Microorganism enumeration

WO2025215382A3PCT designated stage Publication Date: 2025-11-27MOMENTUM BIOSCIENCE LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/GB2025/050788
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-12
Filing Date
2025-04-11
Publication Date
2025-11-27

AI Technical Summary

Technical Problem

Existing methods for preparing clinical samples with microorganisms are inaccurate for Gram-positive bacteria and fungi/yeast, leading to suboptimal performance in downstream diagnostic assays.

Method used

A method to determine the concentration of microorganisms by identifying their type (Gram-positive, Gram-negative, or fungi/yeast) and predicting the time to reach a target concentration through molecular detection at multiple time points, allowing for accurate sample preparation for downstream assays.

Benefits of technology

Enables precise determination of microorganism concentration for timely and effective diagnostic testing, improving assay performance by ensuring samples are prepared at the required concentration for molecular species identification, antimicrobial susceptibility testing, sequencing, and mass spectrometry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GB2025050788_27112025_PF_FP_ABST
    Figure GB2025050788_27112025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention is in the field of detection of infection. The invention relates to methods of determining the concentration of at least one type of microorganism and methods of preparing an output sample comprising a target concentration of one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism. Related devices for determining the concentration or preparing an output sample are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] MICROORGANISM ENUMERATION

[0002] FIELD OF THE INVENTION

[0003] The present invention is concerned with improving the time to detection of infection. Microorganism enumeration methods and devices are provided that allow for minimum culture periods to be determined to achieve the required microorganism concentration for downstream assay performance (diagnostic testing). The methods of the invention enable samples to be prepared which comprise a target concentration of at least one type of microorganism. The target concentration may be the concentration required for downstream assays such as molecular species / genera identification, antimicrobial susceptibility testing, sequencing and / or mass spectrometry.

[0004] BACKGROUND TO THE INVENTION

[0005] The rapid identification of infections in clinical samples remains a challenge for healthcare professionals in hospitals and other healthcare environments. Whilst downstream assays for identifying and characterising infections exist, to be effective such assays require samples comprising microorganisms at certain / minimum concentrations.

[0006] McFarland standards have been used as a reference to adjust the turbidity of bacterial suspensions so that the number of bacteria will be within a given range to standardize microbial testing. However, the present inventors have recognized that as such standards were developed for Gram negative bacteria, they are inaccurate when applied to Gram positive bacteria and fungi / yeast (e.g. Candida), both of which are important sources of infection.

[0007] Thus, there is a need for improved methods of preparing samples comprising microorganisms at a target concentration for downstream assays.

[0008] DESCRIPTION OF THE INVENTION

[0009] The present inventors have found that identifying the type of microorganism present in a sample (in particular whether the microorganism is Gram positive, Gram negative or fungi / yeast) enables the concentration of the microorganisms in the sample to be more accurately determined than if the type of microorganism is not identified. If the concentration of the microorganism is not already at a target concentration, which is often the case for samples from blood specimens taken from a patient (“blood samples”) that has, or is suspected of having, an infection, the sample can be cultured until the concentration of the microorganism reaches or exceeds the target concentration. By determining the concentration of the microorganism over at least two time points, with knowledge of the microorganism type, the time point at which the target concentration is reached or exceeded can be predicted. This prediction means that the sample can be utilised in downstream assays at an early timepoint when the threshold concentration required for that assay has been attained. Notably, the methods can be used for samples containing multiple types of microorganism that can be distinguished, one from another.

[0010] The invention provides a method of determining the concentration of at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism, the method comprising: a) detecting a molecule specific for the at least one type of microorganism in the sample; b) detecting in the sample at a first time point the level of a molecule from the at least one type of microorganism; and c) determining the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified in step a) and the level of the molecule from the at least one type of microorganism detected in step b).

[0011] The invention provides a method of preparing an output sample comprising a target concentration of at least one type of microorganism, the method comprising: a) detecting a molecule specific for the at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism; b) detecting in the sample at a first time point the level of a molecule from the at least one type of microorganism; c) determining the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified in step a) and the level of the molecule from the at least one type of microorganism detected in step b); d) culturing the sample between the first time point and a second time point; e) detecting in the sample at the second time point the level of the molecule from the at least one type of microorganism; f) determining the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified in step a) and the level of the molecule from the at least one type of microorganism detected in step e); g) determining a third time point at which the concentration of the at least one type of microorganism in the sample will reach or exceed the target concentration based on the concentrations of the at least one type of microorganism determined in steps c) and f) (i.e. the concentrations at the first and second time points); and h) culturing the sample until the third time point.

[0012] Detecting a molecule specific for the at least one type of microorganism in the sample identifies that the type of microorganism is present.

[0013] Step a) and b) may be performed separately or simultaneously. If a non-zero level of the molecule specific for the at least one type of microorganism is detected the molecule specific for the at least one type of microorganisms is necessarily detected. Detecting the molecule specific for the at least one type of microorganism in the sample may be performed at the first time point.

[0014] Although the term “sample” is used consistently herein, the skilled person would appreciate that the sample changes as it is cultured, for example, the concentration of microorganisms increases as the sample is cultured.

[0015] Given the aim of the invention is to culture the microorganisms to attain a concentration needed for downstream assays, the concentration of the at least one type of microorganism at the second time point may be (and is desirably) greater than the concentration of the at least one type of microorganism at the first time point.

[0016] The first and second time points may, or may be predicted to, precede the time point at which the concentration of the at least one type of microorganism reaches or exceeds the target concentration. Again, given the aim of the invention is to culture the microorganisms to attain a concentration needed for downstream assays, the time points may be selected with this aim in mind. The benefit of the invention is gained by determining the growth of the microorganism before the target concentration is reached, preferably so as to predict the time point at which the target concentration will be reached.

[0017] In certain situations the selected second time point may not show a sufficiently greater concentration of the at least one type of microorganism than the first time point to accurately determine a third time point at which the concentration of the at least one type of microorganism in the sample will reach or exceed the target concentration. For example, a slow-growing or damaged microorganism may not grow sufficiently between the first time point and the second timepoint. In this case one or more additional time points may be introduced by repeating steps d) and e) above. Such steps are amenable to an automation algorithm allowing an instrument performing the invention to provide a result even when initial microorganism growth is slow or delayed.

[0018] The methods may further comprise detecting at the third time point the level of the molecule from the at least one type of microorganism to confirm that the concentration of the at least one type of microorganism has reached or exceeded the target concentration. Although the methods herein permit accurate quantification of microorganisms and predicting when the target concentration has been reached or exceeded, there may be benefit in confirming the concentration of microorganisms at that time point.

[0019] The methods may further comprise taking an aliquot of the sample once the concentration of the at least one type of microorganism in the sample has reached or exceeded the target concentration, and further culturing the sample until the concentration of the at least one type of microorganism has reached or exceeded a further target concentration. This may be particularly useful where the sample is to be used for multiple downstream assays, which do not have the same concentration requirements. Separate aliquots can be used to reach or exceed target concentrations of microorganisms in each aliquot, which may be the same or different depending on the downstream assay for which that aliquot is to be used. The methods of the invention may be performed separately on each aliquot.

[0020] The target concentration is the concentration required for a downstream assay. Any suitable downstream assay may be employed as would be familiar to the skilled person. The downstream assay selected from molecular species / genera identification, antimicrobial susceptibility testing, sequencing and / or mass spectrometry.

[0021] The target concentration may be at least 100 CFU / mL. The target concentration may be specific to the implementation of the downstream assay and is therefore set by the end user or the supplier of the downstream assay. It is not necessarily a single value.

[0022] Determining the concentration of the at least one type of microorganism may comprise the use of a reference dataset correlating the level of the molecule from the at least one type of microorganism with the concentration of the at least one type of microorganism. As shown herein, the level of the molecule from the at least one type of microorganism is reliably linked to the concentration of that type of microorganism. Thus, reference datasets can be used to convert the level of the molecule to the concentration of the type of microorganism in the sample (at that time point). These can be in any suitable form, such as a standard curve or a lookup table.

[0023] It may be advantageous to culture the sample for a period before performing steps of detection, to allow for some growth. This is typically a short period of time (e.g. 10 minutes, 1 hour, or no more than 12 hours) given the purpose of the methods and is not necessarily required. Thus, the methods may further comprise culturing the sample prior to step a) and / or prior to step b). Culturing may include aerating and / or incubating under conditions which promote growth of the microorganism. Such conditions may include incubation at a temperature between 30 and 37 °C. Once the target concentration has been reached or exceeded the sample may be cooled to a temperature which retards further growth of the microorganism (e.g. between 4 and 15 °C, preferably around 4°C).

[0024] The type of microorganism that is identified in step a) is typically at the level of Gram positive bacteria, Gram negative bacteria or fungi / yeast (e.g. Candida) but other levels may be used, e.g. Enterobacteriaceae. Each of these types of microorganism grow differently to one another, but similarly within type, giving rise to key advantages of the invention. Thus, detecting the molecule specific for the at least one type of microorganism identifies the type of microorganism as Gram positive bacteria, Gram negative bacteria or fungi / yeast (e.g. Candida).

[0025] The molecule from the at least one type of microorganism may be the molecule specific for the at least one type of microorganism.

[0026] The molecule from the at least one type of microorganism may be ATP or an enzyme (such as a phosphatase, kinase, polymerase ligase). Enzymes such as a polymerase, ligase or adenylate kinase may be detected by enzymatic assays which detect the activity of the enzyme.

[0027] The molecule specific for the at least one type of microorganism may be a nucleic acid or polypeptide. The molecule specific for the at least one type of microorganism is representative of the targeted type of microorganism. For example, the target may be a gene or corresponding expressed protein. As a more specific example, for gram positive bacteria the target may be the tuf gene. Because the nucleic acid or polypeptide may vary between species within the group of Gram positive bacteria, as explained and demonstrated herein, multiple detection reagents may be used to detect the molecule specific for the at least one type of microorganism.

[0028] Detecting the molecule from or specific for the at least one type of microorganism may be achieved by any suitable means. For example, it may comprise nucleic acid amplification, sequencing, mass spectrometry or an enzymatic activity assay.

[0029] The methods may further comprise detecting periodically the molecule from the at least one type of microorganism until the target concentration is reached or exceeded.

[0030] There may be, and indeed there is typically, no prior knowledge of the type of microorganism in the sample prior to performing the methods described herein.

[0031] Prior to performing the method, the concentration of the at least one type of microorganism in the sample may be less than 100 CFU / mL. Preferably, prior to performing the method the concentration of the at least one type of microorganism in the sample is no more than 10 CFU / mL.

[0032] According to all aspects of the invention, the molecule specific for the at least one type of microorganism may only be detected if the at least one type of microorganism is present in the sample. The present inventors have found that by identifying the type of microorganism present, the concentration of that microorganism type may be accurately calculated and the growth of the microorganism type to be accurately predicted. Typically, the types of microorganism that are detected and delineated according to the invention are Gram positive bacteria, Gram negative bacteria and fungi / yeast (particularly Candida as the most prevalent source of blood-borne infection). When a type of microorganism is detected this may involve detecting one or more subtypes, which may be genera. Thus, when looking for blood-borne infection not all Gram-positive bacteria, Gram negative bacteria and fungi / yeast will be relevant. For example, if the type of microorganism is Gram positive bacteria, subtypes thereof may include Enterococci, Staphylococci and Streptococci. Species may include E. faecalis, E. faecium, S. aureus or S. pneumoniae. If the type of microorganism is Gramnegative bacteria, subtypes thereof may include Acinetobacter, Klebsiella, Escherichia and Pseudomonas. Species may include A baumannii, E. coli, K. aerogenes and / or P. aeruginosa. If the type of microorganism is fungi / yeast (e.g. Candida) subtypes thereof may include Candida (e.g. Candida albicans).

[0033] The molecule specific for the at least one type of microorganism may be a nucleic acid or polypeptide. It may be a gene or corresponding protein. Thus, the molecule specific for the at least one type of microorganism may be a nucleic acid specific for the at least one type of microorganism or a polypeptide specific for the at least one type of microorganism. The nucleic acid specific for the at least one type of microorganism may be a nucleic acid which is present only in the at least one type of microorganism (i.e. not present in other types of microorganism). The polypeptide specific for the at least one type of microorganism may be a nucleic acid which is present only in the at least one type of microorganism (i.e. not present in other types of microorganism).

[0034] If the type of microorganism is Gram positive bacteria, the molecule specific for the type of microorganism may be a molecule specific for Enterococci, Staphylococci and Streptococci and may be specific for E. faecalis, E. faecium, S. aureus and / or S. pneumoniae. If the type of microorganism is Gram negative bacteria, the molecule specific for the type of microorganism may be a molecule specific for Acinetobacter, Klebsiella, Escherichia and Pseudomonas and may be specific for A. baumannii, E. coli, K. aerogenes and / or P. aeruginosa. If the type of microorganism is fungi / yeast (e.g. Candida) the molecule specific for the type of microorganism may be a molecule specific for Candida and may be specific for Candida albicans.

[0035] The molecule specific for the at least one type of microorganism may be detected by nucleic acid amplification, sequencing, or mass spectrometry. The molecule specific for the at least one type of microorganism may be a nucleic acid specific for the type of microorganism and be detected by nucleic acid amplification, sequencing or mass spectrometry. The molecule specific for the at least one type of microorganism may be a polypeptide specific for the microorganism and be detected by mass spectrometry.

[0036] Detecting a nucleic acid molecule may comprise, consist essentially of or consist of a nucleic acid amplification step. This serves to make the methods of the invention maximally sensitive. Such amplification techniques are well known in the art, and include methods such as PCR, NASBA (Compton, 1991), 3SR (Fahy et al., 1991), Rolling circle replication, Transcription Mediated Amplification (TMA), strand displacement amplification (SDA) Clinical Chemistry 45: 777-784, 1999, the DNA oligomer self-assembly processes described in US6261846 (incorporated herein by reference), ligase chain reaction (LCR) (Barringer et al., 1990), selective amplification of target polynucleotide sequences (US 6410276), arbitrarily primed PCR (WO 90 / 06995), consensus sequence primed PCR (US 4437975), invader technology, strand displacement technology and nick displacement amplification (WO 2004 / 067726). The list above is not intended to be exhaustive. Any nucleic acid amplification technique may be used provided the appropriate nucleic acid product is specifically amplified. The nucleic acid amplification technique may be quantitative.

[0037] Similarly, sequencing based methodologies may be employed in some embodiments to include any of the range of next generation sequencing platforms, such as sequencing by synthesis of clonally amplified sequences (Illumina), pyrosequencing, 454 sequencing (Roche), nanopore sequencing (e.g. Oxford Nanopore), ion torrent (ThermoFisher) and single molecule real-time (SMRT) sequencing (Pacific Biosystems). A sequencing approach can confirm the presence or otherwise of a nucleic acid and also provide quantification thereof (e.g. through molecular counting methods).

[0038] Amplification may be achieved with the use of amplification primers specific for nucleic acid to be detected. In order to provide specificity for the nucleic acid molecules primer binding sites corresponding to a suitable region of the sequence may be selected. The skilled reader will appreciate that the nucleic acid molecules may also include sequences other than primer binding sites which are required for detection of a nucleic acid molecule, for example RNA Polymerase binding sites or promoter sequences may be required for isothermal amplification technologies, such as NASBA, 3SR and TMA.

[0039] Primers may incorporate synthetic nucleotide analogues as appropriate or may be RNA or PNA based for example, or mixtures thereof. The primers may be labelled, such as with fluorescent labels and / or FRET pairs, depending upon the mode of detection employed.

[0040] Probes may be utilised, again which may be labelled, as desired. The detection method may require use of nucleotide probes in addition to primers, or as an alternative to primers. For example, a branched DNA assay, which does not require use of primers, may be employed in some embodiments. Detection of the amplification products may be by routine methods, such as, for example, gel electrophoresis or carried out using real-time or end-point detection methods. In embodiments where the amplification product is used to determine the concentration of the microorganism, the amplification is performed with quantitative detection.

[0041] A number of techniques for real-time or end-point detection of the products of an amplification reaction are known in the art. These include use of intercalating fluorescent dyes such as SYBR Green I (Sambrook and Russell, Molecular Cloning - A Laboratory Manual, Third edition), which allows the yield of amplified DNA to be estimated based upon the amount of fluorescence produced. Many of the real-time detection methods produce a fluorescent read-out that may be continuously monitored; specific examples including molecular beacons and fluorescent resonance energy transfer probes. Real-time and end-point techniques are advantageous because they keep the reaction in a “single tube”. This means there is no need for downstream analysis in order to obtain results, leading to more rapidly obtained results. Furthermore keeping the reaction in a “single tube” environment reduces the risk of cross contamination and allows a quantitative output from the methods of the invention. This may be particularly important in the context of the present invention where health and safety concerns may be of paramount importance (such as in detecting potential microbial infection in a patient samples for example).

[0042] Real-time and end-point quantitation of PCR reactions may be accomplished using the TaqMan® system (Applied Biosystems), see Holland et al; Detection of specific polymerase chain reaction product by utilising the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase; Proc. Natl. Acad. Sci. USA 88, 7276-7280 (1991), Gelmini et al. Quantitative polymerase chain reaction-based homogeneous assay with fluorogenic probes to measure C-Erb-2 oncogene amplification. Clin. Chem. 43, 752-758 (1997) and Livak et al. Towards fully automated genome wide polymorphism screening. Nat. Genet. 9, 341-342 (19995) (incorporated herein by reference). This type of probe may be generically referred to as a hydrolytic probe. Suitable hydrolytic / Taqman probes for use in real time or end point detection are also provided. The probe may be suitably labelled, for example using the labels detailed below.

[0043] In the Molecular Beacon system, see Tyagi & Kramer. Molecular beacons - probes that fluoresce upon hybridization. Nat. Biotechnol. 14, 303-308 (1996) and Tyagi et al. Multicolor molecular beacons for allele discrimination. Nat. Biotechnol. 16, 49-53 (1998) (incorporated herein by reference), the beacons are hairpin-shaped probes with an internally quenched fluorophore whose fluorescence is restored when bound to its target. These probes may be referred to as hairpin probes.

[0044] A further real-time fluorescence-based system which may be incorporated in the methods of the invention is the Scorpion system, see Detection of PCR products using self-probing amplicons and fluorescence by Whitcombe et al. Nature Biotechnology 17, 804 - 807 (01 Aug 1999). Additional real-time or end-point detection techniques which are well known to those skilled in the art and which are commercially available include Lightcycler® technology, Amplifluour® primer technology, DzyNA primers (Todd et al., Clinical Chemistry 46:5, 625- 630 (2000)), or the Plexor™ qPCR and qRT-PCR Systems.

[0045] Thus, in further aspects of the invention the products of nucleic acid amplification are detected using real-time or end point techniques. In specific embodiments of the invention the real-time technique consists of using any one of hydrolytic probes (the Taqman® system), FRET probes (Lightcycler® system), hairpin primers (Amplifluour® system), hairpin probes (the Molecular beacons system), hairpin probes incorporated into a primer (the Scorpion® probe system), primers incorporating the complementary sequence of a DNAzyme and a cleavable fluorescent DNAzyme substrate (DzYNA), Plexor qPCR and oligonucleotide blocking systems.

[0046] Amplification products may be quantified to give a level of the nucleic acid present in the sample and thus the concentration of microorganisms in the sample.

[0047] Detecting a nucleic acid specific for the at least one type of microorganism may comprise performing a nucleic acid amplification reaction. The nucleic acid amplification reaction may amplify a nucleic acid specific for the at least one type of microorganism. The nucleic acid amplification reaction may comprise the following components: a forward primer and a reverse primer hybridizing specifically to the nucleic acid specific for the at least one type of microorganism, optionally together with a probe that hybridizes between the primer binding sites specifically to the nucleic acid specific for the at least one type of microorganism. The method may further comprise detecting the amplification products to determine whether the sample contains the at least one type of microorganism. Detecting a nucleic acid specific for the at least one type of microorganism may comprise the use of a forward and reverse primer hybridizing specifically to the nucleic acid specific for the at least one type of microorganism and / or the use of a probe that hybridizes specifically to the nucleic acid specific for the at least one type of microorganism. Identifying the at least one type of microorganism may comprise distinguishing amplification products.

[0048] Detecting a nucleic specific for the at least one type of microorganism may comprise performing a nucleic acid amplification reaction comprising the following components: i. a forward and reverse primer hybridizing specifically to at least one nucleic acid specific for Gram positive bacteria, optionally together with a probe that hybridizes between the primer binding sites specifically to the nucleic acid specific for Gram positive bacteria; ii. a forward and reverse primer hybridizing specifically to at least one nucleic acid specific for Gram negative bacteria, optionally together with a probe that hybridizes between the primer binding sites specifically to the nucleic acid specific for Gram negative bacteria; and / or iii. a forward and reverse primer hybridizing specifically to at least one nucleic acid specific for fungi / yeast (e.g. Candida), optionally together with a probe that hybridizes between the primer binding sites specifically to the nucleic acid specific for fungi / yeast (e.g. Candida).

[0049] Detecting a nucleic acid specific for the at least one type of microorganism may comprise performing a nucleic acid amplification reaction comprising a nucleic acid amplification reaction with multiple primer pairs (i.e. a forward and reverse primer, optionally with a probe hybridizing between the primer binding sites) wherein each primer pair amplifies a different nucleic acid specific for the at least one type of microorganism. Thus, the method may comprise detecting multiple nucleic acids specific for the at least one type of microorganism. Detection of at least one of the nucleic acids specific for the at least one type of microorganism identifies that said type of microorganism is present. As an illustrative example, if the type of microorganism is Gram positive bacteria, the tuf gene of Enterococci, Staphylococci and Streptococci may be targeted with different primer pairs and probe for each respective tuf gene. Specific combinations are shown in Table 1 below. The primer pairs and probes in Table 1 represent further aspects of the invention.

[0050] Fungi / yeast (e.g. Candida) may be detected and identified by detecting the ILV3 gene as described in WO2018189502 which is hereby incorporated by reference. Thus, the molecule specific for the at least one type of microorganism may be the ILV3 gene. The ILV3 gene from Candida may be detected with primers having the sequences GAAGGYCCAAARGGTGGWCC and GAWCCACCMGARAATCTRCCRTC; and a probe having the sequence GAWGGYTTCAACATTTCYGGCATACC. The ILV3 gene from Aspergillus may be detected with primers having the sequences SCAGGGTGCTTCSCA and TSGCRTCGTACCACTG; and a probe having the sequence CAGTATGGGTACAAAGGGWATGMGA.

[0051] Gram positive bacteria and Gram negative bacteria may be detected and identified by detecting the 16s rRNA gene of bacteria. Suitable reagents for such methods of detecting bacteria are disclosed in Klaschik et al (J. Clin. Microbiol. 2002, 40(11):4304) and Wu et al (JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 2008, p. 2613-2619) each of which is hereby incorporated by reference. Such methods may rely upon the use of a probe to distinguish Gram-negative from Gram-positive bacteria. The primers may amplify specific parts of the 16S region of bacterial DNA. The primers PLK1 (TACGGGAGGCAGCAGT) and PLK2 (TATTACCGCGGCTGCT) are highly conserved in different groups of eubacteria. A 187-bp fragment is synthesized by these primers. PLK2 may be labelled with fluorescein internally. The fluorescence dye-labelled hybridization probes ISN2 (CCGCAGAATAAGCACCGGCTAACTCCGT) and ISP2

[0052] (CCTAACCAGAAAGCCACGGCTAACTACGTG) emit light at different wavelengths (640 and 705 nm) and can be used for detection and Gram stain differentiation of bacterial DNA by a fluorescence signal. Other suitable primers may comprise the nucleotide sequence CAACGCGAAGAACCTTACC and ACGTCATCCCCACCTTCC. A suitable Gram-positive probe comprises the nucleotide sequence ACGACAACCATGCACCACCTG. A suitable Gram-negative probe comprises the nucleotide sequence ACGACAGCCATGCAGCACCT. Although these probes may be differently labelled to permit differential detection, it will be appreciated by the skilled person that alternative approaches as described herein may be adopted to facilitate detection.

[0053] Nucleic acid amplification may be performed with forward and reverse primers which amplify nucleic acid from more than one type of microorganism. Detecting the level of a nucleic acid specific for one type of microorganism may involve the use of a probe hybridising specifically to the amplification product derived from the nucleic acid specific for the one type of microorganism. The method may further comprise detecting and distinguishing the amplification products to identify the type of the at least one microorganism. Distinguishing amplification products may comprise: i. a melting curve analysis; ii. use of differently labelled primers and / or probes; and / or iii. determining the size of the amplification products.

[0054] The primers and / or probes may be differentially labelled according to type of microorganism to permit identification of the type of microorganism; optionally wherein at least one primer and / or probe is differentially labelled according to Gram positive, Gram negative and / or fungi / yeast (e.g. Candida) to permit identification of whether the microorganism is Gram positive, Gram negative or fungi / yeast (e.g. Candida). For example a different fluorophore may be used to indicate each of Gram positive, Gram negative or fungi / yeast (e.g. Candida).

[0055] Nucleic acid amplification may be performed with at least one primer pair that binds to the nucleic acid specific for the at least one type of microorganism. Nucleic acid amplification may be performed with multiple primer pairs specific for the at least one type of microorganism. Nucleic acid amplification may be performed with a set of primer pairs specific for the at least one type of microorganism, wherein each primer pair in the set amplifies a subtype of microorganism within the at least one type of microorganism. For example, if the at least one type of microorganism is Gram positive bacteria, nucleic acid amplification may be performed with a set of primer pairs, wherein each primer pair in the set amplifies nucleic acid from a particular genus or species of Gram positive bacteria. If the at least one type of microorganism is Gram negative bacteria, nucleic acid amplification may be performed with a set of primer pairs, wherein each primer pair in the set amplifies a nucleic acid from a particular genus, species, or group (e.g. Enterobacteraceae) of Gram negative bacteria. If the at least one type of microorganism is fungi / yeast, nucleic acid amplification may be performed with a set of primer pairs, wherein each primer pair in the set amplifies a nucleic acid from a particular genus or species of fungi / yeast.

[0056] The type of microorganism may be a genus, species, group of genera (representative of the type, e.g. pathogenic Gram positive bacteria) or group of species of microorganism (again, representative of the type, e.g. pathogenic Gram positive bacteria). Preferably, the molecule specific for the at least one type of microorganism is a nucleic acid specific for the at least one type of microorganism. The nucleic acid may be detected by nucleic acid amplification with a forward primer, a reverse primer and a probe that specifically hybridizes to the nucleic acid specific for the at least one type of microorganism.

[0057] Polypeptides may be detected by mass spectrometry including electrospray ionization (ESI) and matrix-assisted laser desorption / ionization (MALDI). Suitable mass spectrometers and associated methods are well known in the art and commercially available.

[0058] The molecule from the at least one type of microorganism may be the molecule specific for the at least one type of microorganism. Thus, when detecting and identifying the type of microorganism, the quantification of the molecule specific for the at least one type of microorganism can be used to determine the concentration of the at least one type of microorganism.

[0059] Alternatively, the molecule from the at least one type of microorganism may be ATP or an enzyme (such as a phosphatase, kinase, polymerase ligase). Enzymes such as phosphatases, kinases, polymerases and ligases may be detected by detecting the activity of the enzyme.

[0060] WO2011 / 130584 (incorporated herein by reference) describes a method for detection of viable microorganisms based on detection of DNA or RNA polymerases in which a sample is contacted with a nucleic acid substrate that acts as a substrate for microbial polymerase, incubated under conditions suitable for polymerase activity from intact microorganisms and any resulting nucleic acid product is determined using a nucleic acid amplification technique such as quantitative polymerase chain reaction. Such assays have been termed “ETGA assays”, where ETGA stands for Enzymatic Template Generation and Amplification.

[0061] In W02009 / 007719 (incorporated herein by reference), NAD-dependent ligases are described as a useful indicator of the presence of a microorganism in a sample. Ligases are enzymes which catalyze ligation of nucleic acid molecules. The ligation reaction requires either ATP or NAD+ as co-factor depending upon the ligase concerned.

[0062] Detection of adenylate kinase as an indicator of viability has also been proposed (Squirrell DJ, Murphy MJ, Leslie RL, Green JCD: A comparison of ATP and adenylate kinase as bacterial cell markers: correlation with agar plate counts). WO96 / 002665 (incorporated herein by reference) describes a method for determining the presence and / or amount of microorganisms and / or their intracellular material present in a sample characterized in that the amount of adenylate kinase in the sample is estimated by mixing it with adenosine diphosphate (ADP), determining the amount of adenosine triphosphate (ATP) produced by the sample from this ADP, and relating the amount of ATP so produced to the presence / or amount of adenylate kinase and to microorganisms and / or their intracellular material, wherein the conversion of ADP to ATP is carried out in the presence of magnesium ions at a molar concentration sufficient to allow maximal conversion of ADP to ATP.

[0063] ATP may be detected by a luminescence assay in which ATP in the presence of the firefly luciferase enzyme is used to oxidize luciferin to oxyluciferin which emits luminescent light which can be detected with a luminometer. Assays for detecting and quantifying ATP are commercially available (e.g. BacTiter-Glo™ Microbial Cell Viability Assay (Promega), ATP Determination Kit (Invitrogen), Luminescent ATP Detection Assay Kit (Abeam), ATP Bioluminescence Assay Kit (Roche)).

[0064] Detecting the molecule from or specific for the at least one microorganism may comprise the use of a PCR machine, DNA sequencer, spectrophotometer and / or luminometer.

[0065] Detecting the molecule from or specific for the at least one microorganism may comprise detecting the level of the molecule from or specific for at least one microorganism.

[0066] Detecting the molecule from the at least one microorganism may not comprise detecting pH or oxidative reductive potential. These are not considered molecules from the microorganism.

[0067] Detecting the molecule from, or specific for, the at least one microorganism may comprise taking an aliquot of the sample. The volume of the aliquot may be 10% or less of the sample (e.g. 1 ml from a 10 ml sample). The volume of the aliquot may be 5% or less of the sample (e.g. 0.5 ml from a 10 ml sample). The microorganisms in the aliquot of the sample may be lysed to release the molecule from, or specific for, the at least one type of microorganism. The microorganisms may be lysed by any means known in the art. The microorganisms may be lysed by physical disruption and / or solution-based cell lysis. Physical disruption may include liquid homogenization (e.g. using a French Press), sonication and / or freeze-thawing. Solution-based cell lysis may include the use of a lysis reagent. The lysis reagent may comprise a mixture of components which ensures efficient lysis of microorganisms without adversely affecting the molecule from or specific for the at least one microorganism. The components may be selected from surfactants / detergents, metal halide salts, buffers, chelators, enzymes (e.g. lysozyme, proteinase K) etc. Thus, the microorganisms may be lysed by contacting the microorganisms with a reagent that causes cell lysis. The microorganisms may be incubated with the reagent under conditions to promote cell lysis.

[0068] Determining the concentration of the at least one type of microorganism may comprise the use of a reference dataset correlating the level of the molecule from the at least one type of microorganism with the concentration of the at least one type of microorganism. As shown herein, the level of the molecule from the at least one type of microorganism is reliably linked to the concentration of that type of microorganism. Thus, reference datasets can be used to convert the level of the molecule to the concentration of the type of microorganism in the sample (at that time point).

[0069] The reference dataset thus correlates the level of the molecule from the at least one type of microorganism with the concentration of the at least one type of microorganism. The reference dataset may be specific for the type of microorganism. Thus, identifying the type of microorganism may determine which reference dataset is used to determine the concentration of the at least one type of microorganism. If the microorganism is Gram positive bacteria, the reference dataset is typically specific for Gram positive bacteria. If the microorganism is Gram negative bacteria, the reference dataset is typically specific for Gram negative bacteria. If the microorganism is fungi / yeast (e.g. Candida) the reference dataset is typically specific for fungi / yeast (e.g. Candida).

[0070] Determining the concentration of the at least one type of microorganism may comprise inputting the detected level of the molecule from the at least one type of microorganism into an equation which calculates the concentration of the at least one type of microorganism based on the detected level of the molecule from the at least one type of microorganism.

[0071] Determining the concentration of the at least one type of microorganism may comprise using a lookup table which correlates the detected level of the molecule from the at least one type of microorganism with the concentration of the at least one type of microorganism. The equation and lookup table may have been generated by detecting the level of the molecule from the at least one type of microorganism at multiple different known concentrations of the at least one type of microorganism (e.g. by a dilution series). A standard curve may have been generated for the microorganism in question. The equation and lookup table is typically specific for the type of microorganism. Thus, identifying the type of microorganism determines which equation or lookup table is used to determine the concentration of the at least one type of microorganism. If the microorganism is Gram positive bacteria, the equation or lookup may be specific for Gram positive bacteria. If the microorganism is Gram negative bacteria, the equation or lookup may be specific for Gram negative bacteria. If the microorganism is fungi / yeast (e.g. Candida) the equation or lookup may be specific for fungi / yeast (e.g. Candida).

[0072] Determining the third time point i.e. the time at which the concentration of the at least one type of microorganism will reach or exceed the target concentration can be achieved by any number of ways.

[0073] For example, the concentration at the first time point and second time point may be plotted on a graph with time on a first axis and concentration on a second axis. A line linking the two points may be extrapolated to determine the time at which the concentration of the at least one type of microorganism will reach or exceed the target concentration.

[0074] Alternatively, the rate of change in the concentration between the first and second time points can be used determine the time at which the concentration of the at least one type of microorganism will reach or exceed the target concentration. For example, if the time between the first and second time points is 1 hour and the concentration of the at least one type of microorganism doubles between the first and second time points it will take an additional hour for the concentration of the at least one microorganism to be double the concentration at the second time point.

[0075] The skilled person can readily determine using the methods of the invention how types of microorganisms are growing between samples, for example if the growth is linear (additive) or exponential (multiplicative). This allows the skilled person to predict the third time point, at which the concentration of the at least one type of microorganism will reach or exceed the target concentration. In some instances, the comparison of levels of molecules between the first and second time points may reveal that the microorganisms are growing slowly, for example because they are in a lag phase. In this case, it may be difficult to predict the third time point based solely on this comparison. In such a scenario, the comparison between levels can be repeated until sufficient growth is seen between time points. Once sufficient growth between time points is observed, the third time point can then be accurately predicted, when the concentration of the at least one type of microorganism will reach or exceed the target concentration. Therefore, according to methods of the invention, if the concentration of the at least one type of microorganism in the sample determined in step f) is not sufficiently greater than the concentration of the at least one type of microorganism in the sample determined in step b), steps d) to f) are repeated one or more times until the concentration of the at least one type of microorganism in the sample determined in step f) is sufficiently greater than the concentration of the at least one type of microorganism in the sample determined in the previous iteration of step f).

[0076] The first time point may, or may be predicted to, precede the time point at which the target concentration is reached. The first and second time points may, or may be predicted to, precede the time point at which the target concentration is reached or exceeded. Given the aim of culturing the microorganisms to attain a concentration needed for downstream assays, the time points may be selected with this aim in mind. The benefit of the invention may be gained by determining the growth of the microorganism before the target concentration is reached, preferably so as to predict the time point at which the target concentration will be reached.

[0077] Once the target concentration has been reached or exceeded the method may further comprise dividing the sample into at least two portions, and culturing at least one portion until a further target concentration of the at least one type of microorganism in the at least one portion has been reached or exceeded. Even further concentrations may be obtained by further dividing and culturing the sample past the further target concentration.

[0078] The target concentration may be the concentration required for a downstream assay selected from molecular species / genera identification, antimicrobial susceptibility testing, sequencing and / or mass spectrometry. The target concentration and any subsequent further target concentrations may be different from each other to provide multiple input concentrations for the same downstream assay and / or to provide input concentrations for downstream assays having different input concentration requirements. The target concentration may be at least 102CFU / mL, at least 103CFU / mL, at least 104CFU / mL, at least 105CFU / mL, at least 106CFU / mL, at least 107CFU / mL, at least 108CFU / mL, or at least 109CFU / mL. Preferably, the target concentration is at least 102CFU / mL.

[0079] The present invention is particularly applicable to clinical samples, in particular samples taken from a subject that is suspected to be suffering from a microorganism infection. Thus, the microorganism may be a pathogenic microorganism, such as a pathogenic bacterium or fungus / yeast. The bacterium or fungus / yeast may be any bacterium or fungus / yeast capable of causing infection or disease in a subject, preferably a human subject. The bacteria include Staphylococcus species, including Staphylococcus epidermidis and Staphylococcus aureus (and preferably methicillin resistant strains), Enterococcus species, Streptococcus species including Streptococcus pneumonia, Pseudomonas species, Klebsiella species, Mycobacterium species, in particular Mycobacterium tuberculosis, Vibrio species, in particular Vibrio cholerae, Salmonella and / or Escherichia coli etc. Bacteria includes Clostridium species and in particular C. difficile. C. difficile is the major cause of antibiotic- associated diarrhoea and colitis, a healthcare associated intestinal infection that mostly affects elderly patients with other underlying diseases. Bacteria includes Pseudomonas species, in particular Pseudomonas aeruginosa. Bacteria includes Klebsiella species, in particular, Klebsiella pneumonia. Fungus / yeast includes Candida, Aspergillus, Cryptococcus, Histoplasma, Pneumocystis and / or Stachybotrys species. Microorganisms include A. baumannii, E. coli, K. aerogenes, P. aeruginosa, E. faecalis, E. faecium, S. aureus, S. pneumoniae and / or Candida albicans.

[0080] A “sample” in the context of the present invention is one which contains, or is suspected to contain, a microorganism, such as a fungus (e.g. a yeast) and / or a bacterium. The sample may also contain an antimicrobial agent. Typically, the sample is a liquid sample. Thus, the sample may comprise, consist essentially of or consist of a clinical sample, such as a body fluid sample. A preferred sample type is blood, to include whole blood, plasma, serum and blood containing samples, such as a blood culture or blood broth. The sample may comprise blood, cerebral spinal fluid (CSF), joint fluid, urine or bronchoalveolar lavage (BAL). The sample may be a clinical sample taken from a subject that is receiving, or has received, treatment using an antimicrobial agent. The sample may comprise a sample from a patient suspected of suffering from, or being screened for, an infection. The sample may be any suitable volume such as 0.2 to 10 ml, or 1 to 10 ml. In some instances, the sample is a paediatric / neonatal sample, preferably a paediatric / neonatal blood sample, where sample volume availability, in particular for a blood sample, is limited (typically < 3 mL) at the point of blood draw. Therefore, the sample may be a 1 mL blood sample. In some instances when the sample obtained from the subject is of volume greater than 5 mL it may be split into aliquots, with the method being performed on each aliquot.

[0081] The sample being used will depend on various factors, such as availability, convenience and the condition that is being tested for. Typical samples which may be used, but which are not intended to limit the invention, include whole blood, serum, plasma, platelet, joint fluid and urine samples etc. taken from a patient, most preferably a human patient. The patient may be suspected of suffering from, or being screened for, a bloodstream infection. The patient may be a hospitalised patient. The sample may be taken from a subject comprising more than 5, 10 or 15 million white blood cells (WBC) per ml of blood.

[0082] In addition to an antimicrobial agent, the sample may further comprise one or more inhibitors of later analysis. The one or more inhibitors of later analysis (e.g. PCR inhibitors) may be selected from: blood cell remnants, haemoglobin, leukocyte DNA and platelets.

[0083] The present invention, thus, may also separate the microorganisms from the one or more inhibitors of microbial growth or inhibitors of later analysis.

[0084] For the avoidance of doubt, the methods of the invention represent in vitro methods. They are carried out on a sample removed from a subject. However, in less preferred embodiments, the methods may additionally include the step of obtaining the sample from a subject (as a preliminary step). Methods of obtaining a suitable sample from a subject are well known in the art. Typically, however, the method may be carried out beginning with a sample that has already been isolated from the patient in a separate procedure. The methods will most preferably be carried out on a sample from a human, but the methods of the invention may have utility for many animals. Antimicrobial agents are frequently used in veterinary practice and agriculture.

[0085] “Antimicrobial agent” is defined herein to encompass any agent that kills or inhibits the growth of a microorganism. The antimicrobial agent may be an antibiotic or antifungal agent. The antimicrobial may be any antimicrobial agent that is used in the treatment of animal and preferably human infections, typically bloodstream infections. The antimicrobial used to treat the subject will be selected by the caregiver based on a clinical assessment of the subject. The antimicrobial agent may be broad-spectrum, which can kill or inhibit a range of microorganisms. Non-limiting examples of antibiotic agents include: penicillin, meropenem, flucioxacillin, ampicillin, oxacillin, piperacillin- tazobactam, vancomycin, teicoplanin, daptomycin, tigecycline, quinupristin / dalfopristin, gentamicin, amikacin, linezolid, azithromycin, clarithromycin, ciprofloxacin, levofloxacin, sparfloxacin, gatifloxacin, garenoxacin, gemifloxacin, moxifloxacin, doxycycline, TMP-SMX, polymyxin B, cefotaxime, cefotetan, cefamandole, cefuroxime, ceftizoxime, ceftazidime, cefixime, cefoperazone, cefepime, cefazolin, cefoxitin and ceftriaxone. Non-limiting examples of antifungal agents include: flucytosine, fluconazole, itraconazole, voriconazole, posaconazole, etoconazole, griseofulvin, amphotericin B, caspofungin, micafungin and anidulafungin. Administered amounts of these agents are determined according to standard of care procedures depending on the particular agent. This contributes to the levels of antimicrobial agent present in the sample. The antimicrobial may be present in the sample at a concentration of at least or more than 0.05, 0.5, 5, 10, 25, 50, 75 or 100 pg / mL. The antimicrobial may be present in the sample at a concentration of no more than or less than 100, 250, 500 or 1000 pg / mL. The antimicrobial may be present in the sample at a concentration of no more than or less than 100 pg / mL. The antimicrobial may typically be present in the sample at a concentration of between 0.5 and 250 pg / mL. The antimicrobial may be present in the sample at a concentration of between 0.5 and 100 pg / mL.

[0086] As explained herein, the invention is typically applied in the clinical setting in which a subject suspected of a microbial infection may have been treated with an antimicrobial agent before a body fluid (especially blood) sample can be taken. Thus, the antimicrobial agent given to a subject as treatment may be (and should be) the only source of antimicrobial agent in the sample. The antimicrobial agent has thus typically been selected by a caregiver (e.g. a doctor or nurse) and administered based on the current clinical symptoms demonstrated by the subject. Accordingly, the microorganism in the sample may be (or is thought to be) susceptible to the antimicrobial agent.

[0087] The methods may further comprise separating the at least one type of microorganism in the sample from non-microorganism cells, inhibitors of microbial growth (e.g. antimicrobial agents) and / or inhibitors of downstream analysis. Methods of separating microorganisms are disclosed in WO2021069903 and WO2019193332 which are hereby incorporated by reference. Such separations may be performed prior to detecting molecules from the microorganisms and / or culturing the microorganisms. The sample may thus be substantially free from non-microorganism cells, inhibitors of microbial growth (e.g. antimicrobial agents) and / or inhibitors of downstream analysis (e.g. PCR inhibitors). Substantially free may refer to the amount of non-microorganism cells, inhibitors of microbial growth (e.g. antimicrobial agents) and / or inhibitors of downstream analysis being at a sufficiently low level that they do not interfere with the method of the present invention and / or any downstream assays.

[0088] The methods may further comprise: a) incubating the sample with particles to form particle-microorganism complexes; and b) separating the particle-microorganism complexes from non-microorganism cells, inhibitors of microbial growth and / or inhibitors of downstream analysis.

[0089] The methods may further comprise: c) washing the separated particle-microorganism complexes.

[0090] The methods of separating the at least one type of microorganism in the sample from nonmicroorganism cells, inhibitors of microbial growth may not adversely affect the viability of the microorganisms. Thus, the microorganisms are not lysed in the separation.

[0091] The separated particle-microorganism complexes may be used directly or the microorganisms may be eluted from the particles.

[0092] Therefore, in some instances prior to performing step a) of the method of the invention, the method comprises i) incubating the sample with magnetic particles to form particlemicroorganism complexes; and ii) separating the particle-microorganism complexes from non-microorganism cells, inhibitors of microbial growth and / or inhibitors of downstream analysis. Optionally, the method further comprises an additional step of separating the particle-microorganism complexes and performing step a) in the absence of the magnetic particles.

[0093] The particles may be magnetic (e.g. superparamagnetic). The particles may bind to the microorganisms by non-specific binding (and therefore are not coated with a specific binding reagent). The particle may have an outer surface that is not coated with any of (i) an antibody, (ii) a carbohydrate, (iii) a peptide derived from Apolipoprotein H protein, (iv) a Mannose Binding Lectin protein. The particles may have a diameter of between 0.1 and 2.0 pm. The particles may have an outer polymeric surface, optionally wherein the polymeric surface comprises a carbon-based polymer. The outer polymeric surface may comprise polystyrene and / or poly(styrene / divinyl benzene). The outer surface of the particles may be coated with: i) carboxylic acid groups; ii) amino groups; iii) hydrophobic groups; and / or iv) streptavidin.

[0094] The methods of the invention are capable of detecting more than one type of microorganism. Because the type or types of microorganism in the sample are typically unknown a priori, the methods include the ability to detect all of the microorganism types (typically Gram positive, Gram negative bacteria and fungi / yeast). Those microorganism types are distinguishably detected. This has the additional benefit that, if the sample happens to contain multiple microorganism types (e.g. Gram positive and Gram negative bacteria), each type can be detected and the concentration of each microorganism type determined. Thus, the methods may be used to prepare an output sample comprising a target concentration of at least two types of microorganism, typically two but sometimes three types of microorganism. For example, the methods may detect one or more molecules that are each specific for at least two or three types of microorganism in a sample comprising, or suspected to comprise, at least one, at least two or at least three types of microorganism. The methods may detect two types in parallel, for example Gram negative bacteria and Gram positive bacteria. The methods may detect three types in parallel, for example, Gram negative bacteria, Gram positive bacteria and fungi / yeast, preferably Candida. All subsequent steps for the at least one type of microorganism are then performed in parallel for the at least two or at least three types of microorganisms. This is preferably based on use of the molecule specific for the type of microorganism so that each type can be detected in the same sample (as discussed herein, preferably one or more nucleic acid targets). If this is based on a molecule that is not specific for the type of microorganism (as discussed herein, preferably ATP) then the microorganism types will need to be separated into separate samples.

[0095] Therefore, in some methods of the invention, if step a) detects more than one type of microorganism then the molecule specific for each type of microorganism is used in the remainder of the method to determine the concentration of each microorganism. When the method is directed towards more than one microorganism, the sample can be cultured until the latest of the third time points determined for each of the more than one type of microorganism. According to these methods, if step a) detects more than one type of microorganism the sample may be split and the remainder of the method performed for each type of microorganism in the sample separately, or the sample may be kept whole with downstream analysis performed accordingly.

[0096] The methods of the invention may therefore prepare an output sample comprising a target concentration of at least two types of microorganism, the method comprising: a) detecting a molecule specific for the at least two types of microorganism in a sample comprising, or suspected to comprise, at least one or two types of microorganism; b) detecting in the sample at a first time point the level of each molecule specific for the microorganism type from at least two types of microorganism; c) determining the concentration of the at least two types of microorganism in the sample based on the types of microorganisms identified in step a) and the level of the molecules from the at least two types of microorganism, as detected in step b); d) culturing the sample between the first time point and a second time point; e) detecting in the sample at the second time point the level of each molecule specific for the microorganism type from the at least two types of microorganism; f) determining the concentration of the at least two types of microorganism in the sample based on the types of microorganism identified in step a) and the level of the each molecule specific for the microorganism types from the at least two types of microorganism detected in step e); g) determining a third time point at which the concentration of the at least two types of microorganism in the sample will reach or exceed the target concentration based on the concentrations of the at least two types of microorganism determined in steps c) and f); and h) culturing the sample until the third time point.

[0097] Note the third time point may be the latest time point calculated for the at least two types of microorganism to ensure that the concentration of each microorganism type present has been attained. Alternatively, the third time point may be calculated for each microorganism type and, once the target concentration for one type of microorganism has been reached a suitable portion of the sample is obtained and the remaining portion of the sample is used to culture until the third time point is attained for the other type or types of microorganism in the sample. The invention also provides devices for performing the methods of the invention. All aspects and embodiments described in relation to the other aspects of the invention (in particular the methods) apply mutatis mutandis to the related devices.

[0098] According to the invention, a device (101) is provided comprising: a) a culturing module (102) configured to receive and culture a sample comprising, or suspected to comprise, at least one type of microorganism; b) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; e) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102) and the detection module (105); and f) a processor (107) configured to control one or more of the culturing module (102), the detection module (105) and the transfer module (106).

[0099] According to the invention, a device (101) is provided comprising: a) a culturing module (102) configured to receive and culture a sample comprising, or suspected to comprise, at least one type of microorganism; b) a lysis module (103) configured to lyse the at least one type of microorganism; c) a reservoir module (104) configured to store a lysis reagent for lysing the at least one type of microorganism; d) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; e) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102), the lysis module (103), the reservoir module (104) and the detection module (105); and f) a processor (107) configured to control one or more of the culturing module (102), the lysis module (103), the reservoir module (104), the detection module (105) and the transfer module (106).

[0100] The device may be for determining the concentration of at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism. The device may be for preparing an output sample comprising a target concentration of at least one type of microorganism. The device may be configured for performing the methods of determining the concentration of at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism described herein. The device may be configured for performing the methods of preparing an output sample comprising a target concentration of at least one type of microorganism as described herein.

[0101] The device (101) may be configured to: a) use the detection module (105) to detect a molecule specific for the at least one type of microorganism in the sample; b) use the detection module (105) to detect in the sample at a first time point the level of a molecule from the at least one type of microorganism; and c) use the processor (107) to identify the type of the at least one microorganism based on detection of the molecule specific for the at least one type of microorganism in step a) and determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step b).

[0102] The device (101) may be configured to: a) use the detection module (105) to detect a molecule specific for the at least one type of microorganism in the sample; b) use the detection module (105) to detect in the sample at a first time point the level of a molecule from the at least one type of microorganism; c) use the processor (107) to identify the type of the at least one microorganism based on detection of the molecule specific for the at least one type of microorganism in step a) and determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step b); d) use the culturing module (102) to culture the sample between the first time point and a second time point; e) use the detection module (105) to detect in the sample at the second time point the level of the molecule from the at least one type of microorganism; f) use the processor (107) to determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step e); g) use the processor (107) to determine a third time point at which the concentration of the at least one type of microorganism in the sample will reach or exceed the target concentration based on the concentrations of the at least one type of microorganism determined in steps c) and f); and h) use the culturing module (102) to culture the sample until the third time point.

[0103] The invention provides a device (101) for determining the concentration of at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism, wherein the device comprises: i) a culturing module (102) configured to receive and culture the sample; ii) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; iii) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102) and the detection module (105); and iv) a processor (107) configured to control one or more of the culturing module (102), the detection module (105) and the transfer module (106), wherein the device (101) is configured to: a) use the detection module (105) to detect a molecule specific for the at least one type of microorganism in the sample; b) use the detection module (105) to detect in the sample at a first time point the level of a molecule from the at least one type of microorganism; and c) use the processor (107) to identify the type of the at least one microorganism based on detection of the molecule specific for the at least one type of microorganism in step a) and determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step b).

[0104] The invention provides a device (101) for preparing an output sample comprising a target concentration of at least one type of microorganism, wherein the device comprises: i) a culturing module (102) configured to receive and culture a sample comprising, or suspected to comprise, at least one type of microorganism; ii) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; iii) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102) and the detection module (105); and iv) a processor (107) configured to control one or more of the culturing module (102), the detection module (105) and the transfer module (106), wherein the device (101) is configured to: a) use the detection module (105) to detect a molecule specific for the at least one type of microorganism in the sample; b) use the detection module (105) to detect in the sample at a first time point the level of a molecule from the at least one type of microorganism; c) use the processor (107) to identify the type of the at least one microorganism based on detection of the molecule specific for the at least one type of microorganism in step a) and determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step b); d) use the culturing module (102) to culture the sample between the first time point and a second time point; e) use the detection module (105) to detect in the sample at the second time point the level of the molecule from the at least one type of microorganism; f) use the processor (107) to determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step e); g) use the processor (107) to determine a third time point at which the concentration of the at least one type of microorganism in the sample will reach or exceed the target concentration based on the concentrations of the at least one type of microorganism determined in steps c) and f); and h) use the culturing module (102) to culture the sample until the third time point.

[0105] The concentration of the at least one type of microorganism at the second time point may be greater than the concentration of the at least one type of microorganism at the first time point.

[0106] The first and second time points may precede or be predicted to precede the time point at which the concentration of the at least one type of microorganism reaches or exceeds the target concentration. The device (101) may be further configured to use the detection module (105) to detect at the third time point the level of the molecule from the at least one type of microorganism to confirm that the concentration of the at least one type of microorganism has reached or exceeded the target concentration.

[0107] The device (101) may be further configured to use the transfer module (107) to take an aliquot of the sample once the concentration of the at least one type of microorganism in the sample has reached or exceeded the target concentration, and further culture the sample using the culturing module (102) until the concentration of the at least one type of microorganism has reached or exceeded a further target concentration.

[0108] The processor (107) may determine the concentration of the at least one type of microorganism using a reference dataset correlating the level of the molecule from the at least one type of microorganism with the concentration of the at least one type of microorganism.

[0109] The device (101) may be further configured to use the culturing module (102) to culture the sample prior to step a) and / or prior to step b).

[0110] To detect a molecule from the at least one type of microorganism in the sample the device (101) may be configured to use the transfer module (106) to transfer an aliquot of the sample (e.g. 5% or 10% of the sample) to the lysis module (103) configured to lyse the microorganism thereby generating a lysed sample, optionally wherein lysis reagent is stored in the reservoir module (104) and is transferred to the lysis module (103) using the transfer module (106). The device (101) may be further configured to use the transfer module (106) to transfer the lysed sample to the detection module (105). The lysis module (103) may be configured to lyse the microorganisms by physical disruption (either alone or in combination with a lysis reagent) which may include liquid homogenization (e.g. using a French Press), sonication and / or freeze-thawing.

[0111] The reservoir module (104) may comprise multiple compartments. For example, one or more compartments may comprise lysis reagent for lysing the microorganism and one or more compartments may comprise reagents for detecting the molecule from, or specific for, the at least one type of microorganism (e.g. primers / probes, substrates, enzymes). The transfer module (106) may be configured to transfer fluid between any one or more of the culturing module (102) and the detection module (105). The transfer module (106) may be configured to transfer fluid between any one or more of the culturing module (102), the lysis module (103), the reservoir module (104) and the detection module (105). The processor (107) may be configured to control the transfer module (106).

[0112] The invention provides a device (101) for determining the concentration of at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism, the device comprising: a) a culturing module (102) configured to receive and culture the sample; b) a lysis module (103) configured to lyse the at least one type of microorganism; c) a reservoir module (104) configured to store a lysis reagent for lysing the at least one type of microorganism; d) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; e) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102), the lysis module (103), the reservoir module (104) and the detection module (105); and f) a processor (107) configured to control one or more of the culturing module (102), the lysis module (103), the reservoir module (104), the detection module (105) and the transfer module (106), wherein the transfer module (106) is configured to: i) transfer an aliquot of the sample from the culturing module (102) to the lysis module (103); ii) transfer an aliquot of the lysis reagent from the reservoir module (103) to the lysis module (103) to contact the aliquot of the sample with the lysis reagent thereby generating a lysed sample; iii) transfer the lysed sample to the detection module (105); wherein the detection module (105) is configured to: i) detect a molecule specific for the at least one type of microorganism; and ii) detect a level of a molecule from the at least one type of microorganism; and wherein the processor (107) is configured to: i) identify the type of the at least one microorganism based on the detection of the molecule specific for the at least one type of microorganism; and ii) determine the concentration of the at least one type of microorganism based on the identified type of microorganism and the detected level of the molecule from the at least one type of microorganism.

[0113] The invention provides a device (101) for preparing an output sample comprising a target concentration of at least one type of microorganism, the device comprising: a) a culturing module (102) configured to receive and culture a sample comprising, or suspected to comprise, at least one type of microorganism; b) a lysis module (103) configured to lyse the at least one type of microorganism; c) a reservoir module (104) configured to store a lysis reagent for lysing the at least one type of microorganism; d) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; e) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102), the lysis module (103), the reservoir module (104) and the detection module (105); and f) a processor (107) configured to control one or more of the culturing module (102), the lysis module (103), the reservoir module (104), the detection module (105) and the transfer module (106), wherein the transfer module (106) is configured to: i) at a first time point transfer an aliquot of the sample from the culturing module (102) to the lysis module (103); ii) transfer an aliquot of the lysis reagent from the reservoir module (103) to the lysis module (103) to contact the aliquot of the sample with the lysis reagent thereby generating a first lysed sample; iii) transfer the first lysed sample to the detection module (105); iv) at a second time point transfer an aliquot of the sample from the culturing module (102) to the lysis module (103); v) transfer an aliquot of the lysis reagent from the reservoir module (103) to the lysis module (103) to contact the aliquot of the sample with the lysis reagent thereby generating a second lysed sample; vi) transfer the second lysed sample to the detection module (105); wherein the detection module (105) is configured to: i) detect a molecule specific for the at least one type of microorganism; and ii) detect a level of a molecule from the at least one type of microorganism; wherein the processor (107) is configured to: i) identify the type of the at least one microorganism based on the detection of the molecule specific for the at least one type of microorganism; ii) determine the concentration of the at least one type of microorganism at the first time point based on the identified type of microorganism and the level of the molecule from the at least one type of microorganism at the first time point; iii) determine the concentration of the at least one type of microorganism at the second time point based on the identified type of microorganism and the level of the molecule from the at least one type of microorganism at the second time point; iv) determine a third time point at which the concentration of the at least one type of microorganism has reached or exceeded a target concentration based on the concentration of the microorganism at the first and second time points; and wherein the culturing module (102) is configured to culture the sample until the third time point.

[0114] Detecting a molecule specific for the at least one type of microorganism may also detect a level of a molecule from the at least one type of microorganism.

[0115] The culturing module (102) may comprise: a thermal control element and / or a shaking element and wherein the processor (107) is further configured to control the thermal control element and / or the shaking element.

[0116] The processor (107) may be configured to control the thermal control element to cool the sample in the culturing module (102) when the concentration of the at least one type of microorganism in the cultured sample has reached or exceeded the target concentration.

[0117] The detection module (105) may comprises a PCR machine, DNA sequencer, spectrophotometer and / or luminometer. The detection module may allow for the detection of both molecules specific for the at least one type of microorganism and non-specific molecules when both are used, for example for detecting the type of microorganism with a specific molecule and determining the concentration of the microorganism with a non-specific molecule.

[0118] The device may further comprise an alert module configured to provide an alert to a user of the device when the concentration of the at least one type of microorganism has reached or exceeded the target concentration. The alert may be an audio and / or visual alert.

[0119] The culturing module (102) may be configured for holding a purified and / or concentrated sample and the device further comprises: e) a purification module configured to hold a sample comprising magnetic particlemicroorganism complexes; and f) a magnet module configured to selectively exert a magnetic force on the sample in the purification module, wherein the magnet module is configured to purify the sample in the purification module by using a magnetic force to separate the magnetic particle-microorganism complexes from the rest of the input sample. The magnet module may be configured to transfer the magnetic particle-microorganism complexes to the culturing module (102).

[0120] The device may further comprise a separation and transfer module configured to separate the particle-microorganism complexes and transfer separated microorganisms to the culturing module (102) in the absence of the magnetic particles.

[0121] The processing module may be configured to hold one or more samples each having a volume of at least 10 mL.

[0122] The processor (107) may be configured to determine the concentration of the at least one type of microorganism by: i) using the type of microorganism identified to select an equation for calculating the concentration of the at least one type of microorganism and inputting into the equation the detected level of the molecule from the at least one type of microorganism; or ii) using the type of microorganism identified to select a lookup table and using the selected lookup table and the detected level of the molecule from the at least one type of microorganism to determine the concentration of the at least one type of microorganism. The processor (107) may be configured to determine the third time point by plotting on a graph the concentration at the first and second time points, wherein the graph has time on a first axis and concentration on a second axis. A line linking the two points may be extrapolated to determine the time at which the concentration of the at least one type of microorganism will reach or exceed the target concentration.

[0123] Alternatively, the processor (107) may be configured to calculate the rate of change in the concentration between the first and second time points to determine the third time point.

[0124] The culturing module is configured to hold one or more samples each having a volume of at least 10 mL. The culturing module may comprise a plurality of sub-culturing modules. The sub-culturing modules are configured to receive an appropriate sample volume. Each - sub-culturing module may be configured to receive a maximum sample volume of no more than 5 mL, preferably no more than 4 mL and more preferably no more than 3.5 mL. In addition, the sub-culturing modules may be arranged to allow multiple cultures in parallel. They may be arranged as a suitable array. There may be 24 sub-culturing modules for example. The sub-culturing modules may be arranged in a 6 x 4 arrangement when there are 24 modules.

[0125] The device of the invention may be configured to have a fully integrated automation workflow. A fully integrated automation workflow encompasses integrated microbial extraction, enrichment and microbial detection, preferably PCR-based detection, microorganism type delineation and growth monitoring with enumeration. This enables efficient and accurate automated growth monitoring and enumeration for an enriching microbial sample, particularly when based on PCR.

[0126] Each aspect or embodiment as defined herein may be combined with any other aspect(s) or embodiment(s) unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

[0127] The foregoing detailed description has been provided by way of explanation and illustration, and is not intended to limit the scope of the appended claims. Many variations in the presently preferred embodiments illustrated herein will be apparent to one of ordinary skill in the art, and remain within the scope of the appended claims and their equivalents.

[0128] BRIEF DESCRIPTION OF THE FIGURES

[0129] Figure 1A-C show multi-species Ct values plotted against TVC-derived CFU / mL values to determine enumeration equations for each channel: Figure 1A shows data from six Gram negative species; Figure 1B shows data from four Gram positive species; Figure 1C shows data from two Candida species.

[0130] Figure 2 shows ATP-luminescence values plotted against ‘actual’ CFU / mL values (determined by total viable count, TVC) to determine a single all-species equation for calculating microbial concentration from ATP-luminescence data. Data is derived from six Gram negative species, six Gram positive species and two fungal species.

[0131] Figure 3 provides graphs showing average calculated microbial concentrations across six replicates (using Figure 1 Method 1 equations for respective delineation channels) for a six- hour enrichment time course where PCR reactions were performed at 1-hour intervals. Graphs are shown for four Gram negative species (A. baumannii, E. coli, K. aerogenes and P. aeruginosa), four Gram positive species (E. faecalis, E. faecium, S. aureus and S. pneumoniae) and Candida albicans. Average microbial spike inputs (based on five TVC plates per species) are shown in brackets in each graph title (CFU / mL blood). TVC-derived ‘actual’ average CFU / mL values are also plotted against enrichment timepoint to demonstrate accuracy of calculated CFU / mL values.

[0132] Figure 4 shows a device according to the invention. Provided is a device (101) comprising a culturing module (102), a lysis module (103), reservoir module (104), a detection module (105) a transfer module (106) and a processor (107). The device and its configuration are defined herein.

[0133] Figure 5 provides a graph showing average calculated microbial concentration across six replicates for a polymicrobial infection of E. coli (6.5 CFU / mL input) and S. aureus (5.4 CFU / mL input), using Figure 1 Method 1 equations for respective delineation channels, for a six-hour enrichment time course where PCR reactions were performed at 1-hour intervals. TVC-derived ‘actual’ average CFU / mL values are also plotted against enrichment timepoint to demonstrate accuracy of calculated CFU / mL value).

[0134] Figure 6. provides graphs showing average calculated microbial concentration across six replicates for a polymicrobial infection of K. aerogenes (5.4 CFU / mL input) and P. mirabilis (4.6 CFU / mL input), using Figure 1 Method 1 equations for the Gram negative delineation channel, for a six-hour enrichment time course where PCR reactions were performed at 1- hour intervals. TVC-derived ‘actual’ CFU / mL values are also plotted against enrichment timepoint to demonstrate accuracy of calculated CFU / mL values (point).

[0135] Figure 7 provides a graph showing average calculated microbial concentrations across 5 replicates (using equations as in figure 5) for a six-hour enrichment time course where PCR reactions were performed at 1-hour intervals. Average microbial spike input was 4.1 CFU / mL blood (based on five TVC plates per species). TVC-derived ‘actual’ average CFU / mL value is also plotted (black).

[0136] Figure 8 provides a comparison of average Total Viability Count (TVC) by processing method. This figure presents bar plots comparing the average TVC for different microorganisms processed using two methods: Manual, 20 mL (left) and Split, 3.3 mL (right). Error bars represent standard error of the mean where multiple replicates were available. *The split method has only one replicate, so no error bars are shown.

[0137] Figure 9 shows ATP-luminescence values plotted against ‘actual’ CFU / mL values (determined by total viable count, TVC) to determine a single all-species equation for calculating microbial concentration from ATP-luminescence data. Data is based on results from Figure 2.

[0138] EXPERIMENTAL SECTION

[0139] 1 Introduction

[0140] Experimental work was undertaken to characterise methods for monitoring microbial growth which here refers specifically to predicting the concentration (CFU / mL) of microbial cells extracted from blood using magnetic beads. T o obtain mathematical equations for calculating the concentration of a growing microbial culture at a given timepoint, two technologies were utilised: Polymerase Chain reaction (PCR); and ATP-luminescence. A set of mathematical equations was created using either PCR or luminescence data, together with measured CFU counts derived from Total Viable Count (TVC) analysis, as described in section 3. The PCR test delineates detected pathogens as Gram negative, Gram positive, or Candida. Therefore, separate equations can be used for each channel to improve accuracy of predictions.

[0141] 2 Materials

[0142] 2.1 Reagents

[0143] • Agar plates

[0144] • Microbial growth medium

[0145] • Transport & Recovery Media (TRM)

[0146] • Human blood in citrate / phosphate / dextrose (CPD) anticoagulant

[0147] • Capture buffer

[0148] • Magnetic beads

[0149] • Wash buffer

[0150] • Enrichment buffer

[0151] • Microbial lysis buffer

[0152] • PCR master mix

[0153] • ATP-luminescence buffer

[0154] 2.2 Equipment

[0155] • 50-mL Tube Heater-Shaker

[0156] • 50-mL Tube Magnetic rack

[0157] • 2-mL Tube Heater-Shaker

[0158] • 2-mL T ube Magnetic rack

[0159] • PCR instrument

[0160] • Luminometer

[0161] • Spectrophotometer

[0162] • Hamilton Microlab Star with onboard BMS qPCR machines (Biomolecular Systems) o Automated system with integrated microbial extraction, enrichment and PCR- based microbial detection, Gram delineation and growth monitoring with enumeration. Methods Microbial culturing

[0163] 1) Microbial cultures were created from Selectrol discs or glycerol stocks and passaged on appropriate agar plates.

[0164] 2) The day before testing, liquid cultures were prepared in 3-mL broth using a single colony from an agar plate and incubated overnight (approximately 18 hours) at 37°C, shaking.

[0165] 3) On the day of testing, overnight cultures were diluted in broth (typically a 100-fold dilution) to create outgrowth cultures which were incubated at 37°C, shaking, until an OD600 measurement of 0.5 - 0.8 was achieved.

[0166] 4) Outgrowth cultures were then diluted to the required microbial concentration (CFU / mL) for sample spiking.

[0167] 5) 200 pL test dilution was spiked per 20-mL blood sample (comprising 10 mL blood + 10 mL TRM). 100 pL total viable count (TVC) plating of the test dilution was performed to determine microbial input levels.

[0168] 6) samples were immediately progressed to sample processing using either an automated or manual protocol. Sample processing

[0169] 1) 20-mL samples were incubated at 37°C for 1 hour, static

[0170] 2) Capture buffer containing magnetic beads was added to each sample.

[0171] 3) Microbial binding was performed by heated mixing for 30 minutes.

[0172] 4) Samples were magnetised for 12 minutes and then blood sample transferred to waste.

[0173] 5) Magnetic beads were resuspended in wash buffer and transferred to 2-mL tubes / wells.

[0174] 6) Samples were magnetised for 3 minutes, and wash buffer transferred to waste.

[0175] 7) Magnetic beads were resuspended in 0.5 mL enrichment buffer and incubated with heating and shaking.

[0176] 8) Enriching microbial suspensions were tested (10 to 20 pL samples) at regular intervals using a combination of methods: a. PCR - to determine Ct values within each delineation channel. b. ATP-luminescence - to determine Relative Luminescence Units (RLU). c. TVC plating - to determine CFU / mL concentration when creating enumeration equations for PCR and ATP-luminescence, and for evaluating enumeration accuracy when using pre-determined equations.

[0177] 3.3 PCR set-up

[0178] 1) 20 pL sample was added to 40 pL Microbial lysis buffer for lysis reaction.

[0179] 2) 2 pL lysed sample was added to 9 pL PCR master mix and PCR run initiated on BMS MIC qPCR machine

[0180] 3) Ct values were analysed.

[0181] 3.4 ATP luminescence

[0182] 1) 10 pL sample was added to 140 pL Luminescence buffer in a cuvette and measured immediately using a luminometer.

[0183] 2) RLU values were analysed.

[0184] 3.5 TVC analysis

[0185] 1) 10 pL sample was diluted in broth and 100 pL plated on appropriate agar plates with the aim of achieving 50 to 500 colonies per plate to enable reliable quantification.

[0186] 2) Sample microbial concentration (CFU / mL) was determined based on colony counts and the dilution factor used for plating.

[0187] 3.6 Development of enumeration equations

[0188] 3.6.1 PCR-based enumeration

[0189] • Ct values for each PCR delineation channel (Gram negative, Gram positive and Candida) were plotted against TVC-derived CFU / mL values to obtain a standard curve for data derived from multiple species within a delineation channel (see Figure 1).

[0190] • Two methods were used to generate mathematical equations to enable prediction of CFU / mL based on Ct value: o Method 1 : Exponential trendline equation for all data across a wide CFU / mL range (typically 100 CFU / mL to 1 ,000,000,000 CFU / mL) o Method 2: Extrapolated trendline equation based on using a Method 1-derived Ct value for 1 ,000,000 CFU / mL (deemed to be in the middle of the linear dynamic range for PCR) and then extrapolating the trendline in both directions based on the known PCR efficiency for a combined fungal and bacterial (FAB) master mix (for example, a 100% PCR efficiency means a 2-fold difference in starting input is equal to a 1 Ct difference in Ct value). This method helps eliminate the effect of outlier Ct values which are more likely to occur at extremes of input CFU / mL level.

[0191] For detecting Gram positive bacteria the following primers and probes were used. Table 1

[0192] For detecting Gram negative bacteria and Candida primers and probes detecting suitable targets were used. Examples of suitable targets are described in further detail herein and include the 16s rRNA gene for Gram negative bacteria and ILV3 for Candida. 4 Results and discussion

[0193] 4.1 PCR-based enumeration analysis

[0194] • Channel-specific equations (based on Method 1 equations) were used to calculate microbial concentrations for individual species (six replicates per species) during an enrichment time-course experiment using a fully automated system on a custom Hamilton Microlab Star robot. • TVC plating was performed at a single timepoint for each species to evaluate the accuracy of calculated microbial concentrations (see Figure 3).

[0195] • This work demonstrates automated PCR-based growth monitoring and enumeration for enriching a microbial sample. Furthermore, TVC data demonstrates that CFU / mL calculations derived from delineation channel equations were highly accurate.

[0196] 4.2 Luminescence-based enumeration analysis

[0197] Based on luminescence data and TVC data from 14-species as shown in Figure 2, the accuracy of luminescence-based prediction (using a single, all-species equation) is shown to be up to ~10-fold variable either side of the prediction. When microbial Gram status is predetermined (Gram positive, Gram negative or Candida) by PCR, luminescence-based enumeration accuracy improves to up to ~5-fold variable. Figure 9 shows R2= 0.3642 for all ATP data points in Figure 2 (the combined Gram status results). Figure 9 confirms that there is superior accuracy of forecast based on molecules specific for each type of microorganism (see R2= 0.655, 0.8149 and 0.911 for each of Gram negative, Gram positive and Candida from Figure 1A-C)compared to using a single non-specific method (ATP) to detect any type of microorganism. This confirms that the claimed methods provide a substantially improved result over non-specific methods alone. These results also show that methods combining molecules specific for each type of microorganism for identification purposes followed by enumeration using non-type specific molecules can allow a fast and accurate enumeration method. Once identified (as shown in Figure 2) species within each Gram category have similar ATP levels / signal per CFU, therefore benefit from molecular type specific equations for enumeration accuracy using the claimed method.

[0198] 5.1 Luminescence-based enumeration analysis

[0199] Further to the results in section 4.1, detection and enumeration of a sample with more than one microorganism present (polymicrobial infection) has been achieved. E. coli was detected in the Gram negative channel while S. aureus was detected in the Gram positive channel, allowing enumeration forecasting for each species simultaneously and independently. Results are provided in Figure 5.

[0200] 5.2 Magnetic-bead free (supernatant) microbial detection & growth monitoring Channel-specific equations were generated separately for Magnetic-bead free (supernatant) samples: samples which are magnetised prior to PCR testing resulting in Ct values representing the supernatant fraction only. Magnetic-bead free detection may be appropriate in cases where downstream testing that cannot tolerate the presence of magnetic beads is to be used.

[0201] Equations for supernatant detection were predefined using the same mathematical methods (method 1) as described in section 3.6.1., using paired Ct and TVC values for samples where only the supernatant fraction was tested through PCR. Results are shown in Figure 6 for K. aerogenes and P.mirabilis.

[0202] 5.3 Neonatal sample microbial detection and growth monitoring

[0203] This study shows compatibility of microbial enumeration techniques with 1 mL blood samples, a format that could be appropriate for testing of paediatric / neonatal blood samples where blood volume availability is limited (typically < 3 mL) at the point of blood draw. This testing method used the magnetic-bead free supernatant fraction (section 5.2) and therefore used the enumeration equations generated as in section 5.2. Results are provided in Figure 7.

[0204] 5.4 Split sample microbial detection and growth monitoring

[0205] Testing on a panel of four species from the top 5 blood stream infection (BSI) pathogens demonstrates at least equivalent microbial extraction performance between the standard format and a “split sample” format which consists of six 3.3 mL replicates processed onboard the Hamilton Microlab STAR. TVC analysis of outputs immediately after the addition of enrichment media showed the following:

[0206] • Escherichia coli shows a higher TVC with the Split format (68) compared to the 20mL Manual method (10).

[0207] • Staphylococcus epidermidis shows a higher TVC with the Split format (26) versus the 20 mL Manual method (9).

[0208] For both E. coli and S. epidermidis experiments, six wells of 3.3 mL were processed independently and plated. Where n=1, the total viability count (TVC) from each plate was summed to mathematically approximate a 20 mL total volume equivalence.

[0209] • Staphylococcus aureus exhibits similar average TVC between 20 mL Manual (171.25) and Split (177).

[0210] • Klebsiella pneumoniae shows comparable average TVC between 20mL Manual (221) and Split (215.5)

[0211] For both S. aureus and K. pneumoniae experiments, samples were processed using the ‘Fully Integrated Automation Workflow’. Each species had a total of four replicates (n=4). The 24DWP follows a 6 x 4 layout, which allows processing of four replicates at a time. Samples are pooled into Column 1 , Rows A-D and then plated. Results are provided in Figure 8.

[0212] 5 Conclusions

[0213] The methods described above demonstrate that both PCR and luminescence data can be used to predict microbial cell concentration. PCR-based microbial enumeration enables greater prediction accuracy due its ability to delineate detected pathogens as Gram negative, Gram positive, or Candida species. Furthermore, the timepoint at which a growing microbial sample will reach a target microbial concentration (e.g. 1 ,000,000 CFU / mL) can be forecast using PCR Ct values, preferably from a minimum of two timepoints, together with the relevant enumeration equation. Luminescence-based enumeration accuracy is also improved when coupled with PCR-based delineation information.

[0214] The methods described above further demonstrate PCR-based microbial enumeration in four additional formats: detection and enumeration of polymicrobial infections; detection and enumeration in magnetic-bead free supernatant fraction samples; detection and enumeration in 1 mL neonatal samples; and detection and enumeration in 3.3-mL split format samples.

[0215] The invention will now be defined by numbered embodiments.

[0216] 1. A method of determining the concentration of at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism, the method comprising: a) detecting a molecule specific for the at least one type of microorganism in the sample; b) detecting in the sample at a first time point the level of a molecule from the at least one type of microorganism; and c) determining the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified in step a) and the level of the molecule from the at least one microorganism detected in step b).

[0217] 2. A method of preparing an output sample comprising a target concentration of at least one type of microorganism, the method comprising: a) detecting a molecule specific for the at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism; b) detecting in the sample at a first time point the level of a molecule from the at least one type of microorganism; c) determining the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified in step a) and the level of the molecule from the at least one microorganism detected in step b); d) culturing the sample between the first time point and a second time point; e) detecting in the sample at the second time point the level of the molecule from the at least one type of microorganism; f) determining the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified in step a) and the level of the molecule from the at least one microorganism detected in step e); g) determining a third time point at which the concentration of the at least one type of microorganism in the sample will reach or exceed the target concentration based on the concentrations of the at least one type of microorganism determined in steps c) and f); and h) culturing the sample until the third time point.

[0218] 3. The method of embodiment 2, wherein the concentration of the at least one type of microorganism at the second time point is greater than the concentration of the at least one type of microorganism at the first time point.

[0219] 4. The method of embodiment 2 or embodiment 3, wherein the first and second time points precede or are predicted to precede the time point at which the concentration of the at least one type of microorganism reaches or exceeds the target concentration.

[0220] 5. The method of any one of embodiments 2 to 4, further comprising detecting at the third time point the level of the molecule from the at least one type of microorganism to confirm that the concentration of the at least one type of microorganism has reached or exceeded the target concentration.

[0221] 6. The method of any one of embodiments 2 to 5, further comprising taking an aliquot of the sample once the concentration of the at least one type of microorganism in the sample has reached or exceeded the target concentration, and further culturing the sample until the concentration of the at least one type of microorganism has reached or exceeded a further target concentration. 7. The method of any one of embodiments 2 to 6, wherein the target concentration is the concentration required for a downstream assay selected from molecular species / genera identification, antimicrobial susceptibility testing, sequencing and / or mass spectrometry.

[0222] 8. The method of any one of embodiments 2 to 7, wherein the target concentration is at least 100 CFU / mL.

[0223] 9. The method of any one of embodiments 1 to 8, wherein determining the concentration of the at least one type of microorganism comprises the use of a reference dataset correlating the level of the molecule from the at least one type of microorganism with the concentration of the at least one type of microorganism.

[0224] 10. The method of any one of embodiments 1 to 9, further comprising culturing the sample prior to step a) and / or prior to step b).

[0225] 11. The method of any one of embodiments 1 to 10, wherein detecting the molecule specific for the at least one type of microorganism identifies the type of microorganism as Gram positive bacteria, Gram negative bacteria or fungi / yeast (e.g. Candida).

[0226] 12. The method of any one of embodiments 1 to 11, wherein the molecule from the at least one type of microorganism is the molecule specific for the at least one type of microorganism.

[0227] 13. The method of any one of embodiments 1 to 12, wherein the molecule from the at least one type of microorganism is ATP or an enzyme (such as a phosphatase, kinase, polymerase or ligase).

[0228] 14. The method of any one of embodiments 1 to 13, wherein the molecule specific for the at least one type of microorganism is a nucleic acid or polypeptide.

[0229] 15. The method of any one of embodiments 1 to 14, wherein detecting the molecule from or specific for the at least one type of microorganism comprises nucleic acid amplification, sequencing, mass spectrometry or an enzymatic activity assay. 16. The method of any one of embodiments 1 to 15, wherein prior to performing the method the concentration of the at least one type of microorganism in the sample is no more than 10 CFU / mL.

[0230] 17. A device (101) for determining the concentration of at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism, wherein the device comprises: i) a culturing module (102) configured to receive and culture the sample; ii) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; iii) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102) and the detection module (105); and iv) a processor (107) configured to control one or more of the culturing module (102), the detection module (105) and the transfer module (106), wherein the device (101) is configured to: a) use the detection module (105) to detect a molecule specific for the at least one type of microorganism in the sample; b) use the detection module (105) to detect in the sample at a first time point the level of a molecule from the at least one type of microorganism; and c) use the processor (107) to identify the type of the at least one microorganism based on detection of the molecule specific for the at least one type of microorganism in step a) and determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step b).

[0231] 18. A device (101) for preparing an output sample comprising a target concentration of at least one type of microorganism, wherein the device comprises: i) a culturing module (102) configured to receive and culture a sample comprising, or suspected to comprise, at least one type of microorganism; ii) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; iii) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102) and the detection module (105); and iv) a processor (107) configured to control one or more of the culturing module (102), the detection module (105) and the transfer module (106), wherein the device (101) is configured to: a) use the detection module (105) to detect a molecule specific for the at least one type of microorganism in the sample; b) use the detection module (105) to detect in the sample at a first time point the level of a molecule from the at least one type of microorganism; c) use the processor (107) to identify the type of the at least one microorganism based on detection of the molecule specific for the at least one type of microorganism in step a) and determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step b); d) use the culturing module (102) to culture the sample between the first time point and a second time point; e) use the detection module (105) to detect in the sample at the second time point the level of the molecule from the at least one type of microorganism; f) use the processor (107) to determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step e); g) use the processor (107) to determine a third time point at which the concentration of the at least one type of microorganism in the sample will reach or exceed the target concentration based on the concentrations of the at least one type of microorganism determined in steps c) and f); and h) use the culturing module (102) to culture the sample until the third time point.

[0232] 19. The device of embodiment 17 or 18, wherein the device (101) is configured to detect the molecule from, or specific to, the at least one type of microorganism by: using the transfer module (106) to transfer an aliquot of the sample to a lysis module (103) which is configured to lyse the microorganism thereby generating a lysed sample; and using the transfer module (106) to transfer the lysed sample to the detection module (105).

[0233] 20. The device of embodiment 17 or embodiment 18, wherein the culturing module (102) comprises: a thermal control element and / or a shaking element and wherein the processor (107) is further configured to control the thermal control element and / or the shaking element, optionally wherein the processor (107) is configured to control the thermal control element to cool the sample in the culturing module (102) when the concentration of the at least one type of microorganism in the cultured sample has reached or exceeded the target concentration.

[0234] 21. The device of any one of embodiments 17 to 20, wherein the detection module (105) comprises a PCR machine, DNA sequencer, spectrophotometer and / or luminometer.

[0235] 22. The device of any one of embodiments 17 to 21 , further comprising an alert module configured to provide an alert to a user of the device when the concentration of the at least one type of microorganism has reached or exceeded the target concentration.

[0236] 23. The device of any one of embodiments 17 to 22, wherein the culturing module (102) is configured to hold a purified and / or concentrated sample and the device further comprises: i) a purification module configured to hold a sample comprising magnetic particlemicroorganism complexes; and ii) a magnet module configured to selectively exert a magnetic force on the sample in the purification module, wherein the magnet module is configured to purify the sample in the purification module by using a magnetic force to separate the magnetic particle-microorganism complexes from the rest of the input sample and transfer the magnetic particle-microorganism complexes to the culturing module (102).

[0237] 24. The device of embodiment 23, wherein the processing module is configured to hold one or more samples each having a volume of at least 10 mL.

[0238] 25. The device of any of embodiments 17 to 24, characterised by the features of any one of embodiments 1 to 15.

[0239] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and patents specifically mentioned herein are incorporated by reference in their entirety for all purposes in connection with the invention. The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims. Moreover, all aspects and embodiments of the invention described herein are considered to be broadly applicable and combinable with any and all other consistent embodiments, including those taken from other aspects of the invention (including in isolation) as appropriate.

Claims

CLAIMS1. A method of preparing an output sample comprising a target concentration of at least one type of microorganism, the method comprising: a) detecting a molecule specific for the at least one type of microorganism in a sample comprising, or suspected to comprise, at least one type of microorganism; b) detecting in the sample at a first time point the level of a molecule from the at least one type of microorganism; c) determining the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified in step a) and the level of the molecule from the at least one type of microorganism detected in step b); d) culturing the sample between the first time point and a second time point; e) detecting in the sample at the second time point the level of the molecule from the at least one type of microorganism; f) determining the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified in step a) and the level of the molecule from the at least one type of microorganism detected in step e); g) determining a third time point at which the concentration of the at least one type of microorganism in the sample will reach or exceed the target concentration based on the concentrations of the at least one type of microorganism determined in steps c) and f); and h) culturing the sample until the third time point.

2. The method of claim 1 , wherein the concentration of the at least one type of microorganism at the second time point is greater than the concentration of the at least one type of microorganism at the first time point.

3. The method of claim 1 or claim 2, wherein the first and second time points precede or are predicted to precede the time point at which the concentration of the at least one type of microorganism reaches or exceeds the target concentration.

4. The method of any one of claims 1 to 3, further comprising detecting at the third time point the level of the molecule from the at least one type of microorganism to confirm that theconcentration of the at least one type of microorganism has reached or exceeded the target concentration.

5. The method of any one of claims 1 to 4, further comprising taking an aliquot of the sample once the concentration of the at least one type of microorganism in the sample has reached or exceeded the target concentration, and further culturing the sample until the concentration of the at least one type of microorganism has reached or exceeded a further target concentration.

6. The method of any one of claims 1 to 5, wherein the target concentration is the concentration required for a downstream assay selected from molecular species / genera identification, antimicrobial susceptibility testing, sequencing and / or mass spectrometry.

7. The method of any one of claims 1 to 6, wherein the target concentration is at least 100 CFU / mL.

8. The method of any one of claims 1 to 7, wherein determining the concentration of the at least one type of microorganism comprises the use of a reference dataset correlating the level of the molecule from the at least one type of microorganism with the concentration of the at least one type of microorganism.

9. The method of any one of claims 1 to 8, further comprising culturing the sample prior to step a) and / or prior to step b).

10. The method of any one of claims 1 to 9, wherein detecting the molecule specific for the at least one type of microorganism identifies the type of microorganism as Gram positive bacteria, Gram negative bacteria or fungi / yeast (e.g. Candida).11 . The method of any one of claims 1 to 10, wherein the molecule from the at least one type of microorganism is the molecule specific for the at least one type of microorganism.

12. The method of any one of claims 1 to 11 , wherein the molecule from the at least one type of microorganism is ATP or an enzyme (such as a phosphatase, kinase, polymerase or ligase).

13. The method of any one of claims 1 to 12, wherein the molecule specific for the at least one type of microorganism is a nucleic acid or polypeptide.

14. The method of any one of claims 1 to 13, wherein detecting the molecule from or specific for the at least one type of microorganism comprises nucleic acid amplification, sequencing, mass spectrometry or an enzymatic activity assay.

15. The method of any one of claims 1 to 14, wherein prior to performing the method the concentration of the at least one type of microorganism in the sample is no more than 10 CFU / rnL.

16. The method of any one of claims 1 to 15, wherein if the concentration of the at least one type of microorganism in the sample determined in step f) is not sufficiently greater than the concentration of the at least one type of microorganism in the sample determined in step b), steps d) to f) are repeated one or more times until the concentration of the at least one type of microorganism in the sample determined in step f) is sufficiently greater than the concentration of the at least one type of microorganism in the sample determined in the previous iteration of step f).

17. The method of any one of claims 1 to 16, wherein if step a) detects more than one type of microorganism then the molecule specific for each type of microorganism is used in the remainder of the method to determine the concentration of each microorganism.

18. The method of claim 17, wherein the sample is cultured until the latest of the third time points determined for each of the more than one type of microorganism.

19. The method of claim 17 or claim 18, wherein if step a) detects more than one type of microorganism the sample is split and the remainder of the method performed for each type of microorganism in the sample separately.

20. The method of any one of claims 1 to 19, wherein the sample comprising, or suspected to comprise, at least one type of microorganism is a blood sample.

21. The method of any one of claims 1 to 20, wherein the sample comprising, or suspected to comprise, at least one type of microorganism is a neonatal sample.

22. The method of any one of claims 1 to 21 , wherein the sample comprising, or suspected to comprise, at least one type of microorganism is a clinical sample obtained from a subject.

23. The method of claim 22, wherein the sample obtained from the subject has a volume 3 mL or less, preferably 1 mL.

24. The method of claim 22, wherein the sample obtained from the subject is of volume greater than 5 mL and is split into aliquots, with the method being performed on each aliquot.

25. The method of any one of claims 1 to 24, wherein before performing step a), the method comprises: i) incubating the sample with magnetic particles to form particle-microorganism complexes; and ii) separating the particle-microorganism complexes from non-microorganism cells, inhibitors of microbial growth and / or inhibitors of downstream analysis.

26. The method of claim 25, further comprising separating the particle-microorganism complexes and performing step a) in the absence of the magnetic particles.

27. A device (101) for preparing an output sample comprising a target concentration of at least one type of microorganism, wherein the device comprises: i) a culturing module (102) configured to receive and culture a sample comprising, or suspected to comprise, at least one type of microorganism; ii) a detection module (105) configured to detect a level of a molecule from the at least one type of microorganism; iii) a transfer module (106) comprising one or more syringes and / or pistons configured to transfer fluid between the culturing module (102) and the detection module (105); and iv) a processor (107) configured to control one or more of the culturing module (102), the detection module (105) and the transfer module (106), wherein the device (101) is configured to:a) use the detection module (105) to detect a molecule specific for the at least one type of microorganism in the sample; b) use the detection module (105) to detect in the sample at a first time point the level of a molecule from the at least one type of microorganism; c) use the processor (107) to identify the type of the at least one microorganism based on detection of the molecule specific for the at least one type of microorganism in step a) and determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step b); d) use the culturing module (102) to culture the sample between the first time point and a second time point; e) use the detection module (105) to detect in the sample at the second time point the level of the molecule from the at least one type of microorganism; f) use the processor (107) to determine the concentration of the at least one type of microorganism in the sample based on the type of microorganism identified and the level of the molecule from the at least one microorganism detected in step e); g) use the processor (107) to determine a third time point at which the concentration of the at least one type of microorganism in the sample will reach or exceed the target concentration based on the concentrations of the at least one type of microorganism determined in steps c) and f); and h) use the culturing module (102) to culture the sample until the third time point.

28. The device of claim 27, wherein the device (101) is configured to detect the molecule from, or specific to, the at least one type of microorganism by: using the transfer module (106) to transfer an aliquot of the sample to a lysis module (103) which is configured to lyse the microorganism thereby generating a lysed sample; and using the transfer module (106) to transfer the lysed sample to the detection module (105).

29. The device of claim 27, wherein the culturing module (102) comprises: a thermal control element and / or a shaking element and wherein the processor (107) is further configured to control the thermal control element and / or the shaking element, optionally wherein the processor (107) is configured to control the thermal control element to cool the sample in the culturing module (102) when the concentration of the at least one type of microorganism in the cultured sample has reached or exceeded the target concentration.

30. The device of any one of claims 27 to 29, wherein the detection module (105) comprises a PCR machine, DNA sequencer, spectrophotometer and / or luminometer.

31. The device of any one of claims 27 to 30, further comprising an alert module configured to provide an alert to a user of the device when the concentration of the at least one type of microorganism has reached or exceeded the target concentration.

32. The device of any one of claims 27 to 31 , wherein the culturing module (102) is configured to hold a purified and / or concentrated sample and the device further comprises: i) a purification module configured to hold a sample comprising magnetic particlemicroorganism complexes; and ii) a magnet module configured to selectively exert a magnetic force on the sample in the purification module, wherein the magnet module is configured to purify the sample in the purification module by using a magnetic force to separate the magnetic particle-microorganism complexes from the rest of the input sample.

33. The device of claim 32 wherein the magnet module is configured to transfer the magnetic particle-microorganism complexes to the culturing module (102).

34. The device of claim 32 or claim 33, further comprising a separation and transfer module configured to separate the particle-microorganism complexes and transfer separated microorganisms to the culturing module (102) in the absence of the magnetic particles.

35. The device of any of claims 27 to 34, wherein the culturing module is configured to hold one or more samples each having a volume of at least 10 mL.

36. The device of any one of claims 27 to 35, wherein the culturing module comprises a plurality of culturing sub-modules.

37. The device according to claim 36, wherein each culturing sub-module is configured to receive a maximum sample volume of no more than 5 mL, preferably no more than 4 mL and more preferably no more than 3.5 mL.

38. The device of claim 36 or claim 37, wherein the device comprises 24 culturing submodules.

39. The device of claim 38, wherein the culturing sub-modules are arranged in a 6 x 4 arrangement.

40. The device of any one of claims 27 to 39, wherein the device is configured to have a fully integrated automation workflow.

41. The device of any of claims 27 to 40, characterised by the features of any one of claims1 to 26.

Citation Information

Patent Citations

  • Method and system for predicting microbial culture concentration

    EP4317405A1

  • Method for predicting abundance of specific microorganism in sludge at some time point in future

    JP2010022317A

  • Methods, systems, and devices for detecting and identifying microorganisms in microbiological culture samples

    WO2013165615A2

  • Method for determining the concentration of intact microorganisms in a sample

    WO2019073025A1