Functional material containing 8-prenylnaringenin, oral composition, food and drink, atrogin-1 expression inhibitor, and functional material composition

The formulation of amorphous 8-prenylnaringenin with Blautia microorganisms and metal compounds enhances bioavailability and muscle atrophy inhibition, addressing odor issues and expanding applications in pharmaceuticals and foods.

WO2025211383A1PCT designated stage Publication Date: 2025-10-09DAICEL CORP
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/013428
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-03
Filing Date
2025-04-01
Publication Date
2025-10-09

AI Technical Summary

Technical Problem

Existing methods do not effectively enhance the bioavailability of 8-prenylnaringenin for pharmaceutical and food applications, limit its muscle atrophy inhibitory effects, and fail to address the unique odor of Blautia microorganism cultures producing it.

Method used

A functional material containing amorphous 8-prenylnaringenin with a particle size of 0.5 to 100 μm, optionally combined with xanthohumol, is produced using Blautia microorganisms, and formulated with metal-containing compounds to suppress odor and enhance bioavailability, while combining with leucine for improved muscle atrophy inhibition.

Benefits of technology

The formulation significantly improves the bioavailability and muscle atrophy inhibitory effects of 8-prenylnaringenin, reduces bitterness and flavor in foods, and suppresses the odor of Blautia microorganism cultures, expanding its applications in pharmaceuticals and foods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

The purposes of the present invention are: to provide a functional material having improved bioavailability of 8-prenylnaringenin (8PN); to provide a novel application of 8PN; to provide a formulation for improving muscle atrophy inhibitory effect by 8PN; and to provide a technique for suppressing odor of an 8PN-producing culture of a Blautia microorganism. A functional material containing an amorphous body having a predetermined average particle diameter and containing 8PN can improve the bioavailability of 8PN. When a bitter amino acid and 8PN are present together, bitterness can be reduced. When a protein and 8PN are present together, the flavor peculiar to the protein can be reduced. When 8PN is blended in protein-containing food and drink, a long-lasting feeling of satiety due to the food and drink is improved. When 8PN and leucine are combined, the atrogin-1 expression can be inhibited. When calcium hydroxide and an 8PN-producing culture of a Blautia microorganism are present together, the odor peculiar to the culture can be suppressed.
Need to check novelty before this filing date? Find Prior Art

Description

Functional material, oral composition, food and drink, atrogin-1 expression inhibitor, and functional material composition containing 8-prenylnaringenin

[0001] The present invention relates to an 8-prenylnaringenin functional material, an oral composition, a food or drink, an atrogin-1 expression inhibitor, and a functional material composition.

[0002] Hops (Humulus lupulus L.) are dioecious vines and perennial plants of the Cannabaceae family. The cones of the female plant contain ingredients that impart bitterness to beer, as well as active ingredients such as prenylated flavonoids, such as xanthohumol, isoxanthohumol, and 8-prenylnaringenin. These prenylated flavonoids have been reported to have various physiological activities and are attracting attention as pharmaceutical or food ingredients. In particular, 8-prenylnaringenin has been reported to exhibit physiological activities such as estrogen-like activity (Non-Patent Document 1), inhibition of angiogenesis (Patent Document 1), and inhibition of disuse muscle atrophy (Patent Document 2).

[0003] Methods for efficiently preparing 8-prenylnaringenin have been investigated for use as a functional ingredient in pharmaceuticals or food materials.

[0004] For example, a method for producing 8-prenylnaringenin by prenylation of naringenin (Non-Patent Documents 2 and 3) and a method for producing 8-prenylnaringenin from isoxanthohumol using Eubacterium limosum ATCC 8486 strain or Peptostreptococcus productus ATCC 27340 strain have been reported (Patent Document 3).

[0005] The physiological functions of flavonoids may differ depending on whether they contain a prenyl group, and it is known that the estrogenic activity of 8-prenylnaringenin is enhanced compared to the estrogenic activity of naringenin (Non-Patent Document 4). It has also been reported that the prenyl group of flavonoids prolongs their residence time in the body and enhances their accumulation in tissues (Non-Patent Document 5).

[0006] JP-T-2005-526122 A JP-A-2016-136952 A JP-T-2008-532558 A

[0007] S. Milligan, et al., J. Clin. Endocrinol. Metab., 84, 2249-2252 (1999)S. Gester, et al., Tetrahedron, 57, 1015-1018 (2001)K. Sasaki, et al., Plant Physiol., 146, 1075-1084 (2008) G. Kretzschmar, O. Zierau, J. Wober, S. Tischer, P. Metz & G. Vollmer: J. Steroid Biochem. Mol. Biol., 118, 1 (2010).Chemistry and Biology Vol. 53, No. 2, 2015, 71-73

[0008] [1] 8-Prenylnaringenin is a compound that has excellent bioavailability due to the presence of a prenyl group. However, when applying 8-prenylnaringenin as an active ingredient to pharmaceuticals or foods and beverages, it is desirable to further increase the bioavailability in order to achieve a high level of efficacy relative to the amount of active ingredient added. However, no method for further increasing the bioavailability of 8-prenylnaringenin is known.

[0009] Therefore, a first object of the present disclosure is to provide a functional material with improved bioavailability of 8-prenylnaringenin.

[0010] [2] As described above, 8-prenylnaringenin has been found to be applicable to pharmaceuticals and foods and beverages based on its effects such as estrogen-like activity, inhibition of angiogenesis, and inhibition of disuse muscle atrophy. However, if new uses for 8-prenylnaringenin are discovered, it is expected that the range of its applications can be further expanded.

[0011] Therefore, a second object of the present disclosure is to provide a new use of 8-prenylnaringenin.

[0012] [3] As mentioned above, 8-prenylnaringenin is known to have the effect of inhibiting muscle atrophy. However, the effect that can be obtained by 8-prenylnaringenin alone is limited.

[0013] Therefore, a third object of the present disclosure is to provide a formulation that improves the muscle atrophy inhibitory effect of 8-prenylnaringenin.

[0014] [4] As described above, the 8-prenylnaringenin-producing culture of Blautia microorganisms is a functional ingredient that can utilize the beneficial effects of 8-prenylnaringenin. However, the 8-prenylnaringenin-producing culture of Blautia microorganisms itself has a unique odor.

[0015] Therefore, a fourth object of the present disclosure is to provide a technology for suppressing the odor of an 8-prenylnaringenin-producing culture of a microorganism of the genus Blautia.

[0016] As a result of intensive research conducted by the inventors to achieve the first objective described above, they used a culture obtained by producing 8-prenylnaringenin from isoxanthohumol using a Blautia microorganism, and compared a highly pure 8-prenylnaringenin material obtained by solvent extraction of the culture with a material obtained by powdering the culture. They found that the bioavailability of the material obtained by powdering was significantly improved.

[0017] As a result of intensive research conducted by the present inventors to achieve the second objective, they discovered that 8-prenylnaringenin has the effects of reducing the bitterness of bitter amino acids, reducing the unique flavor of proteins, and improving the satiety of protein foods and beverages.

[0018] As a result of intensive research conducted by the present inventors to achieve the third objective, they discovered that combining 8-prenylnaringenin with leucine improves the effect of suppressing the expression of atrogin-1 (a gene whose expression increases during muscle atrophy).

[0019] As a result of extensive research conducted by the present inventors to achieve the fourth object, they found that the odor characteristic of 8-prenylnaringenin-producing cultures of Blautia microorganisms can be reduced by the use of metal-containing compounds.

[0020] The present disclosure has been completed based on these findings. That is, the present disclosure provides the inventions of the following aspects, specifically, a first embodiment shown in items 1 to 6, a second embodiment shown in items 7 to 21, a third embodiment shown in items 22 and 23, and a fourth embodiment shown in item 24.

[0021] [1] Item 1. A functional material containing an amorphous form containing 8-prenylnaringenin and having an average particle size of 0.5 to 100 μm. Item 2. The functional material according to Item 1, further containing xanthohumol. Item 3. The functional material according to Item 2, containing 2 to 30 parts by weight of xanthohumol per 100 parts by weight of the 8-prenylnaringenin. Item 4. The functional material according to any one of Items 1 to 3, wherein the content of 8-prenylnaringenin is 0.5 to 200 mg / g. Item 5. A solid oral composition containing the functional material according to any one of Items 1 to 4. Item 6. A method for producing a functional material, comprising: Step 1, obtaining a solution containing 8-prenylnaringenin by causing a Blautia microorganism to produce 8-prenylnaringenin using isoxanthohumol as a substrate in a solution containing isoxanthohumol; and Step 2, drying the solution containing 8-prenylnaringenin to obtain an amorphous body having an average particle size of 0.5 to 100 μm.

[0022] [2] Item 7. An oral composition comprising a bitter amino acid and 8-prenylnaringenin. Item 8. An agent for reducing the bitterness of a bitter amino acid, comprising 8-prenylnaringenin. Item 9. A method for reducing the bitterness of a bitter amino acid, comprising incorporating 8-prenylnaringenin into an oral composition containing a bitter amino acid. Item 10. Application of 8-prenylnaringenin as an agent for reducing the bitterness of a bitter amino acid. Item 11. Use of 8-prenylnaringenin to reduce the bitterness of a bitter amino acid.

[0023] Item 12. An oral composition comprising a protein and 8-prenylnaringenin. Item 13. A protein flavor reducer comprising 8-prenylnaringenin. Item 14. A method for reducing protein flavor by incorporating 8-prenylnaringenin into an oral composition containing a protein. Item 15. Application of 8-prenylnaringenin as a protein flavor reducer. Item 16. Use of 8-prenylnaringenin for reducing protein flavor.

[0024] Item 17. A food or drink comprising a protein and 8-prenylnaringenin. Item 18. An agent for improving satiety in protein-containing foods or drinks, comprising 8-prenylnaringenin. Item 19. A method for improving satiety in protein-containing foods or drinks, by blending 8-prenylnaringenin into a protein-containing food or drink. Item 20. Use of 8-prenylnaringenin as an agent for improving satiety in protein-containing foods or drinks. Item 21. Use of 8-prenylnaringenin to improve satiety in protein-containing foods or drinks.

[0025] [3] Item 22. An atrogin-1 expression inhibitor comprising 8-prenylnaringenin and leucine. Item 23. The atrogin-1 expression inhibitor according to Item 22, which is used as a muscle atrophy inhibitor.

[0026] [4] Item 24. A functional material composition comprising a functional material consisting of an 8-prenylnaringenin-producing culture of a microorganism of the genus Blautia, and a metal-containing compound.

[0027] According to a first embodiment of the present disclosure, a functional material with improved bioavailability of 8-prenylnaringenin is provided. According to a second embodiment of the present disclosure, new uses of 8-prenylnaringenin are provided, such as reducing the bitterness of bitter amino acids, reducing the flavor of proteins, or improving the satiety of protein-containing foods and beverages. According to a third embodiment of the present disclosure, a formulation for improving the inhibitory effect of atrogin-1 expression is provided. According to a fourth embodiment of the present disclosure, a technology for suppressing the odor of an 8-prenylnaringenin-producing culture of a Blautia genus microorganism is provided.

[0028] [1] First Embodiment The first embodiment of the present disclosure encompasses a functional material containing 8-prenylnaringenin, a solid oral composition containing the functional material, and a method for producing the functional material.

[0029] [1-1] Functional Material The functional material of the present disclosure contains 8-prenylnaringenin as an active ingredient and is composed of an amorphous substance having an average particle size of 0.5 to 100 μm.

[0030] The content of 8-prenylnaringenin contained in the functional material is not particularly limited, but examples include 0.5 to 200 mg / g (amount of 8-prenylnaringenin per 1 g of functional material), 0.5 to 150 mg / g, 0.5 to 100 mg / g, 0.5 to 50 mg / g, 0.5 to 30 mg / g, 0.5 to 10 mg / g, preferably 0.8 to 5 mg / g, more preferably 1 to 3 mg / g, 1 to 2 mg / g, or 1.2 to 1.5 mg / g.

[0031] From the viewpoint of further improving bioavailability, the functional material of the present disclosure preferably contains xanthohumol. Xanthohumol may be contained in particles separate from amorphous particles containing 8-prenylnaringenin, or may form amorphous particles together with 8-prenylnaringenin (amorphous particles containing a mixture of 8-prenylnaringenin and xanthohumol). In a preferred embodiment, xanthohumol forms amorphous particles together with 8-prenylnaringenin.

[0032] The content of xanthohumol is not particularly limited and can be set appropriately depending on the desired degree of bioavailability improvement effect. For example, the content may be, per 100 parts by weight of 8-prenylnaringenin, for example, 2 to 30 parts by weight, preferably 2.5 to 20 parts by weight, more preferably 3 to 15 parts by weight, even more preferably 3.5 to 10 parts by weight, still more preferably 4 to 8 parts by weight, and even more preferably 4.5 to 6 parts by weight.

[0033] The functional material of the present disclosure may or may not contain other components in addition to the above-mentioned 8-prenylnaringenin and xanthohumol, as long as the effects of the present disclosure are not impaired. Some or all of the other components may be contained in particles separate from the amorphous particles containing 8-prenylnaringenin, or may form amorphous particles together with 8-prenylnaringenin.

[0034] Examples of other components that may or may not be contained include components other than water that are inevitably contained in the "8-prenylnaringenin-containing solution" described in "(1-3) Method for producing a functional material" below. Examples of such components include medium components (including surfactants), isoxanthohumol, by-products of 8-prenylnaringenin-producing bacteria, and the like. One of these components may be contained alone, or two or more may be contained in combination.

[0035] Other components that may or may not be present include excipients used to facilitate powdering and additives incorporated for quality maintenance. Examples of excipients include lactose, dextrin, corn starch, etc. Examples of additives include buffers, suspending agents, stabilizers, preservatives, and antiseptics. Examples of buffers include phosphates, citrates, acetates, etc. Examples of stabilizers include ascorbic acid, etc. Examples of preservatives include benzoates (alkali metal salts such as potassium salts and sodium salts), sorbates (alkali metal salts such as potassium salts and sodium salts), benzalkonium chloride, methylparaben, propylparaben, etc. Examples of preservatives include benzalkonium chloride, etc. These additives may be contained alone or in combination. These components may be contained alone or in combination.

[0036] A preferred embodiment of the present disclosure is a functional material obtained by the "(1-3) Method for producing a functional material" described below.

[0037] The fact that the functional material of the present disclosure is amorphous can be confirmed by a broad diffraction pattern in the X-ray diffraction pattern.

[0038] The functional material of the present disclosure has excellent bioavailability and can tolerate a wide range of particle sizes, with a specific average particle size being 0.5 to 100 μm. The lower limit of the average particle size range may be 1 μm, 10 μm, 30 μm, 50 μm, 60 μm, 65 μm, or 70 μm, and the upper limit of the average particle size range may be 90 μm, 85 μm, 80 μm, or 75 μm.

[0039] The particle size is a value expressed as the diameter of a circle (equivalent circle diameter) having the same area as the particle area captured in a planar image of the amorphous body. The average particle size refers to the particle size D50 at 50% of the volume-based integrated value in the equivalent circle diameter integrated distribution obtained using a dry particle size distribution analyzer (Malvern Panalytical Morphologi 4) or a particle size distribution analyzer employing an image-based particle size distribution measurement, which operates on the same principle.

[0040] The functional material of the present disclosure can be used as a material for a solid oral composition (specifically, a functional food or drink or pharmaceutical product) containing 8-prenylnaringenin as an active ingredient. The functional material of the present disclosure can also be used in the following "[2] Second Embodiment," "[3] Third Embodiment," and "[4] Fourth Embodiment."

[0041] [1-2] Solid Oral Composition The solid oral composition of the present disclosure is in a dry form and contains the functional material shown in the above "[1-1] Functional Material."

[0042] The content of the functional material in the solid oral composition of the present disclosure can be determined appropriately depending on the dosage form, product classification, and / or intended use. For example, the content of the functional material in the solid oral composition of the present disclosure can be set so that the amount of 8-prenylnaringenin is, for example, 5 to 80 wt %.

[0043] The solid oral composition of the present disclosure may or may not contain components other than the functional materials shown in the above "(1-1) Functional Materials," as long as the effects of the present disclosure are not impaired. Examples of other components that may or may not be contained include functional components and / or additives.

[0044] Functional ingredients include proteins (whey protein, casein protein, soy protein, pea protein, hemp protein, fish protein, rice protein, lactoferrin, collagen, etc.); amino acids, their metabolites, or dipeptides (BCAA, essential amino acids, non-essential amino acids, citrulline, ornithine, HMB, GABA, theanine, carnosine, imidazole dipeptide, creatine, SAC, etc.) [Note that amino acids, their metabolites, or dipeptides can be incorporated when the solid oral composition of the present disclosure is used, for example, for promoting muscle protein synthesis, suppressing muscle protein catabolism, preventing sarcopenia, antioxidant effects, anti-inflammatory effects, or fatigue recovery. ]; metal-containing compounds (Ca-, Mg-, or Fe-containing compounds); carotenoids (astaxanthin, beta-cryptoxanthin, red pepper-derived xanthophyll, etc.); vitamins or vitamin-like substances (vitamin A, beta-carotene, B vitamins, vitamin C, vitamin D, vitamin E, CoQ10, reduced coenzyme Q10); proteoglycan, chondroitin, N-acetylglucosamine, maslinic acid [Note that proteoglycan, chondroitin, N-acetylglucosamine, and maslinic acid can be incorporated when the solid oral composition of the present disclosure is used, for example, to improve musculoskeletal function or prevent osteoporosis.]; polyphenols (soy isoflavones, equol, catechin, quercetin, quercetin glycoside, rutin, procyanidins, epigallocatechin gallate, chitosan, ellagic acid from African mango, gallic acid from Terminalia bellirica, gallate-type catechin, bitter acid from aged hops, hesperidin, tiliroside from rose hips, glabridin from licorice, apple polyphenols, kudzu flower isoflavones, hyperoside from rafuma, isoquercitrin from rafuma, chlorogenic acids from coffee beans, picea tanno polyphenols, gymnemic acid, mulberry leaf-derived iminosugars (as fagomine), kidney bean-derived phaseolamin, salacinol, beta-conglycinin, tea flower saponin, and γ-oryzanol (note that polyphenols, gymnemic acid, mulberry leaf-derived iminosugars (as fagomine), kidney bean-derived phaseolamin, salacinol, beta-conglycinin, tea flower saponin, and γ-oryzanol can be incorporated when the solid oral composition of the present disclosure is used, for example, for fat burning or body fat reduction); lipids (EPA, DHA, milk-derived sphingomyelin) (note that lipids can be incorporated when the solid oral composition of the present disclosure is used, for example, for improving brain function or eye fatigue). ]; vegetable fiber (such as indigestible dextrin, inulin, polydextrose, and dietary fiber derived from psyllium husks); probiotics (such as lactic acid bacteria, bifidobacteria, butyric acid bacteria, Bacillus subtilis C-3102 strain, L. gasseri CP2305, and Bacillus subtilis subsp. natto QOL); monosaccharides and oligosaccharides (psicose and calcium maltobionate) [Note that monosaccharides and oligosaccharides can be incorporated when the solid oral composition of the present disclosure is used, for example, for anti-obesity or anti-diabetic effects. ]; 5-aminolevulinic acid phosphate, Euglena gracilis-derived paramylon (as β-1,3-glucan), sesamin, ginger extract, garlic extract [5-aminolevulinic acid phosphate, Euglena gracilis-derived paramylon (as β-1,3-glucan), sesamin, ginger extract, and garlic extract can be incorporated when the solid oral composition of the present disclosure is used, for example, for fatigue recovery or mitochondrial function activation.BioPerine (registered trademark), piperine (black pepper extract) [Note that BioPerine and piperine can be added to enhance the absorption of 8-prenylnaringenin.] These functional ingredients may be used alone or in combination of two or more. The content of these functional ingredients can be determined appropriately depending on the degree of effect expected from the functional ingredients.

[0045] Additives include masking agents (highly branched cyclic dextrin, sucralose, stevia (enzyme-treated stevia, stevia extract), aspartame, neotame, honey, etc.); excipients (lactose, crystalline cellulose, reduced maltose, starch, guar gum, etc.); lubricants (magnesium stearate, calcium stearate, sucrose ester, hardened rapeseed oil, etc.); coating agents (shellac, carnauba wax, etc.); sweeteners (glucose, fructose, high fructose corn syrup, sorbitol, mannitol, maltitol, reduced sugars, etc.); Examples of additives include starch syrup, xylitol, erythritol, reduced palatinose, licorice, and monk fruit; emulsifiers (lecithin, glycerin fatty acid esters, and the like); leavening agents (sodium bicarbonate, burnt alum, and the like); acidulants (citric acid, lactic acid, and the like); preservatives (sorbic acid, and the like); antioxidants (sodium erythorbate, and the like); yeast food (tricalcium phosphate, ammonium carbonate, and the like); umami seasonings (sodium L-glutamate, disodium 5'-inosinate, and the like); and pH adjusters (DL-malic acid, sodium lactate, and the like). These additives may be used alone or in combination of two or more. The content of these additives can be determined appropriately depending on the type of additive and the formulation form of the solid oral composition.

[0046] The dosage form of the solid oral composition of the present disclosure is not particularly limited, as long as it is solid, and examples thereof include granules, powders, tablets, capsules, and the like.

[0047] In addition, product categories of the solid oral composition of the present disclosure include functional foods and beverages (health functional foods such as foods for specified health uses (including conditional FOSHU [foods for specified health uses]) and foods with nutrient functions, foods with functional claims, foods for special dietary uses, nutritional supplements, health supplements, supplements, etc.), and pharmaceuticals.

[0048] The solid oral composition of the present disclosure can be used for any application in which an ameliorative or therapeutic effect can be obtained through the physiological action of 8-prenylnaringenin. For example, the solid oral composition of the present disclosure can be used as an estrogen-like agent, an angiogenesis inhibitor, a muscle atrophy inhibitor (particularly, an agent for inhibiting disuse muscle atrophy), etc.

[0049] The dose of the solid oral composition of the present disclosure is not particularly limited and can be appropriately determined depending on the intended use, the level of symptoms of the subject, etc., but for humans, the dose may be, for example, 0.001 to 8.5 mg / kg.

[0050] [1-3] Method for producing functional material The method for producing a functional material of the present disclosure is a method capable of producing the functional material shown in "[1-1] Functional material" above, and includes Step 1 of obtaining a solution containing 8-prenylnaringenin by causing a Blautia microorganism to produce 8-prenylnaringenin using isoxanthohumol as a substrate in a solution containing isoxanthohumol, and Step 2 of drying the solution containing 8-prenylnaringenin to obtain an amorphous body having an average particle size of 0.5 to 100 μm.

[0051] [1-3-1] Step 1 In step 1, a Blautia microorganism is allowed to produce 8-prenylnaringenin using isoxanthohumol as a substrate in a solution containing isoxanthohumol, thereby obtaining a solution containing 8-prenylnaringenin.

[0052] [Solution containing isoxanthohumol] The solution containing isoxanthohumol is not particularly limited as long as it contains isoxanthohumol in water and has a composition that provides an environment in which a microorganism of the genus Blautia can grow and produce 8-prenylnaringenin using isoxanthohumol as a substrate.

[0053] The content of isoxanthohumol in the solution containing isoxanthohumol is, for example, 0.01 to 3 g / L, preferably 0.05 to 2 g / L, more preferably 0.1 to 1 g / L, and even more preferably 0.2 to 0.5 g / L. Isoxanthohumol may be added all at once at the start of production of 8-prenylnaringenin, or may be added gradually or continuously, but is preferably added all at once.

[0054] A preferred example of a solution containing isoxanthohumol is a medium supplemented with isoxanthohumol. The medium can appropriately contain nutrient sources required for the growth of Blautia microorganisms. Examples of nutrient sources include carbon sources (glucose, sucrose, lactose, maltose, soluble starch, glycerin, dextrin, molasses, pyruvic acid, etc.), nitrogen sources (organic nitrogen sources such as amino acids, yeast extract, peptones, meat extract, liver extract, and digested serum powder; inorganic nitrogen sources such as ammonium salts and nitrates (specifically, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium hydrogen phosphate, potassium nitrate, and sodium nitrate), and surfactants (polyoxyethylene sorbitan esters, specifically, polysorbates 20, 40, 60, and 80). One or more of these components can be selected. The amount of surfactant added is, for example, 1 to 10 g / L, preferably 3 to 8 g / L, and more preferably 4 to 6 g / L of the isoxanthohumol-containing solution.

[0055] Furthermore, the medium may contain supplementary components for promoting the growth of microorganisms, such as amino acids (cysteine, tryptophan, arginine, and salts thereof), vitamins (phytonadione, biotin, folic acid, pyridoxine, thiamine, riboflavin, nicotinic acid, pantothenic acid, vitamin B12, thiooctoic acid, p-aminobenzoic acid), inorganic compounds (potassium dihydrogen phosphate, magnesium sulfate, manganese sulfate, sodium chloride, cobalt chloride, calcium chloride, zinc sulfate, copper sulfate, alum, sodium molybdate, potassium chloride, borate, nickel chloride, sodium tungstate, sodium selenate, and ferrous ammonium sulfate), and the like. One or more of these components may be selected.

[0056] Specific examples of the medium include GAM medium, modified GAM medium (manufactured by Nissui Pharmaceutical Co., Ltd.), Brain Heart Infusion medium (manufactured by Nissui Pharmaceutical Co., Ltd.), and Anaerobe Basal Broth (ABB) medium (manufactured by Oxoid).

[0057] It is preferable that the medium be deaerated with a gas that constitutes the gas phase for anaerobic culture, which will be described later in the section "Production of 8-prenylnaringenin."

[0058] [Microorganisms of the genus Blautia] Microorganisms of the genus Blautia are not particularly limited, as long as they are capable of producing 8-prenylnaringenin using isoxanthohumol as a substrate. Specific examples of microorganisms of the genus Blautia include Blautia sp., Blautia coccoides, Blautia schinkii, and Blautia hominis, and more specifically, Blautia sp. DC 3652 (NITE BP-02924) strain, Blautia coccoides JCM 1395 strain, Blautia schinkii JCM 14657 strain, and Blautia hominis JCM 32276 strain. These Blautia microorganisms may be used alone or in combination of two or more. Among these Blautia microorganisms, Blautia sp. DC 3652 (NITE BP-02924) strain is preferred.

[0059] Strains assigned JCM numbers can be obtained from the Japan Collection of Microorganisms (Microbial Materials Development Division, RIKEN BioResource Center, National Research and Development Agency, Postal Code: 305-0074, Address: 3-1-1 Takanodai, Tsukuba City, Ibaraki Prefecture). The NITE BP-02924 strain was deposited internationally with the National Institute of Technology and Evaluation (NITE) Patent Microorganism Depositary (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818) on March 20, 2019, under the Budapest Treaty.

[0060] [Production of 8-Prenylnaringenin] The conditions for producing 8-prenylnaringenin using isoxanthohumol as a substrate may be appropriately set as appropriate culture conditions taking into consideration the nutritional and physiological properties of the microorganism belonging to the genus Blautia.

[0061] The culture conditions include conditions for anaerobic culture (fermentation). Preferably, the gas phase to be contacted with the isoxanthohumol-containing solution is a gas consisting of at least one of hydrogen, carbon dioxide, and nitrogen, more preferably a mixed gas consisting of hydrogen, carbon dioxide, and nitrogen. The mixed gas has a composition of, for example, 0.3 to 2 parts by volume, preferably 0.5 to 1.5 parts by volume, more preferably 0.7 to 1.2 parts by volume of carbon dioxide and, for example, 4 to 12 parts by volume, preferably 6 to 10 parts by volume, more preferably 7 to 9 parts by volume, and even more preferably 7.5 to 8.5 parts by volume of nitrogen per part by volume of hydrogen.

[0062] The temperature conditions for the culture are, for example, 20°C to 45°C, preferably 25°C to 43°C, more preferably 30°C to 40°C, and even more preferably 35°C to 38°C.

[0063] The gas phase pressure conditions for the culture are, for example, in the range of 0.001 to 1 MPa, preferably 0.01 to 0.5 MPa, more preferably 0.05 to 0.3 MPa, and even more preferably 0.08 to 0.15 MPa.

[0064] The culture time is, for example, 8 to 336 hours, preferably 24 to 240 hours, more preferably 72 to 200 hours, and even more preferably 150 to 180 hours.

[0065] [Solution Containing 8-Prenylnaringenin] The solution containing 8-prenylnaringenin obtained in step 1 contains, in addition to the product 8-prenylnaringenin, preferably xanthohumol produced by isomerization of the substrate isoxanthohumol. The solution containing 8-prenylnaringenin may further contain one or more of the following: medium components (including surfactants), bacterial cells, the substrate isoxanthohumol, and by-products (other than xanthohumol) produced by the 8-prenylnaringenin-producing bacteria.

[0066] [1-3-2] Step 2 In step 2, the solution containing 8-prenylnaringenin obtained in step 1 above is dried to obtain an amorphous substance having an average particle size of 0.5 to 100 μm.

[0067] As the drying method, a conventionally known method can be used. Specifically, freeze-drying, spray-drying, etc. can be used. Furthermore, an excipient such as lactose, dextrin, cornstarch, etc. may be added to the solution containing 8-prenylnaringenin before drying. By drying, an amorphous form containing 8-prenylnaringenin and having an average particle size of 0.5 to 100 μm can be obtained. Since a wide range of average particle sizes is acceptable in the present disclosure, conventionally known methods can be used to control the average particle size, and typically, powdering using a general drying method will yield an amorphous form with an average particle size within the specified range.

[0068] In a preferred embodiment, the solution containing 8-prenylnaringenin also contains xanthohumol, and therefore, upon drying, amorphous particles containing a mixture of 8-prenylnaringenin and xanthohumol are obtained.

[0069] [1-3-3] Other Steps The production method of the present disclosure may include any other steps as long as they do not impair the effects of the present disclosure, i.e., do not result in crystallization of the 8-prenylnaringenin produced in step 1. Examples of such other steps include, as steps carried out between steps 1 and 2, a step of concentrating the solution containing 8-prenylnaringenin, a step of adding an excipient and / or an additive blended for the purpose of quality preservation to the solution containing 8-prenylnaringenin, and a step of sterilizing or disinfecting the solution containing 8-prenylnaringenin; and as steps carried out after step 2, a centrifugation step, a solid-liquid separation step, a step of adding an additive blended for the purpose of quality preservation, a decolorization step, and the like.

[0070] On the other hand, the production method of the present disclosure does not include a step that results in crystallization of the 8-prenylnaringenin produced in step 1. Such a step that is excluded from the production method of the present disclosure includes a step of extracting the solution containing 8-prenylnaringenin obtained in step 1 with an organic solvent or an ionic liquid to obtain an organic solvent fraction or an ionic liquid fraction containing 8-prenylnaringenin.

[0071] [2] Second Embodiment A second embodiment of the present disclosure includes an oral composition comprising a bitter amino acid and 8-prenylnaringenin, a second 2 embodiment of an oral composition comprising a protein and 8-prenylnaringenin, and a second 3 embodiment of a food or beverage comprising a protein and 8-prenylnaringenin.

[0072] [2-1] Oral Composition The oral composition of the present disclosure comprises a bitter amino acid and 8-prenylnaringenin. The oral composition of the present disclosure comprising a bitter amino acid and 8-prenylnaringenin (hereinafter, in the items included in [2-1], simply referred to as the "oral composition") can reduce the bitterness of the bitter amino acid by incorporating 8-prenylnaringenin together with the bitter amino acid.

[0073] [2-1-1] Bitter Amino Acids The bitter amino acids contained in the oral composition of the present disclosure include known bitter amino acids without particular limitation. Specific examples of bitter amino acids used in the oral composition of the present disclosure include valine, leucine, isoleucine, arginine, methionine, phenylalanine, lysine, cysteine, tyrosine, and histidine. These bitter amino acids may be used alone or in combination of two or more. Among these bitter amino acids, preferred are valine, leucine, isoleucine, and / or arginine, and more preferred are valine, leucine, isoleucine, and arginine.

[0074] The content (total amount) of bitter amino acids contained in the oral composition of the present disclosure is not particularly limited, but may be, for example, 0.1 to 10 wt% of the total bitter amino acids. From the viewpoint of enhancing the bitterness-reducing effect, the total amount is preferably 0.1 to 8 wt%, more preferably 0.1 to 6 wt%, even more preferably 0.1 to 4 wt%, and even more preferably 0.1 to 3 wt%. Furthermore, because the oral composition of the present disclosure has an excellent bitterness-reducing effect, bitterness can be effectively reduced even if bitter amino acids are contained at a concentration that inherently makes the bitterness more noticeable. From this viewpoint, suitable amounts of bitter amino acids contained in the oral composition of the present disclosure include 0.5 to 10 wt%, 1 to 10 wt%, 1.5 to 10 wt%, 2 to 10 wt%, or 2.3 to 10 wt%.

[0075] [2-1-2] 8-Prenylnaringenin In order to incorporate 8-prenylnaringenin into the oral composition of the present disclosure, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing a functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0076] In the oral composition of the present disclosure, the ratio of the bitter amino acid content (total amount) to the 8-prenylnaringenin content can be set as appropriate depending on the desired level of bitterness reduction effect, etc., and examples of the ratio of 8-prenylnaringenin per 1000 parts by weight of bitter amino acid content include 0.08 parts by weight or more, preferably 0.1 to 5 parts by weight, preferably 0.18 to 5 parts by weight, more preferably 0.35 to 5 parts by weight, 0.38 to 5 parts by weight, 0.5 to 5 parts by weight, 0.6 to 5 parts by weight, and even more preferably 0.7 to 5 parts by weight, 0.75 to 5 parts by weight, 0.75 to 4 parts by weight, 0.75 to 3 parts by weight, 0.75 to 2 parts by weight, 0.75 to 1 part by weight, and 0.75 to 0.9 parts by weight.

[0077] In the oral composition of the present disclosure, when the functional material described in the above "(1-1) Functional Material" (preferably the functional material obtained by the above "(1-3) Manufacturing Method of Functional Material" or the functional material composition described in the below "(4) Fourth Embodiment") is used to incorporate 8-prenylnaringenin, the content (total amount) of bitter amino acid and the content ratio of functional material can be appropriately set depending on the desired level of bitterness reduction effect, etc., but the functional material content per part by weight of bitter amino acid content is preferably 100%. The ratio of the reactive material is, for example, 0.06 parts by weight or more, preferably 0.07 to 3.5 parts by weight, preferably 0.12 to 3.5 parts by weight, more preferably 0.25 to 3.5 parts by weight, 0.26 to 3.5 parts by weight, 0.35 to 3.5 parts by weight, 0.42 to 3.5 parts by weight, and even more preferably 0.5 to 3.5 parts by weight, 0.53 to 3.5 parts by weight, 0.53 to 2.8 parts by weight, 0.53 to 2.1 parts by weight, 0.53 to 1.4 parts by weight, 0.53 to 0.7 parts by weight, or 0.53 to 0.63 parts by weight.

[0078] Specific examples of the content of 8-prenylnaringenin in the oral composition of the present disclosure include 0.0001 to 0.1 wt %, 0.0002 to 0.07 wt %, 0.0004 to 0.04 wt %, 0.0008 to 0.01 wt %, 0.001 to 0.08 wt %, 0.001 to 0.04 wt %, 0.001 to 0.02 wt %, 0.001 to 0.01 wt %, or 0.001 to 0.005 wt %.

[0079] When the functional material described above in "[1-1] Functional material" (preferably the functional material obtained by the above "[1-3] Method for producing a functional material" or the functional material composition described below in "[4] Fourth embodiment") is used to incorporate 8-prenylnaringenin in the oral composition of the present disclosure, specific amounts of the functional material may be, for example, 0.072 to 72 wt %, 0.14 to 50 wt %, 0.3 to 30 wt %, 0.57 to 7.2 wt %, 0.72 to 57 wt %, 0.72 to 28 wt %, 0.72 to 14 wt %, 0.72 to 7.2 wt %, or 0.72 to 3.5 wt %.

[0080] [2-1-3] Other Components The oral composition of the present disclosure may or may not contain any other components, as long as they do not impair the bitterness-reducing effect of the bitter amino acid.

[0081] For example, when the oral composition of the present disclosure is in a solid form (dry form), it may or may not contain one or more of the other components (functional components and / or additives, etc.) described above in “[1-2] Solid Oral Composition.”

[0082] For example, when the oral composition of the present disclosure is in a hydrous form (e.g., liquid, gel, etc.), it can further contain a base and / or additive depending on the formulation form. Examples of such base and / or additive include water, lower (C1 to C5) monohydric alcohols, polyhydric alcohols, natural fats and oils, hydrocarbon oils, ester oils, fatty acid alkyl esters, fatty acids, fatty acid esters, higher (C6 or more or C12 or more) monohydric alcohols, cholesterol, glyceryl tri-2-ethylhexanoate, cetyl 2-ethylhexanoate, silicone oil; gelling agents (pectin, gelatin, carrageenan, xanthan gum, agar, methylcellulose, HPMC, guar gum, tara gum, locust bean gum, glucomannan, gum arabic, gellan gum, alginic acid, etc.); surfactants; refreshing agents, preservatives, flavoring agents, colorants, humectants, abrasives, UV absorbers, chelating agents, buffers, solubilizers, solubilizers, etc. These additives may be used alone or in combination of two or more. The content of these base materials and / or additives can be appropriately determined depending on the type of base material and / or additive, the dosage form of the oral composition, etc.

[0083] Furthermore, even when the oral composition of the present disclosure is in a water-containing form (e.g., liquid, gel, etc.), it may or may not contain one or more of the other components (functional components and / or additives, etc.) described above in “[1-2] Solid oral composition.”

[0084] [2-1-4] Dosage Forms and Product Classifications Dosage forms of the oral composition of the present disclosure include gels, creams, lotions, ointments, liquids, pastes, jellies, aerosols, powders, granules, capsules, candies, drops, lozenges, tablets (particularly plain tablets), chewable tablets, gummies, edible films, and the like. These dosage forms can be prepared by formulating them using additives appropriate for the dosage form according to known methods described in the General Provisions for Preparations of the Japanese Pharmacopoeia, Seventeenth Edition, and the like. When the oral composition of the present disclosure is in the form of a food or beverage, it can be prepared according to conventional methods for producing food or beverage products.

[0085] Examples of product categories for the oral composition of the present disclosure include foods and beverages (for example, functional foods and beverages (health functional foods such as foods for specified health uses (including conditional FOSHU [foods for specified health uses]) and foods with nutrient functions, foods with functional claims, foods for special dietary uses, dietary supplements, health supplements, supplements, etc.), pharmaceuticals (for oral use), oral care products (for example, mouthwash, mouthwash, dental cream, oral ointment, dentifrices (toothpaste, gel dentifrice, liquid dentifrice (dental rinse)), oral tablets (buccal tablets, gums, lozenges, adhesive tablets, etc.), oral capsules for external use (for spraying into the mouth), oral sprays, etc.), etc.

[0086] [2-1-5] Bitterness Reducer for Bitter Amino Acids 8-Prenylnaringenin can reduce the bitterness of bitter amino acids. Therefore, the present disclosure also provides an agent for reducing the bitterness of bitter amino acids, comprising 8-prenylnaringenin.

[0087] The bitterness-reducing agent for bitter amino acids of the present disclosure is used to reduce the bitterness of bitter amino acids. Bitter amino acids are as described above in "[2-1-1] Bitter Amino Acids." The method for using the bitterness-reducing agent of the present disclosure is as described below in "[2-1-6] Method for Reducing the Bitterness of Bitter Amino Acids."

[0088] In order to incorporate 8-prenylnaringenin into the bitterness reducer for bitter amino acids of the present disclosure, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0089] The content of 8-prenylnaringenin contained in the bitter amino acid bitterness reducer of the present disclosure is not particularly limited, as long as it can be used for the above-mentioned applications, and examples include 0.05 wt% or more, 0.05 to 90 wt%, 0.05 to 80 wt%, 0.05 to 60 wt%, 0.05 to 40 wt%, 0.05 to 20 wt%, 0.05 to 15 wt%, 0.05 to 10 wt%, 0.05 to 5 wt%, 0.05 to 3 wt%, 0.05 to 1 wt%, preferably 0.08 to 0.5 wt%, more preferably 0.1 to 0.3 wt%, 0.1 to 0.2 wt%, or 0.12 to 0.15 wt%.

[0090] When the functional material described in "[1-1] Functional Material" above (preferably the functional material obtained by "[1-3] Method for Producing Functional Material" above or the functional material composition described in "[4] Fourth Embodiment" below) is used to incorporate 8-prenylnaringenin into the bitterness reducer for bitter amino acids of the present disclosure, the content of the functional material contained in the bitterness reducer for bitter amino acids of the present disclosure is not particularly limited, as long as it is usable for the above-mentioned applications, and examples include 35% by weight or more, 35 to 99.9% by weight, 45 to 99.9% by weight, preferably 57 to 99.5% by weight, 64 to 99.5% by weight, more preferably 72 to 99% by weight, 86 to 99% by weight, or 86 to 95% by weight.

[0091] The bitterness reducer for bitter amino acids of the present disclosure may or may not contain additives and / or bases as optional other components, as long as the bitterness reducer effect of bitter amino acids is not impaired. Examples of additives and bases that may or may not be contained include excipients, buffers, antioxidants, UV inhibitors, preservatives, antiseptics, pH adjusters, dispersants, emulsifiers, solubilizers, carriers, solvents (water, etc.), etc. When additives and bases are used, one of these additives and bases may be used alone, or two or more may be used in combination. Furthermore, the content of these additives and bases may be appropriately determined depending on the type of component and / or the formulation form of the bitterness reducer for bitter amino acids.

[0092] The formulation of the bitterness-reducing agent for bitter amino acids of the present disclosure is not particularly limited, and examples include dry powder and granular formulations, and liquid formulations.

[0093] [2-1-6] Method for Reducing the Bitterness of a Bitter Amino Acid 8-Prenylnaringenin can reduce the bitterness of a bitter amino acid. Therefore, the present disclosure also provides a method for reducing the bitterness of a bitter amino acid, which comprises incorporating 8-prenylnaringenin into an oral composition containing the bitter amino acid.

[0094] In the method for reducing the bitterness of a bitter amino acid disclosed herein, the oral composition containing the bitter amino acid is similar to the oral composition described in "[2-1] Oral composition" except that it does not contain 8-prenylnaringenin or the functional material described in "[1-1] Functional material" above (preferably the functional material obtained in "[1-3] Method for producing a functional material" above or the functional material composition described in "[4] Fourth embodiment" below).

[0095] In the method for reducing the bitterness of a bitter amino acid disclosed herein, in order to incorporate 8-prenylnaringenin into an oral composition, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing a functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0096] The amount of 8-prenylnaringenin or functional material to be blended relative to the amount (total amount) of bitter amino acids contained in the oral composition is as described above in "[2-1-2] 8-Prenylnaringenin."

[0097] [2-2] Oral Composition The oral composition of the present disclosure comprises a protein and 8-prenylnaringenin. An oral composition comprising a protein of the present disclosure and 8-prenylnaringenin (hereinafter, in the items included in [2-2], simply referred to as the "oral composition") can reduce the flavor characteristic of protein by incorporating 8-prenylnaringenin together with the protein.

[0098] [2-2-1] Protein The protein contained in the oral composition of the present disclosure includes known proteins without particular limitation. Specifically, examples of the protein used in the oral composition of the present disclosure include plant proteins and / or animal proteins.

[0099] The vegetable protein is not particularly limited as long as it is derived from a plant. Examples of such plants include pulses such as soybeans, peas, lentils, chickpeas, black beans, broad beans, mung beans, lupin beans, and kidney beans; cereals such as wheat, barley, oats, sorghum, rice, rye, buckwheat, barnyard millet, millet, teff, quinoa, corn, and potatoes; nuts and seeds such as almonds, coconuts, peanuts, cashew nuts, hazelnuts, pecan nuts, macadamia nuts, pistachios, walnuts, Brazil nuts, pili nuts, chestnuts, sesame seeds, pine nuts, hemp seeds (industrial hemp), chia seeds, amaranth, canary seeds, and linseed; and algae. The vegetable protein may be derived from one plant or a combination of two or more plants.

[0100] There are no particular limitations on the animal protein, as long as it is derived from an animal. Examples of such animals include mammals such as pigs, cows, sheep, deer, horses, kangaroos, and rabbits; birds such as chickens, quails, turkeys, and ducks; reptiles such as crocodiles and snakes; amphibians such as frogs; fish such as sardines, tuna, salmon, and cod; mollusks such as octopus and squid; and crustaceans such as crabs and shrimp. More specific examples of animal proteins include milk proteins (whey, casein, etc.), connective proteins (proteins derived from connective tissues such as skin, bones, cartilage, and tendons (e.g., collagen)), muscle proteins, and egg white proteins (albumin, etc.). Animal proteins may be derived from one type of animal, or may be derived from two or more types of animals in combination.

[0101] In order to incorporate proteins into the oral composition of the present disclosure, products of the above proteins may be used, or organs, tissues, eggs, body fluids, secretions, or crude protein products of the plants or animals from which the proteins are derived may be used.

[0102] The protein content (total amount) contained in the oral composition of the present disclosure is not particularly limited, but may be, for example, 0.05 wt% or more, such as 0.05 to 70 wt% of the total protein. From the viewpoint of enhancing the flavor-reducing effect, the total amount of protein is preferably 0.05 to 50 wt%, 0.05 to 40 wt%, 0.05 to 30 wt%, 0.05 to 25 wt%, 0.05 to 20 wt%, more preferably 0.05 to 15 wt%, even more preferably 0.05 to 10 wt%, and even more preferably 0.05 to 8 wt%. Furthermore, because the oral composition of the present disclosure has an excellent effect of reducing the protein flavor, it can effectively reduce the flavor even when the protein is contained at a concentration that originally makes the flavor more noticeable. From this viewpoint, suitable amounts of protein contained in the oral composition of the present disclosure include 0.1 to 70 wt%, 0.5 to 70 wt%, 0.8 to 70 wt%, 2 to 70 wt%, 4 to 70 wt%, or 6 to 70 wt%.

[0103] [2-2-2] 8-Prenylnaringenin In order to incorporate 8-prenylnaringenin into the oral composition of the present disclosure, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing a functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0104] In the oral composition of the present disclosure, the ratio of the protein content (total amount) to the 8-prenylnaringenin content can be appropriately set depending on the desired degree of flavor reduction effect, etc., and the ratio of 8-prenylnaringenin per 1000 parts by weight of protein content is, for example, 0.03 parts by weight or more, preferably 0.035 to 5 parts by weight, or 0.04 to 5 parts by weight, more preferably 0.055 to 5 parts by weight, 0.06 to 5 parts by weight, or 0.07 to 5 parts by weight. parts, or 0.075 to 5 parts by weight, more preferably 0.1 to 5 parts by weight, 0.13 to 5 parts by weight, or 0.15 to 5 parts by weight, even more preferably 0.22 to 5 parts by weight, 0.25 to 5 parts by weight, 0.28 to 5 parts by weight, or 0.3 to 5 parts by weight, still more preferably 0.47 to 5 parts by weight, or 0.5 to 5 parts by weight, particularly preferably 0.8 to 5 parts by weight, 1 to 5 parts by weight, 1.5 to 5 parts by weight, or 2 to 5 parts by weight, 2 to 4 parts by weight, or 2 to 3 parts by weight.

[0105] When the functional material described above in "[1-1] Functional material" (preferably the functional material obtained by the above "[1-3] Method for producing functional material" or the functional material composition described below in "[4] Fourth embodiment") is used to incorporate 8-prenylnaringenin in the oral composition of the present disclosure, the protein content (total amount) and the content ratio of the functional material can be appropriately set depending on the desired level of flavor reduction effect, etc., and the ratio of the functional material per part by weight of the protein content is, for example, 0.02 parts by weight or more, preferably 0.025 to 17.5 parts by weight, or 0.028 to 17.5 parts by weight, more preferably 0.04 to 17.5 parts by weight. 5 parts by weight, 0.042 to 17.5 parts by weight, 0.05 to 17.5 parts by weight, or 0.053 to 17.5 parts by weight, more preferably 0.07 to 17.5 parts by weight, 0.09 to 17.5 parts by weight, or 0.1 to 17.5 parts by weight, even more preferably 0.15 to 17.5 parts by weight, 0.18 to 17.5 parts by weight, 0.2 to 17.5 parts by weight, or 0.21 to 17.5 parts by weight, still more preferably 0.33 to 17.5 parts by weight, or 0.35 to 17.5 parts by weight, particularly preferably 0.57 to 17.5 parts by weight, 0.7 to 17.5 parts by weight, 1 to 17.5 parts by weight, or 1.4 to 17.5 parts by weight, 1.4 to 2.8 parts by weight, or 1.4 to 2 parts by weight.

[0106] Specific examples of the content of 8-prenylnaringenin in the oral composition of the present disclosure include 0.0001 to 0.1 wt %, 0.0002 to 0.07 wt %, 0.0004 to 0.04 wt %, 0.0008 to 0.01 wt %, 0.001 to 0.08 wt %, 0.001 to 0.04 wt %, 0.001 to 0.02 wt %, 0.001 to 0.01 wt %, or 0.001 to 0.005 wt %.

[0107] When the functional material described above in "[1-1] Functional material" (preferably the functional material obtained by the above "[1-3] Method for producing a functional material" or the functional material composition described below in "[4] Fourth embodiment") is used to incorporate 8-prenylnaringenin in the oral composition of the present disclosure, specific amounts of the functional material may be, for example, 0.072 to 72 wt %, 0.14 to 50 wt %, 0.3 to 30 wt %, 0.57 to 7.2 wt %, 0.72 to 57 wt %, 0.72 to 28 wt %, 0.72 to 14 wt %, 0.72 to 7.2 wt %, or 0.72 to 3.5 wt %.

[0108] [2-2-3] Other Components The oral composition of the present disclosure may or may not contain any other components as long as they do not impair the flavor-reducing effect of the protein.

[0109] For example, when a protein is formulated using organs, tissues, eggs, body fluids, secretions, or crude protein products of the plant or animal from which it is derived, it may contain components other than protein (water, lipids, carbohydrates, vitamins, minerals, etc.) that were contained in the plant or animal from which it is derived.

[0110] For example, when the oral composition of the present disclosure is in a solid form (dry form), it may or may not contain one or more of the other components (functional components and / or additives, etc.) described above in “[1-2] Solid Oral Composition.”

[0111] For example, when the oral composition of the present disclosure is in a hydrous form (e.g., liquid, gel, etc.), it can further contain a base and / or additive depending on the formulation form. Examples of such base and / or additive include water, lower (C1 to C5) monohydric alcohols, polyhydric alcohols, natural fats and oils, hydrocarbon oils, ester oils, fatty acid alkyl esters, fatty acids, fatty acid esters, higher (C6 or more or C12 or more) monohydric alcohols, cholesterol, glyceryl tri-2-ethylhexanoate, cetyl 2-ethylhexanoate, silicone oil; gelling agents (pectin, gelatin, carrageenan, xanthan gum, agar, methylcellulose, HPMC, guar gum, tara gum, locust bean gum, glucomannan, gum arabic, gellan gum, alginic acid, etc.); surfactants; refreshing agents, preservatives, flavoring agents, colorants, humectants, abrasives, UV absorbers, chelating agents, buffers, solubilizers, solubilizers, etc. These additives may be used alone or in combination of two or more. The content of these base materials and / or additives can be appropriately determined depending on the type of base material and / or additive, the dosage form of the oral composition, etc.

[0112] Furthermore, even when the oral composition of the present disclosure is in a water-containing form (e.g., liquid, gel, etc.), it may or may not contain one or more of the other components (functional components and / or additives, etc.) described above in “[1-2] Solid oral composition.”

[0113] [2-2-4] Dosage Forms and Product Classifications Dosage forms of the oral composition of the present disclosure include gels, creams, lotions, ointments, liquids, pastes, jellies, aerosols, powders, granules, capsules, candies, drops, lozenges, tablets (particularly plain tablets), chewable tablets, gummies, edible films, and the like. These dosage forms can be prepared by formulating the composition using additives appropriate for the dosage form according to known methods described in the General Provisions for Preparations of the Japanese Pharmacopoeia, Seventeenth Edition, and the like. When the oral composition of the present disclosure is in the form of a food or beverage, it can be prepared according to conventional methods for producing food or beverage products.

[0114] Examples of product categories for the oral composition of the present disclosure include foods and beverages (for example, functional foods and beverages (health functional foods such as foods for specified health uses (including conditional FOSHU [foods for specified health uses]) and foods with nutrient functions, foods with functional claims, foods for special dietary uses, dietary supplements, health supplements, supplements, etc.), pharmaceuticals (for oral use), oral care products (for example, mouthwash, mouthwash, dental cream, oral ointment, dentifrices (toothpaste, gel dentifrice, liquid dentifrice (dental rinse)), oral tablets (buccal tablets, gums, lozenges, adhesive tablets, etc.), oral capsules for external use (for spraying into the mouth), oral sprays, etc.), etc.

[0115] [2-2-5] Protein Flavor Reducer 8-Prenylnaringenin can reduce the protein flavor. Therefore, the present disclosure also provides a protein flavor reducer comprising 8-prenylnaringenin.

[0116] The protein flavor reducer of the present disclosure is used to reduce the flavor of proteins. Proteins are as described above in "[2-2-1] Protein." The method for using the flavor reducer of the present disclosure is as described below in "[2-2-6] Method for reducing protein flavor."

[0117] In order to incorporate 8-prenylnaringenin into the protein flavor reducer of the present disclosure, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing a functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0118] The content of 8-prenylnaringenin contained in the protein flavor reducer of the present disclosure is not particularly limited, as long as it can be used for the above-mentioned applications, and examples include 0.05% by weight or more, 0.05 to 90% by weight, 0.05 to 80% by weight, 0.05 to 60% by weight, 0.05 to 40% by weight, 0.05 to 20% by weight, 0.05 to 15% by weight, 0.05 to 10% by weight, 0.05 to 5% by weight, 0.05 to 3% by weight, 0.05 to 1% by weight, preferably 0.08 to 0.5% by weight, more preferably 0.1 to 0.3% by weight, 0.1 to 0.2% by weight, or 0.12 to 0.15% by weight.

[0119] When the functional material described in "[1-1] Functional Material" above (preferably the functional material obtained by "[1-3] Method for Producing Functional Material" above or the functional material composition described in "[4] Fourth Embodiment" below) is used to incorporate 8-prenylnaringenin into the protein flavor reducer of the present disclosure, the content of the functional material contained in the protein flavor reducer of the present disclosure is not particularly limited, as long as it is usable for the above-mentioned applications, and examples include 35% by weight or more, 35 to 99.9% by weight, 45 to 99.9% by weight, preferably 57 to 99.5% by weight, 64 to 99.5% by weight, more preferably 72 to 99% by weight, 86 to 99% by weight, or 86 to 95% by weight.

[0120] The protein flavor reducer of the present disclosure may or may not contain additives and / or bases as optional other components, as long as the protein flavor reducer effect is not impaired. Examples of such additives and bases, which may or may not be present, include excipients, buffers, antioxidants, UV inhibitors, preservatives, antiseptics, pH adjusters, dispersants, emulsifiers, solubilizers, carriers, solvents (water, etc.), etc. When additives and bases are used, one of these additives and bases may be used alone, or two or more may be used in combination. The content of these additives and bases may be appropriately determined depending on the type of component and / or the formulation form of the protein flavor reducer.

[0121] The formulation of the protein flavor-reducing agent of the present disclosure is not particularly limited, and examples include dry powder and granular formulations, and liquid formulations.

[0122] [2-2-6] Method for Reducing Protein Flavor 8-Prenylnaringenin can reduce the flavor specific to proteins. Therefore, the present disclosure also provides a method for reducing the flavor of proteins, which comprises incorporating 8-prenylnaringenin into an oral composition containing a protein.

[0123] In the method for reducing the flavor of a protein disclosed herein, the oral composition containing the protein is similar to the oral composition described in "[2-2] Oral composition" except that it does not contain 8-prenylnaringenin or the functional material described in "[1-1] Functional material" above (preferably the functional material obtained in "[1-3] Method for producing a functional material" above or the functional material composition described in "[4] Fourth embodiment" below).

[0124] In the method for reducing the flavor of a protein according to the present disclosure, in order to incorporate 8-prenylnaringenin into an oral composition, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing a functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0125] The amount of 8-prenylnaringenin or functional material to be blended relative to the amount (total amount) of protein contained in the oral composition is as described above in "[2-2-2] 8-Prenylnaringenin."

[0126] [2-3] Food and drink The food and drink of the present disclosure contains a protein and 8-prenylnaringenin. Food and drink containing the protein of the present disclosure and 8-prenylnaringenin (hereinafter, in the items included in [2-3], simply referred to as "food and drink") can improve satiety after ingestion by incorporating 8-prenylnaringenin together with the protein. The improvement in satiety can be confirmed by extending the time until hunger is felt after ingestion.

[0127] [2-3-1] Protein The types of proteins contained in the food and beverage products of the present disclosure are the same as those described above in "[2-2-1] Protein."

[0128] The protein content (total amount) contained in the food and beverage products of the present disclosure is not particularly limited, but may be, for example, 0.05% by weight or more, such as 0.05 to 70% by weight. From the perspective of further improving satiety, the total amount of protein is preferably 0.1 to 70% by weight, 0.5 to 70% by weight, 0.8 to 70% by weight, more preferably 2 to 70% by weight, 4 to 70% by weight, and even more preferably 6 to 70% by weight. Because the food and beverage products of the present disclosure have an excellent effect of improving satiety, satiety can be effectively improved even if they contain protein at a concentration that would normally make you feel hungry for a short period of time. From this perspective, suitable amounts of protein contained in the food and beverage products of the present disclosure include 0.05 to 50% by weight, 0.05 to 40% by weight, 0.05 to 30% by weight, 0.05 to 25% by weight, 0.05 to 20% by weight, 0.05 to 15% by weight, 0.05 to 10% by weight, or 0.05 to 9% by weight.

[0129] [2-3-2] 8-Prenylnaringenin In order to incorporate 8-prenylnaringenin into the foods and beverages of the present disclosure, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing a functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0130] In the foods and beverages of the present disclosure, the ratio of the protein content (total amount) to the 8-prenylnaringenin content can be set as appropriate depending on the desired level of satiety-enhancing effect, and examples of the ratio of 8-prenylnaringenin per 1000 parts by weight of protein content include 0.03 parts by weight or more, preferably 0.035 to 5 parts by weight, or 0.04 to 5 parts by weight, and more preferably 0.055 to 5 parts by weight, 0.06 to 5 parts by weight, 0.06 to 4 parts by weight, 0.06 to 3 parts by weight, 0.06 to 2 parts by weight, 0.06 to 1 part by weight, 0.06 to 0.5 parts by weight, or 0.06 to 0.1 parts by weight.

[0131] In the food and beverage products of the present disclosure, when the functional material described in the above "[1-1] Functional material" (preferably the functional material obtained by the above "[1-3] Method for producing functional material" or the functional material composition described in the below-mentioned "[4] Fourth embodiment") is used to incorporate 8-prenylnaringenin, the content ratio of the protein (total amount) and the functional material can be appropriately set depending on the desired degree of satiety-enhancing effect, etc. The ratio of the functional material per 1 part by weight is, for example, 0.02 parts by weight or more, preferably 0.025 to 17.5 parts by weight, or 0.028 to 17.5 parts by weight, more preferably 0.04 to 17.5 parts by weight, 0.042 to 17.5 parts by weight, 0.042 to 2.8 parts by weight, 0.042 to 2 parts by weight, 0.042 to 1.5 parts by weight, 0.042 to 1 part by weight, 0.042 to 0.5 parts by weight, 0.042 to 0.1 part by weight, or 0.042 to 0.08 parts by weight.

[0132] In the foods and beverages of the present disclosure, specific amounts of 8-prenylnaringenin included are, for example, 0.0001 to 0.1 wt %, 0.0002 to 0.07 wt %, 0.0004 to 0.04 wt %, 0.0008 to 0.01 wt %, 0.001 to 0.08 wt %, 0.001 to 0.04 wt %, 0.001 to 0.02 wt %, 0.001 to 0.01 wt %, or 0.001 to 0.005 wt %.

[0133] When the functional material described above in "[1-1] Functional material" (preferably the functional material obtained by the above "[1-3] Method for producing a functional material" or the functional material composition described below in "[4] Fourth embodiment") is used to incorporate 8-prenylnaringenin in the food and beverage products of the present disclosure, specific amounts of the functional material may be, for example, 0.072 to 72 wt %, 0.14 to 50 wt %, 0.3 to 30 wt %, 0.57 to 7.2 wt %, 0.72 to 57 wt %, 0.72 to 28 wt %, 0.72 to 14 wt %, 0.72 to 7.2 wt %, or 0.72 to 3.5 wt %.

[0134] [2-3-3] Other Components The food and drink of the present disclosure may or may not contain any other components, as long as the effect of the protein as an agent for improving satiety is not impaired.

[0135] For example, when a protein is formulated using organs, tissues, eggs, body fluids, secretions, or crude protein products of the plant or animal from which it is derived, it may contain components other than protein (water, lipids, carbohydrates, vitamins, minerals, etc.) that were contained in the plant or animal from which it is derived.

[0136] For example, when the food or beverage of the present disclosure is in a solid form (dried form), it may or may not contain one or more of the other components (functional components and / or additives, etc.) described above in “[1-2] Solid food or beverage.”

[0137] For example, when the food or beverage product of the present disclosure is in a water-containing form (e.g., liquid, gel, etc.), it may further contain a base and / or additive depending on the formulation form. Examples of such base and / or additive include water, lower (C1 to C5) monohydric alcohols, polyhydric alcohols, natural fats and oils, hydrocarbon oils, ester oils, fatty acid alkyl esters, fatty acids, fatty acid esters, higher (C6 or more or C12 or more) monohydric alcohols, cholesterol, glyceryl tri-2-ethylhexanoate, cetyl 2-ethylhexanoate, silicone oil; gelling agents (pectin, gelatin, carrageenan, xanthan gum, agar, methylcellulose, HPMC, guar gum, tara gum, locust bean gum, glucomannan, gum arabic, gellan gum, alginic acid, etc.); surfactants; refreshing agents, preservatives, flavoring agents, colorants, humectants, abrasives, UV absorbers, chelating agents, buffers, solubilizers, solubilizers, etc. These additives may be used alone or in combination of two or more. The content of these base materials and / or additives can be appropriately determined depending on the type of base material and / or additive, the formulation form of the food or drink, etc.

[0138] Furthermore, even when the food or beverage product of the present disclosure is in a water-containing form (e.g., liquid, gel, etc.), it may or may not contain one or more of the other components (functional components and / or additives, etc.) described above in “[1-2] Solid food or beverage product.”

[0139] [2-3-4] Dosage Forms and Product Classifications Examples of dosage forms for the food and beverage products of the present disclosure include liquids, pastes, jellies, aerosols, powders, granules, capsules, candies, drops, lozenges, tablets (particularly plain tablets), chewable tablets, gummies, edible films, etc. Preparation into these dosage forms may be carried out by formulating using additives appropriate for the dosage form according to known methods described in the General Provisions for Preparations of the Japanese Pharmacopoeia, 17th Edition, etc., or may be prepared according to ordinary methods for producing foods and beverages.

[0140] Product categories of the food and beverage products disclosed herein include functional foods and beverages (foods for specified health uses (including conditional FOSHU [foods for specified health uses]) and health functional foods such as nutrient functional foods, functional food products, foods with functional claims, foods for special dietary uses, nutritional supplements, health supplements, and supplements.

[0141] [2-3-5] Agent for improving satiety in protein-containing foods and beverages 8-Prenylnaringenin can improve the satiety of protein-containing foods and beverages. Therefore, the present disclosure also provides an agent for improving satiety in protein-containing foods and beverages, which comprises 8-prenylnaringenin.

[0142] The use of the satiety enhancer for protein-containing foods and beverages of the present disclosure is to improve satiety after ingestion, that is, to extend the time until hunger is felt after ingestion.

[0143] In the satiety enhancer for protein-containing foods and beverages of the present disclosure, the protein is as described above in "[2-3-1] Protein," and foods and beverages containing protein-containing foods and beverages are similar to the foods and beverages described above in "[2-3] Foods and beverages," except that they do not contain 8-prenylnaringenin or the functional material described above in "[1-1] Functional material" (preferably the functional material obtained by the above "[1-3] Method for producing a functional material" or the functional material composition described below in "[4] Fourth embodiment"). The method of using the satiety enhancer of the present disclosure is as described below in "[2-3-6] Method for improving satiety in protein-containing foods and beverages."

[0144] In order to incorporate 8-prenylnaringenin into the satiety enhancer for protein-containing foods and beverages of the present disclosure, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0145] The content of 8-prenylnaringenin contained in the satiety enhancer for the protein-containing food or beverage of the present disclosure is not particularly limited, as long as it can be used for the above-mentioned purposes, and examples include 0.05% by weight or more, 0.05 to 90% by weight, 0.05 to 80% by weight, 0.05 to 60% by weight, 0.05 to 40% by weight, 0.05 to 20% by weight, 0.05 to 15% by weight, 0.05 to 10% by weight, 0.05 to 5% by weight, 0.05 to 3% by weight, 0.05 to 1% by weight, preferably 0.08 to 0.5% by weight, more preferably 0.1 to 0.3% by weight, 0.1 to 0.2% by weight, or 0.12 to 0.15% by weight.

[0146] When the functional material described above in "[1-1] Functional material" (preferably the functional material obtained by the above "[1-3] Method for producing a functional material" or the functional material composition described below in "[4] Fourth embodiment") is used to incorporate 8-prenylnaringenin into the protein satiety enhancer of the present disclosure, the content of the functional material contained in the protein satiety enhancer of the present disclosure is not particularly limited, as long as it can be used for the above-mentioned applications, and examples include 35% by weight or more, 35 to 99.9% by weight, 45 to 99.9% by weight, preferably 57 to 99.5% by weight, 64 to 99.5% by weight, more preferably 72 to 99% by weight, 86 to 99% by weight, or 86 to 95% by weight.

[0147] The satiety enhancer for protein-containing foods and beverages of the present disclosure may or may not contain additives and / or bases as optional other components, as long as the satiety enhancer effect is not impaired. Examples of additives and bases that may or may not be contained include excipients, buffers, antioxidants, UV inhibitors, preservatives, antiseptics, pH adjusters, dispersants, emulsifiers, solubilizers, carriers, solvents (water, etc.). When additives and bases are used, one of these additives and bases may be used alone, or two or more may be used in combination. The content of these additives and bases may be appropriately determined depending on the type of component and / or the formulation form of the satiety enhancer for protein-containing foods and beverages.

[0148] The formulation of the satiety enhancer for protein-containing foods and beverages of the present disclosure is not particularly limited, and examples include powders, dry granular formulations, and liquid formulations.

[0149] [2-3-6] Method for improving satiety duration of protein-containing foods and beverages 8-Prenylnaringenin can improve satiety duration of protein-containing foods and beverages. Therefore, the present disclosure also provides a method for improving satiety duration of protein-containing foods and beverages by blending 8-prenylnaringenin into the protein-containing foods and beverages.

[0150] In the method for improving satiety of a protein-containing food or beverage according to the present disclosure, the food or beverage containing the protein-containing food or beverage is similar to the food or beverage described in "[2-3] Food or beverage" above, except that it does not contain 8-prenylnaringenin or the functional material described in "[1-1] Functional material" above (preferably the functional material obtained by "[1-3] Method for producing a functional material" above or the functional material composition described in "[4] Fourth embodiment" below).

[0151] In the method of the present disclosure for improving satiety in a protein-containing food or beverage, in order to incorporate 8-prenylnaringenin into the protein-containing food or beverage, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing a functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0152] The amount of 8-prenylnaringenin or functional material to be blended relative to the amount (total amount) of protein contained in the protein-containing food or drink is as described above in "[2-3-2] 8-Prenylnaringenin."

[0153] [3] Third Embodiment A third embodiment of the present disclosure is an atrogin-1 expression inhibitor containing 8-prenylnaringenin and leucine. The atrogin-1 expression inhibitor of the present disclosure can improve its atrogin-1 expression inhibitory effect by adding leucine to 8-prenylnaringenin.

[0154] [3-1] 8-Prenylnaringenin In order to incorporate 8-prenylnaringenin into the atrogin-1 expression inhibitor of the present disclosure, a purified product of 8-prenylnaringenin may be used, or the functional material described above in "[1-1] Functional material," preferably the functional material obtained by the above "[1-3] Method for producing a functional material," or the functional material composition described below in "[4] Fourth embodiment," may be used.

[0155] In the atrogin-1 expression inhibitor of the present disclosure, the content of 8-prenylnaringenin may be set appropriately depending on the desired atrogin-1 expression inhibitory effect, dosage, formulation, etc., and may be, for example, 0.0001 to 0.1 wt %, 0.0002 to 0.07 wt %, 0.0004 to 0.04 wt %, 0.0008 to 0.01 wt %, 0.001 to 0.08 wt %, 0.001 to 0.04 wt %, 0.001 to 0.02 wt %, 0.001 to 0.01 wt %, or 0.001 to 0.005 wt %.

[0156] When the functional material described in the above section "[1-1] Functional Material" (preferably the functional material obtained by the above section "[1-3] Method for Producing a Functional Material" or the functional material composition described below in "[4] Fourth Embodiment") is used to incorporate 8-prenylnaringenin into the atrogin-1 expression inhibitor of the present disclosure, the content of the functional material may be appropriately set depending on the desired atrogin-1 expression inhibitory effect, dosage, formulation, or the like, and examples thereof include 0.072 to 72 wt %, 0.14 to 50 wt %, 0.3 to 30 wt %, 0.57 to 7.2 wt %, 0.72 to 57 wt %, 0.72 to 28 wt %, 0.72 to 14 wt %, 0.72 to 7.2 wt %, and 0.72 to 3.5 wt %.

[0157] [3-2] Leucine In the atrogin-1 expression inhibitor of the present disclosure, the ratio of 8-prenylnaringenin to leucine can be appropriately set depending on the desired level of improvement in the inhibition of atrogin-1 expression. For example, the ratio of leucine to 1 part by weight of 8-prenylnaringenin is, for example, 10 to 5,000 parts by weight, preferably 50 to 5,000 parts by weight, more preferably 100 to 5,000 parts by weight, even more preferably 400 to 5,000 parts by weight, even more preferably 600 to 5,000 parts by weight, and particularly preferably 750 to 5,000 parts by weight, 750 to 3,000 parts by weight, 750 to 1,500 parts by weight, 750 to 1,200 parts by weight, 750 to 1,000 parts by weight, or 750 to 900 parts by weight.

[0158] [3-3] Other Components The atrogin-1 expression inhibitor of the present disclosure may consist solely of the above-mentioned 8-prenylnaringenin or functional material and leucine, or may contain additives and / or bases depending on the formulation. Such additives and bases, which may or may not be contained, are not particularly limited as long as they are pharmaceutically acceptable, and examples thereof include water, lower (carbon number 1 to 5) monohydric alcohols, polyhydric alcohols, natural fats and oils, hydrocarbon oils, ester oils, fatty acid alkyl esters, fatty acids, fatty acid esters, higher (carbon number 6 or more or 12 or more) monohydric alcohols, cholesterol, glyceryl tri-2-ethylhexanoate, cetyl 2-ethylhexanoate, silicone oil; gelling agents (pectin, gelatin, carrageenan, xanthan gum, agar, methylcellulose, HPMC, guar gum, tara gum, locust bean gum, glucomannan, gum arabic, gellan gum, alginic acid, etc.); surfactants; excipients, lubricants, coating agents, sweeteners, acidulants, umami seasonings, leavening agents, cooling agents, preservatives, flavoring agents, colorants, humectants, abrasives, ultraviolet absorbers, chelating agents, buffers, solubilizers, solubilizers, pH adjusters, etc. When an additive and / or base is used, the additive and / or base may be used alone or in combination of two or more. The content of the additive and / or base is appropriately determined depending on the type of component used and the formulation form of the atrogin-1 expression inhibitor.

[0159] Furthermore, the atrogin-1 expression inhibitor of the present disclosure may or may not contain nutritional components and / or other pharmacological components, as necessary, in addition to the above-described active ingredients. Such nutritional components and pharmacological components, which may or may not be contained, are not particularly limited as long as they are pharmaceutically acceptable, and examples thereof include proteins, other amino acids, antacids, stomachic agents, digestive aids, other intestinal regulators, antispasmodics, mucosal repair agents, anti-inflammatory agents, astringents, antiemetics, antitussives, expectorants, anti-inflammatory enzymes, sedatives, hypnotics, antihistamines, caffeine, cardiac diuretics, antibacterial agents, vasoconstrictors, vasodilators, local anesthetics, herbal medicines, herbal extracts, vitamins, and menthols. When nutritional components and / or other pharmacological components are used, these nutritional components and / or pharmacological components may be used alone or in combination of two or more. The content of these nutritional components and / or pharmacological components is appropriately determined depending on the type of components used and the formulation form of the atrogin-1 expression inhibitor.

[0160] [3-4] Dosage Forms and Product Classifications Dosage forms of the atrogin-1 expression inhibitor of the present disclosure include liquids, pastes, jellies, powders, granules, capsules, candies, drops, troches, tablets, chewable tablets, gummies, edible films, and the like. These dosage forms can be prepared by formulating the product using additives appropriate for the dosage form according to known methods described in the General Provisions for Preparations of the Japanese Pharmacopoeia, Seventeenth Edition, and the like. When the dosage form of the atrogin-1 expression inhibitor of the present disclosure is a food or beverage, it can be prepared according to a typical method for producing a food or beverage.

[0161] Product categories of the atrogin-1 expression inhibitor of the present disclosure include pharmaceuticals (for internal use), foods and beverages (for example, functional foods and beverages (foods for specified health uses (including conditional FOSHU [foods for specified health uses]) and foods with nutrient function claims, foods with functional claims, foods for special dietary uses, nutritional supplements, health supplements, foods for the sick, supplements, space foods, enteral nutrients, etc.), etc.

[0162] [3-5] Uses The atrogin-1 expression inhibitor of the present disclosure is used for inhibiting atrogin-1 expression. Furthermore, the atrogin-1 expression inhibitor of the present disclosure can be used for any application utilizing the effect of atrogin-1 expression inhibition. An application utilizing the effect of atrogin-1 expression inhibition includes the inhibition of muscle atrophy. Examples of such muscle atrophy include disuse muscle atrophy (e.g., muscle atrophy due to aging, prolonged bed rest, plaster cast immobilization due to fractures, and exposure to microgravity such as space travel), progressive muscle atrophy (e.g., amyotrophic lateral sclerosis (ALS)), age-related muscle weakness (sarcopenia), and muscle atrophy associated with disease (e.g., cancer (cachexia), sepsis, type 1 diabetes, etc.).

[0163] The atrogin-1 expression inhibitor of the present disclosure can be used by administering or having an effective amount of 8-prenylnaringenin and leucine ingested by a subject in need of atrogin-1 expression inhibition (e.g., a subject experiencing or at risk of experiencing the above-described muscle atrophy). Examples of subjects experiencing muscle atrophy include subjects currently experiencing muscle atrophy due to aging, prolonged bed rest, cast immobilization due to a fracture or the like, or exposure to microgravity such as space travel; subjects with amyotrophic lateral sclerosis (ALS); patients with age-related muscle weakness; and patients with cancer (cachexia), sepsis, or type 1 diabetes who are currently experiencing muscle atrophy due to the disease. Examples of subjects at risk of developing muscle atrophy include elderly people, subjects who are subject to long periods of bed rest, subjects who are subject to plaster cast immobilization due to fractures, etc., and subjects who are subject to microgravity exposure such as space stays, and who do not develop muscle atrophy at the time of ingestion or administration; subjects who have amyotrophic lateral sclerosis (ALS) causative genes (e.g., SOD1, TDP43, LRP12, C9ORF72, SPTLC2, etc.) and do not develop muscle atrophy at the time of ingestion or administration; subjects who are lacking in exercise and / or nutrition and do not develop muscle atrophy at the time of ingestion or administration; and subjects with cancer (cachexia), sepsis, or type 1 diabetes who do not develop muscle atrophy at the time of ingestion or administration.

[0164] The atrogin-1 expression inhibitor of the present disclosure may be used for either therapeutic or non-therapeutic purposes. Here, "non-therapeutic" does not include medical procedures, i.e., does not include methods of surgery, therapy, or diagnosis on humans, more specifically, does not include methods of surgery, therapy, or diagnosis on humans performed by a physician or a person under the direction of a physician.

[0165] Animals to which the atrogin-1 expression inhibitor of the present disclosure is applicable include humans and non-human animals (such as mammals).

[0166] [4] Fourth Embodiment A fourth embodiment of the present disclosure is a functional material composition comprising a functional material consisting of an 8-prenylnaringenin-producing culture of Blautia microorganisms and a metal-containing compound. The functional material composition of the present disclosure suppresses the odor (specifically, the sour odor) characteristic of an 8-prenylnaringenin-producing culture of Blautia microorganisms.

[0167] The 8-prenylnaringenin-producing culture of a microorganism of the genus Blautia (hereinafter simply referred to as the functional material) in the functional material composition of the present disclosure includes a culture obtained by causing a microorganism of the genus Blautia to produce 8-prenylnaringenin from isoxanthohumol. More specifically, the functional material includes a culture obtained by a method comprising the steps of: causing a microorganism of the genus Blautia to produce 8-prenylnaringenin using isoxanthohumol as a substrate in a solution containing isoxanthohumol, thereby obtaining a solution containing 8-prenylnaringenin; and drying the solution containing 8-prenylnaringenin. Preferably, the functional material includes a functional material obtained by the above-mentioned "(1-3) Method for producing a functional material."

[0168] The content of the functional material in the functional material composition of the present disclosure is not particularly limited, but may be, for example, 50 wt % or more, specifically 50 to 99.5 wt %. From the viewpoint of enhancing the odor suppression effect, the content of the functional material in the functional material composition of the present disclosure is preferably 50 to 95 wt %, more preferably 50 to 91 wt %, and even more preferably 50 to 86 wt %. Because the functional material composition of the present disclosure has an excellent odor suppression effect, odor can be effectively suppressed even with a high content of the functional material. From this viewpoint, suitable contents of the functional material in the functional material composition of the present disclosure include 54 to 99.5 wt %, 60 to 99.5 wt %, 70 to 99.5 wt %, 80 to 99.5 wt %, 85 to 99.5 wt %, 90 to 99.5 wt %, or 95 to 99.5 wt %.

[0169] Examples of metal-containing compounds include metal hydroxides and metal salts (compounds in which one or more hydrogen atoms of an acid are substituted with a metal ion).

[0170] Examples of metal salts include salts of inorganic acids and salts of organic acids. Examples of salts of inorganic acids include chloride salts (Cl - salts of sulphates (SO4 2- or HSO4 - salts of phosphate (PO4 3- , HPO4 2- , or H2PO4 - salts of ammonium nitrate, carbonate (CO3 2- or HCO3 - Examples of the salts of organic acids include formates and salts of fatty acids (acetic acid, propionic acid, butyric acid, etc.) which may be linear or branched and have one or more carbon atoms (preferably 1 to 5, more preferably 1 to 4).

[0171] Examples of the metal include Ca, Mg, and Fe, with Ca being preferred.

[0172] These metal-containing compounds may be used alone or in combination of two or more. Among these metal-containing compounds, those approved as food additives are preferred. Furthermore, among these metal compounds, from the viewpoint of further enhancing the odor suppression effect, metal hydroxides are preferred, and calcium hydroxide is more preferred.

[0173] In the functional material composition of the present disclosure, the amount of the metal-containing compound to be blended can be appropriately determined depending on the desired level of odor suppression effect, but the ratio of the metal-containing compound per 1 part by weight of the functional material is, for example, 0.01 to 0.99 parts by weight, preferably 0.05 to 0.99 parts by weight, 0.09 to 0.99 parts by weight, 0.14 to 0.99 parts by weight, 0.14 to 0.9 parts by weight, or 0.14 to 0.85 parts by weight. , 0.14 to 0.8 parts by weight, 0.14 to 0.75 parts by weight, 0.14 to 0.7 parts by weight, 0.14 to 0.65 parts by weight, 0.14 to 0.6 parts by weight, 0.14 to 0.55 parts by weight, 0.14 to 0.5 parts by weight, 0.14 to 0.45 parts by weight, 0.14 to 0.4 parts by weight, 0.14 to 0.35 parts by weight, 0.14 to 0.3 parts by weight, 0.14 to 0.25 parts by weight, or 0.14 to 0.2 parts by weight.

[0174] In the functional material composition of the present disclosure, specific examples of the blending amount of the metal-containing compound include 0.5 to 50 wt %, 0.5 to 46 wt %, 0.5 to 40 wt %, 0.5 to 30 wt %, 0.5 to 20 wt %, 0.5 to 16 wt %, 1 to 16 wt %, 3 to 16 wt %, 4 to 16 wt %, 8 to 16 wt %, 9 to 16 wt %, 12 to 16 wt %, 0.5 to 10 wt %, and 0.5 to 5 wt %.

[0175] Each feature disclosed herein may be combined with any other feature disclosed herein.

[0176] The present invention will be described in more detail below with reference to examples, but the configurations and combinations thereof in each embodiment are merely examples, and additions, omissions, substitutions, and other modifications of the configurations may be made as appropriate within the scope of the present invention. The present disclosure is not limited by the embodiments, but is limited only by the scope of the claims.

[0177] Test Example 1 In this test example, the effect of improving the bioavailability of a functional material containing 8-prenylnaringenin (8PN) was confirmed.

[0178] (1) Preparation of Functional Material Containing 8-Prenylnaringenin (8PN) (Example 1) Modified GAM medium (manufactured by Nissui Pharmaceutical Co., Ltd.) was supplemented with Tween® 20 (generic name: Polysorbate 20) (Tokyo Chemical Industry Co., Ltd.) (final concentration: 5 g / L) and isoxanthohumol (final concentration: 300 mg / L), followed by heat sterilization and degassing with a N:CO:H (80 vol%:10 vol%:10 vol%) mixed gas. This was used as the fermentation medium. Blautia sp. DC 3652 (NITE BP-02924) strain was inoculated into the fermentation medium under the mixed gas atmosphere (atmospheric pressure) and anaerobically cultured at 37°C for 7 days. The resulting culture solution was spray-dried (using dextrin as an excipient) and powdered.

[0179] (2) Measurement of functional material containing 8PN The obtained functional material was measured using a Rigaku MiniFlex II. As a result, a broad diffraction pattern for 8PN was observed, confirming that it was amorphous. Furthermore, when the particle size distribution was measured using a Malvern Panalytical Morphologi Model MOR280, the average particle diameter D50 was 71.5 μm.

[0180] The obtained functional material was dissolved in ethanol and filtered through a 0.45 μm filter. The filtrate was then subjected to quantitative analysis by HPLC under the following conditions. The results showed that the amorphous material contained 1.40 mg / g of 8PN and 0.07 mg / g of xanthohumol. This indicates that the functional material was obtained as an amorphous material containing a mixture of 8PN and xanthohumol. <HPLC conditions> Column: Inertsil ODS-3 (4.6 mm × 25 cm, 5 μm) Eluent A: H2O / Formic acid (99 / 1) Eluent B: Acetonitrile / Formic acid (99 / 1) Gradient conditions: 0-5 min (volume ratio of solution B: 20%) → 5-10 min (volume ratio of solution B: 70%) → 10-30 min (volume ratio of solution B: 70%) Column temperature: 40°C Flow rate: 1.0 mL / min Detection: UV at 290 nm

[0181] (3) Preparation of 8PN Synthetic Product (Comparative Example 1) 8PN was chemically synthesized by 8-prenylation of naringenin according to the method described in the literature (Kawamura, T., Hayashi, M., Mukai, R., Terao, J., & Nemoto, H. (2012). An efficient method for C8-prenylation of flavonols and flavanones. Synthesis, 44, 1308-1314.). The resulting synthetic product was subjected to X-ray analysis in the same manner as above, and the diffraction pattern confirmed that it was crystalline. Furthermore, the 8PN content of the resulting synthetic product was 95.5% based on the quantitative analysis by HPLC described above. Furthermore, the particle size distribution was measured in the same manner as above, and the average particle diameter D50 was 113.1 μm.

[0182] (4) Pharmacokinetics Test The functional material obtained in (1) above and the synthetic product obtained in (3) above were orally administered to rats at a dose of 50 mg / kg (human equivalent dose of approximately 8 mg / kg) for 8PN. Oral administration was performed by feeding the rats solid oral compositions containing the functional material obtained in (1) above and the synthetic product obtained in (3) above mixed into their feed. The blood concentration of 8PN (μg / mL) was measured over time. The results are shown in Table 1A.

[0183]

[0184] As shown in the results in Table 1A, the functional material of Example 1 exhibited significantly higher bioavailability when the same dose of 8PN was orally administered.

[0185] A hard capsule supplement (containing 0.28 mg of 8PN) containing the functional material containing 8-prenylnaringenin (8PN) of Example 1 was formulated in a conventional manner using appropriate amounts of capsule base, excipients, etc. A formulation example is shown below.

[0186] [Test Example 2] In this test example, the effects of 8PN on reducing the bitterness of bitter amino acids ([2-1]), reducing the flavor of protein ([2-2]), and improving the satiety of protein-containing foods and beverages ([2-3]) were confirmed.

[0187] [2-1] Reduction of bitterness of bitter amino acids The effect of 8PN on reducing the bitterness of bitter amino acids (valine, leucine, isoleucine, and arginine) was evaluated.

[0188] Liquid oral compositions having the compositions shown in Table 2A (except for Comparative Example 2-a3, which was water) were prepared. These liquid oral compositions were subjected to a sensory evaluation of their bitterness by expert panelists. The bitterness was evaluated on a 10-point scale, with Comparative Example 2-a1 (aqueous solution containing only bitter amino acids) being scored as 10 and Comparative Example 2-a3 (water) being scored as 1. The results are shown in Table 2A.

[0189]

[0190] As shown in Table 2A, the bitterness of bitter amino acids could hardly be reduced even when 2 wt% sucrose was added (Comparative Example 2-a2), but the bitterness was reduced in a concentration-dependent manner by adding only a very small amount of 8-PN (Examples 2-A1 to 2-A4).

[0191] [2-2] Protein Flavor Reduction The effect of 8PN on reducing the protein flavor of protein materials was evaluated. The following protein powders were used as protein materials: Whey WPC powder (protein content: 78.4 wt%), Whey WPI powder (protein content: 88.3 wt%), Soy protein powder (protein content: 87.6 wt%), and Pea protein powder (protein content: 78.3 wt%).

[0192] [2-2-1] Liquid oral compositions were prepared according to the compositions shown in Table 2B (except for Comparative Example 2-b3, which was water). Expert panelists performed a sensory evaluation of these liquid oral compositions to determine the level of protein-specific flavor. The level of flavor was evaluated on a 10-point scale, with Comparative Example 2-b1 (aqueous solution containing only whey WPC powder) being scored as 10 and Comparative Example 2-b3 (water) being scored as 1. The results are shown in Table 2B.

[0193]

[0194] As shown in Table 2B, the protein-specific flavor was only slightly reduced by adding 2 wt% sucrose (Comparative Example 2-b2), but the flavor was reduced in a concentration-dependent manner by adding only a very small amount of 8-PN (Examples 2-B1 to 2-B4). In particular, in Example 2-B4, the flavor was significantly reduced, and an excellent masking effect was obtained.

[0195] [2-2-2] Liquid oral compositions were prepared according to the compositions shown in Table 2C (except for Comparative Example 2-c3, which was water). Expert panelists performed a sensory evaluation of these liquid oral compositions to determine the level of protein-specific flavor. The level of flavor was evaluated on a 10-point scale, with Comparative Example 2-c1 (aqueous solution containing only whey WPI powder) being scored as 10 and Comparative Example 2-c3 (water) being scored as 1. The results are shown in Table 2C.

[0196]

[0197] As shown in Table 2C, the protein-specific flavor could not be reduced at all even when 2 wt% of sucrose was added (Comparative Example 2-c2), but the flavor was reduced in a concentration-dependent manner by adding only a very small amount of 8-PN (Examples 2-C1 to 2-C4).

[0198] [2-2-3] Liquid oral compositions were prepared according to the compositions shown in Table 2D (except for Comparative Example 2-d3, which was water). These liquid oral compositions were subjected to a sensory evaluation by expert panelists to determine the level of protein-specific flavor. The level of flavor was evaluated on a 10-point scale, with Comparative Example 2-d1 (aqueous solution containing only soy protein powder) being scored as 10 and Comparative Example 2-d3 (water) being scored as 1. The results are shown in Table 2D.

[0199]

[0200] As shown in Table 2D, the protein-specific flavor could only be reduced slightly by adding 2 wt% sucrose (Comparative Example 2-d2), but the flavor was reduced in a concentration-dependent manner by adding only a very small amount of 8-PN (Examples 2-D1 to 2-D4).

[0201] [2-2-4] Liquid oral compositions were prepared according to the compositions shown in Table 2E (except for Comparative Example 2-e3, which was water). Expert panelists performed a sensory evaluation of these liquid oral compositions to determine the level of protein-specific flavor. The level of flavor was evaluated on a 10-point scale, with Comparative Example 2-e1 (aqueous solution containing only pea protein powder) being scored as 10 and Comparative Example 2-e3 (water) being scored as 1. The results are shown in Table 2E.

[0202]

[0203] As shown in Table 2E, the protein-specific flavor was reduced even when 2 wt% sucrose was added (Comparative Example 2-e2), but the flavor was further reduced by adding only a very small amount of 8-PN (Example 2-E1 to Example 2-E2).

[0204] [2-2-5] Liquid oral compositions were prepared according to the compositions shown in Table 2F (except for Comparative Example 2-f3, which was water). These liquid oral compositions were subjected to a sensory evaluation by expert panelists to determine the level of protein-specific flavor. The level of flavor was evaluated using a 10-point scale, with Comparative Example 2-f1 (milk) being 10 and Comparative Example 2-f3 (water) being 1. The results are shown in Table 2F.

[0205]

[0206] As shown in Table 2F, the protein-specific flavor could only be reduced slightly by adding 2 wt% sucrose (Comparative Example 2-f2), but the flavor was reduced in a concentration-dependent manner by adding only a very small amount of 8-PN (Examples 2-F1 to 2-F4).

[0207] [2-2-6] Liquid oral compositions were prepared according to the compositions shown in Table 2G (except for Comparative Example 2-g3, which was water). These liquid oral compositions were subjected to a sensory evaluation by expert panelists to determine the level of protein-specific flavor. The level of flavor was evaluated on a 10-point scale, with Comparative Example 2-g1 (soy milk) being scored as 10 and Comparative Example 2-g3 (water) being scored as 1. The results are shown in Table 2G.

[0208]

[0209] As shown in Table 2G, the protein-specific flavor could only be reduced slightly by adding 2 wt% sucrose (Comparative Example 2-g2), but the flavor was reduced in a concentration-dependent manner by adding only a very small amount of 8-PN (Examples 2-G1 to 2-G4).

[0210] [2-2-7] Jelly oral compositions were prepared according to the compositions shown in Table 2H (except for Comparative Example 2-h3, which was water). These jelly oral compositions were subjected to a sensory evaluation by expert panelists to determine the level of protein-specific flavor. The level of flavor was evaluated on a 10-point scale, with Comparative Example 2-h1 (gelatin jelly) being scored as 10 and Comparative Example 2-h3 (water) being scored as 1. The results are shown in Table 2H.

[0211]

[0212] As shown in Table 2H, the protein-specific flavor could only be reduced slightly by adding 2 wt% sucrose (Comparative Example 2-h2), but the flavor was reduced in a concentration-dependent manner by adding only a very small amount of 8-PN (Examples 2-H1 to 2-H4).

[0213] [2-3] Improving satiety with protein-containing foods and beverages Protein-containing beverages were prepared with the compositions shown in Table 2I. The subjects were six healthy adult men and women, and were prohibited from eating or drinking anything other than water from the time they woke up on the day of the test. On the day of the test, the subjects gathered in a room where they could rest in a fasting state. The subjects ingested the total amount of protein-containing beverage shown in Table 2I. Hunger sensations before ingestion, 30 minutes after ingestion, 60 minutes after ingestion, 90 minutes after ingestion, 120 minutes after ingestion, and 180 minutes after ingestion were rated using the following five-point score. The results are shown in Table 2I. 1: Unable to bear hunger 2: Very hungry 3: Slightly hungry 4: Almost no hunger 5: No hunger at all

[0214]

[0215] As shown in Table 2I, the beverage containing 8-PN together with protein (Example 2-I) suppressed hunger 90 minutes after ingestion compared to the protein-containing beverage not containing 8-PN (Comparative Example 2-i), demonstrating improved satiety.

[0216] [Test Example 3] In this test example, the inhibitory effect of the combination of 8PN and leucine on the expression of atrogin-1 was confirmed.

[0217] Mouse skeletal muscle-derived cell line C2C12 (4 × 10 4One mL of 10% FCS / DMEM (10% FCS / DMEM) cells was seeded into a 24-well plate and cultured at 37°C in a 5% CO2, 95% air atmosphere. After removing the medium, 1 mL of differentiation medium (2% horse serum / DMEM) was added, and the culture was continued for an additional 4 days. After removing the medium, 1 mL of serum-free differentiation medium and the components listed in Table 3 were added at the specified concentrations, and the culture was continued for 4 hours. After removing the culture medium, the cells were washed once with 1 mL of D-PBS(-), and then total RNA was extracted using Nucleospin RNA (Takara Bio, product code 740955.10) according to the standard protocol. cDNA was prepared from RNA using a PrimerScript RT Reagent kit (Takara Bio, cat. RP03A), and then real-time PCR was performed using the intercalator method with SYBR Green I. The following primers were used for each gene in the real-time PCR: GPDH: TGTGTCGTCGTGGATCTGA (Forward) (SEQ ID NO: 1) TTGCTGTTGAAGTCGCAGGAG (Reverse) (SEQ ID NO: 2) Atrogin1: AACATGTGGGTGTATCGGATGG (Forward) (SEQ ID NO: 3) TGATGTTCAGTTGTAAGCACACAGG (Reverse) (SEQ ID NO: 4) In this test example, no cytotoxicity was observed under the conditions of any of the comparative examples and examples.

[0218] The expression level of Atrogin-1 (Atrogin-1 / GAPDH) was measured by relative quantification (ΔΔCt method) using GAPDH as a housekeeping gene. The expression level of Atrogin-1 (Atrogin-1 / GAPDH) in Comparative Example 3-1 (control) was set to 1, and the relative values ​​of the expression level in each Comparative Example and each Example were calculated. The results are shown in Table 3.

[0219]

[0220] As shown in Table 3, dexamethasone induction promoted the expression of Atrogin-1, a muscle atrophy-related gene (Comparative Example 3-2), while the addition of 8PN suppressed Atrogin-1 expression (Comparative Example 3-3). Furthermore, the addition of leucine together with 8PN further suppressed Atrogin-1 expression (Example 3). On the other hand, when the leucine in Example 3 was replaced with valine, which is also a BCAA like leucine, no further suppression of Atrogin-1 expression was observed, and rather a tendency for promotion was observed (Comparative Example 3-4). In other words, the effect of suppressing Atrogin-1 expression observed by combining 8PN and leucine was found to be a unique effect due to the selection of leucine as a combined component. Furthermore, from these results, the effect of improving the muscle atrophy suppression effect by the combination of 8PN and leucine can be rationally inferred.

[0221] [Test Example 4] In this test example, the odor-inhibiting effect of the 8PN material obtained from microorganisms was confirmed.

[0222] The powdered functional material compositions shown in Table 4 were prepared (except for Comparative Example 4-2, which was water). For each functional material composition prepared, expert panelists performed a sensory evaluation of the level of odor (specifically, sour odor). The odor level was evaluated on a 10-point scale, with Comparative Example 4-1 (only the functional material of Example 1) being 10 and Comparative Example 4-2 (water) being 1. The results are shown in Table 4.

[0223]

[0224] As shown in Table 4, the odor exhibited by the functional material of Example 1 was suppressed by adding calcium hydroxide (Examples 4-1 to 4-4). In particular, according to Examples 4-3 and 4-4, the odor exhibited by the functional material of Example 1 was completely masked.

Claims

1. A functional material containing an amorphous substance containing 8-prenylnaringenin and having an average particle size of 0.5 to 100 μm.

2. The functional material according to claim 1, further comprising xanthohumol.

3. The functional material according to claim 2, wherein the xanthohumol is contained in an amount of 2 to 30 parts by weight per 100 parts by weight of the 8-prenylnaringenin.

4. The functional material according to claim 1, wherein the content of 8-prenylnaringenin is 0.5 to 200 mg / g.

5. A solid oral composition comprising the functional material according to any one of claims 1 to 4.

6. A method for producing a functional material, comprising: Step 1: obtaining a solution containing 8-prenylnaringenin by causing a Blautia microorganism to produce 8-prenylnaringenin using isoxanthohumol as a substrate in a solution containing isoxanthohumol; and Step 2: drying the solution containing 8-prenylnaringenin to obtain an amorphous substance having an average particle size of 0.5 to 100 μm.

Citation Information

Patent Citations

  • Method for producing dealkylated prenylflavanone, and method for producing composition including dealkylated prenylflavanone

    JP2024039127A

  • Amorphous ramelteon and process for the preparation thereof

    WO2009084023A2