Antisense oligomer and antitumor effect enhancer
Antisense oligomers targeting LOC644656 enhance the effectiveness of antitumor therapies by increasing cancer cell sensitivity to chemotherapeutic agents and radiation therapy, addressing drug resistance and improving treatment outcomes.
Patent Information
- Application Number
- PCT/JP2025/013659
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-04
- Filing Date
- 2025-04-03
- Publication Date
- 2025-10-09
AI Technical Summary
There is a need for enhancing the effectiveness of existing antitumor therapies due to challenges such as strong side effects, refractory cancers, and cancer cell resistance to antitumor drugs, with insufficient research on methods to improve standard treatments.
Development of antisense oligomers that suppress the functional expression of LOC644656, a long non-coding RNA highly expressed in cancer cells, by forming complementary sequences to target and degrade LOC644656, thereby enhancing the sensitivity of cancer cells to chemotherapeutic agents and radiation therapy.
The antisense oligomers increase the sensitivity of cancer cells to chemotherapeutic agents and radiation therapy by suppressing LOC644656 expression, addressing drug resistance and improving treatment efficacy.
Smart Images

Figure JPOXMLDOC01-APPB-C000001 
Figure JPOXMLDOC01-APPB-C000002 
Figure JPOXMLDOC01-APPB-C000003
Abstract
Description
Antisense oligomers and antitumor effect enhancers
[0001] The present invention relates to an antisense oligomer or a pharmaceutically acceptable salt thereof, an antitumor effect enhancer, and an antitumor agent.
[0002] As the population ages and lives become longer, one in two people will develop some form of cancer. Therefore, there is a need for a wide range of options for cancer treatment. Standard cancer treatments for most types of cancer have been established by combining existing antitumor drugs. However, there are challenges, such as strong side effects, the existence of refractory cancers for which standard therapies are ineffective, and the problem of recurrence. While active efforts are being made to develop new antitumor drugs, there has been insufficient research and development into methods to enhance the effectiveness of existing standard therapies. In particular, there is an urgent need to address the development of cancer cell resistance to antitumor drugs.
[0003] An object of the present invention is to provide an antisense oligomer or a pharmaceutically acceptable salt thereof that can be used as an antitumor effect enhancer, an antitumor effect enhancer, and an antitumor agent.
[0004] The present inventors, through analysis of the mechanism by which cancer cells acquire resistance to chemotherapeutic agents, focused on LOC644656, a long non-coding RNA (lncRNA) that is highly expressed only in human ES cells and cancers, and discovered that an antisense oligomer that suppresses the functional expression of LOC644656 can be used as an antitumor effect enhancer, thereby completing the present invention. The present invention encompasses the following aspects: [1] An antisense oligomer or a pharmaceutically acceptable salt thereof that suppresses the functional expression of LOC644656, comprising a base sequence complementary to the base sequence of the following (i-1) or (i-2): (i-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 1. (i-2) A base sequence in which one or more bases have been deleted, substituted or inserted in a base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 1. [2] The antisense oligomer or pharmaceutically acceptable salt thereof according to [1], which contains a base sequence complementary to the base sequence of (ii-1), (ii-2), (iii-1) or (iii-2) below. (ii-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 2. (ii-2) A base sequence in which one or more bases are deleted, substituted, or inserted in a base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 2. (iii-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 3. (iii-2) A base sequence in which one or more bases are deleted, substituted, or inserted in a base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 3. [3] The antisense oligomer according to [1] or [2], which consists of a base sequence complementary to SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, or a pharmaceutically acceptable salt thereof. [4] An antitumor effect enhancer comprising the antisense oligomer according to any one of [1] to [3], or a pharmaceutically acceptable salt thereof. [5] The antitumor effect enhancer according to [4], which is used in combination with another antitumor agent or radiation therapy.[6] The antitumor effect enhancer according to [4] or [5], for administration to a patient with a cancer selected from the group consisting of lung squamous cell carcinoma, uterine endometrial cancer, invasive breast cancer, hepatocellular carcinoma, sarcoma, esophageal cancer, colon adenocarcinoma, uveal melanoma, renal clear cell carcinoma, adrenocortical carcinoma, testicular cancer, pheochromocytoma / paraganglioma, and prostate adenocarcinoma. [7] An antitumor agent administered in combination with (I) the antisense oligomer according to any one of [1] to [3] or a pharmaceutically acceptable salt thereof, and (II) a cytotoxic antitumor agent.
[0005] The present invention provides an antisense oligomer or a pharmaceutically acceptable salt thereof that can be used as an antitumor effect enhancer, an antitumor effect enhancer, and an antitumor agent.
[0006] FIG. 1 shows a schematic diagram of the structure of the construct used in Reference Example 1, which allows LOC644656 to be induced with doxycycline using the Tet-ON system. FIG. 2 shows the relative cell viability (%). FIG. 3 shows the relative cell viability (%). FIG. 4 shows the relative cell viability (%). FIG. 5 shows the relative cell viability (%) relative to the DMSO-added group. FIG. 6 shows the relative cell viability (%) relative to the 5-FU-unadded group.
[0007] [Antisense Oligomer] The antisense oligomer of the present invention or a pharmaceutically acceptable salt thereof comprises a base sequence complementary to the base sequence of the following (i-1) or (i-2), and suppresses the functional expression of LOC644656: (i-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 1 (i-2) A base sequence in which one or more bases have been deleted, substituted or inserted in the base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 1
[0008] Hereinafter, "antisense oligomer or a pharmaceutically acceptable salt thereof" may be simply referred to as "antisense oligomer".
[0009] <LOC644656> LOC644656 is a long non-coding RNA (lncRNA) with the nucleotide sequence shown in SEQ ID NO: 1. In humans, LOC644656 is encoded on chromosome 11. Human LOC644656 is highly expressed only in human ES cells and cancer. The nucleotide sequence of human LOC644656 is publicly known. The reference nucleotide sequence of human LOC644656 obtained by the Human Genome Project has been registered in GenBank, provided by the National Center for Biotechnology Information (NCBI), under accession number NR_036539.
[0010] <Suppression of functional expression> The antisense oligomer of the present invention or a pharmaceutically acceptable salt thereof suppresses the functional expression of LOC644656 (conferring chemotherapy drug resistance to cancer cells). The antisense oligomer of the present invention complementarily binds to the target site of LOC644656 to form a double strand, and it is thought that LOC644656 is destroyed when the double strand site is degraded by RNase H, thereby suppressing the functional expression of LOC644656.
[0011] <Nucleotide sequence> The antisense oligomer of the present invention comprises a nucleotide sequence complementary to the nucleotide sequence (i-1) or (i-2) below: (i-1) A nucleotide sequence of 15 or more consecutive nucleotides from the nucleotide sequence shown in SEQ ID NO: 1. (i-2) A nucleotide sequence in which one or more nucleotides have been deleted, substituted or inserted from the nucleotide sequence of 15 or more consecutive nucleotides from the nucleotide sequence shown in SEQ ID NO: 1.
[0012] The base sequence of SEQ ID NO: 1 is shown below.
[0013]
[0014] (Base Length) The base sequence of the antisense oligomer of the present invention is 15 bases or more, and from the viewpoint of the effects of the present invention, preferably 18 bases or more, and is 1,161 bases or less, the same as the base sequence shown in SEQ ID NO: 1, and is preferably 80 bases or less, more preferably 60 bases or less, and even more preferably 40 bases or less. In particular, from the viewpoint of the effects of the present invention, it is preferably 15 to 40 bases, more preferably 18 to 30 bases, and even more preferably 18 to 25 bases.
[0015] (Bases) The bases (also called nucleic acid bases) constituting the base sequence of the antisense oligomer include natural bases such as adenine (A), guanine (G), cytosine (C), thymine (T), uracil (U), and hypoxanthine (I), as well as non-natural modified bases thereof. There are no particular limitations on the proportion or number of modified bases contained in the antisense oligomer. Modified bases include modified adenines such as 1-methyladenine, 2-methyladenine, N6-methyladenine, and 2-methylthio-N6-isopentenyladenine; modified guanines such as 2,2-dimethylguanine, 2-methylguanine, and 7-methylguanine; modified cytosines such as 5-methylcytosine, 4-acetylcytosine, 3-methylcytosine, and 2-thiocytosine; modified uracil-5-oxyacetic acid, pseudouracil, 3-methyluracil, dihydrouracil, 5-ethyluracil, 5-bromouracil, 6-methyluracil, 2-thiouracil, 4-thiouracil, and 5-methyluracil. Examples of modified uracils include 5'-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, and 5-methyl-2-thiouracil; modified hypoxanthines such as 1-methylhypoxanthine; and other 6-azapyrimidines, purines, 2,6-diaminopurine, 2-aminopurine, indole, imidazole, and xanthine.
[0016] (Complementary base sequence) The term "complementary base sequence" refers to a base sequence that forms, with a target base sequence, a Watson-Crick base pair selected from the group consisting of adenine-thymine, adenine-uracil, and guanine-cytosine, or a base pair equivalent thereto. In a Watson-Crick base pair, a hydrogen bond is formed between the base pair. Here, "a base pair equivalent thereto" refers to a base pair equivalent to adenine-thymine, adenine-uracil, or guanine-cytosine, which is formed by using, for example, the above-mentioned modified bases in place of adenine, thymine, uracil, guanine, or cytosine; a wobble base pair such as guanine-uracil, inosine-uracil, inosine-adenine, or inosine-cytosine; and the like.
[0017] (Deletion, Substitution, or Insertion) In the base sequence (i-2), one or more bases are deleted, substituted, or inserted in a contiguous base sequence of 15 or more bases in the base sequence shown in SEQ ID NO: 1. The number of deleted, substituted, or inserted bases is not limited as long as it does not impair the effects of the present invention. For example, it is one or more, and preferably five or less, more preferably three or less, and even more preferably two or less. That is, the number of deleted, substituted, or inserted bases is preferably one, two, three, four, or five, more preferably one, two, or three, even more preferably one or two, and even more preferably one.
[0018] The base substitution includes substitution with a base that does not form a Watson-Crick base pair with the target base sequence, such as substitution with a base that forms a wobble base pair selected from the group consisting of guanine-uracil, inosine-uracil, inosine-adenine, and inosine-cytosine, and substitution with a base that does not form either a Watson-Crick base pair or a wobble base pair.
[0019] The antisense oligomer of the present invention preferably contains a base sequence complementary to the base sequence of (ii-1), (ii-2), (iii-1) or (iii-2) below: (ii-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 2 (ii-2) A base sequence in which one or more bases are deleted, substituted or inserted in a base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 2 (iii-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 3 (iii-2) A base sequence in which one or more bases are deleted, substituted or inserted in a base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 3
[0020] SEQ ID NO: 2: ATCGAATGGACGGGGATAAATAAAAACGATGTTACAGATAGCCCTCTAAGTGTGGATAGT SEQ ID NO: 3: CCAAGAGAATGAGAGACTACCCTGTTGTAACAGATTTGGATCGCGCTTAG
[0021] The antisense oligomer of the present invention more preferably consists of a base sequence complementary to SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7.
[0022] SEQ ID NO: 4: ATCGAATGGACGGGGATAAA SEQ ID NO: 5: GCCCTCTAAGTGTGGATAGT SEQ ID NO: 6: CAGATTTGGATCGCGCTTAG SEQ ID NO: 7: CCAAGAGAATGAGAGACTAC
[0023] <Antisense Oligomer> The antisense oligomer of the present invention is not limited as long as it has the above-mentioned specific base sequence and suppresses the functional expression of LOC644656. For example, it is any of an oligonucleotide, a morpholino oligomer, a peptide nucleic acid (PNA) oligomer, and a glycol nucleic acid (GNA) oligomer.
[0024] (Oligonucleotides) An oligonucleotide is an oligomer in which nucleotides having a base moiety, a sugar moiety, and a phosphate moiety are linked by phosphate bonds as a basic backbone. The nucleotides may be either natural or non-natural nucleotides. Natural nucleotides include deoxyribonucleotides in which the sugar moiety is deoxyribose and ribonucleotides in which the sugar moiety is ribose, and the respective oligomers are natural DNA and RNA. In DNA and RNA, the phosphate bond between nucleotides is a phosphodiester bond. In non-natural nucleotides, one or more of the base moiety, sugar moiety, and phosphate moiety have non-natural modifications. Therefore, the antisense oligomer of the present invention may contain at least one base modification, and / or at least one sugar modification, and / or at least one phosphate moiety (backbone) modification. Non-natural modified bases are as described above. Examples of unnatural sugar moieties include bridged nucleic acids (BNA) (e.g., linked nucleic acid (LNA), amide-bridged nucleic acid (AmNA), guanidine-bridged nucleic acid (GuNA), spirocyclopropylene-bridged nucleic acid (scpBNA)), cyclohexene nucleic acid (CeNA), 1,5-anhydrohexitol nucleic acid (HNA), 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), constrained Examples of oligonucleotides having non-natural phosphate bonds include ethyl-bridged nucleic acids (cEtBNA), threose nucleic acids (TNA), fluoro-β-arabinonucleic acid (FNA), tricycloDNA (tcDNA), 2'-F-modified ribonucleic acid (2'-F-RNA), 2'-O-methyl-modified ribonucleic acid (2'-O-Me-RNA), 2'-O-methoxyethyl-modified ribonucleic acid (2'-O-MEO-RNA), 4'-thio-modified ribonucleic acid (4'-S-RNA or 4'-S-DNA), etc. Examples of oligonucleotides having non-natural phosphate bonds include those in which natural phosphodiester bonds are partially or entirely substituted with non-natural phosphate bonds selected from phosphorothioate bonds (S-modified), phosphorodithioate bonds, alkylphosphonate bonds, phosphoroamidate bonds, phosphorodiamidate bonds, and boranophosphate bonds.
[0025] (Morpholino Oligomer) The morpholino oligomer is preferably an oligomer (phosphorodiamidate morpholino oligomer (PMO)) in which a group represented by the following formula (I) is linked.
[0026]
[0027] [In the formula, R 2 and R 3 are the same or different and represent a hydrogen atom, a linear or branched alkyl having 1 to 6 carbon atoms, a cycloalkyl having 5 to 12 carbon atoms, or an aryl having 6 to 10 carbon atoms.
[0028] Specific examples of linear or branched alkyl groups having 1 to 6 carbon atoms include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl, and isohexyl. The alkyl group may have one to three substituents. Specific examples of cycloalkyl groups having 5 to 12 carbon atoms include cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclodecyl, and cyclododecyl. Specific examples of aryl groups having 6 to 10 carbon atoms include phenyl, α-naphthyl, and β-naphthyl. Phenyl is particularly preferred. The aryl group may have one to three substituents. Examples of the substituents include halogen atoms, alkoxy groups, cyano groups, and nitro groups. Examples of halogen atoms include fluorine atoms, chlorine atoms, bromine atoms, and iodine atoms. Examples of the alkoxy include linear or branched alkoxy having from 1 to 6 carbon atoms, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, n-pentyloxy, isopentyloxy, n-hexyloxy, isohexyloxy, etc. Among these, alkoxy having from 1 to 3 carbon atoms is preferred.
[0029] Morpholino oligomers can be prepared, for example, according to WO 1991 / 009033 or WO 2009 / 064471. In particular, PMOs can be prepared according to the methods described in WO 2009 / 064471 or according to the methods described in WO 2013 / 100190.
[0030] (Modification of 5'- and 3'-Terminals) The antisense oligomer of the present invention may be modified at least at either the 5'- or 3'-terminus. In one embodiment, both the 5'- and 3'-terminus may be modified. Examples of modifying groups at the 5'- and / or 3'-terminus include an α-tocopherol group, a polyethylene glycol (PEG) group, an N-acetylglucosamine (O-GlcNAc) group, a methoxy (O-Me) group, a cholesterol group, an amino group, a peptide group (e.g., a cell-penetrating peptide, as described below), and derivatives thereof. The modifying group can be bound to the 5'- and / or 3'-terminus of the oligomer directly or via a linking moiety. The peptide group refers to a monovalent group formed by removing one hydrogen atom from a peptide.
[0031] The linking moiety is not particularly limited as long as it can covalently link the desired modification group to the 5' end or 3' end of the oligonucleotide, and linking groups used in the technical field, such as -O-, -CO-, -NH-, -CONH-, and -NHCO-, can be used.
[0032] In the present invention, one embodiment of the 5'-end of the oligonucleotide can be, for example, the following group (1) or (2).
[0033]
[0034] [wherein the wavy line indicates the bond to the 5' end of the oligonucleotide.]
[0035] In another embodiment, the modification to the 5' end is a group of the following structure (6).
[0036] wherein the wavy line indicates the bond to the 5' end of the oligonucleotide, W is S or O, preferably O, and X is NRA1 R A2 (R A1 and R A2 are each independently a hydrogen atom or lower alkyl, e.g., methyl; A3 (R A3 is a hydrogen atom or lower alkyl, e.g., methyl; Y is O or NR A4 (R A4 is a hydrogen atom or lower alkyl, such as methyl; and Ra is any modifying group (e.g., a PEG group, a cholesterol group, an amino group, a peptide group, or a derivative thereof).
[0037] The group having the structure (6) above is preferably a group having the structure (6-1) below.
[0038]
[0039] Ra is, for example, a group represented by the following (3), (4), (5), or (7).
[0040]
[0041] *-L1-peptide group (7) [wherein * represents a bond to the structure of (6) or (6-1) above, and L1 represents a single bond or a linker.]
[0042] The linker represented by L1 is not particularly limited as long as it can link the group having the structure (6) or (6-1) above to the peptide via the linker, and examples thereof include groups represented by any of the following (8-1) to (8-3):
[0043]
[0044] [In the formula, * is the same as above, ** represents a bond to a peptide, n represents an integer of 2 to 6, and m represents an integer of 2 to 6.]
[0045] The peptide moiety of the peptide group may be a cell-penetrating peptide (CPP). Specific examples of CPPs include cationic CPPs such as TAT, R8, DPV3, DPV6, Penetrating, and R9-TAT; amphipathic CPPs such as pVEC, ARF(19-31), MPG, MAP, and Transportan; and hydrophobic CPPs such as Bip4, C105Y, Melittin, and gH625. CPPs can be appropriately designed by those skilled in the art based on literature (Xie J, et al., Front Pharmacol. 2020 May 20; 11: 697, etc.).
[0046] Examples of the 3'-terminal include the following groups (2'), (4'), and (9).
[0047]
[0048] #-L2-peptide group (9) [In the formula, # represents a bond to the 3'-end of the oligonucleotide, and L2 represents a single bond or a linker.] The linker represented by L2 is not particularly limited as long as it can link the sugar at the 3'-end of the oligonucleotide to the peptide via the linker, and examples thereof include the following groups (10-1) to (10-3).
[0049] [wherein # is the same as above, ## represents a bond to the peptide group, n represents an integer of 2 to 6, and m represents an integer of 2 to 6.] The peptide portion of the peptide group can be the same as the modification to the 5'-end described above.
[0050] (Methods for Producing Various Antisense Oligomers) The various antisense oligomers described above can be produced by known methods or novel methods based on known methods based on base sequence information. Production of antisense oligomers can also be outsourced to a third party.
[0051] <Pharmaceutically Acceptable Salts> In the present invention, the antisense oligomer may be a pharmaceutically acceptable salt. Examples of salts include acid addition salts and base addition salts. The acid addition salt may be either an inorganic acid salt or an organic acid salt. Examples of inorganic acid salts include hydrochloride, hydrobromide, sulfate, hydroiodide, nitrate, and phosphate. Examples of organic acid salts include citrate, oxalate, acetate, formate, propionate, benzoate, trifluoroacetate, maleate, tartrate, methanesulfonate, benzenesulfonate, and paratoluenesulfonate. The base addition salt may be either an inorganic base salt or an organic base salt. Examples of inorganic base salts include sodium salt, potassium salt, calcium salt, magnesium salt, and ammonium salt. Examples of organic base salts include triethylammonium salt, triethanolammonium salt, pyridinium salt, and diisopropylammonium salt. The compound of the present invention may be a solvate such as a hydrate. The solvent is not particularly limited as long as it is pharmaceutically acceptable.
[0052] The antisense oligomer of the present invention or a pharmaceutically acceptable salt thereof is preferably used as an active ingredient of an antitumor effect enhancer, as described below. The reason why the antisense oligomer of the present invention or a pharmaceutically acceptable salt thereof exhibits such an effect is unknown, but part of the reason is presumed to be as follows. LOC644656 is known to bind to DNA-PKcs, a sensor protein that recognizes DNA damage. Therefore, it is presumed that LOC644656 confer resistance to antitumor agents by affecting the DNA repair system of cancer cells in some way. It is believed that the antisense oligomer of the present invention complementarily binds to the target site of LOC644656, and that the binding site is degraded by RNase H, thereby destroying LOC644656 and suppressing the functional expression of LOC644656.
[0053] [Anti-tumor effect enhancer] The anti-tumor effect enhancer of the present invention comprises the above-mentioned antisense oligomer or a pharmaceutically acceptable salt thereof as an active ingredient. The anti-tumor effect enhancer refers to a drug that has the effect of enhancing the anti-tumor effect of other tumor treatment methods. Specifically, it refers to a drug that provides an anti-tumor effect superior to the anti-tumor effect achieved by using the other tumor treatment method alone. "Anti-tumor effect" refers to the effect of suppressing and attenuating tumor growth. Specific examples of other tumor treatment methods that can be combined with the anti-tumor effect enhancer of the present invention include anti-tumor agents (chemotherapeutic agents) other than the above-mentioned antisense oligomer or a pharmaceutically acceptable salt thereof, radiation therapy, etc. The anti-tumor effect enhancer may or may not have an anti-tumor effect by itself. In one embodiment, the anti-tumor effect enhancer does not have an anti-tumor effect by itself.
[0054] The other antitumor agents are not limited, and examples thereof include cytotoxic antitumor agents. Specific examples of cytotoxic antitumor agents include antimetabolites, alkylating agents, anticancer antibiotics, microtubule polymerization inhibitors, microtubule depolymerization inhibitors, topoisomerase inhibitors, and platinum preparations. Specific examples of antimetabolites include 5-fluorouracil (5-FU). Specific examples of anticancer antibiotics include adriamycin, daunorubicin, neocarzinostatin, and the like.
[0055] The type of cancer that can be treated by the antitumor effect enhancer is not particularly limited. Among them, from the viewpoint of the effects of the present invention, the following types of cancer are preferred. Lung cancers such as lung squamous cell carcinoma (LUSC); uterine cancers such as uterine corpus endometrial carcinoma (UCEC); breast cancers such as breast invasive carcinoma (BRCA); liver cancers such as liver hepatocellular carcinoma (LIHC); muscle cancers such as sarcoma (SARC); esophageal carcinoma (ESCA) and colon adenocarcinoma (CAC); Preferred cancers include digestive cancers such as uveal melanoma (UVM); eye cancers such as kidney renal clear cell carcinoma (KIRC); adrenal gland cancers such as adrenocortical carcinoma (ACC) and pheochromocytoma and paraganglioma (PCPG); testicular cancers such as testicular germ cell tumors (TGCT); and prostate cancers such as prostate adenocarcinoma (PRAD).
[0056] From the viewpoint of pharmacokinetics, liver cancer, kidney cancer, and the like are preferred.
[0057] <Pharmaceutical Composition> In one aspect, the antitumor effect enhancer of the present invention is provided as a pharmaceutical composition containing the above-mentioned antisense oligomer or a pharmaceutically acceptable salt thereof as an active ingredient. The active ingredient may include one or more of the above-mentioned antisense oligomers or pharmaceutically acceptable salts thereof.
[0058] <Carrier> The pharmaceutical composition is provided as a pharmaceutical composition containing one or more pharmaceutically acceptable carriers, as needed. Examples of carriers include lipid nanoparticles (LNPs). Examples of lipids constituting lipid nanoparticles include cationic lipids, positively or negatively charged phospholipids, sterols, saturated or unsaturated fatty acids, and combinations thereof. When the carrier is a lipid nanoparticle, it is preferable that the antisense oligomer, which is the active ingredient, is encapsulated within the lipid nanoparticle. Further examples of carriers include aqueous buffers, pH adjusters such as acids and bases, stabilizers such as ascorbic acid and p-aminobenzoic acid, excipients such as D-mannitol, isotonicity agents, and preservatives.
[0059] <Dosage Form> The dosage form is not particularly limited, and examples thereof include various injections, oral preparations, drip infusions, etc. Furthermore, the pharmaceutical composition can be provided in any of the form of an aqueous solution, a frozen solution, and a freeze-dried product.
[0060] <Content of Active Ingredient> The content of the active ingredient in the pharmaceutical composition is not particularly limited. It can be appropriately set depending on the type of active ingredient, intended use, dosage form, and type of carrier. The content of the active ingredient in the pharmaceutical composition is, for example, 0.0001% by mass or more, preferably 0.001% by mass or more, more preferably 0.01% by mass or more, and 100% by mass or less, preferably 90% by mass or less, more preferably 50% by mass or less.
[0061] The pharmaceutical composition is intended for administration to cancer patients. There are no particular limitations on the race, sex, or age of the patients.
[0062] <Administration Route> Examples of the administration route of the pharmaceutical composition include oral administration and parenteral administration such as transdermal administration, subcutaneous administration, intramuscular administration, intravenous administration, and intraarterial administration.
[0063] <Dosage> The dosage can be determined appropriately by those skilled in the art. When the active ingredient is an antisense oligomer, the dosage of the antisense oligomer is preferably 0.1 mg / kg or more, more preferably 1 mg / kg or more, even more preferably 10 mg / kg or more, and preferably 1000 mg / kg or less, more preferably 500 mg / kg or less, and even more preferably 100 mg / kg or less. In the case of local administration, it is preferably 0.01 μg or more, more preferably 1 μg or more, and preferably 1000 μg or less, more preferably 100 μg or less. In the case of systemic administration, it is preferably 0.1 mg / kg or more, more preferably 1 mg / kg or more, and preferably 500 mg / kg or less, more preferably 100 mg / kg or less. In addition, when the active ingredient is an antisense oligomer, it can be administered once to several times a day, or at an interval of one day or several days.
[0064] [Other Aspects] The present invention also relates to the following aspects. - A method for treating tumors, comprising the step of administering the antisense oligomer or a pharmaceutically acceptable salt thereof, and an antitumor agent to a subject in need thereof. - A method for treating tumors, comprising the step of irradiating a subject in need thereof with the antisense oligomer or a pharmaceutically acceptable salt thereof, and radiation. - The antisense oligomer or a pharmaceutically acceptable salt thereof for enhancing antitumor effect. - Use of the antisense oligomer or a pharmaceutically acceptable salt thereof for producing an antitumor effect enhancer. - An antitumor agent administered in combination with the antisense oligomer or a pharmaceutically acceptable salt thereof, and a cytotoxic antitumor agent.
[0065] The present invention will be described in more detail below with reference to Reference Examples and Examples, but the present invention is not limited to these Examples.
[0066] Reference Example 1 (1) A construct that allowed LOC644656 to be inducible with doxycycline using the Tet-ON system was integrated into the genome using the PiggyBac Transposon Vector System (System Biosciences), and liver cancer-derived HepG2 cells, liver cancer-derived SK-HEP1 cells, breast cancer-derived MCF-7 cells, and renal clear cell carcinoma-derived 786-O cells were prepared. In the figure, these cells are referred to as HepG2::TetLOC644656, SK-HEP1::TetLOC644656, MCF-7::TetLOC644656, and 786-O::TetLOC644656, respectively. The structure of the construct used is shown in Figure 1. Each cell was cultured at 1 x 10 cells in a 96-well plate. 4 After seeding and culturing for 24 hours, 1 μg / mL doxycycline (Dox+ in the figure) or PBS (Dox- in the figure) was added. After culturing for another 24 hours, the medium was replaced with one containing 1000 μM, 500 μM, 200 μM, 100 μM, or 50 μM 5-fluorouracil (5-FU). HepG2 and SK-HEP1 cells were cultured for an additional 72 hours, MCF-7 cells for an additional 48 hours, and 786-O cells for an additional 24 hours. Relative cell viability (%) was measured using the Cell Counting Kit-8 cell proliferation / cytotoxicity assay kit (Dojindo Laboratories, Inc.) according to the manufacturer's instructions. The results are shown in Figure 2. In the figure, **** indicates a statistically significant difference (two-way ANOVA) of P<0.001, and ** indicates a significant difference of P<0.01.
[0067] (2) Relative cell viability was measured in the same manner as in Reference Example 1(1) above, except that a medium containing 1000 nM, 500 nM, 200 nM, 100 nM, or 50 nM of adriamycin (ADR in the figure) was used instead of the medium containing 5-FU. The results are shown in Figure 3. In the figure, **** indicates a statistically significant difference (two-way ANOVA) of P<0.001, *** indicates a significant difference of P<0.005, ** indicates a significant difference of P<0.01, and * indicates a significant difference of P<0.05.
[0068] The above-mentioned Reference Examples 1(1) and (2) suggest that high expression of LOC644656 in cancer cells results in insensitivity to chemotherapeutic agents, and therefore that suppression of the functional expression of LOC644656 can enhance sensitivity to chemotherapeutic agents.
[0069] Reference Example 2 (1) Using the HepG2::TetLOC44656 and SK-HEP1::TetLOC644656 prepared in Reference Example 1, the relative cell viability was measured in the same manner as in Reference Example 1 (1) above, except that a medium containing 1000 nM, 500 nM, or 200 nM of daunorubicin (DNR in the figure) was used instead of the 5-FU-containing medium in Reference Example 1. The results are shown in Figures 4A and 4B. (2) The relative cell viability was measured in the same manner as in Reference Example 1(1) above, using HepG2::TetLOC644656 and SK-HEP1::TetLOC644656 prepared in Reference Example 1, except that a medium containing 1 μg / mL, 0.5 μg / mL, or 0.2 μg / mL of neocarzinostatin (NCS in the figure) was used instead of the 5-FU-containing medium in Reference Example 1. The results are shown in Figures 4C and 4D.
[0070] In FIG. 4, **** indicates a statistically significant difference (two-way ANOVA) of P<0.001, *** indicates a significant difference of P<0.005, ** indicates a significant difference of P<0.01, and * indicates a significant difference of P<0.05.
[0071] The above-mentioned Reference Examples 2(1) and (2) suggest that high expression of LOC644656 in cancer cells results in insensitivity to chemotherapeutic agents. Therefore, it is suggested that suppression of the functional expression of LOC644656 can enhance sensitivity to chemotherapeutic agents. Furthermore, administration of neocarzinostatin, like radiation exposure, causes double-stranded DNA breaks and exerts an antitumor effect. Therefore, the results of the above-mentioned Reference Example 2(2) suggest that suppression of the functional expression of LOC644656 can enhance sensitivity to radiation therapy.
[0072] Production Example 1: Preparation of antisense oligomers Antisense oligomers were synthesized having the sequences shown in Table 1 below. The synthesis was outsourced to a custom synthesis service provided by Integrated DNA Technologies, Inc.
[0073]
[0074] Example 1 2 × 10 HEK293T cells were plated on a 12-well plate. 5 The cells were seeded, and the next day, 80% confluent HEK293T cells were transfected with 50 nM each of the antisense oligomers ASO#1 to ASO#8, NEAT1, and NC described in Preparation Example 1 using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific). ASO#1 to ASO#8 are antisense oligomers against the respective regions of LOC644656. NEAT1 is an antisense oligo against the NEAT1 gene. ASO#1 is the complementary strand of ASO#1. NC is a negative control sequence not present in the genomic sequence.
[0075] Forty-eight hours after transfection, RNA was extracted and collected from the cells using an RNeasy kit (QIAGEN), and 1 μg of total RNA was reverse transcribed using ReverTra Ace qPCR RT Master Mix (Toyobo Co., Ltd.). Next, the expression levels of the NEAT1 gene or LOC644656 were quantified by quantitative PCR using 10 ng of cDNA as a template. The expression level of the β-actin gene was used as an internal standard. Quantitative PCR was performed using an Applied Biosystems StepOnePlus Real Time PCR System (Thermo Fisher Scientific) according to the manufacturer's instructions. Labeling was performed using the following primer set and FAST SYBR Green Master Mix (Thermo Fisher Scientific).
[0076] The PCR primer sets used in this specification are shown in Table 2.
[0077] The expression levels of the NEAT1 gene and the LOC644656 gene were compared with those of the β-actin gene. t The value was used as an internal standard, and ΔΔC tThe results are shown in Table 3.
[0078]
[0079] The effect of antisense oligomers on the expression level of LOC644656 varied depending on the target region. In particular, ASOs #1, #6, #7, and #8 were highly effective in reducing the expression level of LOC644656.
[0080] Example 2 SK-HEP1 cells derived from liver cancer at 80% confluence were transfected with the antisense oligomers ASO#1, #6, #7, and #8 described in Preparation Example 1, as well as NC, in the same manner as in Example 1. In the figure, ASO#1 is represented as "#1 933 ASO," ASO#6 as "#6 827 ASO," ASO#7 as "#7 857 ASO," and ASO#8 as "#8 974 ASO." After 24 hours, 1 x 10 cells were transfected into a 96-well plate. 4 The cells were seeded and cultured for an additional 24 hours until they engrafted and proliferated. The medium was replaced with one containing DMSO or 200 μM 5-FU, and then cultured for 24 hours. Relative cell viability (%) was measured using a cell proliferation / cytotoxicity assay kit, Cell Counting Kit-8 (Dojindo Laboratories, Inc.), as in Reference Example 1. The results are shown in Figure 5. Figure 5 shows the effect of 5-FU in terms of relative cell viability, with the cell viability after DMSO treatment taken as 100%. In the figure, **** indicates statistical significance (two-way ANOVA) for P<0.001, and *** indicates significance for P<0.005.
[0081] It was revealed that antisense oligomers ASO#1, #6, #7 and #8 enhanced sensitivity to 5-FU in cancer-derived SK-HEP1 cells.
[0082] Example 3 Hepatocellular carcinoma-derived HepG2 cells, hepatocellular carcinoma-derived SK-HEP1 cells, breast cancer-derived MCF-7 cells, and renal clear cell carcinoma-derived 786-O cells were each transfected with the antisense oligomers ASO#1 (ASO in the figure) and SO#1 (SO in the figure) described in Preparation Example 1 using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific). After transfection, the cells were cultured for 24 hours, replated onto a 96-well plate, and cultured for an additional 24 hours. The medium was then replaced with one containing 5-fluorouracil (5-FU) at the following concentrations, and cultured for an additional 24 hours. The medium for HepG2 cells, SK-HEP1 cells, and MCF-7 cells was replaced with a medium containing 1000 μM, 500 μM, 200 μM, 100 μM, or 50 μM of 5-FU, and the medium for 786-O cells was replaced with a medium containing 200 μM, 100 μM, 50 μM, 20 μM, or 10 μM of 5-FU.
[0083] A total of 72 hours after transfection, the relative cell viability (%) relative to the 5-FU-free group was measured using a cell proliferation / cytotoxicity assay kit, Cell Counting Kit-8 (Dojindo Laboratories, Inc.), according to the manufacturer's instructions. A microplate reader (trade name Varioskan LUX Multireader, Thermo Fisher Scientific) was used to measure absorbance. The results are shown in Figure 6. In the figure, **** indicates statistical significance (two-way ANOVA) P<0.001, *** indicates significant difference P<0.05, ** indicates significant difference P<0.01, and * indicates significant difference P<0.05.
[0084] It was confirmed that the antisense oligomer of LOC644656 increased the sensitivity to 5-FU in cancer cells derived from liver cancer, breast cancer, and renal clear cell carcinoma.
Claims
1. An antisense oligomer or a pharmaceutically acceptable salt thereof that contains a base sequence complementary to the base sequence of (i-1) or (i-2) below and suppresses the functional expression of LOC644656: (i-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO:
1. (i-2) A base sequence in which one or more bases have been deleted, substituted, or inserted in the base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO:
1.
2. The antisense oligomer according to claim 1 or a pharmaceutically acceptable salt thereof, comprising a base sequence complementary to the base sequence of (ii-1), (ii-2), (iii-1) or (iii-2) below: (ii-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO:
2. (ii-2) A base sequence in which one or more bases have been deleted, substituted or inserted in a base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO:
2. (iii-1) A base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO:
3. (iii-2) A base sequence in which one or more bases have been deleted, substituted or inserted in a base sequence of 15 or more consecutive bases in the base sequence shown in SEQ ID NO:
3.
3. The antisense oligomer or a pharmaceutically acceptable salt thereof according to claim 1 or 2, which consists of a base sequence complementary to SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO:
7.
4. An antitumor effect enhancer comprising the antisense oligomer according to claim 1 or 2 or a pharmaceutically acceptable salt thereof.
5. The antitumor effect enhancer according to claim 4, for use in combination with other antitumor agents or radiation therapy.
6. The antitumor effect enhancer described in claim 4, for administration to patients with cancer selected from the group consisting of lung squamous cell carcinoma, uterine endometrial cancer, invasive breast cancer, hepatocellular carcinoma, sarcoma, esophageal cancer, colon adenocarcinoma, uveal melanoma, renal clear cell carcinoma, adrenocortical carcinoma, testicular cancer, pheochromocytoma / paraganglioma, and prostate adenocarcinoma.
7. An antitumor agent administered in combination with (I) the antisense oligomer or a pharmaceutically acceptable salt thereof according to claim 1 or 2, and (II) a cytotoxic antitumor agent.
Citation Information
Patent Citations
Method for prognosing and reducing cardiovascular disease in patients with kidney diseases
WO2018191528A1