Gene-edited tumor-infiltrating lymphocytes and t cell receptor-engineered t cells, and use thereof in immunotherapy

Abstract

Provided are gene-edited tumor-infiltrating lymphocytes and T cell receptor-engineered T cells, and a use thereof in immunotherapy. By means of knocking out an NR4A1 gene, an NR4A2 gene, and / or an NR4A3 gene in a tumor infiltrating lymphocyte or a T cell receptor-engineered T cell, the proliferation capability and anti-tumor capability of the tumor infiltrating lymphocyte or the T cell receptor-engineered T cell are enhanced.

Description

Genetically edited tumor infiltrating lymphocytes and T cell receptor engineered T cells and their use in immunotherapy

[0001] This application claims priority to Chinese Patent Application No. 202410452437.2, filed on April 15, 2024, and Chinese Patent Application No. 202410855502.6, filed on June 27, 2024. This application incorporates the entirety of the above-mentioned Chinese Patent Applications. TECHNICAL FIELD

[0002] The present application relates to the field of cell therapy, in particular to genetically edited tumor infiltrating lymphocytes and T cell receptor engineered T cells and their use. BACKGROUND

[0003] In the past decade, immunotherapy represented by immune checkpoint inhibitors has revolutionized the treatment of cancer. However, a large proportion of patients do not benefit from immune checkpoint inhibitor therapy, partly due to the lack of tumor-specific effector T cells required for effective response. Adoptive cell transfer (ACT) therapy overcomes this deficiency by infusing a large dose of cell products containing antigen-specific T cells into the patient's body, providing a promising alternative for precision cancer treatment. Different ACT technical solutions represent different cell immunotherapy products, including: chimeric antigen receptor T cell therapy (CAR-T), T cell receptor engineered T cell therapy (TCR-T) and tumor infiltrating lymphocyte therapy (TIL).

[0004] CAR-T cells are modified to express a chimeric antigen receptor against tumor antigens. FDA has approved CAR-T therapy against CD19 or B-cell maturation antigen BCMA for the treatment of hematological tumors and lymphomas, making a major breakthrough in this field. However, the clinical efficacy of CAR-T cells in solid tumors is far less satisfactory, with various obstacles, including the scarcity of available antigens, tumor heterogeneity or tumor immunosuppression, etc.

[0005] TCR-T cell therapy has several advantages over CAR-T. First, TCR-T cell therapy can target more tumor antigens than CAR-T therapy. In fact, due to the intrinsic properties of TCR, TCR-T cells can recognize more antigen epitopes derived from membrane proteins and intracellular proteins and presented by major histocompatibility complex (MHC), while CAR-T cells are limited to targeting cell surface antigens. Second, the epitope density required for TCR-T cell-induced activation is lower than that of classical CAR-T cells, and this increased antigen recognition sensitivity can improve the recognition and killing of tumor cells by TCR-T. Finally, compared with CAR, the lower affinity of TCR for its target may allow each TCR-T cell to "scan" and eliminate multiple tumor cells presenting the targeted antigen.

[0006] Tumor infiltrating lymphocytes (TIL) therapy is a new type of cellular immunotherapy that exerts an anti-tumor effect by ex vivo expansion of infiltrating lymphocytes in tumor tissue and reinfusion. Such lymphocytes are generally obtained through two consecutive stages of culture. First, tumor tissue fragments obtained from patients are cultured using a culture medium containing a high concentration of interleukin-2 (IL-2) to allow T cells to escape from the tumor tissue, thereby obtaining a small amount of Pre-REP TIL. The obtained Pre-REP TIL are then co-cultured with human PBMC feeder cells to promote their massive proliferation through a rapid expansion process (REP), thereby obtaining a sufficient clinical dosage of TIL. Because of their natural homing ability, TIL can infiltrate tumor tissue well and achieve a killing effect on solid tumors.

[0007] Compared with CAR-T and TCR-T, TIL can recognize more tumor antigens at the same time, reduce tumor antigen escape, and effectively overcome the problem of insufficient drug efficacy caused by tumor heterogeneity. In addition, TIL are T cells directly isolated from tumor tissue, and this group of T cells has better homing and tumor infiltration ability. In terms of efficacy and safety, according to current clinical reports, the efficacy of CAR-T against solid tumors is not very significant, and serious adverse events including cytokine release syndrome and neurotoxicity are prone to occur, while the efficacy of TIL against solid tumors is generally good, and there have been no reports of serious adverse events so far. On February 16, 2024, Lifileucel, the world's first TIL cell therapy, was granted accelerated approval by the U.S. Food and Drug Administration (FDA) for the treatment of patients with advanced melanoma who have progressed after PD-1 antibody therapy. Lifileucel is also the first T cell therapy approved for the treatment of solid tumors, which is a milestone.

[0008] However, despite the fact that T cell therapy has become a cancer treatment method with great potential, the physiological characteristics inherent in T cells can limit the effectiveness of such therapy. Among them, T cell exhaustion is a major limitation of T cells to exert anti-tumor efficacy, which is believed to be caused by continuous antigen stimulation and immunosuppressive tumor microenvironment. Exhausted T cells exhibit overexpression of inhibitory receptors, reduced effector cytokine production and impaired cytotoxic killing function, ultimately leading to tumor immune escape. Alleviating exhaustion to maintain T cell effector function and achieve persistent killing of tumors remains a major challenge. Developing new T cell engineering strategies to engineer T cell exhaustion-related pathway genes can ultimately lead to superior clinical outcomes and promote the progress of cancer cell therapy.

[0009] The NR4A orphan nuclear receptor family consists of NR4A1, NR4A2 and NR4A3 genes, is an early gene induced by T cell receptor signaling, and plays an important role in T cell development and immune response. Studies have found that the expression level of NR4A is related to the responsiveness of immunotherapy against tumors and immune cell checkpoints and CAR-T cell therapy to some extent, and exhausted T cells in tumor-infiltrating lymphocytes (TIL) overexpress NR4A receptor genes, accompanied by increased expression of inhibitory receptors such as PD-L1 and TIM3, reduced cytokine expression and reduced cell killing level (Chen J et al. Nature 567: 530-534). Knocking out the NR4A1 gene can partially enhance CD8+ T cell activity (Liu X et al. Nature 567: 525-529). However, there is obvious functional redundancy in different members of the NR4A family in CD8+ T cell exhaustion, and the loss of function of a single NR4A gene is not sufficient to fully improve the exhaustion and anti-tumor activity of tumor-infiltrating lymphocytes. SUMMARY

[0010] The present application takes tumor-infiltrating lymphocytes (TIL) and T cell receptor engineered T cells (TCR-T) as research models, obtains ovarian cancer, kidney cancer TIL and peripheral blood PBMC samples from the tissues of subjects, knocks out NR4A1 and / or NR4A2 and / or NR4A3 genes through in vitro culture and CRISPR-Cas9 technology, and observes that knocking out NR4A1 and / or NR4A2 and / or NR4A3 genes can promote TIL and TCR-T cell proliferation, increase cytokine IFN-γ and granzyme B secretion levels, and reduce cell exhaustion.

[0011] Further, the present application proves that the TIL and TCR-T with knockout of NR4A1 and / or NR4A2 and / or NR4A3 gene have better killing effect on tumor cells in vitro and in vivo through in vitro killing model of tumor cell lines, organoid model and tumor-bearing mouse model, which indicates that the TIL and TCR-T modified by the present application have better anti-tumor activity and anti-tumor persistence in vivo.

[0012] Therefore, the present application aims to disclose a new combination of regulatory target points for TIL and TCR-T, NR4A1 and / or NR4A2 and / or NR4A3 gene. The modified TIL and TCR-T have better proliferation ability and anti-tumor activity, which can well solve the problems of TIL and TCR-T in the process of resisting solid tumors, such as easy exhaustion, difficult persistence, limited efficacy, etc., and provide a better immunotherapy product for the majority of patients.

[0013] Specifically, the present application provides a modified tumor infiltrating lymphocyte or T cell receptor engineered T cell in the first aspect.

[0014] The modified TIL or TCR-T provided by the present application does not contain NR4A1 and / or NR4A2 and / or NR4A3 gene, or the biological function of NR4A1 gene product and / or NR4A2 gene product and / or NR4A3 gene product of the modified TIL or TCR-T is reduced or eliminated.

[0015] The NR4A1 gene is full name nuclear receptor subfamily 4 group A member 1, and the gene ID in human genome is 3164 (NCBI Entrez Gene ID: 3164, updated on March 17, 2024); the NR4A2 gene is full name nuclear receptor subfamily 4 group A member 2, and the gene ID in human genome is 4929 (NCBI Entrez Gene ID: 4929, updated on March 5, 2024); the NR4A3 gene is full name nuclear receptor subfamily 4 group A member 3, and the gene ID in human genome is 8013 (NCBI Entrez Gene ID: 8013, updated on March 5, 2024).

[0016] In some embodiments, the expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 gene or its gene product of the above-mentioned TIL or TCR-T is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100% compared to unmodified or control TIL or TCR-T, respectively.

[0017] In some embodiments, the property of the above-mentioned TIL or TCR-T is improved compared to unmodified or control TIL or TCR-T.

[0018] In some embodiments, the improved property of the above-mentioned TIL or TCR-T comprises one or more selected from the group consisting of: increased TIL or TCR-T cell proliferation ability, increased cytokine secretion ability, increased granzyme secretion ability, increased tumor cell killing ability, increased persistence, decreased exhaustion level, increased tumor spheroid killing ability, increased anti-tumor activity in animals.

[0019] Another aspect of the present application provides a method for preparing the above-mentioned modified TIL or TCR-T, comprising treating NR4A1 and NR4A2 and NR4A3 genes in the TIL or TCR-T with gene editing technology, RNA interference technology, PROTAC technology, antibody or small molecule inhibitor.

[0020] In some embodiments, the gene editing technology comprises CRISPR / Cas technology, transcription activator-like effector nuclease (TALEN) technology, Zinc-finger nuclease (ZFN) technology, single or multiple base mutation, prime editing or site-directed knock-in.

[0021] In some embodiments, wherein the Cas type comprises: Cas9, Cas12a, Cas3, Cas13, Cas14, Cas7, Cas8, Cas10 and Cas11.

[0022] In some embodiments, wherein the Cas9 type comprises: SpCas9, SaCas9, SpCas9-HF, eSpCas9 and xCas9.

[0023] In some preferred embodiments, wherein the NR4A1 and / or NR4A2 and / or NR4A3 gene is disrupted and / or knocked out by the method of CRISPR / Cas.

[0024] In some preferred embodiments, wherein the NR4A1 and / or NR4A2 and / or NR4A3 gene is disrupted and / or knocked out by the method of CRISPR / Cas9.

[0025] In some embodiments, the CRISPR / Cas9 technology comprises introducing into the above-mentioned TIL or TCR-T a CRISPR / Cas9 system containing both a single guide RNA (sgRNA) targeting a gene of interest and a Cas9 nuclease.

[0026] In some embodiments, wherein the sgRNA comprises a sgRNA targeting the NR4A1 gene and a sgRNA targeting the NR4A2 gene and a sgRNA targeting the NR4A3 gene.

[0027] In some embodiments, the CRISPR / Cas9 technology can use a sgRNA targeting the NR4A1 gene and a sgRNA targeting the NR4A2 gene and a sgRNA targeting the NR4A3 gene, respectively or simultaneously.

[0028] The present disclosure provides guide RNAs (gRNAs) that direct a site-directed modification polypeptide to a specific target nucleic acid sequence. The gRNA comprises a nucleic acid targeting segment and a protein binding segment. The nucleic acid targeting segment of the gRNA comprises a sequence of nucleotides that is complementary to a sequence in the target nucleic acid sequence. Thus, the nucleic acid targeting segment of the gRNA interacts with the target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing), and the sequence of nucleotides of the nucleic acid targeting segment determines the location within the target nucleic acid to which the gRNA will bind. The nucleic acid targeting segment of the gRNA can be modified (e.g., by genetic engineering) to hybridize to any desired sequence within the target nucleic acid sequence.

[0029] The protein binding segment of the guide RNA interacts with a site-directed modification polypeptide (e.g., a Cas protein) to form a complex. The guide RNA directs the bound polypeptide to a specific sequence of nucleotides within the target nucleic acid via the nucleic acid targeting segment described above. The protein binding segment of the guide RNA comprises two segments of nucleotides that are complementary to each other and form a double-stranded RNA duplex.

[0030] In some embodiments, the gRNA comprises two separate RNA molecules. In such embodiments, each of the two RNA molecules comprises a segment of nucleotides that are complementary to each other, such that the complementary nucleotides of the two RNA molecules hybridize to form the double-stranded RNA duplex of the protein binding segment. In some embodiments, the gRNA comprises a single-stranded RNA molecule (sgRNA), in which the sequences at the ends of the above-described two RNA molecules that form the complementary region are connected, forming the sgRNA.

[0031] The specificity of the gRNA for the target locus is mediated by the sequence of the nucleic acid binding segment comprising 20 nucleotides that are complementary to a target nucleic acid sequence within the target locus.

[0032] In some embodiments, the present application provides sgRNAs targeting NR4A1 gene, wherein the targeting sequence is TCGGTGCTGGTGTCCCATAT (SEQ ID NO: 1) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO: 1; sgRNAs targeting NR4A2 gene, wherein the targeting sequence is TAGTAAACCGACCCGGAGTG (SEQ ID NO: 2) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO: 2; sgRNAs targeting NR4A3 gene, wherein the targeting sequence is GTATGTCTGCGCCGCATAAC (SEQ ID NO: 3) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO: 3.

[0033] In some embodiments, the Cas9-sgRNA RNP complex or the vector containing Cas9 protein and sgRNA expression elements is introduced into the above-mentioned TIL or TCR-T by chemical transfection, electroporation or vector delivery.

[0034] The above-mentioned vector delivery method includes delivery using a viral vector, a viro-like vector or a non-viral vector, including but not limited to viral vectors based on vaccinia virus, polio virus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloid sarcoma virus and mammary tumor virus), etc. Suitable non-viral vectors are selected from plasmids, transposons, lipid nanoparticles, liposomes, exosomes, attenuated bacteria or virus-like particles.

[0035] In some preferred embodiments, the Cas9-sgRNA RNP complex is introduced into the above-mentioned TIL or TCR-T by electroporation.

[0036] Another aspect of the present application provides a method for producing the above-mentioned modified TIL, comprising the following steps:

[0037] (1) processing a tumor sample obtained from a subject into a plurality of tumor fragments to obtain a TIL population;

[0038] (2) in vitro expansion of the obtained TIL population in a culture medium containing a T cell growth factor, to obtain a Pre-REP TIL population;

[0039] (3) treating the Pre-REP TIL population using the preparation method described in any one of the above embodiments, and co-culturing with trophoblast cells in a culture medium containing a T cell growth factor, so that the expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 gene is reduced or eliminated.

[0040] In some embodiments, the T cell growth factor described above is selected from one or more of IL-2, IL-7, IL-15, IL-21, preferably IL-2.

[0041] In some embodiments, the final concentration of the T cell growth factor described above in step (2) is about 750-6000 IU / mL, preferably 6000 IU / mL.

[0042] In some embodiments, the final concentration of the T cell growth factor described above in step (3) is about 750-6000 IU / mL, preferably 3000 IU / mL.

[0043] In some embodiments, the TIL described above can be used for autologous TIL therapy of a subject.

[0044] Another aspect of the present application provides a method for producing the modified TCR-T described above, comprising the following steps:

[0045] (1) obtaining peripheral blood T cells from a subject;

[0046] (2) performing activation culture in a culture medium containing a T cell growth factor and CD3 / CD28 nanomagnetic bead antibodies, to obtain a CD3+ T cell population;

[0047] (3) treating the CD3+ T cell population using the preparation method described in any one of the above embodiments, and culturing in a culture medium containing a T cell growth factor and TCR-T transduction virus, and then performing TCR positive sorting, to obtain TCR-T with reduced or eliminated expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 gene.

[0048] In some embodiments, the T cell growth factor described above is selected from one or more of IL-2, IL-7, IL-15, IL-21, preferably IL-2.

[0049] In some embodiments, the final concentration of the T cell growth factor described above in step (2) is about 30-6000 IU / mL, preferably 60 IU / mL.

[0050] In some embodiments, the final concentration of the T cell growth factor in step (3) above is about 30-6000 IU / mL, preferably 300 IU / mL.

[0051] In some embodiments, the TCR-T above is used for autologous TCR-T therapy of a subject.

[0052] Another aspect of the present application provides a pharmaceutical composition comprising the TIL or TCR-T of any one of the above embodiments or the TIL or TCR-T treated by the method of any one of the above embodiments and optionally a pharmaceutically acceptable carrier.

[0053] Another aspect of the present application provides the use of the TIL or TCR-T of any one of the above embodiments or the TIL or TCR-T treated by the method of any one of the above embodiments or the pharmaceutical composition above in the preparation of a medicament for preventing and / or treating a tumor.

[0054] In some embodiments, the tumor is a solid tumor.

[0055] In some preferred embodiments, the tumor is selected from one or more of the group consisting of melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer, and kidney cancer.

[0056] Another aspect of the present application provides a method of treating a tumor in a subject in need thereof, the method comprising administering to the subject the TIL or TCR-T of any one of the above embodiments or the TIL or TCR-T treated by the method of any one of the above embodiments or the pharmaceutical composition above.

[0057] In some embodiments, the tumor is a solid tumor.

[0058] In some preferred embodiments, the tumor is selected from one or more of the group consisting of melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer, and kidney cancer.

[0059] Another aspect of the present application provides the use of reducing or eliminating the expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 gene in TIL or TCR-T, which comprises improving the proliferation ability of TIL or TCR-T cells, improving the cytokine secretion ability, improving the granzyme secretion ability, improving the tumor cell killing ability, improving the TIL or TCR-T cell persistence, reducing exhaustion, enhancing the killing of organoids, and enhancing the anti-tumor activity in vivo.

[0060] The experiments of the present application prove that the present application improves the properties of TIL or TCR-T by knocking out the NR4A1 and / or NR4A2 and / or NR4A3 gene of TIL or TCR-T, which has a series of advantages compared with unmodified TIL or TCR-T:

[0061] (1) can promote TIL or TCR-T cell proliferation, reduce TIL or TCR-T exhaustion in vivo, and play a better anti-tumor role;

[0062] (2) can promote TIL or TCR-T cells to secrete more cytokines and granzymes, and have better anti-tumor activity;

[0063] (3) can promote the persistent anti-tumor activity of TIL or TCR-T, reduce tumor recurrence, and overcome the shortcomings of CAR-T therapy in treating solid tumors. BRIEF DESCRIPTION OF DRAWINGS

[0064] Figure 1: Knockout of NR4A1 and NR4A2 and NR4A3 genes promotes TIL proliferation.

[0065] Figure 2: Knockout of NR4A1 and NR4A2 and NR4A3 genes promotes CD8+ TIL proliferation.

[0066] Figure 3: At an effector to target ratio of 10:1, knockout of NR4A1 and NR4A2 and NR4A3 genes promotes TIL killing of P815 cells.

[0067] Figure 4: Knockout of NR4A1 and NR4A2 and NR4A3 genes reduces TIL exhaustion.

[0068] Figure 5: At different effector to target ratios, knockout of NR4A1 and NR4A2 and NR4A3 genes promotes persistent and continuous killing of tumor cells by TIL.

[0069] Figure 6: Knockout of NR4A1 and NR4A2 and NR4A3 genes promotes TIL killing of tumor organoids.

[0070] Figure 7: Killing curve at different effector to target ratios, knockout of NR4A1 and / or NR4A2 and / or NR4A3 genes can promote CD8+ T cell killing of P815 cells.

[0071] Figure 8: Killing fluorescence map at different effector to target ratios, knockout of NR4A1 and / or NR4A2 and / or NR4A3 genes can promote CD8+ T cell killing of P815 cells.

[0072] Figure 9: At different effector to target ratios, knockout of NR4A1 and / or NR4A2 and / or NR4A3 genes promotes CD8+ T cells to secrete interferon gamma.

[0073] Figure 10: NR4A1 and / or NR4A2 and / or NR4A3 gene knockout promotes CD8+ T secreting granzyme B at different effector to target ratios.

[0074] Figure 11: NR4A1 and NR4A2 and NR4A3 gene knockout promotes TCR-T proliferation.

[0075] Figure 12: NR4A1 and NR4A2 and NR4A3 gene knockout promotes TCR-T secreting interferon gamma at different effector to target ratios.

[0076] Figure 13: NR4A1 and NR4A2 and NR4A3 gene knockout promotes TCR-T secreting granzyme B at different effector to target ratios.

[0077] Figure 14: NR4A1 and NR4A2 and NR4A3 gene knockout all promote TCR-T cell killing of SHP-77 tumor cells at different effector to target ratios.

[0078] Figure 15: NR4A1 and NR4A2 and NR4A3 gene knockout all promote TCR-T cell killing of tumor cells in vivo at different doses. DETAILED DESCRIPTION

[0079] While this application can be implemented in many different forms, there is provided here, in part, a specific, illustrative embodiment thereof demonstrating the principles of the application. It should be emphasized that the present application is not limited to the specifically illustrated embodiment. Moreover, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0080] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. More specifically, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. In this application, the term "or" means "and / or" unless stated otherwise. Furthermore, use of the term "including" as well as other forms such as "include", "includes," and "included" is not limiting. Also, ranges are used herein to include endpoints and all values between the endpoints.

[0081] Generally, the terminology and techniques associated with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. The methods and techniques of the present application are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited throughout the present specification unless otherwise indicated. See, e.g., Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); Abbas et al., Cellular and Molecular Immunology, 6th ed., W.B. Saunders Company (2010); Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1998); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). The terminology and laboratory procedures and techniques associated with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are well and commonly used in the art. In addition, the use of any of the following terms in the present specification is intended to be interpreted as being inclusive of the meanings of the referenced terms.

[0082] Definitions

[0083] For better understanding of the present application, definitions and explanations of relevant terms are provided as follows.

[0084] As used herein, the term "tumor infiltrating lymphocytes" or "TILs" refers to a population of cells originally obtained as white blood cells that have left the bloodstream of a subject and migrated to a tumor. TILs include, but are not limited to, CD8+ cytotoxic T cells (lymphocytes), Thl and Thl7 CD4+ T cells, natural killer cells, dendritic cells, and Ml macrophages. TILs include primary TILs and secondary TILs. "Primary TILs" are those obtained from a patient tissue sample (sometimes referred to as "freshly harvested"), and "secondary TILs" are any population of TIL cells that have been expanded or proliferated, including, but not limited to, bulk TILs and expanded TILs ("pre-REP TILs" or "REP TILs" or "post-REP TILs"). A population of TIL cells can include genetically modified TILs.

[0085] As used herein, the term "T cell receptor engineered T cell" or "TCR-T" refers to a T cell isolated from a subject that, after genetic engineering, can express a T cell receptor that recognizes a specific antigen and a specific human leukocyte antigen (HLA) combination independently of its native TCR and its expanded cell population. Further, a TCR-T can include a genetically modified TCR-T.

[0086] As used herein, the term "NR4A1" refers to the encoded gene or protein product of the nuclear receptor subfamily 4 group A member 1. The gene protein product functions as a transcription factor involved in the regulation of T cell activation and differentiation in a ligand-independent manner, playing a key role in the adaptive immune response. The NCBI Entrez Gene ID for NR4A1 is 3164. In the present invention, NR4A1 can encompass unprocessed NR4A1, any form of processed NR4A1, variants of NR4A1, or substances comprising functionally active fragments of NR4A1.

[0087] As used herein, the term "NR4A2" refers to the encoded gene or protein product of the nuclear receptor subfamily 4 group A member 2. The gene protein product functions as a transcription factor involved in the regulation of T cell activation and differentiation in a ligand-independent manner, playing a key role in the adaptive immune response. The NCBI Entrez Gene ID for NR4A2 is 4929. In the present invention, NR4A2 can encompass unprocessed NR4A2, any form of processed NR4A2, variants of NR4A2, or substances comprising functionally active fragments of NR4A2.

[0088] As used herein, the term "NR4A3" refers to the coding gene or protein product of the Orphan Nuclear Receptor Subfamily 4 Group A Member 3. The gene protein product is involved in the regulation of T cell activation and differentiation as a transcription factor in a ligand-independent manner, playing a key role in the adaptive immune response. The NCBI Entrez Gene number for NR4A3 is 8013. In the present invention, NR4A3 can encompass unprocessed NR4A3, any form of processed NR4A3, variants of NR4A3, or substances comprising functionally active fragments of NR4A3.

[0089] As used herein, the term "TIL properties" refers to properties of TIL cells that are improved after the TIL cells are modified by the manufacturing method of the present invention. Changes in TIL properties can include: increased TIL proliferation capacity, increased TIL cell number, increased survival capacity, improved T cell subpopulation ratio, increased cytokine secretion capacity, increased granzyme secretion capacity, increased tumor cell killing capacity, decreased level of cell exhaustion, or any combination thereof. Changes in the present invention can be increases or decreases.

[0090] As used herein, the term "CAR-T" refers to chimeric antigen receptor T cells or chimeric antigen receptor T cell therapy.

[0091] As used herein, the terms "peripheral blood mononuclear cells" and "PBMCs" refer to peripheral blood cells with round cell nuclei, including lymphocytes (T cells, B cells, NK cells) and monocytes. Preferably, the peripheral blood mononuclear cells are irradiated allogeneic peripheral blood mononuclear cells. PBMCs are a type of antigen presenting cell.

[0092] As used herein, the terms "RNA interference" or "RNAi" refer to the RNA-dependent silencing of gene expression initiated by double-stranded RNA (dsRNA) molecules in the cytoplasm of a cell. The dsRNA molecules reduce or inhibit the accumulation of the transcript of the target nucleic acid sequence, thereby silencing the gene or reducing the expression of the gene.

[0093] As used herein, the term "ZFN", i.e. Zinc-finger nucleases, is composed of a DNA recognition domain and a non-specific endonuclease. The DNA recognition domain is composed of a series of Cys2-His2 zinc-finger proteins (usually 3-4) in series, each of which recognizes and binds to a specific triplet base. Researchers can target different DNA sequences by processing the zinc finger DNA binding domain of ZFN, so that ZFN can bind to the target sequence in the complex genome and be specifically cut by the DNA cleavage domain. In addition, by combining zinc finger nuclease technology and intracellular DNA repair mechanisms, researchers can also freely edit the genome in vivo. At present, in a large number of plants, fruit flies, zebrafish, frogs, mice and other species, ZFN technology has been widely used in targeted gene mutation, and by artificially modifying the genomic information, new species with modified genetic background can be generated. This technology has very important value in the field of medicine and has potential significance for gene therapy of diseases, and has very wide application prospect.

[0094] As used herein, the term "TALEN" refers to Transcription activator-like effector nucleases, a new gene editing tool. TALE proteins are natural proteins derived from a plant pathogen, Xanthomonas, which also contains a DNA binding domain. The DNA binding domain in TALE proteins is composed of a series of 33-35 amino acid repeat domains, each of which can recognize a base. The DNA binding specificity of TALE nucleases is mainly determined by two highly variable amino acids, which scientists call repeat-variable di-residues (RVD) sites. Like zinc finger domains, this TALE repeat module can also be concatenated to recognize a long string of DNA sequences. However, cloning such a large TALE protein DNA sequence recognition domain repeat coding sequence is also a big challenge. To solve this problem, scientists have come up with a number of ways to quickly assemble TALE protein DNA sequence recognition domains in any combination. There are several large-scale, systematic research projects using various assembly strategies to show that TALE repeat recognition modules can be assembled to recognize any DNA sequence. Since the invention of TALEN technology in 2010, multiple research groups around the world have used in vitro cultured cells, yeast, Arabidopsis, rice, fruit flies, and zebrafish to verify the specific cleavage activity of TALEN.

[0095] As used herein, the term "CRISPR" is a bacterial immune system that has been modified by scientists in recent years to become the hottest gene editing tool. The CRISPR (Clusters of Regularly Interspaced Short Palindromic Repeats) technology was discovered in 2012 by scientists at MIT and the University of California, Berkeley, and is an RNA sequence-mediated double-stranded DNA endonuclease tool. It consists of two parts, one of which is an sgRNA of about 100 bp, which is used for targeted recognition of the double-stranded DNA of interest, and the other is a Cas9 protein of 1369 amino acids, which can bind to sgRNA and has DNAse activity. The complex of artificially designed sgRNA and Cas9 protein can specifically cut the DNA of interest. When the cut causes mismatch repair, it causes frameshift and knockout of the target. When a repair DNA sequence is added, it will be edited as desired.

[0096] Preferably, the NR4A1 and NR4A2 and NR4A3 genes are obtained by knockout via TALEN, ZFN, RNAi or CRISPR / Cas gene editing system, wherein the CRISPR / Cas gene editing system comprises CRISPR / Cas9, CRISPR / Cas12a, CRISPR / Cas13 and CRISPR / Cas14. In an embodiment of the present application, the CRISPR / Cas9 system is used to successfully obtain TIL or TCR-T cells with knockout of NR4A1 and NR4A2 and NR4A3 genes, which has the advantages of being safer and more reliable compared to the prior art. Similarly, other gene editing technologies including TALEN, ZFN, RNAi also have their advantages, and the knockout of NR4A1 and NR4A2 and NR4A3 genes in immune cells can also be performed by such gene editing methods. As for the CRISPR / Cas gene editing system, in addition to CRISPR / Cas9, similar CRISPR / Cas12a, CRISPR / Cas13 and CRISPR / Cas14 can also be used for gene editing to knockout NR4A1 and NR4A2 and NR4A3 genes.

[0097] As used herein, the term "sgRNA", i.e. single guide RNA, is used in CRISPR-Cas9 technology to anchor the targeting DNA.

[0098] In some embodiments, the sgRNA design follows the principle of PAM sequence being NGG, close to the CDS region, and is designed using software such as http: / / crispr.mit.edu, http: / / zifit.partners.org / ZiFiT / , etc. In some embodiments, the chemically modified sgRNA has (i) methylation modification; (ii) methylation modification with phosphorylation modification; (iii) other modifications capable of stabilizing the sgRNA in the first 1-10 bases (such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases) of the head and tail. The synthetic modified sgRNA is provided by professional suppliers.

[0099] As used herein, the term "RNP" refers to a Cas9:sgRNA ribonucleoprotein (RNP) complex. The RNP method is to form an RNP complex of Cas9 protein and sgRNA in vitro, and then to deliver the RNP into T cells by electroporation. The advantages are: high knockout efficiency, low off-target rate (the Cas9 protein and sgRNA will be completely degraded by T cells within 24 hours). The disadvantage is: it is difficult to obtain absolutely endotoxin-free Cas9 protein, and the requirements for reagents and instruments are relatively high.

[0100] In some embodiments, the Cas9-sgRNA RNP complex is introduced into the activated TIL or TCR-T cells 2-5 days after TIL or TCR-T cell activation using electroporation.

[0101] As used herein, "CD4+ cell" refers to a cell that is positive for CD4, which can be, for example, a T cell. The terms "CD4+ cell", "CD4 positive cell" can be used synonymously. These cells can be identified by methods known in the art, for example, by staining the cells with a fluorescently labeled antibody against CD4 and using fluorescence activated cell sorting.

[0102] As used herein, "CD8+ cell" refers to a cell that is positive for CD8, which can be, for example, a T cell. The terms "CD8+ cell", "CD8 positive cell" can be used synonymously. These cells can be identified by methods known in the art, for example, by staining the cells with a fluorescently labeled antibody against CD8 and using fluorescence activated cell sorting.

[0103] As used herein, the term "solid tumor" refers to an abnormal mass of tissue that typically does not contain cysts or fluid areas. A solid tumor can be benign or malignant. The term solid tumor cancer refers to a malignant, neoplastic, or cancerous solid tumor. Solid tumor cancers include, but are not limited to, melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer, and renal cancer. The tissue structure of a solid tumor includes interdependent tissue compartments, including parenchyma (cancer cells) and supportive stromal cells (microenvironment in which cancer cells are dispersed and can provide support).

[0104] As used herein, the term "effective amount" or "therapeutically effective amount" refers to the amount of a compound or combination of compounds as described herein sufficient to achieve the intended application, including but not limited to the treatment of a disease. The therapeutically effective amount can vary depending on the intended application (in vitro or in vivo) or the subject and disease condition being treated (e.g., the subject's body mass, age, and sex), the severity of the disease condition, or the mode of administration. The term also applies to a dose that will induce a particular response in target cells (e.g., a reduction in platelet adhesion and / or cell migration). The specific dose will depend on the particular compound chosen, the dosing regimen to be followed, whether the compound is to be administered in combination with other compounds, the timing of administration, the tissue to which it is administered, and the physical delivery system carrying the compound.

[0105] As used herein, the terms "treatment," "treating," "treat" and the like, refer to obtaining a desired pharmacologic and / or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or can be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. "Treatment" as used herein, covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in an individual which can be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development or progression; and (c) relieving the disease, i.e., causing regression of the disease and / or alleviating one or more symptoms of the disease. "Treatment" is also meant to include delivering a pharmaceutical agent to provide a pharmacological effect, even in the absence of a disease or condition. For example, "treatment" includes delivering a composition that can elicit an immune response or confer immunity in the absence of a disease, such as in the case of a vaccine.

[0106] As used herein, the term "subject" can be a human or non-human animal, preferably a human, suffering from, for example, cancer.

[0107] As used herein, the term "autologous" refers to any material, e.g., TILs, derived from the same individual that is later reintroduced into that individual, e.g., during therapy.

[0108] As used herein, the term "pharmaceutical composition" refers to a preparation, which is a product that results from the combination of active ingredients with pharmaceutical carrier materials and / or additionally with other ingredients. The preparation of the present application can permit the bioactive effectiveness of the active ingredients and can not contain additional components that are not acceptable as being toxic to the subject to which the preparation will be administered. Such preparations are sterile. "Pharmaceutically acceptable" excipients (carriers, additives) are those that are, at the time of administration, reasonably safe for use in the subject to provide an effective dose of the active ingredients used.

[0109] As used herein, the term "pharmaceutically acceptable" refers to a vehicle, diluent, excipient and / or salt thereof that is chemically and / or physically compatible with the other ingredients in the formulation and is physiologically compatible with the recipient.

[0110] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and inert ingredients in the pharmaceutical art (see, for example, Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th Edition, Pennsylvania: Mack Publishing Company, 1995). The use of such a pharmaceutically acceptable carrier or pharmaceutically acceptable excipient is well known in the art. Except insofar as any conventional pharmaceutically acceptable carrier or pharmaceutically acceptable excipient is incompatible with the active pharmaceutical ingredient, its use in the therapeutic compositions of the present application is contemplated. Other active pharmaceutical ingredients (e.g., other drugs) can also be incorporated into the compositions and methods.

[0111] Examples

[0112] The present application generally described herein will be more readily understood by reference to the following examples, which are provided to exemplify the present application and are not intended to limit the application. The examples are not intended to represent that the experiments below are all or only experiments performed.

[0113] The experimental methods used in the following examples are conventional unless otherwise stated; the materials, reagents, etc. used are commercially available unless otherwise stated.

[0114] Example 1: Preparation of tumor infiltrating lymphocytes (TIL) with knock-out of NR4A1 and / or NR4A2 and / or NR4A3 gene

[0115] Culture medium preparation

[0116] 50 mL cell culture medium was prepared with the following ingredients:

[0117] Table 1: Medium ingredients

[0118] Cryopreservation medium: 75% CS10 cell cryopreservation solution (Biolife solutions, 210102), 2% human serum albumin (Switzerland Jet Bernin, S20170005), 100 IU / mL recombinant human interleukin-2 injection (Shuanglu Pharmaceutical, S20040008), normal saline.

[0119] Isolation and expansion of TIL

[0120] 1. Isolation of tumor tissue from subjects; tissue derived from Shanghai Renji Hospital or Shanghai First Hospital.

[0121] 2. Wash tumor tissue with PBS, then cut tumor tissue into 3x3x3 mm tissue pieces with sterile scissors and place in 6-well plates with appropriate amount of BCM-60 medium, 5 pieces per well. 3

[0122] 3. Obtain Pre-REP TIL after 14 days of continuous culture, and store in cryopreservation medium.

[0123] Recovery of Pre-REP TIL

[0124] 1. Thaw Pre-REP TIL cells stored in cryopreservation medium, and resuspend in 8 ml BCM-0 medium after thawing in a 37°C water bath.

[0125] 2. Centrifuge at 500xg for 5 min, discard supernatant containing CS10 cryopreservation solution; add about 10 ml BCM-2 medium according to the number of cells marked on the cryopreservation tube, resuspend in a centrifuge tube at a density of about 1x10 7 cells / mL, count and record the number of cells and viability by AO / PI.

[0126] 3. Dilute the remaining cells to a density of about 2x10 6 cells / mL using BCM-2 medium, and inoculate into a T75 culture flask, and incubate overnight at 37°C in a 5% CO2 cell incubator.

[0127] CD8+ sorting

[0128] If CD8+ sorting is required, CytoSinct TM CD8 Nanobeads, human (Miltenyi, L00864) can be used to positively sort CD8+ from TIL cells after recovering Pre-REP TIL.

[0129] Knockout of NR4A1 and / or NR4A2 and / or NR4A3 gene in TIL cells

[0130] 1. Take out the recovered cells, centrifuge at 450xg for 10 min, then wash once with DPBS, discard the supernatant, and resuspend the cells with Lonza P3 electroporation buffer.

[0131] 2. Lonza P3 electroporation buffer is prepared fresh, and Nucleofector TM solution is mixed with Supplement at a ratio of 4.5:1.​

[0132] 3. Simultaneous formulation of RNP complex (single system): In a sterile, DNase / RNase Free centrifuge tube, add the following reagents in order: 5 μΐ mixed Lonza P3 electroporation buffer, 180 pmol sgRNA, 60 pmol Cas9 protein (Thermofisher, A36499), mix well, and incubate at room temperature for 10 minutes to form the RNP complex.

[0133] 4. Carefully remove the cell suspension (resuspended with Lonza P3 electroporation buffer, make sure the total volume of the single reaction is 20 μΐ), add the RNP complex to the centrifuge tube, and mix gently. Transfer the mixed solution to the 16-well Nucleocuvette TM electroporation strip. Note that the mixture should be mixed well when added, and no bubbles should be generated during the entire process. The liquid surface should be smooth.

[0134] 5. The electroporation program is EH-115. Immediately after electroporation, add 80 μΐ of preheated BCM-0 medium (without cytokines) to each well, without mixing, and place the cells in the electroporation strip in a 37 °C / 5% CO2 incubator for 0.5-1 hour. (Note: The incubation time can be adjusted to 1-2 hours, which can improve cell viability to some extent)

[0135] 6. Resuspend the cells in the electroporation strip with 200 μΐ of BCM-2 medium, and place them in a 24-well plate, respectively. Add PBS to the extra blank wells to prevent cell medium evaporation. (Note: The incubation time must not exceed 2 hours, otherwise the toxicity of the electroporation buffer will harm the cells)

[0136] 7. After incubation, transfer the cells to a prepared 24-well plate containing 1500 μΐ of preheated BCM-2 medium, and place it in an incubator for culture. The cell density is 1-2 x 10 6 cells / ml.

[0137] Preparation of feeder cells

[0138] 1. Take three 3-mL aliquots of feeder cells from each of the three donors, and quickly thaw them in a 37 °C water bath.

[0139] 2. Transfer the three aliquots of feeder cells to three 15-mL centrifuge tubes, respectively, and resuspend them with 9 mL of BCM-0 medium. Centrifuge at 500 x g for 5 minutes, discard the supernatant, resuspend with 10 mL of BCM-0 medium, mix well, and count the cells.

[0140] 3. Mix the three types of feeder cells at a ratio of 1:1:1, and resuspend them with 2 x 10 7cells / ml density resuspended with BCM-2, 500ul cell suspension (1x10 7 cells / well) in each well.

[0141] 4. The remaining feeder cells were inoculated in BCM-2 medium for continuous culture, and the blank control group was continuously photographed, counted, counted, and observed. Generally, the blank control group should start to die in large numbers before and after Day 5, and eventually all die, which is used as a QC observation index for feeder cells.

[0142] Harvest and identify TIL cells with NR4A1 and / or NR4A2 and / or NR4A3 gene knockout

[0143] 1. D3 collected D1 electroporated Pre-TIL cells, centrifuged at 500xg for 5min, resuspended in BCM-2 medium, counted with AO / PI, and adjusted the density to 1x10 5 cells / ml; according to the experimental design, 0.5ml cell suspension (5x10 4 cells) was added to the 48-well plate with counted feeder cells prepared in D2, gently blown and sucked to mix, and placed in a 37℃, 5% CO2 incubator for static culture.

[0144] 2. BCM-3 medium was used during expansion from D4 to D16. During the early stage of the REP phase, i.e. D4-D9, the operation was minimized, BCM-3 half-replacement was performed on D6, 1-1.5mL fresh medium was supplemented on D7, and after D9, the cells were expanded every 2-3 days. The cells were resuspended, and the cell density and cell viability were recorded with AO / PI. The culture system was adjusted to ensure the viable cell density at (1-3)x10 6 cells / mL. The excess cells were frozen at the end point.

[0145] 3. At the end of the culture, more than 1x10 6 cells were extracted for genomic PCR, and then one-generation sequencing was performed to detect the gene knockout efficiency. The sequencing experiment was completed by Jinweizhi or Jin Sui Biological Technology Co., Ltd.

[0146] The gene knockout results are shown in Table 3, and N1 / N2 / N3 TKO TIL represents NR4A1 and NR4A2 and NR4A3 triple gene knockout TIL cells. The sgRNA shown in the present application has good knockout efficiency in TIL cells.

[0147] Table 2: sgRNA sequences used in this example

[0148] Table 3: Knockout efficiency of gene editing in this example

[0149] Example 2: Knockout of NR4A1 and NR4A2 and NR4A3 genes promotes TIL proliferation

[0150] After the TILs prepared in Example 1 were mixed with trophoblast cells in BCM-2 medium and incubated for 4 days, the TILs were subjected to rapid expansion in BCM-3 medium. After 9 days, the culture reached the end point. During this period, the cell density and cell viability were recorded every other day by resuspending the cells, and the culture system was adjusted according to the cell density to ensure that the viable cell density was (1-3) x 10 6 cells / mL. The cell expansion ratio during rapid expansion was recorded.

[0151] The results of cell expansion ratio during rapid expansion are shown in Figure 1, where Ctrl represents control TILs without knockout. N1 / N2 / N3 represents TILs with knockout of NR4A1 and NR4A2 and NR4A3 genes. It can be seen that the number of TIL cell expansion with knockout of NR4A1 and NR4A2 and NR4A3 genes is higher than that of the control group, indicating that knockout of NR4A1 and NR4A2 and NR4A3 genes can promote TIL proliferation.

[0152] The results of CD8+ TIL cell expansion after CD8+ sorting are shown in Figure 2, where Ctrl represents control CD8+ TILs without knockout. N1 / N2 / N3 represents CD8+ TILs with knockout of NR4A1 and NR4A2 and NR4A3 genes. The proliferation curve shows that the number of CD8+ TIL cell expansion with knockout of NR4A1 and NR4A2 and NR4A3 genes is higher than that of the control CD8+ TILs. The use of flow cytometry antibody anti-Ki67-FITC (BD, 556026) staining to characterize cell proliferation also showed the same trend as the proliferation curve.

[0153] In summary, knockout of NR4A1 and NR4A2 and NR4A3 genes promotes TIL proliferation, especially in CD8+ TILs.

[0154] Example 3: Knockout of NR4A1 and NR4A2 and NR4A3 genes can promote TIL killing function on P815 cells

[0155] P815 cell killing co-culture and ELISA detection

[0156] 1. Prepare experimental and control TILs according to the method in Example 1, and detect the killing ability on P815 cells at the end point of REP. In each well of a 96-well plate, inoculate 10000 P815-GFP cells with a density of about 1 x 10 5cells / ml (at least 2x10 6 The medium was 100 μl (DMEM + 10% FBS).

[0157] 2. After the cells adhered (4-6h), the supernatant was discarded by centrifugation, and 100 μl of BCM-0 medium containing 0.5 μg / ml anti-CD3 (OKT3) was added, and the control experiment did not contain OKT3. The TIL cells after gene knockout were inoculated according to different E:T ratios (40:1, 20:1, 10:1), and after 20 min at room temperature, they were placed in the Incucyte device, and the green fluorescence signal was collected every 3 h, and the data were monitored for 72 h. The data were analyzed and counted using the Incucyte Basic analysis analysis module. The supernatant was collected at the appropriate time point and frozen for ELISA detection of killing factors. The groups were set as follows:

[0158] 1. Control group Ctrl: TIL cells without gene knockout;

[0159] 2. Control group N1: NR4A1 single gene knockout TIL cells;

[0160] 3. Control group N2: NR4A2 single gene knockout TIL cells;

[0161] 4. Control group N3: NR4A3 single gene knockout TIL cells;

[0162] 5. Control group PD1: PD-1 single gene knockout TIL cells;

[0163] 6. Control group N1 / PD1: NR4A1 / PD-1 double gene knockout TIL cells;

[0164] 7. Control group N2 / PD1: NR4A2 / PD-1 double gene knockout TIL cells;

[0165] 8. Control group N3 / PD1: NR4A3 / PD-1 double gene knockout TIL cells;

[0166] 9. Experimental group N1 / N2 / N3: NR4A1 / NR4A2 / NR4A3 triple gene knockout TIL cells.

[0167] Figure 3 shows the results of the comparison of killing 3h at the effector target ratio E:T = 10:1. In this experiment, the killing effect of TIL was strong, and the killing was completed in a short time of 3-6h. Normalization of the killing curve showed that the killing ability N1 / N2 / N3 > N1 / PD1 > N1=N2 > N2 / PD1 > Ctrl. It is shown that NR4A1 and NR4A2 and NR4A3 triple gene knockout can promote the killing of P815 cells by TIL.

[0168] Example 4: Knockout of NR4A1 and NR4A2 and NR4A3 genes can reduce the exhaustion of TIL cells

[0169] The TIL preparation method refers to Example 1.

[0170] The CD3 TIL (ovarian cancer) obtained after the end of Pre-REP was directly subjected to gene editing and subsequent REP expansion. After the end of expansion, the TILs of the control group and the gene editing group were transferred to BCM-0 medium without IL-2 for continuous culture for three days or more, and the sample cultured for 72 h was detected for the expression levels of TIM3 and Lag3 by flow cytometry.

[0171] The CD3 TIL (non-small cell lung cancer) obtained after the end of Pre-REP was then subjected to gene editing and subsequent REP expansion after magnetic bead purification to obtain CD8 TIL. The samples of REP 14 days and 16 days were taken during the expansion process for flow cytometry detection of the expression levels of TIM3 and PD1.

[0172] The results are shown in Figure 4. Compared with the unedited control TIL, knockout of NR4A1 and NR4A2 and NR4A3 genes significantly reduced the degree of exhaustion of CD3 TIL (Figure 4A) and CD8 TIL (Figure 4B).

[0173] Example 5: Knockout of NR4A1 and NR4A2 and NR4A3 genes can promote the persistent and continuous killing of TIL to tumor cells

[0174] The TIL preparation method refers to Example 1.

[0175] The prepared TIL was co-cultured with the ovarian cancer cell line GFP-OVCAR3 for more than 7 days at different effector-target ratios, and the same number of target cells was supplemented for re-stimulation at 45 hours and 117 hours for the 20:1 group, respectively. The killing effect of TIL cells on target cells was reflected by monitoring the green fluorescent area by incucyte instrument.

[0176] The prepared TIL was co-cultured with the engineered cell line GFP-P815 for more than 7 days at different effector-target ratios, and the same number of target cells was supplemented for re-stimulation at 45 hours, 69 hours, 93 hours, 117 hours, and 141 hours for the 20:1 group and the 10:1 group, respectively. The killing effect of TIL cells on target cells was reflected by monitoring the green fluorescent area by incucyte instrument.

[0177] Results are shown in Figure 5 that NR4A1 and NR4A2 and NR4A3 gene knockout significantly enhanced the sustained killing ability of TIL to tumor target cells compared with unedited control TIL at different effector target ratios.

[0178] Example 6: Knockout of NR4A1 and NR4A2 and NR4A3 genes can promote TIL killing of tumor organoids

[0179] Renal cancer CD3 TILs were prepared according to the method of Example 1 for organoid killing experiments. The specific method is as follows:

[0180] TIL culture (directly for co-culture experiment after resuscitation)

[0181] For fresh TIL cells: the obtained TIL was centrifuged at 1200 rpm at room temperature for 5 min, and after centrifugation, cell counting was performed, the number of TIL cells and the viability were recorded, the cells were resuspended with TIL BCM-60 complete medium, and the cell concentration was adjusted to 1 x 10 6 cells / mL, 70 μm screen filter, count, start co-culture;

[0182] For frozen TIL cells: resuscitation, 1200 rpm, 5 min at room temperature, after centrifugation, cell counting was performed, the number of TIL cells and the viability were recorded, the cells were resuspended with TIL BCM-60 complete medium, and the cell concentration was adjusted to 1 x 10 6 cells / mL, 70 μm screen filter, count, start co-culture.

[0183] Immune co-culture

[0184] (1) Organoids (PDO) were removed from the glue, 10 μM Y-27632, 200 ng / mL IFN-γ were added, and the suspension culture was performed overnight.

[0185] (2) CD28 plate coating: 250 μg / well CD28 coating, 37°C incubation for 1 h.

[0186] (3) Collect PDO, TIL pass through 70 μm screen, PDO:TIL cells are inoculated in CD28 coated wells according to the target ratio, and suspension culture for 24 h.

[0187] Multidimensional detection after immune co-culture (bright field photography and fluorescence detection experiment)

[0188] (1) Co-culture experiment grouping (3 replicate wells) is as follows: different effector target ratios are set as follows: 5:1, 10:1, 20:1, 40:1.

[0189] (2) Fluorescent markers: Cell Tracer (Thermo Fisher Scientific) labels organoids (blue), and TIL cells (green); Cytotox (Sartorius) labels dead cells (red).

[0190] (3) Detection time point: Brightfield and fluorescent (DAPI, RFP, GFP) pictures were taken using Cytation 5 (BioTek) at 10x, whole well scan, Z-stack after 72 hours of co-culture.

[0191] The results are shown in Figure 6. The killing rate of NR4A1 and NR4A2 and NR4A3 gene knockout TILs on primary tumor organoids is higher than that of the unedited control group, indicating that knockout of NR4A1 and NR4A2 and NR4A3 genes can promote the killing function of TILs on primary tumor organoids.

[0192] Example 7: Preparation of CD8+T cells with NR4A1 and / or NR4A2 and / or NR4A3 gene knockout

[0193] Culture medium preparation

[0194] The culture medium components are the same as those in Table 1 of Example 1.

[0195] Recovery and activation of CD8+T cells

[0196] 1. Prepare BCM-60 cell culture medium 20 min in advance and place it in a room temperature biosafety cabinet for full warming. Take the CD8+human primary T cell frozen tube from the liquid nitrogen tank and place it in the liquid nitrogen to be transferred to the cell room through the cell room transfer bin. Place the frozen tube in a 37°C water bath, gently shake it, and take it out when only a small piece of ice is left. Spray the outside with 75% alcohol, wipe it dry with a dust-free paper, and place it in a biosafety cabinet.

[0197] 2. Transfer the cells to 8 ml of BCM-0 cell culture medium and mix gently. Transfer to a centrifuge and centrifuge at 450xg at room temperature for 10 min. After centrifugation, slowly discard the supernatant and resuspend the cells with 10 ml of BCM-60 medium. Take 10 μl of cell suspension and 10 μl of AO / PI and mix, then take 20 μl of the mixture and add it to the cell counting plate, and count the number of cells (concentration and viability) with a counting instrument.

[0198] 3. Activation can be performed immediately after cell recovery. According to the number of viable cells, adjust the cell density to 1x10 6cells / ml, medium is BCM-60 cell culture medium containing 60 IU / mL IL2. Add 5 μΐ of Kingsford CD3 / CD28 nanomagnetic beads antibody (Enceed™ T cell Activation, human, 1:200 dilute) to each 1 ml cell suspension. Activate in 37 °C incubator for 3 days.

[0199] Knockout of NR4A1 and / or NR4A2 and / or NR4A3 gene

[0200] 1. Take out the activated cells, centrifuge at 450 x g for 10 min, then wash once with DPBS, discard the supernatant, and resuspend the cells with Lonza P3 electroporation buffer.

[0201] 2. Prepare Lonza P3 electroporation buffer immediately before use. Add 1 ml of Nucleofector TM and Supplement according to a ratio of 4.5: 1, and mix well.

[0202] 3. Prepare the RNP complex (single system) at the same time: add the following reagents in the order shown below to a sterile, DNase / RNase Free centrifuge tube: 5 μΐ of mixed Lonza P3 electroporation buffer, 180 pmol sgRNA, 60 pmol Cas9 protein, mix well, and incubate at room temperature for 10 minutes to form the RNP complex.

[0203] 4. Carefully take out the cell suspension (resuspend with Lonza P3 electroporation buffer, and make sure that the total volume of the single reaction system is 20 μΐ), add it to the system containing the RNP complex, and mix gently. Transfer the mixed solution to the 16-well Nucleocuvette TM strip of the electroporation plate. Make sure to mix well when adding, and do not generate any bubbles during the entire process, and make sure that the liquid surface is smooth.

[0204] 5. The electroporation program is EH-115. Immediately take out the cells after electroporation, and add 80 μΐ of preheated BCM-0 medium (without cytokines) to each well, without mixing, and let the cells stand in the electroporation strip, and then send them to a 37 °C / 5% CO2 incubator for 0.5-1 hour. (Note: The incubation time can be appropriately adjusted to 1-2 hours, which can improve the cell viability to a certain extent)

[0205] 6. Resuspend the cells in each well of the electroporation strip with 200 μΐ of BCM-60 medium, and then place them in a 24-well plate, respectively. Add PBS to the blank wells to prevent the evaporation of the cell medium. (Note: The incubation time must not exceed 2 h, otherwise the toxicity of the electroporation buffer will cause damage to the cells.)

[0206] 7. After completion of incubation, the cells were transferred to a prepared 24-well plate containing 1500 μl of preheated BCM-60 cell culture medium (containing 60 IU / ml of IL-2) and placed in an incubator for culture, with a cell density of (1-2) x 10 6 cells / ml.

[0207] Gene knockout efficiency was detected by one-generation sequencing. The results are shown in Table 4, N1 / N2 / N3 TKO CD8+T represents NR4A1 and NR4A2 and NR4A3 triple gene knockout CD8+T cells. The sgRNA shown in the present application has good knockout efficiency in CD8+T cells.

[0208] Table 4: Gene editing knockout efficiency of the present embodiment

[0209] Example 8: Knockout of NR4A1 and / or NR4A2 and / or NR4A3 gene can promote the killing ability of CD8+T cells to P815 cells

[0210] P815-GFP killing co-culture was performed 3 days after electroporation of CD8+T cells according to the method shown in Example 7. 50000 P815-GFP cells were inoculated in each well of a 96-well flat-bottom plate, with a density of about 5 x 10 5 cells / ml (at least 2 x 10 6 cells of total target cells). The culture medium was 100 μl (DMEM + 10% FBS).

[0211] After the cells adhered (overnight), the supernatant was centrifuged and discarded, and BCM-0 medium containing 0.5 μg / ml anti-CD3 (OKT3) was added, and the control experiment did not contain OKT3. CD8+T cells after gene knockout were added according to different E:T ratios (2.5:1, 0.5:1, 0.1:1), and after 20 min at room temperature, they were placed in an Incucyte device, and green fluorescence signals were collected every 6 h, and the data were monitored for 90 h, and the data were analyzed and counted using the Incucyte Basic analysis analysis module. The target cells were observed and added as needed, and the total volume of T cell culture medium was 200 μl per well, and the supernatant was collected at different time points and frozen for ELISA detection of killing factors. The groups were set as follows:

[0212] 1. Control group Ctrl: CD8+T cells without gene knockout;

[0213] 2. Control group N1N2: NR4A1 / NR4A2 double gene knockout CD8+T cells;

[0214] 3. Control group N1N3: NR4A1 / NR4A3 double gene knockout CD8+ T cells;

[0215] 4. Control group N2N3: NR4A2 / NR4A3 double gene knockout CD8+ T cells;

[0216] 5. Experimental group N1N2N3: NR4A1 / NR4A2 / NR4A3 triple gene knockout CD8+ T cells.

[0217] The P815 cell co-culture killing results were analyzed. At the low-efficiency target ratio (E:T = 0.1:1) killing endpoint, it can be seen from the Total Area killing curve (Figure 7) and the fluorescence chart (Figure 8) that the killing effect of the N1N2N3 triple knockout group is the best, followed by the double knockout N2N3 > N1N3 > N1N2, slightly better than Ctrl.

[0218] At the medium-high efficiency target ratio (E:T = 0.5:1 or 2.5:1), due to strong killing, multiple rounds of continuous killing were performed. After 48h of the first round of killing, 100ul of supernatant was discarded, and the first round of target cells P815-GFP (5x10 4 / well, BCM-0+0.5ug / ml OKT3 culture medium) was supplemented; killing and observation were performed, and after 24h, the same operation was performed to supplement the second round of target cells, and the killing was continued. After 24h, the killing difference of different N target point combinations was obvious, and the experiment was terminated, and the supernatant was collected. From the Total Area killing curve (Figure 7) and the fluorescence chart (Figure 8), it can be seen that N1N2N3 > N2N3 > N1N3 > N1N2 > Ctrl.

[0219] Example 9: Knocking out NR4A1 and / or NR4A2 and / or NR4A3 genes can promote CD8+ T cells to secrete interferon-γ (IFN-γ) and granzyme B

[0220] The killing plate containing OKT3 in Example 8 was terminated after 90h of co-culture, the cell culture plate was taken out, centrifuged at 400xg for 5min, the cell supernatant was collected, diluted 8 times (for Granzyme B detection) or used as the original solution (for IFN-γ detection), and detected according to the Human Granzyme B ELISA Kit (abcam, ab235635) and Human IFN gamma ELISA kit (Sigma, RAB0222) kit operation instruction.

[0221] At low effector to target ratio (E:T = 0.1:1), the weakest killing was observed, so continuous killing was observed. At medium and high effector to target ratio (E:T = 0.5:1 or 2.5:1), the killing was stronger, so multiple rounds of continuous killing were observed, a total of 3 rounds of killing, and the target cells P815 were supplemented during the killing.

[0222] The results are shown in FIG. 9 and FIG. 10. At the end of killing, the IFN-γ factor secretion level under different effector to target ratios was N1N2N3 > N2N3 > N1N3 > N1N2 > Ctrl, and the granzyme B level under different effector to target ratios was N1N2N3 > N2N3 > N1N3 > N1N2 > Ctrl, which was consistent with the results of the killing curve. It was shown that knockout of the NR4A1 and / or NR4A2 and / or NR4A3 gene can promote CD8+T cells to secrete IFN-γ and granzyme B.

[0223] Example 10: Preparation of T cell receptor engineered T cells (TCR-T) with knockout of NR4A1 and / or NR4A2 and / or NR4A3 gene

[0224] Culture medium preparation

[0225] BCM-60 (T cell complete culture medium): CTS TM OpTmizer TM medium + 5% SR + 60 IU / ml IL-2 + 1% Glutamax

[0226] BCM-0 (T cell cytokine-free culture medium): CTS TM OpTmizer TM medium + 5% SR + 1% Glutamax

[0227] BCM-300 (T cell expansion culture medium): CTS TM OpTmizer TM medium + 5% SR + 300 IU / ml IL-2 + 1% Glutamax

[0228] T cell recovery and activation (Day 0)

[0229] 1. T cell culture medium was prepared 20 min in advance and placed in a biosafety cabinet at room temperature for thorough warming. The T cell cryopreservation tube was taken out of the liquid nitrogen tank and placed in dry ice to be taken to the cell room. The cryopreservation tube was placed in a 37°C water bath, gently shaken, and taken out when only a small ice block remained. The outside was sprayed with 75% alcohol, wiped dry with a dust-free paper, and taken to the biosafety cabinet.

[0230] 2. Transfer cells to 9 ml BCM-0 cell culture medium. Centrifuge at 400xg for 5-10 min at room temperature, take 15 μl and 15 μl AO / PI dye mix and count (concentration and viability). Adjust cell density to 1 x 10 6 cells / ml according to the number of viable cells.

[0231] 3. Immediately after cell recovery, activate the cells in BCM-60 cell culture medium containing 60 IU / mL IL2. Add 5 μl of Enceed™ T cell Activation, human, 1 :200 dilute, to each 1 ml of cell suspension. Incubate at 37°C for 2 days. After 2 days of activation, check the expression of CD25 and CD69 by flow cytometry to observe the activation of the cells.

[0232] Electroporation (Day 2)

[0233] 1. Resuspend lyophilized gRNA at 100 μΜ (100 pmol / μl) in RNase / Dnase-free pyrogen-free water. Cas9 protein (5 mg / ml (30 pmol / μl)) can be stored at -20°C without any dilution. Add Supplement to Nucleofector TM solution (4.5:1 ratio of Nucleofector™ solution to Supplement) to form Lonza P3 electroporation buffer, mix and incubate at room temperature.

[0234] 2. Select the EH-115 program for T cell electroporation. Pre-warm T25 flasks containing BCM-60 medium (adjust the cell concentration to 1 x 10 6 cells / ml according to the number of electroporated cells) and TCR-T virus recognizing NYESO-1 antigen (MOI = 10) per flask. Remove residual T cell activation magnetic beads from the T cell culture by centrifugation at 300xg for 8 min and harvest the activated T cells. Then, aspirate the supernatant and resuspend the T cells in DPBS buffer. Place 15 μl Lonza P3 electroporation buffer, 9 μl (180 pmol) sgRNA and 10 μl (60 pmol) Cas9 in a sterile, DNase / RNase-free centrifuge tube, incubate at room temperature for 10 min to form 1 x RNP complex.

[0235] 3. Count and collect the same number of cells (5-8) x 10 6cells). Centrifuge the desired number of cells at 400xg for 10 minutes. Remove supernatant completely; wash once with 8 ml DPBS, remove supernatant completely; gently resuspend cells with Lonza P3 electric transfection buffer (70 μΐ per reaction). Carefully add 70 μΐ of cell suspension to the RNP complex, mix gently by pipetting 2-3 times. Transfer the mixture to the electrode cup. Place the capped electrode cup into the 4D-Nucleofector TM X Unit. Check the electrode cup for the correct orientation. Start the Nucleofection TM program by pressing "Start" on the 4D-Nucleofector TM Core Unit display.

[0236] 4. Immediately after the run is complete, carefully remove the electrode cup from the holder and transfer the cells to a prepared T25 containing pre-warmed BCM-60 medium in a 37°C / 5% CO2 incubator. Replace the medium with BCM-300 after 24 h of infection. Analyze the knockout efficiency after 3 days of cultivation.

[0237] Dead cell sorting (Day 5)

[0238] 1. Prepare 1x Binding Buffer: Dilute 20x Binding Buffer (Miltenyi, 130-091-221) with ddH2O to 1x Binding Buffer for use; remove the cells from the incubator, mix well, and count with AO / PI; centrifuge at 400xg for 10 min at room temperature, remove supernatant.

[0239] 2. Add 100 μΐ of Dead Cell Removal MicroBeads (Miltenyi, 130-090-101) per 1x10 7 cells, mix well, and incubate for 15 min at room temperature; if the resuspension volume from the previous step is less than 500 μΐ, add 1x Binding Buffer to bring the volume to 500 μΐ.

[0240] 3. Place the sorting column on a magnetic stand, rinse the LS column with 3 ml of 1x Binding Buffer, and add the sample to be sorted to the column for sorting, collecting the flow-through (live cells); rinse the column with 12 ml of Binding Buffer, 3 ml at a time, 4 times, collecting the flow-through (live cells).

[0241] 4. Take LS column off sorter, put on 15ml falcon, add 5ml Binding Buffer to LS column, push once with plunger, collect cells (dead cells).

[0242] 5. Spin sorted dead and live cells, resuspend in appropriate volume of media, count and viability by AO / PI.

[0243] TCR + Sort, TCR + Detection (Day 5)

[0244] 1. Take cells out of incubator, mix, count by AO / PI; wash once with 3ml Binding Buffer (Miltenyi, 130-091-221), spin at 400g for 10min at room temperature; discard supernatant, resuspend 1x10 7 cells in 80ul Binding Buffer, add 20ul FcR Blocking (Miltenyi, 130-059-901) per 1x10 6 cells, block at 4C for 10min; spin at 400g for 10min at room temperature, discard supernatant, add 100ul Binding Buffer per 1x10

[0245] 2. Wash once with 3ml Binding Buffer; add 10ul alpha-PE Microbeads (Miltenyi, 130-048-801) per 1x10 6 cells, add 80ul Binding Buffer per 20ul alpha-PE Microbeads, resuspend cells, incubate at 4C for 30min.

[0246] 3. Wash once with 3ml Binding buffer; resuspend 1x10 7 cells in 200ul buffer, ready for sorting; wash LS column twice with 3ml Binding Buffer, then add sample ready for sorting to MACS LS column, wash twice with 9ml Binding Buffer in 3ml aliquots, collect negative cells.

[0247] 4. Take the LS sorting column off the sorter and place it on a 15 ml centrifuge tube, add 5 ml Binding Buffer to the LS sorting column, then push it once directly with the plunger, and collect the positive cells.

[0248] Gene knockout efficiency was detected by one generation sequencing. The results are shown in Table 5, N1 / N2 / N3 TKO TCR-T represents NR4A1 and NR4A2 and NR4A3 triple gene knockout TCR-T cells. The sgRNA shown in the present application has good knockout efficiency in TCR-T cells.

[0249] Table 5: Gene editing knockout efficiency of this embodiment

[0250] Example 11: Knockout of NR4A1 and NR4A2 and NR4A3 genes promotes TCR-T proliferation

[0251] Take the TCR positive cells obtained by TCR positive sorting in Example 9, take 1.5x10 6 cells were resuspended with 1.5 ml BCM-300 medium, inoculated in a 48-well plate according to the amount of 500 μl per well, and 3 duplicate wells were set for each group, recorded as Day 0 of the proliferation curve. According to the growth of the cells, counting was carried out on the 2nd, 4th, 6th, 9th, and 12th days of the proliferation curve, respectively, and each duplicate well was counted twice. According to the counting results, fresh BCM-300 medium was supplemented, and the density of the cells was adjusted to 1x10 6 cells / ml.

[0252] The TCR-T cell expansion multiple results are shown in Figure 11, wherein Ctrl represents the control TCR-T without knockout; N1 represents the NR4A1 single gene knockout TCR-T; N1 / PD1 represents the NR4A1 and PD-1 double gene knockout TCR-T; N1 / N2 / N3 represents the NR4A1 and NR4A2 and NR4A3 triple gene knockout TCR-T. It can be seen that the number of TCR-T cells with NR4A1 and NR4A2 and NR4A3 triple gene knockout is higher than that of other control groups, indicating that the knockout of NR4A1 and NR4A2 and NR4A3 genes can promote TCR-T proliferation.

[0253] Example 12: Knockout of NR4A1 and NR4A2 and NR4A3 genes promotes TCR-T cells to secrete IFN-γ and Granzyme B

[0254] 96-well flat-bottomed plates were added with 50 μl of 0.01% poly-L-ornithine solution, after 1 h at room temperature, the supernatant was discarded, and the plates were dried in a biological safety cabinet for 30 min to 60 min. The SHP-77-GFP cells in the logarithmic growth phase were digested into single cells according to the standard adherent cell culture process, and were resuspended in BCM-0 at a concentration of 2x10 4 The TCR-T cells were resuspended in BCM-0 at a concentration of 2x10

[0255] According to the killing situation, when the killing appeared different between groups, the cell culture supernatant was collected. The Incucyte detection was stopped, the 96-well plate was taken out, centrifuged at 400 g for 5 min, 150 μl of culture supernatant was aspirated and quickly transferred to a -80°C refrigerator for storage, and was used for IFN-γ and Granzyme B ELISA detection. After 8-fold dilution (for Granzyme B detection) or using the original solution (for IFN-γ detection), the detection was performed according to the Human Granzyme B ELISA Kit (Invitrogen, BMS2027-2) and Human IFN gamma ELISA kit (Sigma, RAB0222) kit operation instructions.

[0256] The results are shown in FIG. 12 and FIG. 13, where Ctrl represents the control TCR-T without knockout; N1 represents the TCR-T with NR4A1 single gene knockout; N1 / PD1 represents the TCR-T with NR4A1 and PD-1 double gene knockout; N1 / N2 / N3 represents the TCR-T with NR4A1 and NR4A2 and NR4A3 triple gene knockout. It can be seen that the IFN-γ factor secretion level of the N1 / N2 / N3 triple knockout group was higher than that of the other control groups at different effector target ratios, and the killing was 48 h; the granzyme B level of the N1 / N2 / N3 triple knockout group was also higher than that of the other control groups at different effector target ratios, and the killing was 48 h. It is shown that the knockout of NR4A1 and NR4A2 and NR4A3 genes can promote the secretion of IFN-γ and granzyme B by TCR-T cells.

[0257] Example 13: Knockout of NR4A1 and NR4A2 and NR4A3 genes promotes killing of SHP-77 tumor cells by TCR-T cells

[0258] As can be seen from the Total Area killing curve of co-culture of SHP-77-GFP tumor cells in Example 11 (Figure 14), the N1 / N2 / N3 triple knockout group TCR-T cells showed better killing ability to SHP-77-GFP tumor cells compared with the control group, especially at low target ratio (E:T = 0.5:1), the difference was more obvious.

[0259] It is shown that knockout of NR4A1 and NR4A2 and NR4A3 genes can promote the killing of TCR-T cells to SHP-77 tumor cells.

[0260] Example 14: Knockout of NR4A1 and NR4A2 and NR4A3 genes promotes in vivo killing of TCR-T cells to tumor cells

[0261] TCR-T cells prepared according to Example 10 were used for in vivo experiments, as follows:

[0262] Construction of in vivo model

[0263] The human small cell lung cancer SHP-77 cell line was cultured in RPMI-1640 medium added with 10% FBS in a 37°C incubator containing 5% CO2. Before continuous culture for ten generations, 3x10 6 SHP-77 cells were mixed with PBS 100 μL and an equal volume of Matrigel matrix, and then inoculated subcutaneously on the right side of the back of 80 mice at a volume of about 200 μL. Before inoculation, the mice were anesthetized with 3-4% isoflurane.

[0264] Animal grouping and dosing regimen

[0265] When the tumor grew to an average of about 100-160 mm 3 around (close to 150 mm 3 ), 56 tumor-bearing mice were randomly divided into 7 groups according to body weight and tumor volume, 8 mice in each group. The day of administration was defined as day 0. The grouping and administration regimen are shown in Table 6:

[0266] Table 6: Grouping and administration regimen of this example

[0267] Note: The NC group refers to the test substance being TCR-T cells without gene editing.

[0268] Evaluation method

[0269] Cage-side observations: The appearance and behavior of each mouse were observed every day, and the observation was continued for 3 weeks from the start of grouping. All abnormal appearance and behavior activities were recorded in the observation table.

[0270] Tumor volume: For subcutaneously transplanted tumor models, tumor volume was measured twice a week for 4 consecutive weeks after grouping. The formula for calculating tumor volume (V) is as follows:

[0271] Wherein a, b represent length, width respectively.

[0272] The formula for calculating the relative tumor volume (RTV) of each nude mouse is as follows:

[0273] Wherein V t is the measured volume per day, and V0 is the volume at the start of treatment.

[0274] Experimental drug withdrawal and recovery criteria

[0275] During the experiment, if the weight of a single mouse decreases by ≥15% compared to the weight on the day of grouping, the drug administration of this animal is stopped, and the drug withdrawal period should be long enough for the mouse to recover its weight. Only a single mouse is withdrawn, and the rest of the mice are normally administered. When the weight of the mouse is recovered, the following criteria will be used to continue the experiment: the weight loss is ≤10% compared to the weight on the day of grouping.

[0276] Euthanasia and sample collection

[0277] During the experiment, if any one or more of the following conditions occur, the animal should be euthanized:

[0278] 1) When the tumor volume of a single animal in the group exceeds 3000mm 3 ;

[0279] 2) Tumor ulceration, necrosis or infection occurs;

[0280] 3) The animal shows abnormal movement or paralysis;

[0281] 4) The weight of the animal decreases by more than 20% of the weight at the start of drug treatment for three consecutive days.

[0282] At the end of the in vivo experiment, the mice were suffocated with CO2 and then decapitated. The tumor was collected, weighed, and photographed. Before the end of the in vivo experiment, animals that had died would not be subjected to sample collection.

[0283] The results are shown in Figure 15. NR4A1 and NR4A2 and NR4A3 gene knockout TCR-Ts produced obvious killing effects on tumors in mice at different dosages, and inhibited the in vivo growth of tumors.

[0284] It should be understood that, although the present application has been described in relation to the presently preferred embodiments thereof, it is not intended to be limited to the embodiments described herein. Certain changes and modifications can be practiced, depending on specific needs, which should be included in the scope of the present application. Therefore, for those skilled in the art, a number of simple substitutions can be made without departing from the concept and principles of the present application, which should be included in the scope of the present application.

Claims

1. A modified tumor infiltrating lymphocyte (TIL) or T cell receptor engineered T cell (TCR-T), wherein the expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 gene or its gene product is reduced or eliminated.

2. The modified TIL or TCR-T of claim 1, wherein the expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 gene or its gene product of the TIL or TCR-T is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100% compared to unmodified or control TIL or TCR-T, respectively.

3. The modified TIL or TCR-T of claim 1 or 2, wherein the property of the TIL or TCR-T is improved compared to unmodified or control TIL or TCR-T.

4. The modified TIL or TCR-T of claim 3, wherein the improved property of the TIL or TCR-T comprises one or more selected from the group consisting of: increased TIL or TCR-T cell proliferation capacity, increased cytokine secretion capacity, increased granzyme secretion capacity, increased tumor cell killing capacity, increased persistence, decreased exhaustion level, increased tumor spheroid killing capacity, and increased anti-tumor activity in animals.

5. A method of preparing the modified TIL or TCR-T of any one of claims 1-4, wherein the NR4A1 and / or NR4A2 and / or NR4A3 gene or its gene product in the modified TIL or TCR-T is treated by one or more of the following approaches: gene editing technology, RNA interference technology, PROTAC technology, antibody or small molecule inhibitor.

6. The method of preparing of claim 5, wherein the gene editing technology comprises one or more of the following approaches: CRISPR / Cas technology, transcription activator-like effector nuclease (TALEN) technology, Zinc-finger nuclease (ZFN) technology, single or multiple base mutation, prime editing or site-directed knock-in.

7. The method of preparing of claim 6, wherein the Cas protein used in the CRISPR / Cas technology is selected from Cas9, Cas12a, Cas3, Cas13, Cas14, Cas7, Cas8, Cas10 or Cas11.

8. The method of preparing of claim 7, wherein the Cas9 protein is selected from SpCas9, SaCas9, SpCas9-HF, eSpCas9 or xCas9.

9. The method of preparing of any one of claims 5-8, wherein the NR4A1 and / or NR4A2 and / or NR4A3 gene is disrupted and / or knocked out by CRISPR / Cas technology.

10. The method of any one of claims 5-9, wherein the NR4A1 and / or NR4A2 and / or NR4A3 gene is disrupted and / or knocked out by CRISPR / Cas9 technology.

11. The method of any one of claims 5-10, wherein the CRISPR / Cas9 technology comprises introducing into the TIL or TCR-T of any one of claims 1-4 a CRISPR / Cas9 system comprising both a single guide RNA (sgRNA) targeting the gene of interest and a Cas9 nuclease.

12. The method of any one of claims 5-11, wherein the sgRNA comprises an sgRNA targeting the NR4A1 gene, an sgRNA targeting the NR4A2 gene, and an sgRNA targeting the NR4A3 gene.

13. The method of any one of claims 5-12, wherein the CRISPR / Cas9 technology uses an sgRNA targeting the NR4A1 gene, an sgRNA targeting the NR4A2 gene, and an sgRNA targeting the NR4A3 gene, respectively or simultaneously.

14. The method of any one of claims 5-13, wherein the targeting sequence in the sgRNA targeting the NR4A1 gene is TCGGTGCTGGTGTCCCATAT (SEQ ID NO: 1) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO: 1; the targeting sequence in the sgRNA targeting the NR4A2 gene is TAGTAAACCGACCCGGAGTG (SEQ ID NO: 2) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO: 2; and the targeting sequence in the sgRNA targeting the NR4A3 gene is GTATGTCTGCGCCGCATAAC (SEQ ID NO: 3) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO:

3.

15. The method of any one of claims 5-14, wherein the method of introducing the CRISPR / Cas9 system into the TIL or TCR-T comprises introducing a Cas9-sgRNA ribonucleoprotein (RNP) complex or a vector containing a Cas9 protein and an sgRNA expression element into the TIL or TCR-T of any one of claims 1-4 using chemical transfection, electroporation, or vector delivery.

16. The method of any one of claims 5-15, wherein the Cas9-sgRNA RNP complex is introduced into the TIL or TCR-T of any one of claims 1-4 using electroporation.

17. A method of producing the TIL of any one of claims 1-4, comprising the steps of: (1) processing a tumor sample obtained from a subject into a plurality of tumor fragments to obtain a population of TILs; (2) expanding the obtained population of TILs in vitro in a culture medium containing T cell growth factors to obtain a population of Pre-REP TILs; ​ ​ (3) treating the Pre-REP TIL population using the preparation method of any one of claims 6-16, and co-culturing with trophoblast cells in a medium containing a T cell growth factor, such that the expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 genes is reduced or eliminated.

18. The method of claim 17, wherein the T cell growth factor is selected from one or more of IL-2, IL-7, IL-15, IL-21.

19. The method of claim 17 or 18, wherein the T cell growth factor is IL-2.

20. The method of claim 17, wherein the final concentration of the T cell growth factor in step (2) is about 750-6000 IU / mL.

21. The method of claim 17, wherein the final concentration of the T cell growth factor in step (2) is 6000 IU / mL.

22. The method of claim 17, wherein the final concentration of the T cell growth factor in step (3) is about 750-6000 IU / mL.

23. The method of claim 17, wherein the final concentration of the T cell growth factor in step (3) is 3000 IU / mL.

24. The method of claim 17, wherein the TILs are autologous TILs to the subject.

25. A method of producing the TCR-T of any one of claims 1-4, comprising the steps of: (1) obtaining peripheral blood T cells from a subject; (2) performing an activation culture in a medium containing a T cell growth factor and CD3 / CD28 nanomagnetic bead antibodies to obtain a CD3+ T cell population; (3) treating the CD3+ T cell population using the preparation method of any one of claims 6-16, and culturing in a medium containing a T cell growth factor and TCR-T transduction virus, followed by TCR positive sorting to obtain TCR-Ts in which the expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 genes is reduced or eliminated.

26. The method of claim 25, wherein the T cell growth factor is selected from one or more of IL-2, IL-7, IL-15, IL-21.

27. The method of claim 25 or 26, wherein the T cell growth factor is IL-2.

28. The method of claim 25, wherein the final concentration of the T cell growth factor in step (2) is about 30-6000 IU / mL.

29. The method of claim 25, wherein the final concentration of the T cell growth factor in step (2) is 60 IU / mL.

30. The method of claim 25, wherein the final concentration of the T cell growth factor in step (3) is about 30-6000 IU / mL.

31. The method of claim 25, wherein the final concentration of the T cell growth factor in step (3) is 300 IU / mL.

32. The method of claim 25, wherein the peripheral blood T cells, CD3+ T cells, TCR-Ts are autologous T cells to the subject.

33. A pharmaceutical composition comprising the TILs of any one of claims 1-4 or the TILs treated by the method of any one of claims 5-24 and optionally a pharmaceutically acceptable carrier.

34. A pharmaceutical composition comprising the TCR-Ts of any one of claims 1-4 or the TCR-Ts treated by the method of any one of claims 5-16 or 25-32 and optionally a pharmaceutically acceptable carrier.

35. Use of the TILs or TCR-Ts of any one of claims 1-4 or the TILs treated by the method of any one of claims 5-24 or the TCR-Ts treated by the method of any one of claims 5-16 or 25-32 or the pharmaceutical composition of claim 33 or 34 in the manufacture of a medicament for preventing and / or treating a tumor.

36. The use of claim 35, wherein the tumor is a solid tumor.

37. The use of claim 35 or 36, wherein the solid tumor is selected from one or more of the group consisting of melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer, and kidney cancer.

38. A method of treating a tumor in a subject in need thereof, the method comprising administering to the subject the TILs or TCR-Ts of any one of claims 1-4 or the TILs treated by the method of any one of claims 5-24 or the TCR-Ts treated by the method of any one of claims 5-16 or 25-32 or the pharmaceutical composition of claim 33 or 34.

39. The method of claim 38, wherein the tumor is a solid tumor.

40. The method of claim 38 or 39, wherein the solid tumor is selected from one or more of the group consisting of melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer, and kidney cancer.

41. Use of reducing or eliminating expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 genes in TILs, the use comprising increasing TIL cell proliferation capacity, increasing cytokine secretion capacity, increasing granzyme secretion capacity, increasing tumor cell killing capacity, increasing TIL cell persistence, decreasing exhaustion, enhancing killing of organoids, boosting anti-tumor activity in vivo; the TILs being the TILs of any one of claims 1-4 or the TILs treated by the method of any one of claims 5-24.

42. Use of reducing or depleting expression and / or function of NR4A1 and / or NR4A2 and / or NR4A3 genes in a TCR-T, the use comprising increasing TCR-T cell proliferative capacity, increasing cytokine secretion capacity, increasing granzyme secretion capacity, increasing tumor cell killing capacity, increasing TCR-T cell persistence, decreasing exhaustion, enhancing killing of spheroids, boosting anti-tumor activity in vivo; the TCR-T being the TCR-T of any one of claims 1-4 or the TCR-T treated by the method of any one of claims 5-16 or 25-32.

Images