Genetically modified obese mouse model

Abstract

Mouse models of obesity associated with human MC4R missense mutations are provided. Human mutations introduced with CRISPR / Cas9 into the mouse MC4R gene lead to an severely obese mouse phenotype in mice with a heterozygous genotype.

Description

[0001] Genetically Modified Obese Mouse Model

[0002] BACKGROUND

[0003] Melanocortin receptor 4 (Mc4r)-deficient obesity is a poorly treated disease. An estimated 3 to 6% of children with severe early onset obesity have homozygous, compound heterozygous or heterozygous mutation in the MC4R gene which cause a loss of Mc4r function, Mc4r deficiency. Patients with Mc4r-deficient obesity present with rapid weight gain, severe hyperphagia, and in some patients above average linear growth and height, and increased bone mass (Pigeyre & Meyre, (2018). Monogenic Obesity. In M. S. Freemark (Ed.), Pediatric Obesity: Etiology, Pathogenesis and Treatment (pp. 135-152). Springer International Publishing). Biochemical features of the disease include hyperinsulinemia, high TSH, and hypothyroidism. Severe early-onset obesity can lead to early onset of serious comorbidities normally seen only in adult subjects such as type 2 diabetes mellitus, hypertension, nonalcoholic fatty liver disease, obstructive sleep apnea, and dyslipidemia (Kumar & Kelly. (2017). Review of Childhood Obesity: From Epidemiology, Etiology, and Comorbidities to Clinical Assessment and Treatment. Mayo Clinic Proceedings, 92(2), 251-265). Children who are carriers of pathogenic Melanocortin 4 Receptor (MC4R) mutations have a higher percentage of body fat and are more likely to suffer from severe hyperphagia compared to obese children who do not carry a MC4R mutation.

[0004] Mutations that cause deficits in melanocortin signaling are well established as pathogenic in obesity including mutations in genes that code for leptin, LEPR, POMC, PCSK1 and MC4R. Mc4r- deficiency, is the most common form of genetic obesity, representing approximately 3-6% of all cases of severe obesity across different ethnicities (Collet et al., (2017). Molecular Metabolism, 6(10), 1321— 1329; da Fonseca et al., (2017). Journal of Diabetes and Its Complications, 31(10), 1549-1561 ). The genetic contribution of known pathogenic MC4R variants has been validated through studies of families, twins and adopted children. Estimates of the heritability of causes is as high as 70% and penetrance in some cases as high as 80% (Farooqi & O’Rahilly, (2006). Genetics of Obesity in Humans. Endocrine Reviews, 27(7), 710-718). Mc4r-D obesity can occur as heterozygous or homozygous loss-of-function variant or mutation. Most affected subjects are heterozygous (Vollbach et al., (2017). International Journal of Obesity, 41(1 ), Article 1 ) but homozygous cases have been reported as more severe (Fairbrother et al., (2018). Current Diabetes Reports, 18(10), 85).

[0005] More than 400 single nucleotide loss-of-function MC4R variants or mutations have been identified, of these approximately 200 are missense mutations and of these at least 69 are established as pathogenic or likely pathogenic ((Fairbrother et al., (2018). Current Diabetes Reports, 18(10), 85). The majority of obesity-related MC4R mutations characterized to date are mis-trafficked leading to functional plasma membrane (PM) Mc4r levels that are only 5 to 20% of wild type levels (Granell et al., (2012). PLOS ONE, 7(12), e50894). Of 48 rare MC4R variants (minor allele frequency of <1%) associated with severe obesity in clinically ascertained studies, 28 have disrupted trafficking from the ER to the PM resulting in deficient Mc4r signaling capacity (Brouwers et al., (2021). Cell Reports, 34(12), 108862). Currently no animal model simulates Mc4r deficient obesity associated with a missense MC4R mutations that cause Mc4r loss-of-function including reduced trafficking of Mc4r to its functional location in the cell eg. plasma membrane and endosome. The most relevant available model simulates Mc4r deficiency though full or partial knock-out of the MC4R gene (eg JAX Strain #032518 or #03759). However, such models do not fully recapitulate the potential pathophysiology and cellular stress caused by Mc4r misfolding, which occurs with MC4R missense loss-of-function mutations. Another limitation of the MC4R knock-out models available is that they are not useful for evaluating the in vivo effects of corrector compounds. These are compounds that can bind and correct misfolded Mc4r and increase Mc4r trafficking to the cell surface.

[0006] Animal models of Mc4r-deficient obesity are needed to enable development of new treatments for severe obesity.

[0007] SUMMARY OF THE INVENTION

[0008] Provided herein are transgenic mice whose genomes comprise homozygous or heterozygous partial loss-of-function mutations in the MC4R gene. In some embodiments MC4R mutations engineered into the genomes of the transgenic mice are MC4R mutations found in humans and associated with severe human obesity but do not occur naturally in mice or any other rodent species. The transgenic mouse model of the invention provided are a model of severe early-onset obesity in humans.

[0009] In one embodiment the invention provides a transgenic mouse with one or more MC4R gene alleles comprising a loss-of-function mutation introduced into an embryo used to breed mice using CRISPR / Cas9 gene editing methods. In a further embodiment a missense mutation associated with obesity in humans is edited into a mouse embryo MC4R gene using CRISPR / Cas9 gene editing methods. In some embodiments the human MC4R mutation is selected from those listed in Table 1 or Table 2 herein.

[0010] In one embodiment the invention provides a transgenic mouse with a heterozygous MC4R genotype comprising one MC4R allele with a p.Arg165Gln mutation. In a further embodiment the transgenic mouse of the invention has a homozygous MC4R genotype comprising two MC4R alleles each with a p.Arg165Gln mutation.

[0011] In one embodiment the invention provides a transgenic mouse with a heterozygous MC4R genotype comprising one MC4R allele with a p.Thrl 62lle mutation. In a further embodiment the transgenic mouse of the invention has a homozygous MC4R genotype comprising two MC4R alleles each with a p.Thrl 621 le mutation.

[0012] In one embodiment the invention provides a transgenic mouse with a heterozygous MC4R genotype comprising one MC4R allele with a p.Arg165Trp mutation. In a further embodiment the transgenic mouse of the invention has a homozygous MC4R genotype comprising two MC4R alleles each with a p.Arg165Trp mutation.

[0013] In one embodiment the invention provides a transgenic mouse with a heterozygous MC4R genotype comprising one MC4R allele with a p.lle316Ser mutation. In a further embodiment the transgenic mouse of the invention has a homozygous MC4R genotype comprising two MC4R alleles each with p.lle316Ser mutation.

[0014] In one embodiment the invention provides a transgenic mouse with a heterozygous MC4R genotype comprising one MC4R allele with a p.Leu250Gln mutation. In a further embodiment the transgenic mouse of the invention has a homozygous MC4R genotype comprising two MC4R alleles each with a p.Leu250Gln mutation.

[0015] In another embodiment the invention provides isolated cells, tissues, or organs isolated from a transgenic mouse model of the invention.

[0016] In another aspect, provided herein, are methods for identifying a candidate compound for the treatment of severe early-onset obesity or severe obesity. The methods include contacting a transgenic mouse as described herein, or a cell, tissue, or organ thereof, with a test compound; measuring body weight or food intake in the mouse, cell, tissue, or organ in the presence or absence of a test compound; and identifying a test compound that decreases body weight or food intake.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Methods and materials are described herein for use in the present invention; other suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0018] BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1. A Mc4r protein trafficking defect cause by 5 human MC4R mutations introduced into the mouse MC4R.

[0020] Figure 2. Body weight gain on high fat diet (HFD) wild type (MC4R+ / +) vs. heterozygous R165 mice (MC4R+ / R165Q)

[0021] Figure 3. Body Weight of wild type (Mc4r+ / +) vs. heterozygous R165Q mice (MC4R+ / R165Q) at baseline.

[0022] Figure 4. Cumulative food intake wild type (MC4R+ / +) vs. heterozygous R165Q mice (Mc4r+ / R165Q).

[0023] Figure 5. Heterozygous R165Q mice (Mc4r+ / R165Q) have higher fat mass and lower lean mass.

[0024] Figure 6. Cummulative food intake during 10 day exposure high fat diet (HFD) in wild type mice (MC4R+ / +), heterozygous R165Q mice (Mc4r+ / R165Q) and homozygous R165Q mice (MC4RR165Q / R165Q). Mc4r-deficient mice with homozygous or heterozygous MC4R genotypes eat significantly more than wild type mice.

[0025] Figure 7. Body weight gain during 10 day exposure high fat diet (HFD) in wild type mice (MC4R+ / +), heterozygous R165Q mice (Mc4r+ / R165Q) and homozygous R165Q mice (MC4R+ / R165Q). Mc4r-deficient mice with homozygous or heterozygous MC4R genotypes gain weight faster than wild type mice. Figure 8. EcoMRI analysis of body composition of wild type mice (MC4R+ / +), heterozygous R165Q mice (Mc4r+ / R165Q) and homozygous R165Q mice (MC4R+ / R165Q) after 10 day exposure to HFD.

[0026] DETAILED DESCRIPTION OF THE INVENTION

[0027] To facilitate the understanding of this invention, several terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the invention. Terms such as “a”, “an,” and “the” are not intended to refer to only a singular entity but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not limit the invention, except as outlined in the claims.

[0028] It is to be understood that this invention is not limited to specific synthetic methods of making that may of course vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0029] As used herein “transgenic mouse” means a mouse in which one or more cells expresses a gene which is not known to occur naturally in mice. The transgenic mice disclosed herein express a sequence of mouse MC4R (mMC4R) which includes at least one mutation that occur naturally in humans but are not known to naturally occur in mice.

[0030] As used herein CRISPR / cas9 refers to standard genetic engineering methods for editing gene sequences in cells. Such methods are described in “CRISPR Gene Editing” (Methods in Molecular Biology), Yonglun Luo Editor (Humana Press New York, N.Y., 2019.

[0031] MC4R refers to the Melanocortin receptor 4 (MC4R) gene and Mc4r refers to the protein expressed from the MC4R gene in a mammalian cell. The human MC4R gene corresponds to NCBI Gene ID: 4160 and the mouse MC4R gene corresponds to NCBI Gene ID: 17202. Mutations in the MC4R gene are identified herein by the effect of the mutation on the Mc4r protein transcript eg. p.Arg165Trp. MC4R mutations for use in the present inventions are clinically important human mutations; in particular, those listed in Table 1 and Table 2.

[0032] As used herein Melanocortin receptor 4 (Mc4r) deficient or Mc4r-deficient as used herein means a loss of in vivo Mc4r function caused by a mutation in the MC4R gene associated with a reduction in Mc4r function, also referred to as Mc4r loss-of-function. Loss of Mc4r function can be determined in cell-based assays using methods known in the art. Mc4r loss-of-function refers to the detrimental effects of a mutation in the MC4R gene on the function of the Mc4r protein expressed from the MC4R gene. Mc4r loss-of-function can be due to a reduction in functional Mc4r, located at the plasma membrane (PM) or endosomal membrane compartment of a cell or a reduction in Mc4r activity or a combination of these loss-of-function effects. For example, some MC4R mutations cause a reduction in a fraction of synthesized Mc4r which is trafficked from an endoplasmic reticulum to a plasma membrane and an increase in a fraction of Mc4r degraded by a regulated proteolysis system in a cell. Other MC4R mutations do not affect the fraction of synthesized Mc4r trafficked to the PM but affect the intrinsic activity of Mc4r at its functional subcellular location i.e. at the plasma membrane or endosome. Examples of clinically important MC4R mutations are shown in Table 1. These mutations meet the American College of Medical Geneticists criteria for classification as pathogenic or likely pathogenic in an obesity condition.

[0033] Table 1. Examples of Clinically Important MC4R Mutations.

[0034] A mouse MC4R gene as used herein refers to the mouse MC4R gene identified as NCBI Gene: 17202. The mouse MC4R gene is also known as Pkcp. The mouse MC4R gene encodes the mouse melanocortin 4 receptor protein (also referred to as Mc4r) corresponding to NCBI Reference Sequence: NP_058673.2 and UniProtKB / Swiss-Prot: P56450.3. Mouse Mc4r protein or mMc4r protein is a 332 amino acid protein belonging to the G-protein coupled receptor 1 family.

[0035] As used herein “wild type” refers to a fully functional mouse gene or protein and “mutant” refers to a gene or protein which carries a deleterious sequence variant which causes a reduction in function relative to a wild type gene or protein. For example, a mouse that is deficient in Mc4r does not express the same level of Mc4r or does not have the same level of Mc4r protein activity as a non-modified mouse and so exhibit a “loss-of-function.” In some embodiments, the expression or activity of Mc4r is reduced (e.g., by at least 10%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more), relative to a control mouse. Functional cellular Mc4r is a transmbrain protein which can reside in the plasma membrane or endosomal membrane of a cell. The level of plasma membrane Mc4r receptor present in a cell can be determined using a variety of assay methods known in the art including but not limited to enzyme complementation assays such as the Eurofins Pathhunter® GPCR assays wherein Mc4r labelled with a fragment of B-galactosidase enzyme is expressed in the cell and a complimentary fragment of B-galactosidase (complement) is also expressed and localized to the plasma membrane or endosome. When Mc4r is present in a compartment where the complement is present a signal is generated. Pathhunter® GPCR assays are described in Application Notes available from Eurofins. Other similar biosensor e.g. Bioluminescence resonance energy transfer (BRET) can be used to quantify a GPCR, such as Mc4r, present either in the plasma or endosomal membrane. Such methods are described in Bouvier et al. Biosensors for monitoring receptor-mediated G-protein activation US9029097B2, herein encorporated by reference. Alternatively a Mc4r signaling assay e.g. cAMP signaling can be used to the functional Mc4r level in cells expressing Mc4r with a loss-of-function mutation. An example of such methods are described in Huang, H., et al (2017). Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1863(10, Part A), 2496-2507, herein encorporated by reference. Lastly in-cell / on-cell western methods can be used to quantify total cellular Mc4r levels and surface (plasma membrane) levels. Such methods are well known in the art (e.g. Boveia, et al (2015).

[0036] Quantitative Analysis of Signal Transduction with In-Cell Western Immunofluorescence Assays. In B. T. Kurien & R. H. Scofield (Eds.), Detection of Blotted Proteins: Methods and Protocols) and further described in Example 1 herein.

[0037] Mouse mutants can be models for Mc4r-related diseases, conditions or disordes. For example, such mice can serve as models for acquired or congenital obesity, such as severe or moderate obesity, severe or moderate obesity with or without one or more obesity-related metabolic disorders, pediatric-onset obesity, obesity associated with loss-of-function mutations in MC4R or Mc4r deficiency, early-onset obesity associated with Mc4r-deficiency, and hypothalamic obesity caused by damage to the hypothalamus or congenital hypothalamic obesity. T ransgenic mice comprising a pathogenic or likely pathogenic missense mutation associated with an obese condition are provided herein. The mice of the invention may harbor one or two MC4R alleles with a mutation selected from those listed in Table 1 or Table 2.

[0038] The term “subject,” as used herein, can be a human, non-human primate, or other mammal, such as but not limited to dog, cat, horse, cow, pig, goat, monkey, rat, mouse, and sheep. In preferred embodiments, the subject is a human.

[0039] In adults, severe obesity is defined as a person having a body mass index (BMI) > 35kg / m2and moderate obesity defined as a person having a BMI >25. Childhood obesity severity is defined by age and sex-matched index BMI cut offs to account for growth e.g. as set by the World Heath Organization. Guidelines and tables for defining index BMI cut offs for children are known in the art. For children between 5 and 19 obesity is defined as BMI-for-age greater than 2 standard deviations above the WHO Growth Reference median. For children under 5 obesity is defined as weight-for- height greater than 3 standard deviations above the WHO Child Growth Standards median. Severe obesity in children can be defined as a BMI at or above the 99thpercentile for the child’s age and gender or above the 95thpercentile for the child’s age and gender, or above the 90thpercentile for the child’s age and gender. Early onset obesity is obesity which affect a subject during childhood typically before the age of 12, before the age of 10, before the age of 8, before the age of 7, before the age of 6 or before the age of 5. Early onset obesity can be severe or moderate obesity.

[0040] Obesity associated with Mc4r deficiency means obesity that affects an individual with a heterozygous or homozygous MC4R mutant genotype comprising a single nucleotide variant or short deletion that has been shown to cause a reduction in Mc4r function in in vitro experiments. Examples of such single nucleotide variants include but are not limited to those exemplified in Table 1. Transgenic mice of the invention may have a homozygous, heterozygous or compound heterozygous mMC4R genotype.

[0041] Methods for generating transgenic animals, particularly animals such as mice, via embryo manipulation and electroporation or microinjection of pluripotent stem cells or oocytes, are known in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, U.S. Pat. No. 4,873,191, U.S Ser. No. 10 / 006,611 , “Transgenic Mouse Methods and Protocols (Methods in Molecular Biology),” Hofker and van Deursen, Editors (Humana Press, Totowa, N.J., 2011 ); and in “CRISPR Gene Editing” (Methods in Molecular Biology), Yonglun Luo Editor (Humana Press New York, N.Y., 2019) which are incorporated herein by reference in their entirety. A transgenic founder animal can be identified based upon the presence of one of more of the MC4R mutations listed in Table 1 in its genome, for example by detecting the presence of the MC4R mutations directly.

[0042] For example, by genotyping any cell sample obtained from the post-natal animal, e.g., the ear of the post-natal animal. A transgenic founder animal can then be used to breed additional animals carrying the mutant genotype. Mice homozygous for a MC4R mutation can be breed with a wild type mouse strain to generate heterozygous mice.

[0043] The invention provides methods for identifying compounds e.g. small organic molecules, peptides oligonucleotides or oligopeptides capable of increasing functional Mc4r protein levels in vivo by treating the mouse model of the invention with a test compound. In some embodiments test compounds are members of a compound library, natural products or known Mc4r agonists or antagonists.

[0044] In some embodiments, test compounds identified as “hits” (e.g., test compounds that improve the obese phenotype in a mouse model of the invention) in a first screen are selected and optimized by being systematically altered, e.g., using rational design, to optimize binding affinity, avidity, specificity, or other parameter. Such potentially optimized structures can also be screened using the methods described herein. Thus, in one embodiment, the invention includes screening a first library of test compounds using a method described herein, identifying one or more hits in that library, subjecting those hits to systematic structural alteration to create one or more second generation compounds structurally related to the hit, and screening the second-generation compound. Additional rounds of optimization can be used to identify a test compound with a desirable therapeutic profile.

[0045] EXAMPLES

[0046] Example 1 : In Vitro Validation of Human Mutation for use in Transgenic Mouse Model

[0047] Five HEK293 cell lines transiently expressing mouse MC4R (mMC4R) with a human mutation selected from p.Arg165Gln, p.Thrl 62lle, p.Arg165Trp, p.lle316Ser and p.Leu250Gln (Table 2) were generated. Expression constructs were generated in pcDNA3.1 vector comprising mouse wild type (WT) MC4R or each of 5 mMC4R comprising a human MC4R mutation were created with site directed mutagenesis method. The constructs were used to transiently transfect the HEK293 cell lines using ThermoFisher Lipofectamin 2000 transfection reagent and following the manufacturer’s instructions using a cell culture of 0.6M and 0.5 pig of DNA per transfection.

[0048] Table 2. Five Selected Human MC4R Mutations. Quantitative analysis of mutant and wild type mouse MC4R expressed by transiently transfected HEK293 cells was performed using a LI-COR Odyssey imaging system.

[0049] Table 3. Materials On-Cell Western Analysis Example 1. Seed cells were prepared for transfection. The cells were then transfected with WT MC4R or one of 5 mutant MC4R constructs in Table 2. Following transfection cells were incubated overnight at 37°C in a CO2 incubator. Clear bottom 96-well plates were coated with 50 ml_ of a Poly-D-Lysine solution (0.1 mg / ml in 3.5 ml of sterile water) and incubated for 1 hour. The Poly-D-Lysine solution was removed and cells were rinsed 3X with 150 uL / well of sterile water. Plate was dried under biological hood for 1 hour and stored at 4oC. Plates were prewarmed to 37oC before seeding cells. Cells were pre-warm in. cell Complete Medium (EMEM + 10% FBS) to 37°C in a dry bath and the medium was aspirated from the transfected cells.

[0050] Add 1 mL of DPBS into each well, swirl to rinse the cells, and gently aspirate. TryplExpress 0.2 mL per well was added. Plates were gently rocked to cover well surface with the TyplExpress and the plate was incubated room temperature for 2 to 3 minutes. Attachment of cells was verified under a microscope. 0.8 mL of pre-warmed complete medium (10% FBS) was added to each well. Cells were rinsed with the added medium and transfer to a 15-ml tube. Cells counts were determined and cells resuspended in media at 3e5c / ml. 100 ul of cell suspension per well was added to Poly-D-Lysine coated 96-welll plates and incubated at 37°C under CO2for 24 hours.

[0051] Following the incubation the media was removed and cells were fixed with 80uM of 4% paraformaldehyde / PBS per well and incubated for 20 minutes at ambient temperature. The fixing solution was removed and fixed cells washed 1X with PBS, then 4 - 5x with PBS.

[0052] Supernatant was removed, replaced with 150 pL of Intercept Blocking Buffer (PBS) per well and incubated for 2 hours at room temperature with moderate shaking on the mini blot mixer. The primary antibody was diluted in Intercept Blocking Buffer and mixed thoroughly. Blocking buffer was removed and 60 pL of diluted primary antibody added per well. Cells were incubated with the primary antibody at 4oC overnight.

[0053] Secondary antibody, LiCor IRDyeCW800, was reconstituted for a final concentration of 1 mg / mL and mixed for 30 min prior to use. LiCor CellTag700 was reconstituted and suspended in 1X PBS for a final concentration of 0.1 mM, vortexed and rehydrated for at least 30 min at room temperature. The secondary antibody was diluted in 0.1% Tween20 and blocking buffer and diluted to 1 :200 and 1 :1200 antibody. CellTag solution at 1:500 - 1:1000 dilution was added to the secondary antibody solution. Primary antibody reconstitution solution was washed with PBS and supernatant obtained. 60 uL of diluted secondary antibody was added to each well of a 96-well plate and incubated for 90 min with gentle shaking in the dark. Secondary antibody was removed and cell tag stain solution added. Plates were washed for 4-5 minutes with 150 ul of PBS with 0.1% Tween20 in the dark. Plates were prepared for scanning and scanned at 700 nm and 800 nm with Resolution 100 pm and Focus Of Set at 3.8 pm (plotted as ‘Normalized Signal Intensity’ in Figure 1 ).

[0054] Signal for mouse Mc4r cell surface levels, as determined by on-cell western was determined for 5 clinically relevant human MC4R mutants edited into the mouse MC4R gene (Figure 1). The 5 human obesity mutations introduced into the mouse MC4R gene were p.Arg165Gln (mT162l), p.Thr162lle (mR165Q), p.Arg165Trp (mR165W), p.lle316Ser (mL316S) and p.Leu250G (mL250Q) were associated with a reduction in cell surface mMc4r (Figure 3). These mutations were associated with a reduced plasma membrane mouse Mc4r (mMc4r) level ranging from 10 - 50% of the mouse WT Mc4r (mWT) level; indicating that the human mutations caused loss-of-function defect in mMc4r.

[0055] Example 2: Generation of Transgenic Mice

[0056] Standard gene editing methods were used to generate mouse zygotes with the R165W MC4R mutation. The p.R165Q mutation (NM_005912.3:c.494G>A) was introduced into C57BL / 6J mouse zygotes (JAX stock #: 0006664) using CRISPR / Cas9 gene editing. The zygotes were coinjected with Cas9 mRNA, sgRNA (SEQ ID NO: 1) and a single stranded DNA donor containing the R165Q mutation (CGG>CAG) and one silent mutation. sgRNA

[0057] ATAACATCATGACGGTTAGG (+ strand) (SEQ ID NO: 1 )

[0058] Single Stranded DNA

[0059] TGACAGCGCTGCTGTCCGAGTAAATGATGAAGAGGACGCCTGACACAGTGCAAGCTGCCCAGAT ACAACTTATGATGATCCCGACCTGCCTGACCGTCATGATGTTATGGTACTGGAGCGCGTAAAA (- strand) (SEQ ID NO: 2)

[0060] Blastocysts were generated from the edited zygotes and transplanted into pseudo-pregnant female mice for gestation. The mouse pups were genotyped using PCR-based methods confirming the expected mutation sequence using the forward primer GTACGGATACGGATGCCCAG (SEQ ID NO: 3) and the reverse primer TCGATGACGGCGTTACACAT (SEQ ID NO: 4), product size = 568 bp. Mice were confirmed to express a MC4R gene encoding the mouse Mc4r harboring a p.R165Q mutation. These Founder mice were bred with the C57BL / 6J background strain to generate WT / pR165Q heterozygous MC4R N1 mice. The N1 generation of mice was sequenced and validated for germline transmission of the mutation.

[0061] Example 3: Phenotypic Characterization of MC4R+ / R165Qcompared to MC4R+ / +(WT) mice

[0062] Heterozygous R165Q mice (MC4R+ / R165Q) develop an obese phenotype compared to wild type mice. Eight week old N1 MC4R+ / R165Qmice (n= 54 , 7 $ ) and WT littermates (n= 64 , 6 $ ) were placed on 45% high fat diet (HFD, #D12451 from Research Diets) over two consecutive weeks. Mice were housed up to two per cage and aclimatized to the housing for 1 week, with ad libitum access to regular rodent chow, prior to HFD introduction. Body weights were determined daily, and food consumption (ad libitum) was assessed every other day. Food intake per 2 animals was calculated based on the difference of the weight of food offered minus in the weight of food remaing after 2 days. Prior to study termination on day 15, fat and lean mass was determined by Echo MRI (magnetic resonance imaging). Following euthanasia on day 15, liver weight was recorded and a blood sample was collected.

[0063] Heterozygous mutant (Mc4r / R165Q) mice displayed rapid body weight gain compared to wildtype (Mc4r+ / +) littermates, reaching statistical significance after only 3 days on HFD. At day 15, mutant mice had gained almost twice as much weight (normalized to baseline) vs. WT mice (Figure 2). At baseline (prior to HFD introduction), the body weight of the wildtype and Mc4r+ / R165° mice was not significantly different (Figure 3). Consistent with the faster weight gain in the Mc4r+ / R165° mice, these animals also had a significantly higher cumulative food intake compdared to wildtype littermates (Figure 4). EchoMRI also revealed profound changes in fat and lean mass in mutant mice compared to their WT counterparts at the end of the 2-week period (Figure 5). The Mc4r+ / R165° mice were found to have a higher fat mass and lower lean mass compared to WT animals.

[0064] Example 4: Phenotypic Characterization of MC4RR165Q / R165Qcompared to MC4R+ / R165Qand MC4R+ / +(WT) mice

[0065] The phenotyping experiment described above was repeated and the obese phenotype in Mc4r / R165Qmice and Mc4rR165Q / R165Qmice was further validated. Relative to WT (Mc4r+ / +) littermates the Mc4r+ / R165° and Mc4rRie5Q / Rie5Qmice ate more (Figure 6) and gained more weight over a 10 day period with exposure to high fat diet (HFD) (Figure 7). Using EchoMRI fat and lean mass in these animals were determined. Fat mass in the Mc4r+ / R165Qand Mc4rR165Q / R165Qmice was significantly higher than in WT mice after 10 days exposure to high-fat diet (Figure 8). The obese phenotype was significantly stronger in the homozygous genotype compared to heterozygous; greater Mc4r loss-of- function is associated with a more severely obese phenotype.

[0066] Enumerated Embodiments

[0067] E1. A mouse comprising in its genome at least one MC4R mutant gene allele encoding an MC4R loss-of-function mutation.

[0068] E2. The mouse of embodiment 1 wherein the loss-of-function mutation reduces the level of MC4R cell surface protein.

[0069] E3. The mouse of embodiment 1 wherein the mutation is p.Arg165Gln.

[0070] E4. The mouse of embodiment 1 wherein the mutation is p.Thrl 62lle.

[0071] E5. The mouse of embodiment 1 wherein the mutation is p.Arg165Trp.

[0072] E6. The mouse of embodiment 1 wherein the mutation is p.lle316Ser.

[0073] E7. The mouse of embodiment 1 wherein the mutation is p.Leu250Gln.

[0074] E8. The mouse of embodiment 1 wherein the mutation is selected from the human mutations listed in Table 1.

[0075] E9. The mouse of embodiment 1 wherein the mouse has a heterozygous MC4R genotype with one wild type MC4R allele and one MC4R allele comprising a loss-of-function mutation.

[0076] E10. The mouse of embodiment 1 wherein the mouse has a homozygous MC4R genotype with two MC4R alleles comprising the same loss-of-function mutation.

[0077] E11 . The mouse of embodiment 1 wherein the mouse has a compound heterozygous MC4R genotype with two MC4R alleles comprising a different loss-of-function mutation.

[0078] E12. The mouse of embodiment 1 wherein the loss-of-function mutation is a missense mutation.

[0079] E13. The mouse of embodiment 1 wherein the loss-of-function mutation is analogous to a human MC4R mutation which is associated with severe obesity.

[0080] E14. A cell from the mouse of any one of the preceding embodiments (e.g., embodiments E1 to E13).

[0081] E15. A mouse comprising a cell having the same genotype of a cell from the mouse of any one of the preceding embodiments (e.g., embodiments E1 to E14).

[0082] E16. A progeny mouse of the mouse of any one of the preceding embodiments (e.g., embodiments E1 to E15).

[0083] E17. A method comprising producing the mouse of any one of the preceding embodiments (e.g., embodiments E1 to E16).

[0084] E18. A method of identifying a compound that can be used to treat obesity, the method comprising providing the mouse of embodiment 1 , exposing the mouse to a test compound, measuring the weight, food intake or fat mass of the mouse and identifying a compound that reduces the weight, food intake or fat mass of the mouse. Other Embodiments

[0085] Various modifications and variations of the described compositions, methods, and uses of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention.

[0086] Other embodiments are in the claims.

Claims

What is claimed is:CLAIMS1. A mouse comprising in its genome at least one MC4R mutant gene allele encoding an MC4R I oss-of-fu notion mutation.

2. The mouse of claim 1 wherein the loss-of-function mutation reduces the level of MC4R cell surface protein.

3. The mouse of claim 1 wherein the mutation is p.Arg165Gln.

4. The mouse of claim 1 wherein the mutation is p.Thrl 621 le.

5. The mouse of claim 1 wherein the mutation is p.Arg165Trp.

6. The mouse of claim 1 wherein the mutation is p.lle316Ser.

7. The mouse of claim 1 wherein the mutation is p.Leu250Gln.

8. The mouse of claim 1 wherein the mutation is selected from the human mutations listed inTable 1.

9. The mouse of claim 1 wherein the mouse has a heterozygous MC4R genotype with one wild type MC4R allele and one MC4R allele comprising a loss-of-function mutation.

10. The mouse of claim 1 wherein the mouse has a homozygous MC4R genotype with two MC4R alleles comprising the same loss-of-function mutation.

11. The mouse of claim 1 wherein the mouse has a compound heterozygous MC4R genotype with two MC4R alleles comprising a different loss-of-function mutation.

12. The mouse of claim 1 wherein the loss-of-function mutation is a missense mutation.

13. The mouse of claim 1 wherein the loss-of-function mutation is analogous to a human MC4R mutation which is associated with severe obesity.

14. A cell from the mouse of any one of the preceding claims.

15. A mouse comprising a cell having the same genotype of a cell from the mouse of any one of the preceding claims.

16. A progeny mouse of the mouse of any one of the preceding claims.

17. A method comprising producing the mouse of any one of the preceding claims.

18. A method of identifying a compound that can be used to treat obesity, the method comprising providing the mouse of claim 1 , exposing the mouse to a test compound, measuring the weight, food intake or fat mass of the mouse and identifying a compound that reduces the weight, food intake or fat mass of the mouse.

Images