Primer combination, kit and method for detecting aerococcus urinaeequi

Abstract

The present invention relates to the field of microbial detection, and specifically relates to a primer combination, kit and method for detecting Aerococcus urinaeequi. The primer combination comprises an upstream primer and a downstream primer, wherein the upstream primer has a nucleotide sequence as shown in SEQ ID No. 2, and the downstream primer has a nucleotide sequence as shown in SEQ ID No. 3. The provided primer combination, kit and PCR detection method can be used to distinguish Aerococcus urinaeequi from Aerococcus viridans, and the provided PCR detection method can efficiently, rapidly and specifically detect Aerococcus urinaeequi.

Description

A primer combination, kit, and method for detecting Ursodeoxycholic acid bacillus. Technical Field

[0001] This invention belongs to the field of microbial detection, specifically relating to a primer combination, kit, and method for detecting Ursodeoxychondria muscarinica. Background Technology

[0002] *Aerococcus* is a genus of Gram-positive cocci characterized by greenish, hemolytic colonies and catalase-negative activity. Currently, there are 11 species in this genus: *Aerococcus viridans*, *Aerococcus urinaeequi*, *Aerococcus urinae*, *Aerococcus sanguinicola*, *Aerococcus christensenii*, *Aerococcus vaginalis*, *Aerococcus suis*, and three newly isolated species from *Aerococcus urinae*: *Aerococcus loyolae*, *Aerococcus mictus*, and *Aerococcus tenax*. This genus is widely distributed in air, soil, plants, and medical environments, and is an important opportunistic pathogen that can cause clinical urinary tract infections, bloodstream infections, endocarditis, and bone and joint infections.

[0003] *Bacillus muscarinii*, a member of the genus *Bacillus*, is a Gram-positive coccus that exists in dual, tetrad, or clustered forms. Studies have shown that *Bacillus muscarinii* is pathogenic to animals; it has been isolated from frozen milk of laying hens with tarsitis, liver and spleen of dead ducks, and urine of dogs and pigs with urethritis. Furthermore, in 2016, researchers isolated *Bacillus muscarinii* from the ascites fluid of patients with chronic kidney disease, indicating that this bacterium is also pathogenic to humans. Therefore, developing accurate and efficient detection methods for *Bacillus muscarinii* is crucial for the treatment and control of this pathogen.

[0004] Whole-genome sequencing has been applied to species identification of *Russula equina*. While efficient and relatively accurate, this method requires specialized equipment and incurs significant costs. Due to deficiencies in biochemical and mass spectrometry identification databases, accurate identification of *Russula equina* is not yet possible. PCR technology, due to its high efficiency and reliability, is widely used in microbial detection. Primers play a crucial role in PCR detection, determining its specificity and efficiency. However, currently developed PCR methods suffer from limitations in primers and detection conditions, resulting in low specificity for *Russula equina* and an inability to accurately identify whether a sample contains *Russula equina*, thus presenting certain limitations. Summary of the Invention

[0005] To address the technical problems existing in the prior art, the purpose of this invention is to provide a primer combination, kit, and method for detecting *Russula muscarinica*. Using the primer combination, kit, or detection method provided by this invention, *Russula muscarinica* can be rapidly and specifically identified, and *Russula muscarinica* and *Russula viride* can be distinguished.

[0006] The first aspect of this invention provides a primer combination for detecting *Russula equinasum*, the primer combination comprising an upstream primer and a downstream primer, the specific sequences of which are as follows:

[0007] Upstream primer: 5'-AAAGCTTACGAAAAGCAGCA-3',

[0008] Downstream primer: 5'-CCAATTTGTAAGTGAGCGC-3'.

[0009] A second aspect of the present invention provides a kit for detecting *Russula equinasum*, the kit comprising the primer combination described above.

[0010] Furthermore, the kit also includes dNTPs, PCR stabilizers, Taq DNA polymerase, and PCR buffer.

[0011] A third aspect of the present invention provides the application of the above-described primer combination or the above-described kit in the detection of *Russula equina*.

[0012] Furthermore, the application is for distinguishing between *Bacillus muscarinicus* and *Bacillus viride*.

[0013] The fourth aspect of the present invention provides a method for detecting *Russula muscarinica*, wherein the method requires the use of the primer combination provided in the first aspect of the present invention or the kit provided in the second aspect of the present invention to detect the sample to be tested.

[0014] Furthermore, the specific steps for detecting *Russula equina* are as follows:

[0015] Extract DNA from the sample to be tested;

[0016] The extracted DNA was amplified by PCR using the primer combination or the kit to obtain PCR products;

[0017] The PCR products were analyzed by electrophoresis.

[0018] The presence of a 401bp fragment in the amplification product indicates that the sample contains the *Echinococcus musculosus* gene.

[0019] Furthermore, the PCR amplification system is as follows: 2-5 μL of DNA template from the sample to be tested, 2-3 μL of downstream primer, 25-27 μL of PCR Mix, and sterile deionized water to a final volume of 50 μL.

[0020] Preferably, the PCR amplification system is as follows: 2 μL of DNA template of the sample to be tested, 2 μL of upstream primer, 2 μL of downstream primer, 25 μL of PCR Mix, and sterile deionized water to make up to 50 μL.

[0021] Further, the PCR amplification reaction procedure is as follows: (1) pre-denaturation; (2) denaturation; annealing: 52-56℃, 30s; extension; 30-32 cycles in total; (3) terminal extension.

[0022] Preferably, the PCR amplification reaction procedure is as follows: (1) pre-denaturation; (2) denaturation; annealing: 54℃, 30s; extension; 30 cycles in total; (3) terminal extension.

[0023] In summary, compared with the prior art, the present invention has the following advantages and effects:

[0024] (1) This invention provides a primer combination for detecting *Russula equinasum*, which has high specificity and can be used to detect *Russula equinasum*. The PCR detection method provided by this invention is simple to operate, low in cost, highly specific, and fast in detection, and has important practical significance for the detection and research of *Russula equinasum*.

[0025] (2) Both *Balloonia equinoides* and *Balloonia viride* belong to the genus *Balloonia*. However, because the 16S rRNA genes of *Balloonia equinoides* and *Balloonia viride* differ by only 1 to 2 bases, conventional PCR methods and primers cannot distinguish between them. Using the specific primer combination provided by this invention, *Balloonia equinoides* can be identified and distinguished from *Balloonia viride*. Attached Figure Description

[0026] Figure 1 shows the comparison results of the unique fragments of *Echinococcus muscarinii* in the database.

[0027] Figure 2 shows the PCR electrophoresis results. Lane M is the DNA Marker, and lanes 1 to 11 are the electrophoresis results of *Bacillus muscarinicus*, *Bacillus viride*, *Proteus mirabilis*, *Clostridium perfringens*, *Enterococcus faecalis*, *Salmonella*, *Staphylococcus aureus*, *Bacillus subtilis*, *Pasteurella multocida*, *Escherichia coli*, and the negative control, respectively.

[0028] Figure 3 shows the alignment results after sequencing of *Echinochloa crus-galli*. Detailed Implementation

[0029] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings.

[0030] Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0031] *Bleurotus* spp. are an important group of opportunistic pathogens. With in-depth research, *Bleurotus muscarinica* has been found to be opportunistically pathogenic to both animals and humans. Therefore, developing accurate and efficient detection methods for *Bleurotus muscarinica* is crucial for the treatment and control of this pathogen. PCR technology, due to its high efficiency and reliability, has been widely used in microbial detection. In PCR detection, primers play a vital role, determining the specificity and efficiency of the test. Currently developed PCR methods, due to deficiencies in primers and detection conditions, lack strong specificity for *Bleurotus muscarinica* and cannot accurately identify whether a sample contains *Bleurotus muscarinica*, thus exhibiting certain limitations.

[0032] This invention, by referencing the NCBI database, performed a genome sequence alignment analysis of *Bacillus muscarinii* and *Bacillus viride*. Then, a fragment existing only in the complete sequence of *Bacillus muscarinii* was selected, and a specific primer combination was designed for this fragment to establish a PCR method. Finally, electrophoresis experiments verified the specificity of the primers and the feasibility of the detection method. Using the primer combination and kit provided by this invention, *Bacillus muscarinii* and *Bacillus viride* can be distinguished. The PCR detection method provided by this invention can efficiently, rapidly, and specifically detect *Bacillus muscarinii*.

[0033] Example 1: Design of PCR primer combinations

[0034] 1. Design and synthesis of specific primers

[0035] Using MAFFT version 7 online software and referring to the NCBI database, the whole genome sequence of *Bacillus muscarinii* and *Bacillus viride* was compared and analyzed. A fragment found only in *Bacillus muscarinii* was selected, and its sequence is shown in SEQ ID NO. 1. SEQ ID NO. 1:

[0036] The sequence AAAGCTTACGAAAAGCAGCAAGAAGAGATCGCCAAATTAGAAGACTATGTAGCACGTAATATTGTGCGCGCCTCAACGACAAAAATGGCACAGTCACGTCGTAAGCAATTAGAGAAAATGACCAAAATTGAAAAGCCATTAAACGATGAAAAATCCGCACGCATTCAGTTCTCCGTTGCTGAAAGTTCTGGGAATGATGTTTTACAAACCAATAACTTAGCCGTCGGGTATAGTCCAGATAAAGTTTTGGCTGAACCTATCTCATTCCAGCTACGCAAGCAGGAAGCAATTGCAATTGTTGGACCAAATGGTGTAGGTAAATCAACCTTACTCAAAACAATTATTAAACAAATTCCAGCTATACGCGGCACTATCGAATATGGCGCTCACTTACAAATTGG (401bp) was compared with the NCBI database. The comparison results are shown in Figure 1. The results show that this sequence exists only in the complete sequence of *Echinococcus equi*.

[0037] Then, a primer pair was designed using NCBI online tools. The upstream primer sequence is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3, as follows:

[0038] SEQ ID NO.2: 5'-AAAGCTTACGAAAAGCAGCA-3',

[0039] SEQ ID NO. 3: 5'-CCAATTTGTAAGTGAGCGC-3'.

[0040] Implementation 2: Construction and Validation of Detection Methods

[0041] In this embodiment, the information for each bacterial species is as follows:

[0042] For information on the species *Aerococcus urinaequi*, please refer to "Zhang Han, Shu Jingchao, Zhang Xiaojing, et al. Identification and whole-genome sequencing analysis of *Aerococcus urinaequi* from ducks [J]. Chinese Journal of Preventive Veterinary Medicine, 2024, 46(02): 128-139.";

[0043] For information on the strain of Aerococcus viridans, please refer to "Isolation and Identification of Aerococcus viridans from Porcine Source [J]. Progress in Veterinary Medicine, 2023, 44(02):141-144.";

[0044] For information on Proteus mirabilis strains, please refer to “Lu Zhenxiang, Chen Xiaopeng, Wu Dongqi, et al. Isolation, identification and drug susceptibility testing of Proteus mirabilis from goose [J]. Animal Husbandry and Veterinary Science and Technology Information, 2019, (05): 28-29.”;

[0045] For information on Pasteurella multocida strains, please refer to "Guo Weina, Zhao Xia, Lu Zhenxiang. Isolation, identification and drug resistance analysis of rabbit-derived Pasteurella multocida [J]. Chinese Journal of Veterinary Medicine, 2023, 59(04):59-62.";

[0046] For information on Enterococcus faecalis, please refer to “Lu Zhenxiang, Chen Xiaopeng, Wu Dongqi, et al. Isolation, identification and drug resistance and virulence gene detection of Enterococcus faecalis [J]. Journal of Beijing Agricultural College, 2022, 37(4):86-90.”;

[0047] Information on the species of Salmonella, Staphylococcus aureus, Bacillus subtilis, Clostridium perfringens, and Escherichia coli can be found in "Zhang Xun, Lu Zhenxiang, Zhu Yuanzhao, et al. Isolation of bacteriocin-producing enterococci and screening of their antibacterial spectrum [J]. Journal of Anhui University of Science and Technology, 2019, 33(06):6-11."

[0048] First, DNA was extracted from *Bacillus muscarinicus*, *Bacillus viride*, *Proteus mirabilis*, *Clostridium perfringens*, *Enterococcus faecalis*, *Salmonella*, *Staphylococcus aureus*, *Bacillus subtilis*, *Pasteurella multocida*, and *Escherichia coli*. The DNA was amplified using the primer combination designed in Example 1 according to the PCR reaction system and procedure described below, and the amplification products were analyzed by agarose gel electrophoresis.

[0049] PCR reaction system: 2 μL DNA template, 2 μL upstream primer, 2 μL downstream primer, 25 μL PCR Mix, and sterile deionized water to make up to 50 μL.

[0050] PCR amplification reaction procedure: (1) Pre-denaturation: 95℃, 5min; (2) Denaturation: 95℃, 30s; Annealing: 54℃, 30s; Extension: 72℃, 1min; 30 cycles in total; (3) Terminal extension: 72℃, 10min; (4) Cool down to 4℃ to end the reaction.

[0051] The electrophoresis results are shown in Figure 2. Lane 1 contains the amplification product of *Bacillus muscarinicus*. Only lane 1 showed amplified bands, and the band size was as expected. This indicates that the primer combination provided by this invention has specificity, and the PCR method is feasible. It can not only detect *Bacillus muscarinicus*, but also distinguish between *Bacillus muscarinicus* and *Bacillus viride*.

[0052] The band from lane 1 was sent to General Biotechnology Co., Ltd. for sequencing. The sequencing results are shown in SEQ ID NO.4. SEQ ID NO.4:

[0053] The sequence of SEQ ID NO.4 was compared with the NCBI database. The comparison result is shown in Figure 3. This fragment exists in all the complete sequences of *Bombyx mori* that have been uploaded to NCBI. It is the same as the sequence of SEQ ID NO.1 and does not contain *Bombyx mori*.

Claims

1. A primer combination for detecting *Russula muscarinii*, characterized in that, The primer combination comprises an upstream primer and a downstream primer, with the following specific sequences: Upstream primer: 5'-AAAGCTTACGAAAAGCAGCA-3', Downstream primer: 5'-CCAATTTGTAAGTGAGCGC-3'.

2. A kit for detecting *Russula muscarinii*, characterized in that, The kit comprises the primer combination as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, The kit also includes dNTPs, PCR stabilizers, Taq DNA polymerase, and PCR buffer.

4. The use of the primer combination of claim 1 or the kit of claim 2 in the detection of *Vallisneria equina*.

5. The application according to claim 4, characterized in that, The application is to distinguish between *Bacillus muscarinicus* and *Bacillus viride*.

6. A method for detecting *Russula muscarinii*, characterized in that, The method requires the use of the primer combination described in claim 1 or the kit described in claim 2 to detect the sample to be tested.

7. The method according to claim 6, characterized in that, The specific steps of the method are as follows: Extract DNA from the sample to be tested; The extracted DNA was amplified by PCR using the primer combination or the kit to obtain PCR products; The PCR products were analyzed by electrophoresis. The presence of a 401bp fragment in the amplification product indicates that the sample contains the *Echinococcus musculosus* gene.

8. The method according to claim 7, characterized in that, The PCR amplification system is as follows: 2-5 μL of DNA template from the sample to be tested, 2-3 μL of upstream primer, 2-3 μL of downstream primer, 25-27 μL of PCR Mix, and sterile deionized water to a final volume of 50 μL.

9. The method according to claim 7, characterized in that, The PCR amplification reaction procedure is as follows: (1) pre-denaturation; (2) denaturation; annealing: 52-56℃, 30s; extension; 30-32 cycles in total; (3) terminal extension.

Images