Method for obtaining high and stable yield soybeans

Abstract

The present invention relates to the technical field of genetic engineering. Provided are a method for obtaining high and stable yield soybeans, a method for obtaining drought-resistant soybeans, and a method for obtaining disease-resistant soybeans. High-yield and drought-resistant soybeans are obtained by means of overexpression of the soybean GmmiR156b gene. Also provided are homologous sequences having 85-100% homology to the soybean GmmiR156b gene, and a target gene of soybean GmmiR156b. By using the target gene of the soybean GmmiR156b determined in the technical solution, in combination with the overexpression of the soybean GmmiR156b gene, the photosynthetic rate of soybeans can be increased, the root development, nodulation and nitrogen fixation of the soybeans are promoted, and the disease resistance and drought resistance of the soybeans are enhanced, achieving the purposes of high yield and stable yield.

Description

Method for obtaining high-yield and stable-yield soybean TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a method for obtaining high-yield and stable-yield soybean. BACKGROUND

[0002] Soybean is an important source of edible protein, edible oil and feed in China. With the continuous improvement of people's living standards, the demand for soybean food continues to rise. Although the planting area of soybean is expanding year by year, the existing soybean varieties still have the problems of low yield, unstable total yield and low planting benefit. Therefore, the total yield is still difficult to meet the domestic market consumption demand, and there is a huge gap between the production and consumption of soybean in China. Based on this, it is necessary to research a breeding technology for obtaining soybean with characteristics of stress resistance, disease and pest resistance, high yield and high quality.

[0003] SUMMARY

[0004] The present application aims to provide a method for obtaining high-yield and stable-yield soybean. By overexpressing the soybean GmmiR156b gene, the photosynthetic rate of soybean is improved, the root development and nodule fixation of soybean are promoted, and the disease resistance and drought resistance of soybean are enhanced, thereby obtaining high-yield and stable-yield soybean with high quality.

[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions.

[0006] The present application provides a method for obtaining high-yield and stable-yield soybean, which obtains high-yield and stable-yield soybean by overexpressing the soybean GmmiR156b gene.

[0007] As a preferred, the method comprises constructing a soybean GmmiR156b gene overexpression vector and obtaining a GmmiR156b gene overexpression soybean strain.

[0008] As a preferred, the method can improve the photosynthetic rate of soybean, promote the root development and nodule fixation of soybean, and enhance the disease resistance and drought resistance of soybean.

[0009] The present application further provides a method for obtaining drought-resistant soybean, which obtains drought-resistant soybean by overexpressing the soybean GmmiR156b gene.

[0010] The present application further provides a method for obtaining disease-resistant soybean, which obtains disease-resistant soybean by overexpressing the soybean GmmiR156b gene.

[0011] The application also provides homologous sequences of the soybean GmmiR156b gene, including gma-miR156a, gma-miR156b, gma-miR156c, gma-miR156d, gma-miR156e, gma-miR156f, gma-miR156g, gma-miR156h, gma-miR156i, gma-miR156j, gma-miR156k, gma-miR156l, gma-miR156m, gma-miR156n, gma-miR156o, gma-miR156p, gma-miR156q, gma-miR156r, gma-miR156s, gma-miR156t, gma-miR156u, gma-miR156v, gma-miR156w, gma-miR156x or gma-miR156y.

[0012] Preferably, the nucleotide sequence of gma-miR156a is shown as SEQ ID NO:2.

[0013] The nucleotide sequence of gma-miR156b is shown as SEQ ID NO:3.

[0014] The nucleotide sequence of gma-miR156c is shown as SEQ ID NO:4.

[0015] The nucleotide sequence of gma-miR156d is shown as SEQ ID NO:5.

[0016] The nucleotide sequence of gma-miR156e is shown as SEQ ID NO:6.

[0017] The nucleotide sequence of gma-miR156f is shown as SEQ ID NO:7.

[0018] The nucleotide sequence of gma-miR156g is shown as SEQ ID NO:8.

[0019] The nucleotide sequence of gma-miR156h is shown as SEQ ID NO:9.

[0020] The nucleotide sequence of gma-miR156i is shown as SEQ ID NO:10.

[0021] The nucleotide sequence of gma-miR156j is shown as SEQ ID NO:11.

[0022] The nucleotide sequence of gma-miR156k is shown as SEQ ID NO:12.

[0023] The nucleotide sequence of the gma-miR156l is shown as SEQ ID NO: 13;

[0024] The nucleotide sequence of the gma-miR156m is shown as SEQ ID NO: 14;

[0025] The nucleotide sequence of the gma-miR156n is shown as SEQ ID NO: 15;

[0026] The nucleotide sequence of the gma-miR156o is shown as SEQ ID NO: 16;

[0027] The nucleotide sequence of the gma-miR156p is shown as SEQ ID NO: 17;

[0028] The nucleotide sequence of the gma-miR156q is shown as SEQ ID NO: 18;

[0029] The nucleotide sequence of the gma-miR156r is shown as SEQ ID NO: 19;

[0030] The nucleotide sequence of the gma-miR156s is shown as SEQ ID NO: 20;

[0031] The nucleotide sequence of the gma-miR156t is shown as SEQ ID NO: 21;

[0032] The nucleotide sequence of the gma-miR156u is shown as SEQ ID NO: 22;

[0033] The nucleotide sequence of the gma-miR156v is shown as SEQ ID NO: 23;

[0034] The nucleotide sequence of the gma-miR156w is shown as SEQ ID NO: 24;

[0035] The nucleotide sequence of the gma-miR156x is shown as SEQ ID NO: 25;

[0036] The nucleotide sequence of the gma-miR156y is shown as SEQ ID NO: 26.

[0037] The application further provides a target gene of the soybean GmmiR156b gene, including GmSPL2a, GmSPL2b, GmSPL6a, GmSPL6b, GmSPL6c, GmSPL6d, GmSPL6e, GmSPL9a, GmSPL9b, GmSPL9c, GmSPL9d, GmSPL13Aa, GmSPL13Ab, GmSPL13Ac or GmSPL13Ad.

[0038] By adopting the technical scheme, the application has the following beneficial effects:

[0039] 1. In the application, nucleotide sequences with 85%, 90%, 95%, 98%, 99% and 100% sequence similarity with the GmmiR156b gene sequence are verified and analyzed by 5' rapid amplification of cDNA ends (RACE) and expression analysis; and it is determined that the specific gene targeted by the GmmiR156b gene is the GmSPL gene, which mediates various biological processes through the GmSPL target gene, and the GmSPL9d is the main target gene of the GmmiR156b gene.

[0040] 2. In the application, the photosynthetic rate of soybean is improved by overexpression of the soybean GmmiR156b gene, the root development, nodule fixation and nitrogen fixation of soybean are promoted, and the disease resistance and drought resistance of soybean are enhanced, thereby achieving the effects of high yield and stable yield. The examples of the application also show that the chlorophyll content and net photosynthetic rate of the GmmiR156b overexpression lines miR156bOE-11 and miR156bOE-5 are significantly improved, the root dry weight, nodule fresh weight and nodule number of soybean are significantly increased, and the root development and nitrogen fixation capacity of soybean are better. Moreover, after inoculation of pathogenic bacteria, the number of pathogenic microorganisms on the leaves of the GmmiR156b overexpression lines is significantly reduced, the degree of disease infection is small, and the disease resistance of soybean is strong; at the same time, under the same drought conditions, the wilting degree of the plant is reduced, and the survival rate after rehydration is increased, and the transpiration of the plant is reduced. BRIEF DESCRIPTION OF DRAWINGS

[0041] Fig. 1 is a nucleotide sequence similar to the soybean GmmiR156b gene sequence;

[0042] Fig. 2 is a comparison of the RACE determination results of 15 GmSPL mRNAs;

[0043] Fig. 3 is the growth of a single soybean plant of the control group and the GmmiR156b overexpression line under different densities;

[0044] Figure 4 is a diagram showing the relevant yield indicators of soybeans of the control group and the GmmiR156b overexpression line under different densities (Figure 4 A is the pod number of soybeans, B is the grain number of soybeans, C is the yield of soybeans, D is the hundred-grain weight of soybeans, E is the node number of soybean plants, and F is the branch number of soybeans) ;

[0045] Figure 5 is a diagram showing the pod number, grain number, and yield per mu of the main stem and branches of three soybean plants under different densities (Figure 5 A is the pod number of soybeans, B is the pod number ratio of the main stem and branches of soybeans, C is the grain number of soybeans, D is the grain number ratio of the main stem and branches of soybeans, E is the grain weight of soybeans, and F is the grain weight ratio of the main stem and branches of soybeans) ;

[0046] Figure 6 is a diagram showing the leaf growth of soybeans of the control group and the GmmiR156b overexpression line (Figure 6 A is the growth of soybean plants of different groups, B is the leaf of soybeans of different groups, and C is the leaf area of soybeans of different groups) ;

[0047] Figure 7 is a diagram showing the chlorophyll content and net photosynthetic rate of the leaves of soybeans of the control group and the GmmiR156b overexpression line (Figure 7 A is the chlorophyll content, and B is the net photosynthetic rate) ;

[0048] Figure 8 is a diagram showing the starch content in the leaves of soybeans of the control group and the GmmiR156b overexpression line (Figure 8 A is the staining of soybean leaves, and B is the starch content in the leaves of soybeans) ;

[0049] Figure 9 is a diagram showing the root system and nodule development of soybeans of the control group and the GmmiR156b overexpression line under different densities;

[0050] Figure 10 is a diagram showing the root system dry weight, nodule number, and nodule fresh weight of soybeans of the control group and the GmmiR156b overexpression line under different densities (Figure 10 A is the root system dry weight of soybeans, B is the nodule number, and C is the nodule fresh weight) ;

[0051] Figure 11 is a diagram showing the single-plant nodule nitrogen fixation enzyme activity of soybeans of the control group and the GmmiR156b overexpression line under different densities;

[0052] Figure 12 is a diagram showing the reactive oxygen burst of the leaves of soybeans of the control group and the GmmiR156b overexpression line;

[0053] Figure 13 is a diagram showing the detection results of the phosphorylated MAPK protein of the leaves of soybeans of the control group and the GmmiR156b overexpression line;

[0054] Figure 14 is a diagram showing the disease resistance of the leaves of soybeans of the control group and the GmmiR156b overexpression line (Figure 14 A is the pathogen infection of the leaves of soybeans, and B is the pathogen number on the leaves of soybeans) ;

[0055] Figure 15 is a drought phenotype of soybean plants of the control and GmmiR156b overexpression line (Figure 15A is the soybean plant phenotype at different drought times, and Figure 15B is the survival rate of the soybean plants after rehydration);

[0056] Figure 16 is the transpiration rate of soybean plants of the control and GmmiR156b overexpression line. DETAILED DESCRIPTION

[0057] The present application provides a method for obtaining high-yield and drought-resistant soybeans by overexpression of the soybean GmmiR156b gene.

[0058] In the present application, the method comprises constructing a soybean GmmiR156b gene overexpression vector and obtaining a GmmiR156b gene overexpression soybean line.

[0059] In the present application, the method can improve the photosynthetic rate of soybeans, promote the root development and nodule nitrogen fixation of soybeans, and enhance the disease resistance and drought resistance of soybeans.

[0060] The present application also provides a method for obtaining drought-resistant soybeans by overexpression of the soybean GmmiR156b gene.

[0061] The present application also provides a method for obtaining disease-resistant soybeans by overexpression of the soybean GmmiR156b gene.

[0062] The present application also provides homologous sequences of the soybean GmmiR156b gene, including gma-miR156a, gma-miR156b, gma-miR156c, gma-miR156d, gma-miR156e, gma-miR156f, gma-miR156g, gma-miR156h, gma-miR156i, gma-miR156j, gma-miR156k, gma-miR156l, gma-miR156m, gma-miR156n, gma-miR156o, gma-miR156p, gma-miR156q, gma-miR156r, gma-miR156s, gma-miR156t, gma-miR156u, gma-miR156v, gma-miR156w, gma-miR156x, or gma-miR156y (as shown in Figure 1).

[0063] In the present application, the homologous sequences are nucleotide sequences with 85%, 90%, 95%, 98%, 99%, and 100% similarity to the GmmiR156b gene sequence.

[0064] In the present application, the nucleotide sequence of the gma-miR156a is shown as SEQ ID NO: 2, and the specific sequence is UGACAGAAGAGAGUGAGCAC.

[0065] In the present application, the nucleotide sequence of the gma-miR156b is shown as SEQ ID NO: 3, and the specific sequence is UGACAGAAGAGAGAGAGCACA.

[0066] In the present application, the nucleotide sequence of the gma-miR156c is shown as SEQ ID NO: 4, and the specific sequence is UUGACAGAAGAUAGAGAGCAC.

[0067] In the present application, the nucleotide sequence of the gma-miR156d is shown as SEQ ID NO: 5, and the specific sequence is UUGACAGAAGAUAGAGAGCAC.

[0068] In the present application, the nucleotide sequence of the gma-miR156e is shown as SEQ ID NO: 6, and the specific sequence is CUGACAGAAGAUAGAGAGCAC.

[0069] In the present application, the nucleotide sequence of the gma-miR156f is shown as SEQ ID NO: 7, and the specific sequence is UUGACAGAAGAGAGAGAGCACA.

[0070] In the present application, the nucleotide sequence of the gma-miR156g is shown as SEQ ID NO: 8, and the specific sequence is ACAGAAGAUAGAGAGCACAG.

[0071] In the present application, the nucleotide sequence of the gma-miR156h is shown as SEQ ID NO: 9, and the specific sequence is UGACAGAAGAGAGUGAGCAC.

[0072] In the present application, the nucleotide sequence of the gma-miR156i is shown as SEQ ID NO: 10, and the specific sequence is UUGACAGAAGAUAGAGAGCAC.

[0073] In the present application, the nucleotide sequence of the gma-miR156j is shown as SEQ ID NO: 11, and the specific sequence is UUGACAGAAGAUAGAGAGCAC.

[0074] In the present application, the nucleotide sequence of the gma-miR156k is as shown in SEQ ID NO: 12, and the specific sequence is UUGACAGAAGAGAGUGAGCAC.

[0075] In the present application, the nucleotide sequence of the gma-miR156l is as shown in SEQ ID NO: 13, and the specific sequence is UUGACAGAAGAUAGAGAGCAC.

[0076] In the present application, the nucleotide sequence of the gma-miR156m is as shown in SEQ ID NO: 14, and the specific sequence is UUGACAGAAGAUAGAGAGCAC.

[0077] In the present application, the nucleotide sequence of the gma-miR156n is as shown in SEQ ID NO: 15, and the specific sequence is UUGACAGAAGAGAGUGAGCAC.

[0078] In the present application, the nucleotide sequence of the gma-miR156o is as shown in SEQ ID NO: 16, and the specific sequence is UUGACAGAAGAGAGUGAGCAC.

[0079] In the present application, the nucleotide sequence of the gma-miR156p is as shown in SEQ ID NO: 17, and the specific sequence is UUGACAGAAGAAAGGGAGCAC.

[0080] In the present application, the nucleotide sequence of the gma-miR156q is as shown in SEQ ID NO: 18, and the specific sequence is UGACAGAAGAGAGUGAGCACU.

[0081] In the present application, the nucleotide sequence of the gma-miR156r is as shown in SEQ ID NO: 19, and the specific sequence is CUGACAGAAGAUAGAGAGCAU.

[0082] In the present application, the nucleotide sequence of the gma-miR156s is as shown in SEQ ID NO: 20, and the specific sequence is UGACAGAAGAGAGUGAGCACU.

[0083] In the present application, the nucleotide sequence of the gma-miR156t is as shown in SEQ ID NO: 21, and the specific sequence is UUGACAGAAGAAAGGGAGCAC.

[0084] In the present application, the nucleotide sequence of the gma-miR156u is shown as SEQ ID NO: 22, and the specific sequence is UGACAGAAGAGAGUGAGCAC.

[0085] In the present application, the nucleotide sequence of the gma-miR156v is shown as SEQ ID NO: 23, and the specific sequence is UGACAGAAGAGAGUGAGCAC.

[0086] In the present application, the nucleotide sequence of the gma-miR156w is shown as SEQ ID NO: 24, and the specific sequence is UGACAGAAGAGAGUGAGCAC.

[0087] In the present application, the nucleotide sequence of the gma-miR156x is shown as SEQ ID NO: 25, and the specific sequence is UGACAGAAGAGAGUGAGCAC.

[0088] In the present application, the nucleotide sequence of the gma-miR156y is shown as SEQ ID NO: 26, and the specific sequence is UGACAGAAGAGAGUGAGCAC.

[0089] The present application also provides target genes of the soybean GmmiR156b gene, including GmSPL2a, GmSPL2b, GmSPL6a, GmSPL6b, GmSPL6c, GmSPL6d, GmSPL6e, GmSPL9a, GmSPL9b, GmSPL9c, GmSPL9d, GmSPL13Aa, GmSPL13Ab, GmSPL13Ac or GmSPL13Ad.

[0090] In the present application, the GeneID of each target gene is as follows:

[0091] The GeneID of GmSPL2a is LOC100796013, and the GeneID of GmSPL2b is LOC100781289;

[0092] The GeneID of GmSPL6a is LOC100820149, and the GeneID of GmSPL6b is LOC100797372;

[0093] The GeneID of GmSPL6c is LOC100817547, the GeneID of GmSPL6d is LOC100812110, and the GeneID of GmSPL6e is LOC100777766;

[0094] The GeneID of GmSPL13Aa is LOC100806582, the GeneID of GmSPL13Ab is LOC100805328, the GeneID of GmSPL13Ac is LOC102664649, and the GeneID of GmSPL13Ad is LOC100787407.

[0095] In the present application, it is determined by experiments that the MicroRNA156 (miR156)-Squamous promoter binding-like (SPL) gene module plays a key role in controlling the traits related to high yield and drought resistance of soybean, and miR156b mainly regulates these traits by directly cleaving SPL transcripts and mediates various biological processes through its SPL target genes. In the present application, 17 SPL genes are found in the soybean, including 2 GmSPL2, 5 GmSPL6, 4 GmSPL9 and 6 GmSPL13. Among them, 2 GmSPL13 genes (GmSPL13Ba and GmSPL13Bb) are regulated at the translation level by GmmiR156b; the rest of the GmSPL mRNA may be cleaved by GmmiR156b because it contains a sequence complementary to the miRNA. Then, 5' cDNA rapid amplification of the end (RACE) assay is performed, and it is found that all 15 GmSPL mRNA are effectively cleaved between base pairs 10 and 11 of the GmmiR156b target site, i.e., it is indicated that these SPLs are GmmiR156b target genes (as shown in FIG. 2).

[0096] In the present application, the experiment on the expression of the 15 GmSPL genes shows that GmSPL2a, GmSPL9a and GmSPL9d have significant expression changes in the apical meristem, axillary meristem (AM) and other organ tissues of soybean, so GmSPL2a, GmSPL9a and GmSPL9d are likely to be the targets of GmmiR156b in the SAM and AM, and GmSPL9d is likely to be the main target of GmmiR156b. It is also found that GmSPL9d can regulate the physical interaction with the central regulator homeobox gene WUSCHEL (WUSs) formed in the AM and other tissues of soybean. It is further determined that GmSPL9d is the main target of GmmiR156b, and the protein encoded thereby directly interacts with GmWUS.

[0097] The technical solutions provided by the present application will be described in detail below in combination with the embodiments, but they should not be understood as limiting the scope of protection of the present application.

[0098] Example 1

[0099] The nucleotide sequence of the soybean GmmiR156b gene is shown as SEQ ID NO: 1, and the specific sequence is GGGTTCTATTGGTGGTTGGGAATGGACTGTGATGAGTGATGTGAGATATCTCATGTTGACAGAAGAGAGAGAGCACAACCCGGGAATGGCTAAAGGAGTCTTTGCCTTTGTTGGGAGTGTGCCCTCTCTTCCTCTGTCATCATCACATTCACATGCCTTTGCTTTCTAGCCAAAGTAGACG.

[0100] The soybean GmmiR156b gene overexpression vector was constructed, and then the constructed overexpression vector was transformed into soybean to obtain GmmiR156b gene overexpression soybean lines, including two GmmiR156b overexpression lines miR156bOE-11 and miR156bOE-5. For details, see "Genetic improvement of the shoot architecture and yield in soya bean plants via the manipulation of GmmiR156b" (Sun Z, Su C, Yun J, et al. Genetic improvement of the shoot architecture and yield in soya bean plants via the manipulation of GmmiR156b [J]. Plant Biotechnology Journal, 2018. DOI: 10.1111 / pbi.12946.).

[0101] Example 2: Regulation of soybean yield

[0102] Experimental materials: two GmmiR156b overexpression lines miR156bOE-11 and miR156bOE-5 and Williams 82 (W82 from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences), wherein Williams 82 (W82) is the control group, and the two GmmiR156b overexpression lines miR156bOE-11 and miR156bOE-5 are the test groups.

[0103] Experimental method: In mid-June of each year, the control group (WT group) and two GmmiR156b overexpression lines miR156bOE-11, miR156bOE-5 were sown by scattering in Shijiazhuang City, Hebei Province (37°56'26''N, 114°43'23''E), and each material was sown in 9 plots, with a fixed row spacing of 50 cm, and each plot was 15 m 2 . After two weeks of sowing, thinning was carried out, and each material was set up three densities, 10000 plants / mu (D1), 15000 plants / mu (D2) and 20000 plants / mu (D3) respectively. When soybeans matured, single plant traits of the three materials under three sowing densities were investigated, and the yield of soybeans in each plot was measured.

[0104] The single plant traits of the three materials under different densities are shown in Figure 3. As can be seen from Figure 4, in terms of pod number, seed number, branch number, plant node number and yield per mu of soybeans, the GmmiR156b overexpression lines miR156bOE-11, miR156bOE-5 were significantly more than the WT group under different densities; in terms of hundred-grain weight, the GmmiR156b overexpression lines miR156bOE-11, miR156bOE-5 were not much different from the WT group, but overall were higher than the WT group.

[0105] The pod number, seed number and seed weight of the main stem and branches of the three soybean plants under different densities were analyzed.

[0106] Among them, the main stem pod number ratio = main stem pod number / total pod number per plant x 100%; the branch pod number ratio = branch pod number / total pod number per plant x 100%; the main stem seed number ratio = main stem seed number / total seed number per plant x 100%; the branch seed number ratio = branch seed number / total seed number per plant x 100%; the main stem seed weight ratio = main stem seed weight / total seed weight per plant x 100%; the branch seed weight ratio = branch seed weight / total seed weight per plant x 100%.

[0107] The results are shown in Figure 5, and the GmmiR156b overexpression lines miR156bOE-11, miR156bOE-5 were significantly better than the WT group under different densities.

[0108] Example 3 Regulation of soybean photosynthetic efficiency, root development and nodule fixation of nitrogen

[0109] (I) Photosynthetic efficiency

[0110] Based on the above experimental materials miR156bOE-11, miR156bOE-5 two GmmiR156b overexpression lines and Williams 82 (W82). In mid-June each year, the control group (WT group) and two GmmiR156b overexpression lines miR156bOE-11, miR156bOE-5 group were sown by scattering in Wuhan City, Hubei Province (30°47'42''N, 114°34'32''E).

[0111] 1. Chlorophyll content and net photosynthetic rate

[0112] Since the GmmiR156b expression abundance of strain miR156bOE-5 is higher and the phenotype is stronger, the photosynthetic rate is determined based on strain miR156bOE-5.

[0113] After the three soybean materials were sown for 30 days (soybean seedling stage, no thinning treatment), the chlorophyll content of the last fully expanded leaf of the WT group and the miR156bOE-5 material was determined using a handheld chlorophyll meter SPAD-502; the net photosynthetic rate of the last fully expanded leaf of the WT group and the miR156bOE-5 material was determined using a LI-6800.

[0114] As can be seen from Figure 6, the growth of the three groups of soybeans, among which the leaf area of the WT group of soybeans is relatively large, and the inter-leaf gap is small; the leaf area of the miR156bOE-5 group of soybeans is relatively small, and the inter-leaf gap is large.

[0115] As can be seen from Figure 7, the chlorophyll content of the last fully expanded leaf of the miR156bOE-5 group is higher than that of the WT group, and the net photosynthetic rate is also higher than that of the WT group.

[0116] 2. Leaf starch content

[0117] The last fully expanded leaf of the WT group and the miR156bOE-5 material after sowing for 30 days was immersed in 95% alcohol for decolorization treatment, and the decolorized leaf was dyed with KI / I2 solution (leaf starch staining), and then the excess dye solution was washed off with water.

[0118] 0.1 g of the above sample was weighed into a 10 mL centrifuge tube, 5 mL of 80% ethanol was added, and the sample was extracted in a 80°C water bath for 30 min. After extraction, the sample was centrifuged (6000 rpm, 5 min), and the supernatant was transferred to a 100 mL volumetric flask. The extraction was repeated three times (10 min each time for the second and third times), and the supernatant from the three extractions was combined and diluted with distilled water to a final volume of 100 mL for determination of the concentration of soluble sugars.

[0119] To the above remaining residue, 2 mL of distilled water was added, and it was pasted at 100°C for 15 min. After cooling, 2 mL of cold 9.2 mol / L perchloric acid was added and shaken. After intermittent shaking in an ice water bath for 15 min, 2 mL of distilled water was added and centrifuged (6000 rpm, 5 min). The supernatant 4 mL was transferred to a 100 mL volumetric flask by using a pipette. 2 mL of 4.6 mol / L perchloric acid was added to the centrifuge tube and shaken. After 15 min of extraction, 2 mL of distilled water was added and centrifuged (6000 rpm, 5 min). The supernatant 4 mL was transferred to the same volumetric flask by using a pipette. Distilled water was used to make up the volume, and it was used for starch content determination.

[0120] The results of leaf staining and starch content of the test are shown in Figure 8, wherein the WT group has a lighter degree of discoloration, and the miR156bOE-5 group has a darker degree of discoloration, that is, it also indicates that the starch content in the miR156bOE-5 group is more.

[0121] (II) Soybean root development

[0122] 1. Soybean root dry weight and nodule number

[0123] During the pod setting and grain filling period of soybeans, the soybeans of the WT group and the miR156bOE-5 group and the miR156bOE-11 group under D1 and D3 densities were dug out from the soil. After the roots were washed, the number of nodules per plant was counted, the fresh nodules were weighed, and the entire root system was dried and then weighed to determine the dry weight of the root system per plant.

[0124] As shown in Figure 9, the development of the root system and nodules of the three groups of soybeans under different densities, wherein under any density condition, the development of the root system of the miR156bOE-5 group and the miR156bOE-11 group is relatively better, with more and longer root hairs, and the development of the root system of the miR156bOE-5 group is the best. In terms of D1 and D3 densities, the development of the root system of the three groups of soybeans under D1 density is relatively better. As can be seen from Figure 10, the dry weight of the root system of the miR156bOE-5 group and the miR156bOE-11 group is significantly heavier than that of the WT group, the number of nodules is significantly more than that of the WT group, and the fresh weight of the nodules is also significantly greater than that of the WT group.

[0125] 2. Nodule nitrogen fixation enzyme activity per plant

[0126] The nodule nitrogenase activity of the D1 and D3 seeding density under the WT group and the miR156bOE-5 group and the miR156bOE-11 group material is determined by using the acetylene reduction method, the root system of the material is washed with clean water after being dug out from the soil, then all the nodules on the single root are picked off and put into a fixed volume of glass vial, and the glass vial is tightly plugged, 2 mL of air is extracted from the glass vial by using a syringe, and an equal volume of acetylene is injected, and then the glass vial is placed in a 28℃ environment for 2h of reaction; after 2h of reaction, 100μL of gas is extracted from each glass vial and injected into a gas chromatograph GC-4000A (Beijing East Analysis Instrument Co., Ltd., Beijing, China), and the content of generated ethylene is determined, and the nodule nitrogenase activity of a single plant is calculated according to the content of generated ethylene. The volume of C2H4 (μL) = K x peak area

[0127] In the formula: K is a response coefficient, which can be calculated by linear regression of the ethylene volume value and the corresponding peak area value in the standard curve; t is the temperature in Celsius (℃); P is the air pressure, usually 760mm of mercury column; 22.4 is the volume of 1 mol of gas under standard conditions, which is 22.4L; 273 is the absolute temperature.

[0128] As can be known from FIG. 11, the nodule nitrogenase activity of a single plant of the miR156bOE-5 group and the miR156bOE-11 group is significantly higher than that of the WT group.

[0129] Example 4 Regulation of soybean disease resistance

[0130] Experimental materials: two GmmiR156b overexpression strains miR156bOE-11 and miR156bOE-5 and Williams 82 (W82). Strains include B. diazoefficiens USDA110 (from the team of Academician Chen Wuxin, China Agricultural University) and Pseudomonas syringae pv. glycinea (Psg) (from the team of Liu Jianzhong, Zhejiang Normal University). The flagellin antigen small peptide flg22 amino acid sequence is synthesized in Shanghai Kingsray Co., Ltd., and the specific sequence is shown in SEQ ID NO: 2, which is QRLSTGSRINSAKDDAAGLQIA.

[0131] Experimental method: Since the expression abundance of GmmiR156b in strain miR156bOE-5 is higher and the phenotype is stronger, the disease resistance of soybean is based on strain miR156bOE-5. W82 is the control group (WT), and GmmiR156b overexpression strain miR156bOE-5 is the test group. The seeds of the WT group and the miR156bOE-5 material were sown in vermiculite soaked with nitrogen-free B&D nutrient solution (the formula of B&D nutrient solution is referred to Broughton, W. J., and Dilworth, M. J. (1971). Control of leghaemoglobin synthesis in snake beans. Biochem. J. 125: 1075-1080.), with a sowing depth of about 2 cm, and each bean was inoculated with 1 mL of B. diazoefficiens USDA110 (OD 600 = 0.08) at the same time, and then the soybeans were placed in a light incubation room with 16h light / 8h dark, light intensity of 7000LUX, temperature of 26℃, and relative humidity of 70%.

[0132] (I) Active oxygen burst detection

[0133] At 10-15d after sowing, the opposite true leaves of soybeans were fully expanded, and the opposite true leaves of the WT group and the miR156bOE-5 group were cut into small circles with a diameter of 4mm using a biopsy punch. The obtained small circles of the WT group and the miR156bOE-5 group were set as Mock groups and flg22 groups, wherein the Mock groups were the small circles of the WT group and the miR156bOE-5 group placed in 96-well enzyme plates containing 100μL sterilized water for overnight recovery of the leaves; the flg22 groups were the small circles of the WT group and the miR156bOE-5 group treated with 100nM flg22 small peptides after overnight recovery in sterilized water. Then the chemiluminescence within 30min was detected using a multifunctional enzyme marker (TECAN SPARK), and the results are shown in Figure 12.

[0134] As shown in Figure 12, the RLUs values of the WT / +flg22 group and the miR156bOE-5 / +flg22 group were significantly higher than those of the WT / Mock group and the miR156bOE-5 / Mock group, and the RLUs value of the miR156bOE-5 / +flg22 group was the highest; the RLUs values of the WT / +flg22 group and the miR156bOE-5 / +flg22 group showed a trend of first increasing and then decreasing over time.

[0135] (II) Phosphorylated MAPK protein detection

[0136] Leaf samples of WT and miR156b OE-5 materials were treated with 1 μM of flg22 small peptide for 0, 5, 10 min after overnight recovery with sterilized water, and immediately frozen in liquid nitrogen. Total proteins were extracted using protein extraction buffer (100 mM Tris-HCl, pH 7.5; 10% glycerol; 2% NP40, 5 mM EDTA; 2 mM dithiothreitol; 1 x proteinase inhibitor cocktail; 2 mM PMSF, 10 mM Na2Mo04, 10 mM NaF, 2 mM Na3V04). Equal amounts of total proteins were separated using SDS-PAGE (10% acrylamide), and transferred to PVDF membranes using semi-dry transfer. The PVDF membranes were blocked with TBST buffer containing 5% skim milk, and incubated with phospho-p44 / 42 MAPK antibody (1:1000 dilution, Cell Signaling Technology), followed by incubation with rabbit secondary antibody diluted 1:3000 in TBST buffer. The target proteins bound to the membranes were detected using chemiluminescent HRP substrate. The results are shown in Figure 13.

[0137] (III) Pathogen inoculation test

[0138] First, Pseudomonas syringae pv. glycinea (Psg) stored at -80°C was streaked on King's B solid medium for activation, and the activated bacterial spots were inoculated into King's B liquid medium containing rifampicin, and incubated overnight at 28°C in a shaker until OD 600 = 1.3. After centrifugation at 4000 rpm for 10 min, the bacterial cells were collected, washed with sterilized water, and resuspended in sterilized water to OD 600= 1.0, then 0.04% Silwet L-77 was added to the bacterial solution after resuspension. The WT and miR156b OE-5 soybean plants, which were 10-14 days old and in good condition without disease, were selected, and the pathogenic bacteria were inoculated on the front and back of the soybean leaves by leaf spraying, and then the inoculated plants were quickly covered with plastic film. Ten days after inoculation, the leaves of the WT and miR156b OE-5 plants were cut into 4 mm diameter small round pieces using a puncher, and 10 small round pieces were placed in a 2 mL EP tube. 100 μL of sterilized water was added to each EP tube, and a steel ball was used to break the leaves into a homogenate. The homogenate was then gradiently diluted, 10 μL of the liquid was taken and spotted on a TSA plate containing half the amount of rifampicin, and the plate was incubated in a 28°C incubator for two days. The colony forming units (CFU) were calculated.

[0139] As can be seen (Figure 14), the degree of pathogen invasion of the leaves of the miR156b OE-5 soybean plants was weak, the leaves were not significantly yellow, and the number of pathogenic bacteria was small, while the leaves of the WT soybean plants were significantly yellow, and the number of pathogenic bacteria was large. This indicates that the miR156b OE-5 soybean plants have relatively strong disease resistance.

[0140] Example 5 Regulation of drought resistance of soybean

[0141] 1. Survival rate

[0142] Experimental materials: two GmmiR156b overexpression lines, miR156b OE-11 and miR156b OE-5, and Williams 82 (W82).

[0143] Experimental method: W82 is the control group, and GmmiR156b overexpression lines miR156bOE-11 and miR156bOE-5 are the test groups. Fill the small black pots with vermiculite and try to ensure that the amount of vermiculite in each small black pot is consistent. Set up 5 pots for each of the three materials. Take a large white tray and fill it with 5L of water. After the vermiculite is fully soaked, plant 4 soybean seeds in each small black pot. Plant three large trays in total, and cover each tray with a lid. After 3-4 days, the soybeans germinate and the cotyledons protrude from the surface of the vermiculite. After 80% of the soybeans germinate, thin the seedlings and remove those that are not uniform in growth. Leave 2 seedlings per small black pot that are uniform in growth. Be careful not to spill the vermiculite. After thinning, gently compact the loose vermiculite to keep the surface level. After 7-10 days, the vermiculite becomes loose due to lack of water, and prepare the B&D normal nitrogen nutrient solution mother liquor in advance. Then dilute it with sterile water to the final concentration. Pour 2-3L of nutrient solution into each tray until it is saturated. If there is too much water, pour out the excess. Move the large trays to a closed environment with a plastic film around them to start the drought treatment. After about 7 days, the vermiculite begins to loosen and the water content decreases. After 12-14 days, the plants begin to show wilting symptoms. When the control and test groups show differences, rehydrate the plants. After 1 day, calculate the survival rate.

[0144] The growth of soybean plants at different stages is shown in Figure 15. Compared with the W82 group, the soybean plants in the miR156bOE-11 and miR156bOE-5 groups showed lower wilting and better growth phenotypes after 12 days of drought. After rehydration, the survival rate of soybean plants in the miR156bOE-11 and miR156bOE-5 groups was relatively high.

[0145] 2. Transpiration rate

[0146] The whole-plant transpiration was measured by gravimetric analysis (for details, see “The Arabidopsis GTL1 transcription factor regulates water use efficiency and drought tolerance by modulating stomatal density via transrepression of SDD1”). Individual plants of different groups were grown in 200 mL containers. During the measurement of transpiration, each container was covered with polyethylene wrap to prevent soil surface evaporation. The individual plants of each group were placed on a balance, and the weight of each container was measured every 5 min. At the end of the experiment, the total leaf area was determined from photographs of excised leaves using the ImageJ program, and the transpiration rate (mmol / m2s) was calculated from the gravimetric water loss rate and leaf area data. 2The data was curve fitted using a 12-point moving average, then a cubic polynomial was fitted to the smoothed data for each day. The equation for the photoperiod transpiration curve was then differentiated and solved for zero to give the time at which maximum transpiration occurred. This time was then used to calculate the maximum photoperiod transpiration rate.

[0147] Since the GmmiR156b expression abundance in the strain miR156bOE-5 is higher and the phenotype is stronger, the transpiration rate of the soybean leaf is detected based on the strain miR156bOE-5. As shown in Figure 16, the transpiration rate of the soybean plant in the miR156bOE-11 group and the miR156bOE-5 group is reduced relative to the W82 group.

[0148] As can be seen from the above examples and test examples, the chlorophyll content and net photosynthetic rate in the GmmiR156b overexpression strains miR156bOE-11 and miR156bOE-5 are significantly improved, the root system dry weight, nodule fresh weight and nodule number of soybean are significantly increased, and the soybean root system development and single plant nitrogen fixation capacity are better. Moreover, the number of pathogenic microorganisms on the soybean leaf of the GmmiR156b overexpression strain is significantly reduced, the degree of disease infection is small, and the soybean disease resistance is strong; at the same time, under the same drought condition, the wilting degree of the plant is reduced, and the survival rate after rehydration is increased, and the transpiration of the plant is reduced.

[0149] The above only describes the preferred embodiments of the present application, and it should be noted that for ordinary skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A method for obtaining high and stable yield of soybeans, characterized in that: High and stable soybean yield can be obtained by overexpressing the soybean GmmiR156b gene.

2. The method according to claim 1, characterized in that The method comprises constructing a soybean GmmiR156b gene overexpression vector and obtaining a GmmiR156b gene overexpression soybean line.

3. The method according to claim 1 or 2, characterized in that The method can increase the photosynthetic rate of soybeans, promote the root system development of soybeans, enhance the nodulation and nitrogen fixation ability of soybeans, and enhance the disease resistance and drought resistance of soybeans.

4. A method for obtaining drought-resistant soybeans, characterized in that: Drought-resistant soybean was obtained by overexpressing the soybean GmmiR156b gene.

5. A method for obtaining disease-resistant soybeans, characterized in that: Obtain disease-resistant soybean by overexpressing the soybean GmmiR156b gene.

6. The homologous sequence of the soybean GmmiR156b gene according to claim 1, characterized in that Including gma-miR156a, gma-miR156b, gma-miR156c, gma-miR156d, gma-miR156e, gma-miR156f, g ma-miR156g, gma-miR156h, gma-miR156i, gma-miR156j, gma-miR156k, gma-miR156l, gma-m iR156m, gma-miR156n, gma-miR156o, gma-miR156p, gma-miR156q, gma-miR156r, gma-miR1 56s, gma-miR156t, gma-miR156u, gma-miR156v, gma-miR156w, gma-miR156x or gma-miR156y; The nucleotide sequence of gma-miR156a is shown in SEQ ID NO: 2; The nucleotide sequence of gma-miR156b is shown in SEQ ID NO: 3; The nucleotide sequence of gma-miR156c is shown in SEQ ID NO: 4; The nucleotide sequence of gma-miR156d is shown in SEQ ID NO: 5; The nucleotide sequence of gma-miR156e is shown in SEQ ID NO: 6; The nucleotide sequence of gma-miR156f is shown in SEQ ID NO: 7; The nucleotide sequence of gma-miR156g is shown in SEQ ID NO: 8; The nucleotide sequence of gma-miR156h is shown in SEQ ID NO: 9; The nucleotide sequence of gma-miR156i is shown in SEQ ID NO: 10; The nucleotide sequence of gma-miR156j is shown in SEQ ID NO: 11; The nucleotide sequence of gma-miR156k is shown in SEQ ID NO: 12; The nucleotide sequence of gma-miR1561 is shown in SEQ ID NO: 13; The nucleotide sequence of gma-miR156m is shown in SEQ ID NO: 14; The nucleotide sequence of gma-miR156n is shown in SEQ ID NO: 15; The nucleotide sequence of gma-miR156o is shown in SEQ ID NO: 16; The nucleotide sequence of gma-miR156p is shown in SEQ ID NO: 17; The nucleotide sequence of gma-miR156q is shown in SEQ ID NO: 18; The nucleotide sequence of gma-miR156r is shown in SEQ ID NO: 19; The nucleotide sequence of gma-miR156s is shown in SEQ ID NO: 20; The nucleotide sequence of gma-miR156t is shown in SEQ ID NO: 21; The nucleotide sequence of gma-miR156u is shown in SEQ ID NO: 22; The nucleotide sequence of gma-miR156v is shown in SEQ ID NO: 23; The nucleotide sequence of gma-miR156w is shown in SEQ ID NO: 24; The nucleotide sequence of gma-miR156x is shown in SEQ ID NO: 25; The nucleotide sequence of gma-miR156y is shown in SEQ ID NO:

26.

7. The target gene of the soybean GmmiR156b gene according to claim 1, characterized in that: Including GmSPL2a, GmSPL2b, GmSPL6a, GmSPL6b, GmSPL6c, GmSPL6d, GmSPL6e, GmSPL9a, GmSPL9b, GmSPL9c, GmSPL9d, GmSPL13Aa, GmSPL13Ab, GmSPL13Ac or GmSPL13Ad.

Images