibroblasts, wherein: A) Collagen 3 expression (COL3) expression by NHDF (fibroblast) cells. Expression of COL3 increased upon MEV_CHL treatment. B) Hyaluronic acid synthetase 3 (HAS3) expression by NHDF (fibroblast) cells. Expression of HAS3 increased upon MEV_CHL treatment. C) Catalase I (CAT1) expression by NHDF (fibroblasts) cells. Expression of CAT1 increased upon MEV Chlorella sp treatment. D) Superoxide dismutase I (SOD1) expression by NHDF (fibroblasts) cells. Expression of SOD1 increased upon MEV_CHL treatment. Statistical analyses were performed by One-sample t-test (theoretical mean of 1) and statistically significant differences were represented (* p<0.05). Data represent mean ± SD of 3 independent experiments. Description of the invention The present invention relates to a process for isolating Extracellular Vesicles (EV) secreted by microalgae (microalgae extracellular vesicles, also known as MEVs) and to compositions thereof, which are useful to be applied to therapeutic, cosmetic, nutraceutical, phytopharmaceutical and medical, including veterinary areas. In the scope of the present inventions, the following expressions have the respective meanings: Stress conditions: any unfavorable condition or substance that affects or blocks a microalga’s metabolism, growth, or development is regarded as stress. Stress can be further divided into i) abiotic, ii) biotic, and iii) anthropogenic. In the scope of the present invention, only abiotic stress is addressed. Basal conditions: specific conditions adequate for growing each microalgae species, also known as “normal growth conditions”. Basal conditions can be related to one or more relevant growth factors for a given microalgae, such as light, temperature, conditions, and salinity, among others. Autotrophic conditions: specific conditions adequate for growing each microalgae species where the only source of energy comes from their photosynthesis process, in opposition to the use of other energy sources such as sugars (heterotrophic) or combinations of thereof (mixotrophic). Therefore, in respect to the stress intensity provided to a given microalgae culture being “higher or lower” means that said stress stimuli is “higher or lower” in reference to the basal culture conditions for that specific microalgae species. 1. Process for cultivating and isolating microalgae extracellular vesicles (MEV) The process of the present invention relates to the production and isolation of microalgae extracellular vesicles (MEV) in a reliable, reproducible, and consistent manner resulting in high yields of the desired MEVs in a scalable manner. It is herein disclosed, microalgae cultures under stressful environmental conditions, namely pH, salinity, light, nutrient starvation, and temperature. Additionally, microalgae can be cultivated in thermal water classified as bicarbonate, sulphate, sulphide, chloride, or weakly mineralized trace metal (Table I). Table I – Thermal water classification Thermal water characteristics pH classification MineralizationSulphurous, Bicarbonate, Sodium Alkalin Poorly mineralizedSulphurous, Sodium, Chloride Alkalin Poorly mineralizedCarbonate, Bicarbonate Alkalin HypersalineSodium Chloride Acid Poorly mineralizedSodium Chloride Neutral HypersalineChloride, Sodium Alkalin HypersalineCarbonate, Bicarbonate, Sodium Acid HypersalineSulphurous, Bicarbonate, and Sodium Alkalin Poorly mineralizedSulphurous, Sodium Bicarbonate, Fluoride, Silica Alkalin Poorly mineralizedSulphurous, Bicarbonate, Sodium, and Fluoride Alkalin Poorly mineralizedSulphate, Calcium, and Magnesium Neutral HypersalineSulphurous, Sodium, Silicates Alkalin Poorly mineralizedBicarbonate, Sodium, Fluoride Alkalin Poorly mineralizedBicarbonate, Calcium Alkalin poorly mineralizedBicarbonate Acid HypersalineSilica, Chloride, Sodium, Potassium Acid Poorly mineralizedBicarbonate, Sodium, Calcium, Magnesium, Silica Acid Poorly mineralizedSulphurous, Sodium, and Fluoride Alkalin HypersalineSulphurous, Chloride, and Sodium Alkalin Poorly mineralizedBicarbonate, Magnesium, Iron Acid Poorly mineralizedFluoride, Sulfate, Calcium, Chloride, Silica, Sulphurous, SodiumAlkalin Poorly mineralizedBicarbonate, Sodium, Carbonate, Fluoride, Sulphurous Alkalin Poorly mineralizedBicarbonate, Sodium, Thiosulfate Alkalin Poorly mineralizedIn general, the process of the invention comprises the following steps: 1.1 Microalgae cultures Microalgae can grow on autotrophic, heterotrophic or mixotrophic conditions. Table II contains a list of some microalgae species and phyla used in the scope of the present invention. 10 / 6 Table II – Microalgae species and respective phylum Microalgae species Phylum Chlorellla sp Chlorophyta Seminavis sp Heterokontophyta Dunaliella sp Chlorophyta Phaeodactylum sp Heterokontophyta Nannochloropsis Heterokontophyta Tetraselmis Chlorophyta Isochrysis Haptophyta Thraustochytrium sp. Heterokontophyta Parachlorella sp. Chlorophyta Rhinomonas sp Cryptophyta Chromera sp Chromeridophyta It is known that MEV secretion can be influenced by light intensity, photoperiod, salinity, pH, nutrient starvation, temperature or thermal water treatment or a combination of abiotic stresses. For assessing the effect of said culture conditions in the MEVs secretion, Dunaliella sp., Phaeodactylum sp., and Seminavis sp are grown in f / 2 medium (Table IX) with filtered and autoclaved seawater prepared as described by Andersen et al., 2005. This medium is herein used to establish, grow, and maintain conventional microalgae cultures. In the scope of the present invention, autotrophic Chlorella sp. (CHL) freshwater medium based on MBL - Medium Woods-Hole as described by Al-lwayzy et al., 2014 or on BG-11 (blue-green medium) supplemented with trace metals, vitamin B12, biotin and thiamine (Table X) as described by Purkayastha et al., 2017 is herein preferably used for establishing the conventional microalgae cultures. 11 / 6 These microalgae cultures are kept under climatised conditions with predetermined light / dark cycles of 12 / 12 hours. The typical light intensity for microalgae grow is about 60 μmol / m / s (Lv et al., 2010). To test the effect of light stress on microalgae growth, high irradiation conditions of 120 μmol / m / s and low light irradiation conditions of 20.7 μmol / m / s were used. 1.2 Collection and processing of microalgae medium Microalgae medium can be obtained from autotrophic, mixotrophic or heterotrophic microalgae cultures. In this sense, microalgae medium can be obtained from the respective cultures by separating the microalgae biomass from the culture medium. This separation process can be done by any known methods but is preferably done by centrifugation or by tangential flow filtration of the culture for separating the biomass fraction from the medium and recovery of the liquid fraction of the culture medium for further use. Microalgae media from Chlorella sp. (phylum Chlorophyta), Dunaliella sp. (phylum Chlorophyta), Phaeodactylum (phylum Heterokontophyta), and Seminavis sp. (phylum Heterokontophyta) are herein disclosed. 1.3 MEV purification MEV can be isolated by known methods in the art, such as by ultrafiltration and / or ultracentrifugation. The resulting microalgae permeate can be further cleared from debris and particles with more than 220 nm in size, using sequential micro and ultrafiltration techniques or tangential flow filtration. Optionally, MEV can be additionally purified by size exclusion chromatography (SEC). Thereafter, the filtered permeate is preferably concentrated with the use of a 100 – 500 KDa pore filter either by using 12 / 6 centrifugation techniques or by tangential field flow unit with 100-500KDa pore. In a last purification step, the concentrated solution can be injected in a high-performance SEC column and the corresponding fractions collected under refrigerated conditions, preferably at a temperature of 4 to 10ºC. An additional lyophilisation step may be also performed in order to produce a storable product and / or to produce compositions that can be used in later occasions. 1.4 Small Extracellular Vesicles (SEVs) modification Isolated MEV can be modified to increase their bioactive efficiency. These modifications may be done either in the initial steps of the isolation process, for e.g. culturing microalgae in stress conditions, such as lower or higher light, pH, nutrient starvation, temperature, salinity, cultivation in thermal water classified as bicarbonate, sulphate, sulphide, chloride, or weakly mineralized trace metal, or in conditions of a combination of different stimuli or even performed to the obtained MEVs in a post-production phase. In the present invention, a pre-production modification is preferred. The pre-production modifications are easier to perform, cheaper and enhances the yield of MEV comparing to post-production modifications. Post-production modifications can be done by enriching MEVs with selected bioactive molecules including hydrophilic, lipophilic, and amphipathic compounds, which are responsible or involved in cosmetical, nutraceutical, phytopharmaceutical, veterinary or therapeutic applications, according to the described in WO2023144127A1 and WO2023001894A1. 13 / 6 The resulting enriched MEVs incorporate the selected bioactive molecules, as mentioned above. In the scope of the present invention, suitable enrichment processes are performed by sonication, incorporation, freeze thawing and extrusion, as known in the art. 2. Characterization of MEV MEV were characterized in terms of concentration, size, and amount of protein. Nanoparticle Tracking Analysis (NTA technique) is used to analyse the size distribution of the isolated MEV. The profile of the curve is centred in sizes below 200 nm, and the average size obtained is close to 150 nm. These results are compatible with the expected size of MEV, that is reported in the literature to be within 50-200 nm. Additionally, the NTA analysis measures the concentration of MEV in the composition by calculating the number of particles per millilitre of sample. Table III shows general characteristics of MEVs isolated from Chlorella (CHL), Dunaliella (DUN), Phaeodactylum (PHD) or Seminavis (SMN) after 6 days of cultivation. Table III – Characteristics of MEVs isolated from microalgae Total Particle / Modal size Mean size Microalgae particle cell (nm) (nm) number Chlorella sp. 9.80E+10 6.70E+05 170.8±62.24 166.8±37.36 (CHL) Phaeodactylum 1.10E+09 1.00E+03 139.3±16.04 142.5±15.15 sp. (PHD) Dunaliella 1.10E+10 2.10E+05 216.6±72.55 228.9±60.63 sp. (DUN) Seminavis sp. 8.00E+10 4.00E+06 130.9±10.74 142±16.01 (SMN) 14 / 6 The effect of light intensity (low and high) on the growth of microalgae and the secretion of MEV are herein disclosed. For this purpose, the microalgae strains CHL and PHD, cultivated under basal light conditions for 7 days, followed by 4 days under low or high light conditions are considered. Additionally, microalgae strain SMN, cultivated for 10 days under basal light conditions, followed by 3 days under low or high light conditions is also taken into account. It is possible to observe that the number of MEV secreted by CHL is 5.3 times higher under high light conditions compared to low light conditions. Similarly, the number of MEV secreted by PHD and SMN is 1.7 and 2.27 times higher, respectively, under high light conditions compared to low light conditions (Table IV). Furthermore, it is possible to observe that MEV secreted by CHL, PHD and SMN under both high and low light conditions range in size between 50 and 200 nm, which falls within the range of extracellular vesicle sizes. This observation corroborates that this composition is based on small EV (Table IV). Table IV – Characteristics of MEVs isolated from microalgae cultivated under low and high light conditions. Total Particle Modal size Mean size Microalgae Light number / cell (nm) (nm) Chlorella sp. Low 1 1 82.4 98 (CHL) Chlorella sp. High 5.30 3.965763 114.9 146.4 (CHL) Phaeodactylum Low 1 1 155.5 146.6 sp. (PHD) Phaeodactylum High 1.70 1.178947 116.4 121.7 sp. (PHD) Seminavis sp. Low 1 1 139.7 150.7 (SMN) Seminavis sp. High 2.27 2.3 141 142 (SMN) (1) Fold change to low light conditions, 15 / 6 The evaluation of the impact of pH stress on CHL MEV secretion is also herein disclosed. For this purpose, cultures of CHL under autotrophic conditions for 14 days in basal medium at pH 6.8, and in alkaline medium at pH 8 and cultures of CHL for 10 days in basal medium at pH 6.8 followed by 4 days in alkaline medium at pH 8 were established. It is possible to observe that the number of MEV is 6.6 times higher when CHL is cultivated for 14 days at pH 8 and is 4 times higher when cultured for 10 days at pH 6.8 followed by 4 days at pH 8. Furthermore, it is possible to observe that MEV secreted by CHL under pH stress conditions range in size between 138 and 171 nm, which falls within the range of extracellular vesicle sizes (50-200 nm). This observation corroborates that this composition is based on small EV. Table V – Characteristics of MEVs isolated from CHL cultivated under pH 6.8 or pH 8. pH Total Particle Modal Mean size Microalgae conditions number / cell size (nm) (nm) Chlorella pH 6.8 for 1 1 130.25 138.4 sp. (CHL) 14 days Chlorella pH 8 for 14 6.60 4.7 156.1 171.25 sp. (CHL) days pH 6.8 for Chlorella 10 days + pH 4 3.3 132.3 146.55 sp. (CHL) 8 for 4 days (1) Fold change to pH 6.8 conditions. The evaluation of the impact of increased salinity (12 g / L of NaCl) on CHL growth and MEV secretion is herein disclosed. For this purpose, CHL cultured for 14 days under high salinity conditions or for 10 days under basal conditions followed by 16 / 6 4 days under higher salinity conditions is herein considered. It is possible to observe that the number of particles under higher salinity conditions is similar to that under basal conditions. However, it is also possible to notice a slight increase in the number of particles, when CHL is cultivated under higher salinity conditions, as presented in Table VI. CHL under salinity stress conditions range in size between 138 and 141 nm, which falls within the range of extracellular vesicle sizes (50-200 nm). This observation corroborates that this composition is based on small EV (Table VI). Table VI – Characteristics of MEVs isolated from CHL cultivated under low and high salinity. Total Modal Mean Salinity Particle Microalgae particle size size condition / cell number (nm) (nm) Chlorella No added NaCl 1 1 130.25 138.4 sp. (CHL) Chlorella 12g / L NaCl added 1.26 2.9 144.9 141.25 sp. (CHL) for 14 Days No added NaCl 10 Chlorella Days + 4 days 12 0.7 0.54 132.3 131.25 sp. (CHL) g / L NaCl (1) Fold change to basal conditions. In addition, the influence of heterotrophic and mixotrophic growth conditions on MEV secretion is also disclosed. It is possible to observe that CHL exhibits significantly higher MEV secretion, when cultivated under heterotrophic conditions (13.81-fold increase) or mixotrophic conditions (11.3-fold increase) compared to autotrophic conditions, as presented in Table VII. CHL under autotrophic, heterotrophic and mixotrophic conditions range in size between 157 and 176 nm, which falls within the range of extracellular vesicle sizes (50-200 nm). This observation corroborates that this composition is based on small EV (Table VII). 17 / 6 Table VII – Characteristics of MEVs isolated from CHL cultivated under autotrophic, heterotrophic, or mixotrophic conditions. Total Particle Modal size Mean size Microalgae Condition particle / cell (nm) (nm) number Chlorella Autotrophy 1.00 1 149.8 157.5 sp. (CHL) Chlorella Heterotrophy 13.81 1.22 137 164.3 sp. (CHL) Chlorella Mixotrophy 11.30 1.75 173.2 175.7 sp. (CHL) (1) Fold change to autotrophic conditions. 3. Compositions comprising MEVs Compositions comprising MEVs isolated by ultrafiltration are herein analysed and characterized based on their protein content. Protein concentrations of these compositions can be assessed by using a micro bicinchoninic acid (BCA) protein assay kit. As observed, protein concentration in the MEV solutions can vary with cultivation conditions and differed among microalgae species. According to the present invention, the range of protein concentration is of 8.4 and 1220.9 µg / mL. Additionally, the amount of protein per 1E10 particles, and this ratio ranged from 0.4 to 111.3 µg of protein per 1E10 particles, as presented in Table VIII. Differences in MEV protein content are often translated into different functional properties. 18 / 6 Table VIII – Protein concentration per MEV isolated from different cultivation conditions and protein per 1E10 particles. Protein Protein / 1x10 Microalgae Culture conditions (µg / mL) particles Chlorella sp. Basal conditions 8.38 0.4 (CHL) Chlorella sp. Low light 16.30 141.6 (CHL) Chlorella sp. High light 16.53 22.8 (CHL) Chlorella sp. pH 6.814 days 218.38 88.2 (CHL) Chlorella sp. pH 814 days 1220.90 74.3 (CHL) Chlorella sp. pH 6.810 days + 141.89 12.8 (CHL) pH 84 days Chlorella sp. 12g / L NaCl added 220.66 63.6 (CHL) for 14 Days No added NaCl 10 Chlorella sp. Days + 4 days 12 54.30 29.8 (CHL) g / L NaCl Chlorella sp. Autotrophy 18.05 15.2 (CHL) Chlorella sp. Heterotrophy 638.98 60.5 (CHL) Chlorella sp. Mixotrophy 624.05 102.8 (CHL) Dunaliella sp. Basal conditions 36.09 11.2 (DUN) Phaeodactylum Basal conditions 24.40 82.7 sp. (PHD) Phaeodactylum Low light 15.00 111.3 sp. (PHD) Phaeodactylum High light 23.75 93.5 sp. (PHD) Seminavis sp. Basal conditions 34.32 1.1 (SMN) Seminavis sp. Low light 22.65 59.3 (SMN) Seminavis sp. High light 40.83 98.6 (SMN) 19 / 6 4. Properties of compositions comprising MEVs 4.1 In vitro toxicity of MEV The effect of MEV on the proliferation and metabolism of fibroblasts and keratinocytes, according to the present invention is herein disclosed. For this purpose, cultures of fibroblasts and keratinocytes incubated with 20,000 and 100,000 MEV per cell from Chlorella (CHL_MEV) were established. It is possible to observe that CHL_MEV did not show an effect on cell proliferation, indicating that CHL_MEV are safe and do not present toxic effects. 4.2 Skin barrier protection of MEV The effect of CHL_MEV as a skin barrier protective agent, according to the present invention is herein disclosed. For this purpose, cultures of keratinocytes with an amount varying from 20,000 to 100,000 particles of CHL_MEV were established. Then extraction of the respective RNA and the expression of Keratin 5 (K5), involucrin (IVL), and occludin (OCL) can be assessed by qPCR, as known in the art. It is possible to observe that the expression of these three markers of skin barrier increased upon CHL_MEV treatment, indicating a protective effect of CHL_MEV on the skin barrier. Accordingly, compositions comprising CHL_MEV of the present invention can be advantageously used in the treatment of sensitive, dry, and / or irritable skin conditions. 4.3 Skin anti-aging effect of MEV The efficacy of CHL_MEV as a skin anti-aging agent is also herein disclosed. For this purpose, cultures of fibroblasts, as described in the previous sub-section 4.2 were established. 20 / 6 Subsequently, RNA was extracted, and the expression levels of collagen 3 (COL3) and Hyaluronan synthase 3 (HAS3) were quantified using qPCR techniques as known in the art. It is known that the expression of COL3 and HAS3 tends to decrease in aged or photodamaged skin. However, upon treatment of fibroblasts with CHL_MEV, an increase in their expression can be observed, showing the anti-aging effect of the compositions comprising CHL_MEV, according to the present invention. 4.3 Skin anti-oxidative effect of MEV The efficacy of CHL_MEV as a skin antioxidant agent is herein disclosed. For this purpose, cultures of fibroblasts were established, and the respective RNA was extracted as described in the previous sub-section 4.2. The expression levels of catalase 1 (CAT1) and superoxide dismutase 1 (SOD1) were assessed using qPCR techniques. It is known that the expression of CAT1 and SOD1 tends to decrease in aged or pollution-exposed skin. However, upon treatment of fibroblasts with compositions comprising CHL_MEV, according to the present invention, it is possible to observe an increase in the expression of CAT1 and SOD1 demonstrating the anti-aging effects of CHL_MEV. Accordingly, compositions comprising CHL_MEV of the present invention can be advantageously used in the treatment of aged, pollution-exposed, and / or photodamaged skin conditions. 5. Pharmaceutical, cosmetical and nutraceutical compositions Compositions comprising microalgae extracellular vesicles (MEVs) as previously described in section 3 are produced by adding an adequate concentration of MEVs to an adequate pharmaceutical and / or cosmetic agent. Suitable agents are also included in the scope of these compositions, such as binders, 21 / 6 colorants, aromatisers, carriers, surfactants, dispersants, vitamins, acceptable pharmaceutic salts, amongst others known in the art, and mixtures thereof. Accordingly, said compositions are presented in the form of a gel, cream, paste, suspension or liquid solution, powder, and included in medical or cosmetic carrier devices, such as patches, adhesive or not, pockets or other type of functional recipients. 22 / 6 EXAMPLES Example 1. Microalgae autotrophic culture without stress For comparative purposes, microalgae selected from the genus Chlorella sp. (CHL), Dunaliella sp., (DUN) Phaeodactylum sp. (PHD), and Seminavis sp. (SMN) were cultivated in autotrophic conditions at 18ºC with predetermined light / dark cycles of 12 / 12 hours under conventional light conditions, i.e. light irradiation of 60 μmol / m / s. Microalgae were cultivated for 6 days in these conditions. DUN, PHD and SMN were grown in f / 2 medium with the composition as described in Table IX and by using filtered and autoclaved seawater prepared as described by Andersen et al., 2005. This medium was used to establish conventional microalgae cultures. Table IX – f / 2 medium composition Component mg / LNaNO3 75NaH2PO4 · H2O 5Na2SiO3 · 9H2O 30FeCl3 · 6H2O 3150 Na2EDTA · 2H2O 4360 MnCl2 · 4H2O 180ZnSO4 · 7H2O 22CoCl2 · 6H2O 10CuSO4 · 5H2O 9.8Na2MoO4 · 2H2O 6.3Thiamine · HCl (vitamin B1) 200 Biotin (vitamin H) 1Cyanocobalamin (vitamin 1 B12) In the scope of the present invention, autotrophic Chlorella sp. freshwater medium based on MBL (Medium Woods-Hole) as described by Al-lwayzy et al., 2014, or on BG-11 (Blue-Green Medium) supplemented with trace metals, vitamin B12, biotin, and thiamine as described by Purkayastha et al., 2017, with 23 / 6 the composition shown in Table X. This is the preferred culture medium used for establishing the conventional microalgae cultures. Microalgae were cultivated between 6 and 14 days. Table X – MBL / BG11 medium composition Component mg / LNaNO3 1500K2HPO4 31.4EDTA 1Ferric ammonium citrate 6MgSO4-7H2O 36Na2CO3 H2O 20Potassium phosphate dibasic 39 Sodium Molybdate (Na2MoO4-2H20) 0.391EDTA 1Thiamine · HCl (vitamin B1)200Biotin (vitamin H) 1Cyanocobalamin (vitamin B12) 1H3BO3  2.86MnCl2  1.81ZnSO4 · 0.22Na2MoO4 · 2H2O 0.39 CuSO4 · 5H2O0.079Co(NO3)2·6H2O 4 0.049Microalgae were counted and the optical density (OD) was measured at the absorbance wavelength at 440 nm. OD is used to estimate the microalgae density in the culture. The OD of all microalgae species increased during the 21 days of culture, as shown in Figure 1. Example 2. Microalgae autotrophic culture under light stress Microalgae from the genus Chlorella (CHL) and Phaeodactylum (PHD) were cultivated in autotrophic conditions at 18ºC under light stress conditions during 14 days in order to assess the effect of light stress on MEV secretion. For this 24 / 6 purpose, 2 different light conditions and corresponding culturing length were established as below: a) Light / dark cycles of 12 / 12 hours light, with low light irradiation of 20.7 μmol / m / s, for 7 days, followed by b) Light / dark cycles of 12 / 12 hours under high light conditions, i.e. with light irradiation of 120 μmol / m / s, for 4 days. After the culturing period is ended, microalgae were harvested by centrifugation, at a rate of 1000 g for 10 minutes, then the supernatant was collected, filtered twice using a filter membrane with a 200-250 nm pore and ultrafiltered with a 100 - 500 kDa pore. MEVs concentration, modal and mean sizes were measured using a Nanoparticle Tracking Analysis (NTA) equipment. The yield of MEV increased by between 1.7 and 5 times upon a high light stimulus, as shown in Table IV. Microalgae growth was assessed by counting microalgae and measuring OD at 440 nm. Microalgae growth was similar between low and high light conditions, as presented in Figure 2 A,B. Fv / Fm ratio was measured to assess stress conditions, wherein Fv=Fm-Fo where Fm (maximum fluorescence) and Fo (minimal fluorescence). The Fv / Fm ratio reduced upon a low light stimulation indicating that the light stress affected the photosynthesis system, suggesting that the microalgae are under stress, as presented in Figure 2 C,D. Seminavis sp. was also cultivated under light stress conditions as previously described. However, the duration and intensity of light irradiation conditions were different and established as below: a) high light irradiation of 120 μmol / m / s, for 10 days, followed by b) low light irradiation of 20.7 μmol / m / s, for 3 days. The growth rate of SMN was similar between low and high light conditions (Figure 2 E). 25 / 6 The Fv / Fm ratio reduced upon low light stimulation, indicating that the light stress affected the photosynthesis system, suggesting that the microalgae are under stress (Figure 2 F). The number of MEV increased by 2.27 times when SMN was cultivated under high light conditions compared to low light conditions (Table IV). Example 3. Chlorella in autotrophic culture under pH stress Chlorella was cultivated in autotrophic conditions at 18ºC with predetermined light / dark cycles of 12 / 12 hours under light conditions (100 μmol / m / s) for 10 days in medium with pH=6.8 or pH=8 plus 4 days in medium with pH=6.8 or pH=8. The collection of supernatant, MEV isolation and their characterization (concentration and size) were performed as described in Example 2. We observed that the number of MEV was 6.6 times higher when CHL was cultivated for 14 days at pH 8, or 4 times higher when cultured for 10 days at pH 6.8 followed by 4 days at pH 8. Additionally, the mean size of the MEV appeared to be larger when CHL was cultivated under conditions with higher pH (refer to Table V). Example 4. Chlorella in autotrophic culture under salinity stress Chlorella was cultivated in autotrophic conditions at 18ºC with predetermined light / dark cycles of 12 / 12 hours under light conditions (100 μmol / m / s) for 10 days in medium with or without 12 g / L of NaCl plus 4 days in medium with or without 12 g / L of NaCl. The collection of supernatant, MEV isolation and their characterization (concentration and size) were performed as described in Example 2. The yield of MEV production by Chlorella sp. under salinity stress increased 50% when compared to basal conditions (Table VI). 26 / 6 Example 5. Chlorella sp. cultivated in autotrophic, heterotrophic or mixotrophic conditions. Chlorella was cultivated under different conditions: heterotrophic conditions (BG-11 medium supplemented with 10 g / L glucose) in the dark at 28ºC, mixotrophic conditions (BG-11 medium supplemented with 10 g / L glucose) under light (100 μmol / m / s) at room temperature (RT), or autotrophic conditions (BG-11 medium) under light (100 μmol / m / s) at RT. The collection of supernatant, MEV isolation and their characterization (concentration and size) were performed as described in Example 2. The yield of MEV production by Chlorella sp. under heterotrophic or mixotrophic conditions was 15 or 10 times higher, respectively, than under autotrophic conditions (Table VII). Example 6. Safety of MEV from Chlorella sp. in fibroblasts and keratinocytes For these experiments MEV were isolated from heterotrophic Chlorella grown in industrial conditions. To assess the effect of MEV from Chlorella sp on cellular proliferation and possible cytotoxicity, XTT assay (PanReac AppliChem) was performed. XTT measures cellular metabolic activity as the yellow tetrazolium salt is reduced to an orange formazan dye. Fibroblasts were plated at 10000 cells / cm2in DMEM with 10% FBS. The medium was changed 24h later to MEV from Chlorella sp-containing DMEM with 2% FBS (exosome-depleted). HaCaT were plated at 17 000 cells / cm2in supplemented DCBM. The medium was changed 24h later to MEV from Chlorella sp- containing supplemented dermal cell basal medium (DCBM). Each MEV from Chlorella sp sample was added twice, and two distinct concentrations were used (2x104and 1x105particles / cell). The treatments were separated by a 24h timespan. Control conditions were similar to treatments 27 / 6 except for MEV from Chlorella sp presence. On the fourth day, the XTT reaction solution was added to each well according to the manufacturer’s instructions and incubated for 5h before being measured on a microplate reader (Cytation3, Biotek). For both the NHDF and HaCaT, the XTT assay was replicated three times. CHL_MEV did not show an effect on cell proliferation, indicating that CHL_MEV are safe and did not present toxic effects (Figure 3). Example 7. Effect of MEV from Chlorella sp. on keratinocytes For these experiments, MEV were isolated from heterotrophic Chlorella grown in industrial conditions. To assess the skincare properties of MEV from Chlorella, the cells were plated and treated on 12-well plates. HaCaT were plated at 20 000 cells / cm2in supplemented DCBM and left for 48h before changing the medium for MEV from Chlorella-containing supplemented DCBM or differentiation medium. The MEV from Chlorella treatments contained 1x105particles / cell and were added twice, separated by a 24h time span. Control conditions were similar to treatments except for MEV from Chlorella presence. Total RNA extraction was performed using an RNA isolation kit (RNeasy miniKit, Qiagen) and total RNA concentration was measured using a Nanodrop 2000 spectrophotometer (Thermo Scientific). For cDNA synthesis, 500 ng of total RNA was added to SuperScript™ IV VILO™ Master Mix (Invitrogen) and ran on a thermocycler according to user guide instructions, using the following protocol: 25°C for 10 minutes, 50°C for 10 minutes, 85°C for 5 minutes. The quantitative PCR reactions were conducted on a CFX96 Optical Reaction Module (Bio-Rad) using the NZYSpeedy qPCR Green Master Mix (2x) (Nzytech). The amplification protocol used was 30 s at 95°C followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 15 s. 28 / 6 The 2-ΔΔCt method was used to perform relative quantification. This procedure was replicated three times for each analysed gene. K5 gene expression was analysed using the primers having SEQ.ID.NO. 7 and SEQ.ID.NO. 8 of; OCL gene expression was analysed using the primers having SEQ.ID.NO. 9 and SEQ.ID.NO. 10; IVL gene expression was analysed using the primers having SEQ.ID.NO. 13 and SEQ.ID.NO. 14; ACTB gene was used as housekeeping gene using the primers having SEQ.ID.NO. 15 and SEQ.ID.NO. 16 from Table XI, which were acquired to Invitrogen. The expression of Keratin 5 (K5), involucrin (IVL), and occludin (OCL) was assessed by qPCR. The expression of these three markers of skin barrier increased upon CHL_MEV treatment, indicating a protective effect of CHL_MEV on the skin barrier (Figure 4). Example 8. Effect of MEV from Chlorella sp. on skin fibroblasts For these experiments MEV were isolated from heterotrophic Chlorella grown in industrial conditions. To assess the skincare properties of MEV from Chlorella, the cells were plated and treated on 12-well plates. Fibroblasts were plated at 10 000 cells / cm2in DMEM with 10% FBS and left for 24h before changing the medium for DMEM with 10% FBS containing the MEV from Chlorella. The MEV from Chlorella treatments contained 1x105particles / cell and were added twice, separated by a 24h time span. Control conditions were similar to treatments except for MEV from Chlorella. Total RNA extraction was performed using an RNA isolation kit (RNeasy miniKit, Qiagen) and total RNA concentration was measured using a Nanodrop 2000 spectrophotometer (Thermo Scientific). For cDNA synthesis, 500 ng of total RNA was added to SuperScript™ IV VILO™ Master Mix (Invitrogen) and ran on a thermocycler 29 / 6 according to user guide instructions, using the following protocol: 25°C for 10 minutes, 50°C for 10 minutes, 85°C for 5 minutes. The quantitative PCR reactions were conducted on a CFX96 Optical Reaction Module (Bio-Rad) using the NZYSpeedy qPCR Green Master Mix (2x) (Nzytech). The amplification protocol used was 30 s at 95°C followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 15 s. The 2-ΔΔCt method was used to perform relative quantification. This procedure was replicated three times for each analysed gene. Col3A1 gene expression was analysed using the primers having SEQ.ID.NO. 1 and SEQ.ID.NO. 2 of; CAT1 gene expression was analysed using the primers having SEQ.ID.NO. 3 and SEQ.ID.NO. 4; SOD1 gene expression was analysed using the primers having SEQ.ID.NO. 5 and SEQ.ID.NO. 6; HAS3 gene expression was analysed using the primers having SEQ.ID.NO. 13 and SEQ.ID.NO. 14. ACTB gene was used as housekeeping gene using the primers having SEQ.ID.NO. 15 and SEQ.ID.NO. 16 from Table XI, which were acquired to Invitrogen. Subsequently, RNA was extracted, and the expression levels of catalase 1 (CAT1) and superoxide dismutase 1 (SOD1) were assessed using qPCR. It is known that the expression of CAT1 and SOD1 tends to decrease in aged or pollution-exposed skin. However, upon treatment of fibroblasts with CHL_MEV, an increase in the expression of CAT1 and SOD1 was observed, indicating the potential anti-aging effects of CHL_MEV. Therefore, it is plausible that aged, pollution- exposed, and / or photodamaged skin could benefit from treatment with CHL_MEV (Figure 5). 30 / 6 SEQUENCE LISTING Table XI – Sequence listing of primers SEQ.ID.1 Forward 5’ATTCACCTACACCGTTCTGG3’ COL3A1 SEQ.ID.2 Reverse 5’TGCGTGTTCGATATTCAAAG3’ SEQ.ID.3 Forward 5’AGCTGACACAGTTCGGGACC3’ CAT1 SEQ.ID.4 Reverse 5’CGAGCACGGTAGGGACAGTT3’ SEQ.ID.5 Forward 5’CATTGCATCATTGGCCGCAC3’ SOD1 SEQ.ID.6 Reverse 5’ACGACTTCCAGCGTTTCCTG3’ SEQ.ID.7 Forward 5’AGTTTGTGATGCTGAAGAAG3’ K5 SEQ.ID.8 Reverse 5’GTTAATCTCATCCATCAGTGC3’ SEQ.ID.9 Forward 5’GTCTAGGACGCAGCAGATTGGT3’ OCL SEQ.ID.10 Reverse 5’CCACTCCTCGACATTGGGGG3’ SEQ.ID.11 Forward 5’GTTCGCGGCTGCTTTGACC3’ HAS3 SEQ.ID.12 Reverse 5’GTCAGGGAAGGAGATGCGCT3’ SEQ.ID.13 Forward 5’GCCTTACTGTGAGTCTGGTTGA 3’ IVL SEQ.ID.14 Reverse 5’GAGCTCGACAGGCACCTTCT3’ SEQ.ID.15 Forward 5’GACGACATGGAGAAAATCTG3’ B-actin SEQ.ID.16 Reverse 5’ACGACCAGAGGCATACAG3’ 31 / 6 REFERENCES Adamo, G., Fierli, D., Romancino, D. P., Picciotto, S., Barone, M. E., Aranyos, A., Božič, D., Morsbach, S., Raccosta, S., Stanly, C., Paganini, C., Gai, M., Cusimano, A., Martorana, V., Noto, R., Carrotta, R., Librizzi, F., Randazzo, L., Parkes, R., … Bongiovanni, A. (2021). Nanoalgosomes: Introducing extracellular vesicles produced by microalgae. Journal of Extracellular Vesicles, 10(6), e12081. https: / / doi.org / 10.1002 / jev2.12081. Al-lwayzy, S. H., Yusaf, T., & Al-Juboori, R. A. (2014). Biofuels from the Fresh Water Microalgae Chlorella vulgaris (FWM-CV) for Diesel Engines. Energies, 7(3), Artigo 3. https: / / doi.org / 10.3390 / en7031829. Andersen, R. A., Berges, J. A., Harrison, P. J., & Watanabe, M. M. (2005). Recipes for Freshwater and Seawater Media. 429– 538. https: / / doi.org / 10.1016 / B978-012088426-1 / 50027-5. Lv, J.-M., Cheng, L.-H., Xu, X.-H., Zhang, L., & Chen, H.-L. (2010). Enhanced lipid production of Chlorella vulgaris by adjustment of cultivation conditions. Bioresource Technology, 101(17), 6797–6804. https: / / doi.org / 10.1016 / j.biortech.2010.03.120. Picciotto, S., Barone, M. E., Fierli, D., Aranyos, A., Adamo, G., Božič, D., Romancino, D. P., Stanly, C., Parkes, R., Morsbach, S., Raccosta, S., Paganini, C., Cusimano, A., Martorana, V., Noto, R., Carrotta, R., Librizzi, F., Capasso Palmiero, U., Santonicola, P., … Bongiovanni, A. (2021). Isolation of extracellular vesicles from microalgae: Towards the production of sustainable and natural nanocarriers of bioactive compounds. Biomaterials Science, 9(8), 2917–2930. 32 / 6 https: / / doi.org / 10.1039 / D0BM01696A. Purkayastha, J., Bora, A., Gogoi, H. K., & Singh, L. (2017). Growth of high oil yielding green alga Chlorella ellipsoidea in diverse autotrophic media, effect on its constituents. Algal Research, 21, 81–88. https: / / doi.org / 10.1016 / j.algal.2016.11.009. Suparmaniam, U., Lam, M. K., Lim, J. W., Yusup, S., Tan, I. S., Lau, S. Y., Kodgire, P., & Kachhwaha, S. S. (2023). Influence of environmental stress on microalgae growth and lipid profile: A systematic review. Phytochemistry Reviews, 22(4), 879–901. https: / / doi.org / 10.1007 / s11101-022-09810-7. Tan, L., Xu, W., He, X., & Wang, J. (2019). The feasibility of Fv / Fm on judging nutrient limitation of marine algae through indoor simulation and in situ experiment. Estuarine, Coastal and Shelf Science, 229, 106411. https: / / doi.org / 10.1016 / j.ecss.2019.106411. 33 / 6

Claims

CLAIMS 1. A process for obtaining microalgae extracellular vesicles (MEVs) from microalgae cultures, subjected to abiotic stress conditions of light, salinity, pH, temperature, nutrient starvation, thermal water or by a combination of any of them, in reference to their respective basal cultivation conditions, said process comprising the following steps: a) Providing a microalgae culture grown during 3 to 30 days in an adequate culture medium under autotrophic, heterotrophic or mixotrophic conditions with influence of at least one of the above abiotic stress stimuli, b) Providing a microalgae culture medium fraction and the respective microalgae biomass fraction separated from the microalgae culture grown as in the previous step a), c) Isolating the respective MEV from the culture medium of b).

2. A process for obtaining modified MEV according to claim 1, wherein the microalgae culture of a) is subject to light intensity stress, higher or lower light intensity.

3. A process for obtaining modified MEV according to claim 1, wherein the microalgae culture of a) is subject to light stress induced by photoperiod, preferably longer than the 12:12 photoperiod.

4. A process for obtaining modified MEV according to claim 1, wherein the microalgae culture of a) is subject to pH stress. 34 / 65. A process for obtaining modified MEV according to claim 1, wherein the microalgae culture of a) is subject to saline stress.

6. A process for obtaining modified MEV according to claim 1 further comprising a modification of the bioactive properties of the MEV by addition of selected bioactive molecules to the MEV by incubation, sonication, incorporation, freeze thawing, or extrusion.

7. A process for obtaining modified MEV according to any of the previous claims, further comprising at least 1 concentration step.

8. A process for obtaining modified MEV according to claim 7, wherein at least one of the concentration steps is performed by high-performance SEC column.

9. A process for obtaining modified MEV according to claim 7 and / or 8, further comprising a lyophilisation step.

10. Microalgae extracellular vesicles (MEV) obtainable by the process as described in any of the claims 1 to 9 wherein said MEV present particle size of 50 and 200nm, having an average size below 200nm, representing 60% or more of the total amount of MEV in a sample, with a yield of at least 2.5x10^9MEV from each L of microalgae medium presenting increased properties of skin barrier protective agent, skin anti-ageing effect, skin anti-oxidative effect, and no cell / tissue toxicity effect, in reference to the MEV obtainable by a process for cultivating the same microalgae under autotrophic, heterotrophic or mixotrophic conditions. 35 / 611. Compositions comprising microalgae extracellular vesicles (MEVs) as described in claims 10 comprising an adequate concentration of MEVs and an adequate pharmaceutical cosmetic and / or edible agent.

12. Compositions comprising microalgae extracellular vesicles (MEVs) according to claim 11, said composition is in the form of a gel, cream, paste, suspension or liquid solution. 36 / 6

Citation Information

Patent Citations

  • Chlorella-based production of extracellular vesicle-embedded small rnas for prophylactic or therapeutic applications

    WO2022053687A2

  • Extracellular vesicles from microalgae, their preparation, and uses

    WO2023001894A1

  • Extracellular vesicles from microalgae, their biodistribution upon administration, and uses

    WO2023144127A1

  • Microalgae exosome and preparation method thereof

    CN117701393A

  • Extracellular vesicles from microalgae

    WO2021122880A1