Stem cells and use thereof in xenotransplantation

Genetically modified porcine totipotent/pluripotent stem cells with TP53 and xeno-antigen mutations and immune modulating proteins enhance xenotransplantation by addressing genome editing challenges and immune rejection, enabling efficient and precise evaluation of immune responses.

WO2025223466A1PCT designated stage Publication Date: 2025-10-30CENT FOR TRANSLATIONAL STEM CELL BIOLOGY LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/090704
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-23
Filing Date
2025-04-23
Publication Date
2025-10-30

AI Technical Summary

Technical Problem

Current methods for xenotransplantation using genetically modified pigs face limitations due to complex genome editing in fibroblasts, costly and time-consuming validation of editing results, and challenges in evaluating functional consequences, leading to immune rejection and inflammation.

Method used

Genetically modify porcine totipotent/pluripotent stem cells, such as EPSCs, with inactivating mutations in TP53, xeno-antigen related genes like GGTA1, CMAH, and B4GALNT2, and introduce heterologous nucleic acids encoding immune modulating proteins like CD47, enabling precise genome editing and evaluation of immune responses.

Benefits of technology

Facilitates efficient and precise genetic engineering of porcine cells for xenotransplantation, reducing immune rejection and inflammation risks, and provides a rapid assessment of immune compatibility with the human vascular system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025090704_30102025_PF_FP_ABST
    Figure CN2025090704_30102025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein is a composition comprising genetically modified totipotent / pluripotent stem cells. A method of xenotransplantation, and a system and a method of evaluating the suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

STEM CELLS AND USE THEREOF IN XENOTRANSPLANTATIONCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to US Provisional Application No. 63 / 637,649, filed April 23, 2024, the content of which is hereby expressly incorporated by reference in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (275162000640SEQLIST. xml; Size: 35, 209 bytes; and Date of Creation: April 22, 2025) is herein incorporated by reference in its entirety.FIELD

[0003] The present invention relates to the field of using cultured totipotent / pluripotent stem cells (such as expanded potential stem cells (EPSCs) ) and / or cells differentiated therefrom, in xenotransplantation, and evaluation of cells, tissues, and / or organs for suitability for xenotransplantation.BACKGROUND OF THE INVENTION

[0004] Organ transplantation is life-saving for patients like cardiac diseases and renal failure and is considered one of the greatest medical achievements in the 20th century and. With the rapid developments in surgical techniques and the utilization of immunosuppressive agents, allotransplantation has become the only available treatment for end-stage organ failure in biomedicine. However, human organ transplantation faces a significant challenge because the need for this procedure far exceeds the availability of donor organs. Each year fewer than half the people on transplant waiting lists receive organ transplants. Even if all potential donors elect to donate, the supply of human organ donations will continue to fall short of the need.

[0005] One solution to this acute shortage is “xenotransplantation, ” or the process of transplanting cells, tissues or organs from one species to another (e.g., human) . While still in the experimental stages, xenotransplantation is a potentially life-saving option for people with such ailments as severe heart disease and kidney failure. Amongst species that could be potentially suitable for xenotransplantation, domesticated animals such as pigs and cows be considered as potential tissue and organ sources before nonhuman primates, such as monkeys, for a number of health, safety and logistical reasons. Pigs are preferred because they mature very quickly, produce large litters and have organs of comparable size and function to human organs in both infancy and adulthood. They also can be bred to high health standards in microbiologically controlled environments. However, species barriers comprising immune rejection, coagulation, and inflammation poses a significant challenge.

[0006] Rejection, in which the recipient’s body attacks the new organ like an infection, is the greatest practical obstacle to xenotransplantation. Traditionally in transplants of organs from one human to another, drug therapies, such as cyclosporine, are used to suppress recipients’ immune systems in order to allow transplanted organs to function without being attacked and rejected as foreign. In xenotransplantation, a more aggressive defense mechanism called “hyperacute rejection” occurs when tissue not recognized as human is introduced to the body. In a matter of minutes, an individual’s immune system sets out to destroy the transplanted organ.

[0007] One technology being developed to overcome such organ rejection is the making of humanized pigs. In some cases, the pigs are genetically modified to remove foreign antigen expression. In some cases, these genetically-altered pigs express specific human proteins that make it more difficult for the human immune system to identify the porcine organ as belonging to a different species. However, current methods that utilize pig somatic cells for genetic engineering to create humanized pigs are facing tremendous limitations due to limited gene editing and subsequent phenotyping. The current pig donors are generated through somatic cell nuclear transfer (SCNT) or cloning. Normally, CRISPR-Cas9 meditated genome editing is performed in pig fibroblasts which are used in cloning. Yet, the use of fibroblasts presents limitations. For instance, complex genome editing and subsequent validation of editing results is challenging to perform in fibroblasts. Furthermore, evaluating the functional consequences of the genetic editing is costly and time consuming since the target cells to be examined will have to come from the cloned animals. The present disclosure addresses these needs and other related needs in the field. BRIEF SUMMARY OF THE INVENTION

[0008] In one aspect, provided herein is a composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in TP53. In some embodiments, the porcine totipotent / pluripotent stem cells are further modified to contain an inactivating mutation in a xeno-antigen related gene.

[0009] In another aspect, provided herein is a composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in a xeno-antigen related gene.

[0010] In some embodiments, the xeno-antigen related gene is selected from the group consisting of GGTA1, CMAH, and B4GALNT2. In some embodiments, the porcine totipotent / pluripotent stem cells contain an inactivating mutation in GGTA1. In some embodiments, the porcine totipotent / pluripotent stem cells contain an inactivating mutation in CMAH. In some embodiments, the porcine totipotent / pluripotent stem cells contain an inactivating mutation in B4GALNT2.

[0011] In some embodiments according to any of the embodiments described above, the porcine totipotent / pluripotent stem cells further contain an inactivating mutation in a gene associated with organ growth. In some embodiments, the gene associated with organ growth is GHR.

[0012] In some embodiments according to any of the embodiments described above, the inactivating mutation is a gene knockout. In some embodiments, the inactivating mutation is introduced by gene editing.

[0013] In some embodiments according to any of the embodiments described above, the porcine totipotent / pluripotent stem cells further comprise a heterologous nucleic acid. In some embodiments, the heterologous nucleic acid encodes an immune modulating protein. In some embodiments, the immune modulating protein is CD47. In some embodiments, the heterologous nucleic acid is integrated into the genome of the totipotent / pluripotent stem cells at a safe harbor locus. In some embodiments, the safe harbor locus is ROSA26. In some embodiments, the heterologous nucleic acid is integrated into the genome of the totipotent / pluripotent stem cells by a recombinase. In some embodiments, the recombinase is a Cre recombinase.

[0014] In some embodiments, the heterologous nucleic acid furthers comprise a lox71 site at a 5’ end of the heterologous nucleic acid and a lox2272 sites at a 3’ end of the heterologous nucleic acid, or the heterologous nucleic acid can further comprises a lox71 site at a 3’ end of the heterologous nucleic acid and a lox2272 sites at a 5’ end of the heterologous nucleic acid.

[0015] In some embodiments according to any of the embodiments described above, the porcine totipotent / pluripotent stem cells are genetically and epigenetically stable.

[0016] In some embodiments according to any of the embodiments described above, the porcine totipotent / pluripotent stem cells are pluripotent. In some embodiments, the porcine totipotent / pluripotent stem cells have broad differentiation potential. In some embodiments, the porcine totipotent / pluripotent stem cells are Expanded Potential Stem Cells (EPSCs) .

[0017] In another aspect, provided herein is a method of xenotransplantation, comprising introducing a composition of any one of the embodiments described above to an individual in need thereof, such as a human.

[0018] In another aspect, provided herein is an in vitro evaluation system for evaluating suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, wherein the system comprises cells and / or organoids differentiated from the totipotent / pluripotent stem cells. In some embodiments, the cells and / or organoids are selected from the group consisting of: endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids.

[0019] In some embodiments, the totipotent / pluripotent stem cells are genetically modified.

[0020] In some embodiments according to any of the embodiments about in vitro evaluation systems described above, the composition comprising totipotent / pluripotent stem cells is any of the composition comprising porcine totipotent / pluripotent stem cells described above. In some alternative embodiments, the totipotent / pluripotent stem cells are unmodified.

[0021] In some embodiments according to any of the embodiments about in vitro evaluation systems described above, the totipotent / pluripotent stem cells are EPSCs. In some embodiments, the totipotent / pluripotent stem cells are porcine totipotent / pluripotent stem cells, such as porcine EPSCs.

[0022] In another aspect, provided herein is a method of evaluating the suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, comprising evaluation of immune responses caused by the totipotent / pluripotent stem cells and / or organoids differentiated from the totipotent / pluripotent stem cells.

[0023] In some embodiments, the cells and / or organoids are selected from the group consisting of: endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids.

[0024] In some embodiments according to any of the embodiments about evaluation methods described above, the composition comprising totipotent / pluripotent stem cells are for use in generating clone animals for xenotransplantation.

[0025] In some embodiments, the cells and / or organoids are cardiomyocytes and / or heart organoids, and the xenotransplantation is cardiac transplantation.

[0026] In some embodiments, the cells and / or organoids are hepatocytes and / or liver organoids, and the xenotransplantation is liver transplantation.

[0027] In some embodiments, the cells and / or organoids are skin keratinocytes and / or skin organoids, and the xenotransplantation is skin transplantation.

[0028] In some embodiments, the cells and / or organoids are pancreatic beta cells and / or islets, and the xenotransplantation is islet transplantation.

[0029] In some embodiments, the cells and / or organoids are intestinal epithelial cells and / or gut organoids, and the xenotransplantation is gut transplantation.

[0030] In some embodiments, the cells and / or organoids are blood cells, and the xenotransplantation is blood transfusion.

[0031] In some embodiments, the cells and / or organoids are retinal pigment epithelium (RPE) cells, and the xenotransplantation is RPE transplantation.

[0032] In some embodiments, the cells and / or organoids are kidney organoids, and the xenotransplantation is renal transplantation.

[0033] In some embodiments, the cells are endothelial cells, and the xenotransplantation is selected from the group consisting of cardiac transplantation, liver transplantation, skin transplantation, islet transplantation, gut transplantation, blood transfusion, and RPE transplantation.

[0034] In some embodiments according to any of the embodiments about evaluation methods described above, the totipotent / pluripotent stem cells are porcine EPSCs.

[0035] In some embodiments according to any of the embodiments about evaluation methods described above, the method further comprises differentiating the totipotent / pluripotent stem cells into the cells and / or organoids, including for example differentiating the porcine EPSCs into the endothelial cells.

[0036] In some embodiments according to any of the embodiments about evaluation methods described above, the totipotent / pluripotent stem cells are genetically modified.

[0037] In some embodiments according to any of the embodiments about evaluation methods described above, the composition comprising genetically modified totipotent / pluripotent stem cells is a composition according to any of the embodiments above.

[0038] In some embodiments according to any of the embodiments about evaluation methods described above, the evaluation of immune responses is selected from the group consisting of evaluation of xeno-antigen expression, complement-mediated cytotoxicity, antibody binding, and macrophage phagocytosis. In some embodiments, the evaluation of immune responses comprises evaluation of human antibody binding. In some embodiments, the evaluation of immune responses comprises evaluation of human macrophage phagocytosis.

[0039] In some embodiments according to any of the embodiments about evaluation methods described above, the method comprises comparing the xeno-antigen activity of the composition comprising endothelial cells differentiated from genetically modified EPSCs with a composition comprising endothelial cells differentiated from unmodified EPSCs.

[0040] In another aspect, provided herein is a method of generating a population of endothelial cells from porcine EPSCs, comprising (a) subjecting the porcine EPSCs to a first condition that differentiates the EPSC into mesodermal cells; and (b) subjecting the mesodermal cells to a second condition that differentiates the mesodermal cells into endothelial cells. In some embodiments, the EPSCs are genetically modified. In some embodiments, the method further comprise (c) subjecting the endothelial cells to a third condition that differentiates the endothelial cells into hemogenic cells.

[0041] In some embodiments, the method further comprises culturing the EPSCs in a priming medium before subjecting the porcine EPSCs to the first condition.

[0042] In some embodiments, the first condition comprises a mesoderm induction medium.

[0043] In some embodiments, the second condition comprises an endothelial cell induction medium.BRIEF DESCRIPTION OF THE DRAWINGS

[0044] FIGs. 1A-1H depict genetic engineering of the porcine EPSCs for xenotransplantation. FIG. 1A shows four rounds of genetic targeting were performed at the pig expanded potential stem cells (EPSCs) genome. The first round of targeting uses 3 pairs of gRNAs to directly generate the triple knockout (TKO) porcine EPSCs. The second round of targeting knocked out the growth hormone receptor GHR and generated quadrable KO (QKO) porcine EPSC. The third targeting was to generate the recombinase mediated cassette exchange (RMCE) master cell line, by knock in (KI) lox66-puroΔTK-lox2272 cassette at the ROSA26 locus. The fourth targeting was to introduce the human CD47 cDNA to the QKO-RMCE master cell line by cassette exchange, thus generated the QKO-hCD47-EPSCs. FIG. 1B shows a schematic view of the RMCE at the ROSA26 locus. FIG. 1C shows genotyping summary of TKO efficiency. FIG. 1D shows genotyping summary of GHRKO efficiency based on TKO-EPSCs. FIG. 1E shows Sanger sequencing showing out-of-frame genomic deletion of QKO in four genes (GGTA1 / CMAH / B4GALNT2 / GHR) . FIG. 1F shows agarose gel image showing the QKO-EPSC genotyping results. FIG. 1G shows genotyping summary of RMCE, lox66-puroΔTK-lox2272 knock-in efficiency. FIG. 1H shows genotyping summary of hCD47 integration efficiency.

[0045] FIGs. 2A-2E depict EGFP integration at ROSA26 locus by RMCE in QKO-EPSCs. FIG. 2A shows the genotyping strategy. FIG. 2B shows genotyping results of EGFP integration at ROSA26 locus. FIG. 2C shows EGFP targeting efficiency. FIG. 2D shows Sanger sequencing results of EGFP integration. FIG. 2E shows expression of EGFP.

[0046] FIG. 3 shows a schematic view of human CD47 integration in PK7-QKO-RMCE master cell line.

[0047] FIGs. 4A-4E depict human CD47 integration at ROSA26 locus by RMCE in QKO-EPSCs. FIG. 4A shows genotyping results of human CD47 integration at ROSA26 locus. FIG. 4B the genotyping strategy. FIG. 4C shows human CD47 targeting efficiency. FIG. 4D shows hCD47-QKO-EPSC brightfield images. FIG. 4E shows Sanger sequencing results of CD47 integration.

[0048] FIG. 5 shows immunofluorescence images of wildtype and gene-edited porcine EPSCs.

[0049] FIG. 6 shows histological analysis of teratomas from porcine wildtype, TKO and QKO-hCD47 EPSC lines.

[0050] FIGs. 7A-7F show evaluation of immune responses of porcine EPSC-derived endothelial cells. FIG. 7A shows a schematic flowchart of directed differentiation from porcine EPSCs to endothelial cells. FIG. 7B shows porcine EPSCs are poor immunogenic without α-Gal expression while EPSC-derived endothelial cells show strong immunogenicity. FIG. 7C shows images of directed endothelial cell differentiation from EPSCs. FIG. 7D shows flow cytometry analysis of CD31 expression on porcine EPSC-derived endothelial cells. FIG. 7E shows PCA distribution of the different cell populations. FIG. 7F shows endothelial specific marker gene expression of WT-EPSC, Q47-EPSC, WT-endo, Q47-endo, PEF, PED. WT-EPSC, wildtype EPSC; Q47-EPSC, QKO-hCD47-EPSC; WT-endo, wildtype EPSC-derived endothelial cells; Q47-endo, QKO-hCD47-EPSC-derived endothelial cells; PED, porcine immortalized endothelial cells; PEF, porcine fibroblasts.

[0051] FIGs. 8A-8D show limited xeno-antigen expression in porcine EPSCs. FIG. 8A shows a schematic figure showing the normal EPSCs express Neu5Gc and Sda glycan epitope, with no α-Gal expression. FIG. 8B shows undetected DBA-lectin (Sda, by B4GALNT2) on QKO-hCD47-EPSCs by immunofluorescence analysis. Both normal PK7-WT-EPSC and QKO-hCD47-EPSCs were negative for IB4-lectin expression (α-Gal, by GGTA1) . Normal PK7-WT-EPSCs were positive control. FIG. 8C shows after feeder-free culture, Neu5Gc (by CMAH) was not detected on QKO-hCD47-EPSCs by flowcytometry analysis. Normal PK7-WT-EPSCs were positive control. FIG. 8D shows human CD47 expression on QKO-hCD47-EPSCs by immunofluorescence analysis. Normal PK7-WT-EPSCs were negative control.

[0052] FIGs. 9A-9G show evaluation of immune responses of porcine EPSC-derived endothelial cells. FIG. 9A shows genetically engineered porcine EPSCs-derived endothelial cells having reduced immunogenicity. FIG. 9B shows undetected ISB4-lectin (α-Gal, by GGTA1) on Q47-EPSC-derived endothelial cells by flowcytometry. WT-EPSC-derived endothelial cells were positive control. FIG. 9C shows results of complement mediated cytotoxicity assay. FIG. 9D shows calculation of normalized dead cell percentage and results of complement mediated cytotoxicity assay. FIG. 9E shows immunofluorescent images of human antibody binding assays. FIG. 9F shows flow results of human antibody binding assays. FIG. 9G shows macrophage phagocytosis activity in Q47-EPSC-derived endothelial cells, compared to WT-EPSC-derived endothelial cells and PED.DETAILED DESCRIPTION OF THE INVENTION

[0053] The present invention provides compositions comprising porcine totipotent / pluripotent stem cells (such as porcine Expanded Potential Stem Cells (EPSCs) ) , methods of using porcine totipotent / pluripotent stem cells (such as porcine EPSCs) and / or cells differentiated therefrom in xenotransplantation, and methods and systems of in vitro evaluation of suitability of compositions (such as cells, tissues, and / or organs) for xenotransplantation.

[0054] Porcine Expanded Potential Stem Cells (pEPSCs) derived from pre-implantation embryos are genetically and epigenetically stable in long term culture, have broad developmental potential in vitro and in vivo, and permit efficient precision genome editing.

[0055] Aside from these advantages, totipotent / pluripotent stem cells (such as pEPSCs) can be directly differentiated into cells such as endothelial cells, which can be used in assessment of various aspects such as coagulation regulation, expression of xeno-antigens, adhesion molecules, chemokines, and costimulatory factors. Totipotent / pluripotent stem cells (such as pEPSCs) can directly differentiate into cells / organoids such as endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids, which can be used in evaluating suitability of a composition comprising totipotent stem cells and / or pluripotent stem cells for xenotransplantation, such as cardiac, liver, skin, islet, gut, RPE, renal transplantation, and blood transfusion. The developmental potential of porcine EPSCs allows for the establishment of in vitro evaluation system for assessing the outcomes of gene editing (such as potential immune responses) . This approach is advantageous as the conventional fibroblast-based method requires tedious procedures to obtain a pig embryo / fetus or reprogramming of cells to obtain induced pluripotent stem cells (iPSCs) before evaluating the editing outcomes. By understanding and manipulating the editing outcomes, we can improve graft functioning, reduce the risk of clotting, thrombosis, immune rejection, and endothelial cell activation, and ultimately enhance the success and viability of xenotransplantation procedures. This provides a valuable tool for evaluating immune responses and evaluating the compatibility of pig endothelial cells with the human vascular system during pig-to-human xenotransplantation while bypassing the requirement of generating cloned animals.

[0056] The invention described herein relates, in part, to a composition comprising porcine totipotent / pluripotent stem cells (such as porcine Expanded Potential Stem Cells (EPSCs) ) , wherein the porcine totipotent / pluripotent stem cells are genetically modified. The invention described herein also relates, in part, to a method of xenotransplantation, comprising introducing a composition comprising genetically modified porcine totipotent / pluripotent stem cells (such as porcine Expanded Potential Stem Cells (EPSCs) ) to an individual in need thereof. The invention described herein also relates, in part, to an in vitro evaluation system for evaluating suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, wherein the system comprises cells and / or organoids differentiated from the totipotent / pluripotent stem cells. The invention described herein also relates, in part, to a method of evaluating the suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, comprising evaluation of immune responses caused by the totipotent / pluripotent stem cells and / or organoids differentiated from the totipotent / pluripotent stem cells. Furthermore, the invention described herein relates, in part, to a method of generating a population of endothelial cells from porcine EPSCs. The compositions and methods disclosed herein provide a solution for efficient and precise genetic engineering of porcine cells for the generation of tissues and organs for xenotransplantation. The compositions and methods disclosed herein also provide a solution for rapid and accurate evaluation of immune responses of engineered porcine cells to evaluate the suitability to be used in xenotransplantation.

[0057] One aspect of the invention relates to a composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in TP53.

[0058] Another aspect of the invention relates to a composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in a xeno-antigen related gene.

[0059] Another aspect of the invention relates to a method of xenotransplantation, comprising introducing a composition disclosed herein to an individual in need thereof.

[0060] Another aspect of the invention relates to an in vitro evaluation system for evaluating suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, wherein the system comprises cells and / or organoids differentiated from the totipotent / pluripotent stem cells.

[0061] Another aspect of the invention relates to a method of evaluating the suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, comprising evaluation of immune responses caused by the totipotent / pluripotent stem cells and / or organoids differentiated from the totipotent / pluripotent stem cells.

[0062] Yet another aspect of the invention relates to a method of generating a population of endothelial cells from porcine EPSCs, comprising (a) subjecting the porcine EPSCs to a first condition that differentiates the EPSC into mesodermal cells; and (b) subjecting the mesodermal cells to a second condition that differentiates the mesodermal cells into endothelial cells.

[0063] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0064] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. I. Definitions

[0065] A number of terms and concepts are discussed below. They are intended to facilitate the understanding of various embodiments of the invention in conjunction with the rest of the present disclosure and the accompanying figures. These terms and concepts may be further clarified and understood based on the accepted conventions in the fields of the present invention and the description provided throughout the present disclosure and / or the accompanying figures. Some other terms can be explicitly or implicitly defined in other sections of this disclosure and in the accompanying figures and may be used and understood based on the accepted conventions in the fields of the present invention, the description provided throughout the present disclosure and / or the accompanying figures. The terms not explicitly defined can also be defined and understood based on the accepted conventions in the fields of the present invention and interpreted in the context of the present disclosure and / or the accompanying figures.

[0066] As used herein, the terms “a, ” “an, ” and “the” can refer to “one, ” “one or more” or “at least one, ” unless specifically noted otherwise.

[0067] The terms “about” or “approximately” are used herein to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or simply error-tolerance of a value. For example, the terms “about” or “approximately” may mean±1%, ±5%, ±10%, ±15%or ±20%variation from a predetermined value.

[0068] As used herein, the terms “isolate, ” “separate” or “purify” and the related terms are not used necessarily to refer to the removal of all materials other than the components of interest from a sample. Instead, in some embodiments, the terms are used to refer to a procedure that enriches the amount of one or more components of interest relative to one or more other components present in the sample. In some embodiments, “isolation, ” “separation” or “purification” may be used to remove or decrease the amount of one or more components from a sample. For example, the expression “an isolated cell” can refer to a cell that has been substantially separated or purified away from other cells of a cell culture or an organism.

[0069] The term “derived” and the related expressions referring to cells or a biological sample indicate that the cell or sample was obtained from the stated source at some point in time. For example, a cell derived from an organism can represent a primary cell obtained directly from the individual (that is, unmodified) , or it can be modified, for example, by introduction of a recombinant vector, by exposure to or culturing under particular conditions, or immortalization. In some cases, a cell derived from a given source will undergo cell division and / or differentiation such that the original cell no longer exists, but the continuing cells will be understood to derive from the same source. The term “derive, ” “derivation” and the related terms and expressions can also be used in this disclosure to refer to creation of a cell population, cell, or culture from a different starting or preceding cell population, cell, or culture. For example, an endothelial cell described in the present disclosure can be described as being derived from an expanded potential stem cell (EPSC) .

[0070] The term “comprising” and the related terms ( “comprise, ” “comprises, ” etc. ) , when used in this disclosure to describe various embodiments of the invention, are open-ended, meaning that they do not exclude additional elements and synonymous with terms “including, ” “containing” or “having. ” When an embodiment of the invention is described using the term “comprising, ” it is intended to include the embodiments, in which the term comprising is replaced with the terms “consisting of” or “consisting essentially of” In other words, the description of the embodiments of the invention described in this disclosure using the term “comprising” and the related terms also provides the description of the related embodiments that use “consisting of” or “consisting essentially of” instead of “comprising” . The term “consisting of” excludes any elements (steps, ingredient etc. ) not specified in the description. The term “consisting essentially of” is intended to exclude only those elements not specified in the description that do not materially affect the basic and novel characteristics of the embodiment.

[0071] The term “stem cell” refers to an undifferentiated cell which is capable of proliferation, self-renewal and giving rise to more progenitor or precursor cells having the ability to generate many mother cells that can in turn give rise to differentiated, or differentiable, daughter cells. The daughter cells can for example be induced to proliferate and produce progeny cells that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential. All stem cells have three important properties: (1) they are unspecialized, (2) are capable of continuous division and self-renewal, and (3) are capable of differentiation into specialized cells. According to the developmental potential, there are totipotent cells (e.g., zygotes) , pluripotent stem cells (e.g., ESC, iPSC) and unipotent stem cells (e.g., neural stem cells, and muscular stem cell) . Thus, stem cells include embryonic stem cells, pluripotent stem cells, and unipotent stem cells of various types and from various sources.

[0072] “Cell potency” describes a cell's ability to differentiate into other cell types. A cell can be designated as a pluripotent cell, a multipotent cell (which can differentiate into several but not all cell types, for example, umbilical cord blood stem cells and mesenchymal stem cells) or an oligopotent cell (having the ability to differentiate into a few cell types, for example, lymphoid cells or vascular cells) . Under current understanding, potency exists on a continuum. Thusly, the boundaries between the divisions of cells based on potency may be fluid and are not necessarily limiting.

[0073] “Totipotent stem cells” are cells that have the capacity to self-renew by dividing and to develop into the three primary germ cell layers of the early embryo and into extra-embryonic tissues such as the placenta.

[0074] “Pluripotent stem cells” are cells which exhibit an undifferentiated phenotype and are potentially capable of differentiating into any fetal or adult cell type of any of the three germ layers (endoderm, mesoderm, and endoderm) . A pluripotent stem cell is distinct from a totipotent stem cell and generally cannot give rise to extraembryonic cell lineages.

[0075] The term “expanded potential stem cells” or “EPSCs” as used herein refer to pluripotent stem cells with an improved ability to generate extraembryonic lineages. The EPSCs as described herein can be derived from preimplantation embryos of multiple species of mammals, including but not limited to pigs, mice, humans, and cows.

[0076] “Differentiation” is the process by which a less specialized cell becomes a more specialized cell type. For example, early development of a multicellular animal is characterized by the rapid proliferation of embryonic cells, which then differentiate to produce the many specialized types of cells that make up the tissues and organs of the multicellular animal. As cells differentiate, their rate of proliferation usually decreases. Some types of differentiated cells never divide again, but many differentiated cells are able to resume proliferation as required to replace cells that have been lost as a result of injury or cell death. Some cells divide continuously throughout life to replace cells that have a high rate of turnover in adult multicellular animals. Examples of differentiated cells include fibroblasts, hepatocytes, cardiomyocytes, myoblasts, neurons, osteoclasts, and lymphocytes.

[0077] The expression “modified cells” and the related terms and expressions encompass all cells that have been or are derived from the cells that have been artificially modified, by any methods, as compared to the original or cells from which they are derived. Modified cells can be produced from primary cells, secondary cells, stem cells, cultured cells and / or other modified cells. Modifications include, but are not limited to, genetic modification or engineering, in which case modified cells can be referred to as “genetically modified” or “genetically engineered. ” Genetic modification can be accomplished by various methods that result in incorporation of foreign or heterologous nucleic acids into the cells being modified. Some examples of such methods are transduction by a virus or a viral vector, or transfection of isolated nucleic acids into cells through transient pores in the cell membrane. Other modifications include exposing the source cells to biological and non-biological molecules or factors or culture conditions. Some examples of modified cells are iPSCs, genetically modified cells, including those used for gene therapies, one example being gene-edited cells, such as those modified using CRISPR / Cas9, TALENs or ZFNs.

[0078] The term “passage, ” “passaging” and the related terms and expressions used in the context of cell culture refer to subculturing, which typically involves transfer of cells from a previous culture into a fresh growth medium. Passaging is performed to ensure propagation of cells in culture. Cell proliferation in culture reduced or ceases when the cells reduce the capacity of the culture vessels and / or media to support further cell growth. For example, cells in adherent cultures may occupy all the available substrate and have no room left for expansion, while cells in suspension cultures exceed the capacity of the medium to support further growth. To keep cells in a culture at an optimal density for continued growth and to stimulate further proliferation, the culture must be expanded and fresh medium supplied. To divide the culture of adherent cells, for example, a monolayer culture of cells, such as cultures of differentiating EPSCs described on the present disclosure, the cells are first dissociated, for example, by enzymatic dissociation. Enzymatic dissociation can be performed by removing the incubation medium from the plates, adding to the plates a buffer, such as PBS and an enzymatic dissociation reagent, such as Accutase, TrypLE or Trypsin (available, for example, from Thermo Fisher Scientific) , incubating the cells with the buffer and dissociation reagent under appropriate conditions, and harvesting the resulting dissociated cells by centrifugation, sedimentation, filtering or other appropriate methods. The dissociated cells are transferred into similar or equivalent reaction vessels with fresh media, to result in a lower cell density.

[0079] As used herein, “Cre” refers to the enzyme expression product of the cre gene which is a recombinase that effects site-specific recombination of DNA at lox sites (see definition below) . One cre gene can be isolated from bacteriophage P1 by methods known in the art, for instance, as disclosed by Abremski et al., Cell, 32: 1301-1311 (1983) , the entire disclosure of which is incorporated herein by reference.

[0080] As used herein, “Lox site” refers to a nucleotide sequence at which the gene product of the cre gene, referred to herein as "Cre, " can catalyze a site-specific recombination. A LoxP site is a 34 base pair nucleotide sequence which can be isolated from bacteriophage P1 by methods known in the art. One method for isolating a LoxP site from bacteriophage P1 is disclosed by Hoess et al., Proc. Natl. Acad. Sci. USA, 79: 3398 (1982) , the entire disclosure of which is hereby incorporated herein by reference.

[0081] As used herein, “marker” refers to any molecule that can be observed or detected. For example, a marker can include, but is not limited to, a nucleic acid, such as a transcript of a specific gene, a polypeptide product of a gene, a non-gene product polypeptide, a glycoprotein, a carbohydrate, a glycolipid, a lipid, a lipoprotein or a small molecule (for example, molecules having a molecular weight of less than 10,000 AMU) . When a presence, absence of amount of a marker can be experimentally observed or detected, such a marker or its amount can be described as “observable” or “detectable. ” The presence or absence of the markers, as applied to the embodiments of the preset invention, means detectable presence or absence of the markers as detected by applicable methods for detecting such markers, and may mean certain detectable or undetectable levels of such markers. In other words, the presence may mean the presence above a certain detectable level, while the absence may mean the absence below a certain detectable level and not necessarily zero detectable level. For most markers described herein, the symbols provided are those developed and / or recognized by HUGO Gene Nomenclature Committee of European Bioinformatics Institute. II. Genetically Modified Porcine Totipotent / Pluripotent Stem Cells

[0082] The present application in one aspect provides a composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in TP53. In some embodiments, the porcine totipotent / pluripotent stem cells are further modified to contain an inactivating mutation in a xeno-antigen related gene. In some embodiments, the xeno-antigen related gene is selected from the group consisting of GGTA1, CMAH, and B4GALNT2. In some embodiments, the EPSCs further contain an inactivating mutation in a gene associated with organ growth. In some embodiments, the gene associated with organ growth is GHR. In some embodiments, the inactivating mutation is a gene knockout. In some embodiments, the porcine totipotent / pluripotent stem cells further comprise a heterologous nucleic acid. In some embodiments, the heterologous nucleic acid encodes an immune modulating protein.

[0083] The present application in one aspect provides a composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in a xeno-antigen related gene. In some embodiments, the xeno-antigen related gene is selected from the group consisting of GGTA1, CMAH, and B4GALNT2. In some embodiments, the porcine totipotent / pluripotent stem cells further contain an inactivating mutation in a gene associated with organ growth. In some embodiments, the gene associated with organ growth is GHR. In some embodiments, the inactivating mutation is a gene knockout. In some embodiments, the porcine totipotent / pluripotent stem cells further comprise a heterologous nucleic acid. In some embodiments, the heterologous nucleic acid encodes an immune modulating protein.

[0084] In some embodiments, the porcine totipotent / pluripotent stem cells are Expanded Potential Stem Cells (EPSCs) . 1. Genes of Interest for Modification

[0085] In one aspect, there is provided a composition comprising porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) , wherein the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) are genetically modified to contain an inactivating mutation in a gene of interest. In some embodiments, the gene of interest is TP53. In some embodiments, the gene of interest is a xeno-antigen related gene.

[0086] The tumor protein gene TP53 is considered as a central monitor in the cell and can be activated by anoxia, inappropriate oncogene signa-ling or DNA damage. In non-stressed, healthy cells, the pro-apoptotic protein p53 encoded by TP53 has a short half-life (20 min) . When the cell is stressed, p53 undergoes post-transcriptional modifications with an increase in its half-life. After that, transcription of many genes is triggered into two broad categories: Those that cause cell cycle arrest and those that cause apoptosis. If DNA damage can be repaired during cell cycle arrest, the cell continues to a normal state; if the repair fails, p53 induces apoptosis.

[0087] Ischemia reperfusion injury (IRI) remains a critical clinical issue in organ transplantation. It is associated with a higher incidence of acute and chronic rejection as well as long-term morbidity and mortality. Apoptosis is a major occurrence of IRI during organ transplantation. During reperfusion, both endothelial cells and parenchymal cells are susceptible to apoptosis or programmed cell death. It has been suggested that p53 has an important role in modulating apoptosis in xenotransplantation.

[0088] In some embodiments, there is provided a composition comprising porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) , wherein the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) are genetically modified to contain an inactivating mutation in TP53. In some embodiments, the inactivating mutation is a gene knockout. In some embodiments, the inactivating mutation is gene knockdown. In some embodiments, the inactivating mutation comprises a point mutation, a deletion, and / or an insertion. In some embodiments, the knocking out or knocking down of TP53 reduces apoptosis in xenotransplantation.

[0089] Hyperacute rejection is mediated by the xenoreactive natural antibodies (XNAs) from the recipient and occur within minutes or hours after the restoration of xenograft blood circulation. XNAs bind to the xenoantigens of the xenograft and activate the classical complement pathway in the recipient, resulting in interstitial hemorrhage, edema and thrombosis of the xenograft, and finally leading to inactivation and necrosis of the xenograft within a few minutes or hours. One main xenoantigen recognized by XNAs is galactose-α1, 3-galactose (α-Gal) . α-Gal is expressed by α-1, 3-galactosyltransferase (GGTA1) gene located in Chromosome 1, and functions in pigs, but not in human beings, apes, or Old World monkeys.

[0090] In addition to α-Gal, two other non-Gal epitopes present an additional barrier to xenotransplantation. One is N-glycolylneuraminic acid (Neu5Gc) , which is encoded by CMP-N-acetylneuraminic acid hydroxylase (CMAH) gene (Song et al., 2010) . The other is the SDa blood group, which is produced by beta-1, 4-N-acetyl-galactosaminyltransferase 2 (β4GALNT2) .

[0091] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are genetically modified to contain an inactivating mutation in a xeno-antigen related gene. In some embodiments, the xeno-antigen related gene is selected from the group consisting of GGTA1, CMAH, and B4GALNT2. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are genetically modified to contain an inactivating mutation in GGTA1. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are genetically modified to contain an inactivating mutation in CMAH. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are genetically modified to contain an inactivating mutation in B4GALNT2. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are genetically modified to contain inactivating mutations in GGTA1, CMAH, and B4GALNT2. In some embodiments, the inactivating mutation is a gene knockout. In some embodiments, the inactivating mutation is gene knockdown. In some embodiments, the inactivating mutation comprises a point mutation, a deletion, and / or an insertion. In some embodiments, the knocking out or knocking down of a xeno-antigen related gene (such as GGTA1, CMAH, and B4GALNT2) helps prevent hyperacute rejection.

[0092] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are further genetically modified to contain an inactivating mutation in a gene associated with organ growth. In some embodiments, the gene associated with organ growth is Growth Hormone Receptor (GHR) . The protein growth hormone receptor is embedded in the outer membrane of cells throughout the body and can bind to growth hormone. The binding of growth hormone stimulates the growth and division of cells. In some embodiments, the inactivating mutation is a gene knockout. In some embodiments, the knocking out of GHR helps control the overgrowth of the xenograft.

[0093] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are further genetically modified to contain an inactivating mutation in porcine endogenous retroviruses (PERV) . PERV is incorporated into the pig genome in the form of proviral DNA and replicates as the cells proliferate. PERV was integrated into the pig genome more than six million years ago, and formed three subtypes (PERV-A, PERV-B and PERV-C) . Two subtypes of PERV-A and -B can be found in the genome of all pigs, and both of which can infect human cells. PERVs are harmless to pigs, however, whether they are potential harmful to humans remains unclear. PERVs have been verified to be transmitted from pig to human in vitro. Since xenotransplant recipients are under strong immunosuppression, it is desirable to avoid PERV infection.

[0094] A number of gene editing tools might be suitable for engineering the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention to introduce the inactivating mutation. Examples of gene editing tools include but are not limited to (1) clustered regularly interspaced short palindromic repeats (CRISPR) -CRISPR-associated protein (Cas) , (2) transcription activator-like effector nucleases (TALENs) , (3) zinc-finger nucleases (ZFNs) , and (4) homing endonucleases or meganucleases.

[0095] CRISPR is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria and archaea. These sequences are derived from DNA fragments of bacteriophages that had previously infected the prokaryote. They are used to detect and destroy DNA from similar bacteriophages during subsequent infections. CRISPR-Cas systems are composed of CRISPR repeat-spacer arrays, which can be further transcribed into CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA) , and a set of CRISPR-associated (cas) genes which encode Cas proteins with endonuclease activity. CRISPR-Cas systems can be classified into 2 classes (Class 1 and Class 2) , 6 types (I to VI) and several subtypes, with multi-Cas protein effector complexes in Class 1 systems (Type I, III, and IV) and a single effector protein in Class 2 systems (Type II, V, and VI) . Type II CRISPR-Cas9 system derived from Streptococcus pyogenes (SpCas9) is one of the best characterized and most commonly used category in numerous CRISPR-Cas systems. The main components of CRISPR-Cas9 system are RNA-guided Cas9 endonuclease and a single-guide RNA (sgRNA) . The Cas9 protein possesses two nuclease domains, named HNH and RuvC, and each cleaves one strand of the target double-stranded DNA. A single-guide RNA (sgRNA) is a simplified combination of crRNA and tracrRNA. The Cas9 nuclease and sgRNA form a Cas9 ribonucleoprotein (RNP) , which can bind and cleave the specific DNA target. Furthermore, a protospacer adjacent motif (PAM) sequence is required for Cas9 protein’s binding to the target DNA. In some embodiments, more than one genes of interest are modified in one round of gene editing using CRISPR / Cas. For example, GGTA1, CMAH, and B4GALNT2 are edited simultaneously by introducing sgRNAs targeting the genes into EPSCs simultaneously (e.g., in one electroporation) .

[0096] ZFNs are fusions between a custom-designed Cys2-His2 zinc-finger protein and the cleavage domain of the FokI restriction endonuclease. ZFNs function as dimers, with each monomer recognizing a specific “half site” sequence-typically nine to 18 base pairs (bps) of DNA-via the zinc-finger DNA-binding domain.

[0097] TALENs are structurally similar to ZFNs. Both methods use the Fokl nuclease to cut DNA and require dimerization to function, however, the DNA binding domains differ. TALENs use transcription activator-like effectors (TALEs) , tandem arrays of 33-35 amino acid repeats. The amino acid repeats possess single-nucleotide recognition, thereby increasing targeting capabilities and specificity compared to ZFNs.

[0098] Homing endonucleases, also known as meganucleases are a collection of naturally occurring enzymes that recognize and cleave long DNA sequences (14–40 bps) . These enzymes make extensive sequence-specific contacts with their DNA substrate and thus typically show exquisite specificity.

[0099] Base editing is a relatively new method of genome editing derived from CRISPR-Cas9. Unlike traditional CRISPR systems, base editors (BEs) do not induce double-stranded breaks in the genome. Base editing systems, use a ‘catalytically dead’ Cas9 (dCas9) , which cannot cleave DNA, fused to bacterial enzymes called DNA deaminases. Cytidine deaminases, which induce C to T substitutions, are naturally occurring in bacteria, while adenine deaminases, which induce A to G substitutions, were engineered from bacterial enzymes specifically for base editing purposes. Fusing dCas9 to either a cytidine deaminase (CBEs) or an adenine deaminase (ABEs) and providing a sgRNA to direct it to the target sequence, allows researchers to introduce substitutions in DNA.

[0100] To introduce inactivating mutations in a totipotent / pluripotent stem cell (such as an Expanded Potential Stem Cell (EPSC) ) , in some embodiments, the totipotent / pluripotent stem cell (such as an Expanded Potential Stem Cell (EPSC) ) is refreshed in 10%FBS in pig EPSC medium, after which guide RNAs (such as sgRNAs) and a Cas enzyme (such as Cas9) are introduced into the EPSC by methods such as electroporation. After introduction of the guide RNAs and the Cas enzyme, the totipotent / pluripotent stem cell (such as an Expanded Potential Stem Cell (EPSC) ) is seeded in feeder wells with 10%FBS in pig EPSC medium plus Y27632, which inhibits the protein kinase p160ROCK. The totipotent / pluripotent stem cell (such as an Expanded Potential Stem Cell (EPSC) ) is changed to normal pig EPSC medium the next day. In some embodiments, the single electroporated pig totipotent / pluripotent stem cell (such as an Expanded Potential Stem Cell (EPSC) ) -derived colonies would emerge after about 10 days. 2. Heterologous Nucleic Acid

[0101] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise additional modifications. For instance, in some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention comprise a heterologous nucleic acid. In some embodiments, the heterologous nucleic acid encodes an immune modulating protein. The immune modulating protein may be a protein involved in complement activation (such as human CD46, human CD55, human CD59) , coagulation regulation (such as human thrombomodulin, human endothelial protein C receptor, and human Von Willebrand factor (VWF) ) , immune modulation (such as human CD47, HLA-E, HLA-G) , and inflammation control (such as human HO-1, A20) . In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human CD46. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human CD55. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human CD59. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human thrombomodulin. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human endothelial protein C receptor. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human CD47. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding HLA-E. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human HLA-G. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human HO-1. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding human A20.

[0102] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding CD47 (such as human CD47) . Human CD47 plays a crucial role in the “don’ t eat me” signal transmitted to macrophages. In the context of pig-to-human xenotransplantation, the expression of porcine CD47 on the cell surface hampers the effective transmission of this self-tolerance signal to human macrophages, leading to the phagocytosis of porcine xenografts. CD47 on the cell surface can protect against phagocytosis by macrophages by binding to the inhibitory macrophage receptor SIRPa.

[0103] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention further comprise a heterologous nucleic acid encoding a selectable marker molecule. The selectable marker molecule facilitates selection of cells into which the heterologous nucleic acid has been introduced (see, e.g., U.S. Pat. Nos. 4,399,216, 4,634,665 and 5,179,017, all by Axel et al. ) . For example, the selectable marker molecule can confer resistance to drugs on porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) into which the heterologous nucleic acid has been introduced.

[0104] A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., Cell 11: 223 (1977) ) , hypoxanthine-guanine phosphoribosyltransferase (Szybalska &Szybalski, Proc. Natl. Acad. Sci. USA 48: 202 (1992) ) , and adenine phosphoribosyltransferase (Lowy et al., Cell 22: 817 (1980) ) genes can be employed in tk-, hgprt-, or aprt-cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77: 357 (1980) ; O'Hare et al., Proc. Natl. Acad. Sci. USA 78: 1527 (1981) ) ; gpt, which confers resistance to mycophenolic acid (Mulligan &Berg, Proc. Natl. Acad. Sci. USA 78: 2072 (1981) ) ; neo, which confers resistance to the aminoglycoside G-418 Clinical Pharmacy 12: 488-505; Wu and Wu, Biotherapy 3: 87-95 (1991) ; Tolstoshev, Ann. Rev. Pharnacol. Toxicol. 32: 573-596 (1993) ; Mulligan, Science 260: 926-932 (1993) ; and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993) ; TIB TECH 11 (5) : 155-215 (1993) ) ; and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30: 147 (1984) ) . Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al. (eds. ) , Current Protocols in Molecular Biology, John Wiley &Sons, N Y (1993) ; Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, N Y (1990) ; and in Chapters 12 and 13, Dracopoli et al. (eds) , Current Protocols in Human Genetics, John Wiley &Sons, N Y (1994) ; Colberre-Garapin et al., J. Mol. Biol. 150: 1 (1981) .

[0105] In some embodiments, the selectable marker molecule is Blasticidin S deaminase (BSD) (Izumi, et al., Exp Cell Res, 197: 229-33, 1991) . Blasticidin S is an antibiotic that is used in biology research for selecting cells in cell culture. Cells can be modified to express the blasticidin resistance genes BSD or bsr, and can then survive treatment with the antibiotic. Blasticidin S is a nucleoside analogue antibiotic, resembling the nucleoside cytidine. Blasticidin works against human cells, fungi, and bacteria, all by disrupting protein translation. Cells of interest express the blasticidin S resistance genes BSD or bsr, and can then survive blasticidin S being added to the culture media.

[0106] In some embodiments, the selectable marker is a neomycin resistance gene. In some embodiments, the selectable marker is a bacterial neomycin resistance gene, for example, neo. Cells that express the neomycin resistance gene are resistant to neomycin and can be selected in G418-containing media;

[0107] In some embodiments, the selectable marker molecule is puroΔTK. PuroΔTK is a fusion of puromycin N-acetyltransferase (Puro) to a truncated version of herpes simplex virus type 1 thymidine kinase (ΔTK) . Cells that express PuroΔTK are resistant to puromycin and sensitive to 1- (-2-deoxy-2-fluoro-1-β-D-arabino-furanosyl) -5-iodouracil (FIAU) . PuroΔTK functions as a fusion protein and retains the full activity of its components for both positive and negative selection. Selection of cells can be initiated by puromycin and various concentrations of FIAU, for example, 2 μg / ml puromycin and 2 μM Ganciclovir.

[0108] In some embodiments, the heterologous nucleic acid (such as one encoding human CD47 or one encoding puroΔTK) is integrated into the genome of the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) at a safe harbor locus. A safe harbor locus is a place in the genome which allows for expression of an inserted transgene without the risk of affecting surrounding endogenous genes. Inserting a heterologous nucleic acid at a safe harbor locus can avoid undesirable effects such as unstable phenotypes, gene silencing, or unexpected gene expression. In some embodiments, the safe harbor locus is selected from the group consisting of ROSA26 and pH11.

[0109] In some embodiments, the safe harbor locus is ROSA26. Rosa26 is ubiquitously expressed in embryonic as well as adult tissues. Targeting the heterologous nucleic acid to the Rosa26 locus is a desirable method to create modified cells consistently expressing the heterologous nucleic acid at a high level. Thus in some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) comprise a heterologous nucleic acid encoding CD47, wherein the heterologous nucleic acid is integrated at ROSA26 to obtain consistent expression of CD47.

[0110] In some embodiments, a heterologous nucleic acid (such as one encoding CD47) is integrated into the genome of the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) via cassette exchange mediated by a recombinase. In some embodiments, the recombinase is a Cre recombinase. In some embodiments, the heterologous nucleic acid comprises a lox site at a 5’ end and a 3’ end of the heterologous nucleic acid.

[0111] Cre recombinase (Cre) is a 343-amino-acid protein comprised of 4 subunits that recognizes pairs of specific 34 bp DNA sequences called loxP sites. It initially creates a DNA loop and then either excises or inverts the looped segment depending on the orientation of the loxP sites.

[0112] LoxP (locus of X-over P1) is a site on the bacteriophage P1 consisting of 34 bp. The site includes an asymmetric 8 bp sequence, variable except for the middle two bases, in between two sets of symmetric, 13 bp sequences. The 13 bp sequences are palindromic but the 8 bp spacer is not, thus giving the loxP sequence a certain direction. The LoxP site consists of two 13 base pair inverted repeats separated by an 8 base pair spacer region.

[0113] When cells that have loxP sites in their genome express Cre, a recombination event can occur between the loxP sites. Usually loxP sites come in pairs for genetic manipulation. Cre recombinase proteins bind to the first and last 13 bp regions of a lox site forming a dimer. This dimer then binds to a dimer on another lox site to form a tetramer. Lox sites are directional and the two sites joined by the tetramer are parallel in orientation. The double stranded DNA is cut at both loxP sites by the Cre protein. The strands are then rejoined with DNA ligase in a quick and efficient process. The result of recombination depends on the orientation of the loxP sites. Upon Cre-mediated recombination, the sequence flanked by loxP (floxed) will be excised and recombined, leaving one loxP sequence, if the two loxP sequences are initially in the same orientation. The two loxP sequences are brought close to each other by forming a loop with the floxed sequence and excised by Cre recombinase. On the other hand, if the loxP sequences are in the reverse orientation, the target sequence will be inverted and no excision occurs.

[0114] In some embodiments, the heterologous nucleic acid comprises modified lox sites to increase the efficiency of Cre‐mediated insertion or replacement. Suitable modified lox sites include but are not limited to: lox2272, lox71, and lox66. In some embodiments, the heterologous nucleic acid (such as one encoding CD47) comprises a lox71 site at a 5’ end of the heterologous nucleic acid and a lox2272 sites at a 3’ end of the heterologous nucleic acid. In some embodiments, the heterologous nucleic acid (such as one encoding CD47) comprises a lox71 site at a 3’ end of the heterologous nucleic acid and a lox2272 sites at a 5’ end of the heterologous nucleic acid. In some embodiments, the heterologous nucleic acid (such as one encoding puroΔTK) comprises a lox66 site at a 5’ end of the heterologous nucleic acid and a lox2272 sites at a 3’ end of the heterologous nucleic acid. In some embodiments, the heterologous nucleic acid (such as one encoding puroΔTK) comprises a lox66 site at a 3’ end of the heterologous nucleic acid and a lox2272 sites at a 5’ end of the heterologous nucleic acid. In some embodiments, the modified lox sequences prevents the cycling of the fragment between the donor and porcine totipotent / pluripotent stem cells genome, ensuring high efficiency.

[0115] In some embodiments, a heterologous nucleic acid (such as one encoding a selectable marker molecule) flanked by homologous arm sequences (such as lox sites) is first integrated into the genome of the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) by CRISPR / Cas. For example, in some embodiments, a puroΔTK encoding sequence and lox66 and lox2272 sites flanking the puroΔTK encoding sequence are introduced into the genome of the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) by CRISPR / Cas9. The porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) comprising the puroΔTK encoding sequence and lox66 and lox2272 sites can then be used for the introduction of a second heterologous nucleic acid (such as one encoding CD47 and flanking lox71 and lox2272 sites) by recombination between the chromosomally located lox66 and the lox71 on the second heterologous nucleic acid.

[0116] In some embodiments, the heterologous nucleic acid can be integrated using FRT sites and flippase (Flp) recombinase from S. cerevisiae. The minimal FRT site sequence is 34 bp, for which Flp binds to both 13-bp arms flanking a 8 bp spacer, i.e. the site-specific recombination (region of crossover) in reverse orientation. FRT-mediated cleavage occurs just ahead from the asymmetric 8bp spacer region on the top strand and behind this sequence on the bottom strand. Several variant FRT sites exist, but recombination can usually occur only between two identical FRTs but generally not among non-identical FRTs.

[0117] Thus, in some embodiments, provided herein is composition comprising porcine Expanded Potential Stem Cells (EPSCs) that are genetically modified to contain an inactivating mutation in TP53, wherein the EPSCs are further modified to contain an inactivating mutation in a xeno-antigen related gene selected from the group consisting of GGTA1, CMAH, and B4GALNT2, and an inactivating mutation in a gene associated with organ growth such as GHR, wherein the inactivating mutation is a gene knockout introduced by CRISPR / Cas9, and wherein the EPSCs further comprise a heterologous nucleic acid encoding an immune modulating protein such as CD47, wherein the heterologous nucleic acid is integrated into the genome of the EPSCs by a CRE recombinase. 3. Characterization of Genetically Modified Porcine Totipotent / Pluripotent Stem Cells

[0118] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are genetically and epigenetically stable. For example, in some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention maintain the normal chromosome numbers (such as a porcine cell that has not undergone genetic modification) .

[0119] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention are pluripotent. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) express marker genes indicating pluripotency including but are not limited to: Oct4, Nanog, and Sox2. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) have broad differentiation potential. For instance, in some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) are capable of differentiating into cells and tissues of ectodermal, mesodermal, endodermal, and extraembryonic lineage. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) are capable of differentiating into cells and tissues including but are not limited to: pigmented tissues, striated muscle, smooth muscle, cartilage tissue, endothelium, and epithelium. In some embodiments, the EPSCs are capable of forming teratomas. 4. Source and Culturing of Porcine Totipotent / Pluripotent Stem Cells (such as Expanded  Potential Stem Cells (EPSCs) )

[0120] The porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present invention can be derived from a variety of sources. In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) are derived from pig pre-implantation embryos. Methods of derivation of porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) from pig pre-implantation embryos and culturing porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) are known in the art. See, e.g., Gao et al., Nat Cell Biol. 2019 June 01; 21 (6) : 687–699, which is incorporated herein in its entirety. In some embodiments, the EPSCs are cultured in an EPSC medium which comprises an N2B27 basal medium supplemented CHIR99021, A419, XAV939, IWR-1, Vitamin C, LIF, and Activin. III. Method of Xenotransplantation

[0121] The present application in one aspect provides a method of xenotransplantation, comprising introducing a composition disclosed herein to an individual in need thereof. In some embodiments, the method of xenotransplantation comprises introducing a cell, tissue or an organ derived from a composition disclosed herein to an individual in need thereof.

[0122] In some embodiments, the individual in need of xenotransplantation is a non-human primate. The transplantation of whole porcine organs into non-human primates has been reviewed (see for example Ekser et al., Transplant Immun. 2009 21: 87-92; Ekser and Cooper. Expert Rev Clin Immunol. 2010 Mar; 6 (2) : 219-30; Mohiuddin, M. PLoS Med. 2007 Mar 27; 4 (3) : e75; Pierson et al., Xenotransplantation. 2009 Sep-Oct; 16 (5) : 263-80) . For therapeutic use of porcine organs to become available for use in human medical treatment, improved outcomes must first be obtained in non-human primate pre-clinical trials, followed by duplication or improvement of these results in human clinical trials. The composition comprising genetically modified porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) disclosed herein can provide a source of porcine donor organs to address these requirements. Organs according to the present invention can be selected from the following: heart, lung, liver, kidney, intestine, spleen, whole blood, red blood cells, platelets, other blood products, retinal pigment epithelium (RPE) , skin, and pancreas.

[0123] In some embodiments, the individual in need thereof is a human. In some embodiments, the individual in need thereof is a patient with a condition selected from the group consisting of: heart dysfunction, liver dysfunction, kidney dysfunction, intestine dysfunction, spleen dysfunction, skin wounds, pancreas dysfunction, retinal diseases, blood disorders / loss, and lung dysfunction. In one embodiment, the xenotransplanted organs of the present invention can survive and function in the recipient like an allograft. In other embodiments, the organs described herein can be used as bridge organs until a human organ becomes available. In one embodiment, the bridge organ can be used in a recipient for at least 3 days. In other embodiments, the bridge organ can be used in a recipient a period of time selected from the following: at least 4, 5, 6, 7, 8, 9, 10, 14, 21, 28 days. For details on the transplantation procedure, see, for example, Handbook of Animal Models in Transplantation Research, Edited by D. V. Cramer, L. Podesta, L. Makowka 1994 CRC Press, for example, Chapters 3, 7, 8, 9 and 14; Cooper et al "Report of the Xenotransplantation Advisory Committee of the International Society for Heart and Lung Transplantation" December 2000 The Journal of Heart and Lung Transplantation, pp 1125-1165.

[0124] Various approaches can be employed to obtain organs for xenotransplantation from the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present disclosure. Firstly, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present disclosure can potentially serve as nuclear donors for generating cloned pigs. Secondly, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present disclosure can potentially be utilized for generating pig organs through blastocyst complementation and germline transmission in chimera assays. Lastly, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present disclosure can be used to create blastoids (artificial blastocyst counterparts) that can potentially be transferred into pig uteri to potentially generate pigs. Such methods are reviewed in Xuan et al. (Cells. 2023 Aug; 12 (16) : 2075) , which is incorporated herein in its entirety.

[0125] In some embodiments, the porcine totipotent / pluripotent stem cells (such as Expanded Potential Stem Cells (EPSCs) ) of the present disclosure are for use in generating clone pigs for xenotransplantation. In some embodiments, totipotent / pluripotent stem cells are used to generate clone animals (such as clone pigs) after they have been evaluated by the in vitro evaluation systems and methods described in Section IV. 1 and IV. 2. Various organs can be harvested from the clone pigs for xenotransplantation.

[0126] Methods for producing clone animals are known in the art. Production of transgenic pigs is described in, for example, Wheeler &Walters (2001) Theriogenology, 56 (8) , 1345-1369. Methods for producing clone pigs using EPSCs are described in US20210230556A1. For example, a clone pig for xenotransplantation might be produced by injecting pig EPSCs into a blastocyst to generate a chimera, and culturing the blastocyst under conditions suitable to develop into a pig.

[0127] In some embodiments, the xenotransplantation is cardiac transplantation. In some embodiments, the xenotransplantation is liver transplantation. In some embodiments, the transplantation is skin transplantation. In some embodiments, the xenotransplantation is islet transplantation. In some embodiments, the xenotransplantation is gut transplantation. In some embodiments, the xenotransplantation is blood transfusion. In some embodiments, the xenotransplantation is retinal pigment epithelium (TPE) transplantation. In some embodiments, the xenotransplantation is kidney transplantation. IV. System and Method of in vitro Evaluation

[0128] The present invention also provides systems and methods of in evaluation to assess suitability of a composition comprising totipotent stem cells and / or pluripotent stem cells for xenotransplantation. In some embodiments, the systems and methods utilize cells / organoids selected from the group consisting of: endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids differentiated from the totipotent / pluripotent stem cells, allowing for rapid and accurate evaluation of immune responses by bypassing the need for generating cloned animals to obtain cells and / or tissues (such as endothelial cells) to be used in evaluation of immune responses. 1. In vitro Evaluation System

[0129] One aspect of the present invention provides an in vitro evaluation system for evaluating suitability of a composition comprising totipotent stem cells and / or pluripotent stem cells for xenotransplantation, wherein the system comprises cells and / or organoids differentiated from the totipotent / pluripotent stem cells. In some embodiments, the cells and / or organoids are selected from the group consisting of: endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids. In some embodiments, the totipotent stem cells and / or pluripotent stem cells are EPSCs. In some embodiments, the totipotent stem cells and / or pluripotent stem cells are porcine totipotent stem cells and / or pluripotent stem cells. In some embodiments, the totipotent stem cells and / or pluripotent stem cells are porcine EPSCs. In some embodiments, the system comprises endothelial cells differentiated from the porcine EPSCs. In some embodiments, the totipotent stem cells and / or pluripotent stem cells (such as porcine EPSCs) are genetically modified as described in Section II. In some embodiments, the system comprises or further comprises a composition comprising cells and / or organoids differentiated from unmodified totipotent stem cells and / or pluripotent stem cells (such as EPSCs) .

[0130] In some embodiment, the cells and / or organoids are cardiomyocytes and / or heart organoids, and the xenotransplantation is a cardiac transplantation. In some embodiment, the cells and / or organoids are hepatocytes and / or liver organoids, and the xenotransplantation is a liver transplantation. In some embodiment, the cells and / or organoids are skin keratinocytes and / or skin organoids, and the xenotransplantation is a skin transplantation. In some embodiment, the cells and / or organoids are pancreatic beta cells and / or islets, and the xenotransplantation is an islet transplantation. In some embodiment, the cells and / or organoids are intestinal epithelial cells and / or gut organoids, and the xenotransplantation is a gut transplantation. In some embodiment, the cells and / or organoids are blood cells, and the xenotransplantation is blood transfusion. In some embodiment, the cells and / or organoids are retinal pigment epithelium (RPE) cells, and the xenotransplantation is a RPE transplantation.

[0131] In some embodiment, the cells and / or organoids are endothelial cells, and the xenotransplantation is selected from the group consisting of cardiac transplantation, liver transplantation, skin transplantation, islet transplantation, gut transplantation, blood transfusion, and RPE transplantation. Endothelial cells play a crucial role in xenotransplantation such as pig-to-human xenotransplantation. Their compatibility with the human vascular system is essential for maintaining the proper functioning of the graft and preventing complications such as clotting, thrombosis, and immune rejection.

[0132] Anatomically, endothelial cells line the inner wall of blood vessels, contributing to the structural integrity and stability of the vessels. They also secrete various factors that are involved in the regulation of coagulation, such as von Willebrand factor and tissue factor pathway inhibitor. These factors help maintain a balance between coagulation and anticoagulation to prevent unwanted clot formation.

[0133] Furthermore, endothelial cells express MHC antigens, α-gal, Neu5Gc, Sda epitopes, which are xeno-antigens that can be recognized by immune cells, potentially leading to immune rejection. The expression of these antigens can trigger an immune response and contribute to the destruction of the graft (Estrada et al., Xenotransplantation, 2015.22 (3) : p. 194-202) . Additionally, endothelial cells express adhesion molecules, chemokines, and costimulatory factors in response to damage or activation. These molecules facilitate immune cell recruitment, adhesion, and activation, further influencing the immune response during xenotransplantation.

[0134] Porcine EPSCs, while expressing Neu5Gc and Sda epitopes, lacked the most crucial α-Gal epitope, limiting their use for evaluation of immune responses. In contrast, endothelial cells, with abundant glycan epitopes expression and their close association with immune reactions, thrombosis, and tissue damage, offer a promising platform for these investigations.

[0135] Thus in some embodiments, provided herein is an in vitro evaluation system for evaluating suitability of a composition comprising porcine EPSCs for xenotransplantation, wherein the system comprises cells and / or organoids differentiated from the porcine EPSCs. 2. In vitro Evaluation Method

[0136] One aspect of the present invention provides a method of evaluating the suitability of a composition comprising totipotent stem cells and / or pluripotent stem cells for xenotransplantation, comprising evaluation of immune responses caused by the totipotent / pluripotent stem cells and / or organoids differentiated from the totipotent stem cells and / or pluripotent stem cells. The cells and / or organoids might include but are not limited to endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids. In some embodiments, the totipotent / pluripotent stem cells are porcine totipotent / pluripotent stem cells. In some embodiments, the totipotent / pluripotent stem cells are EPSCs. In some embodiments, the totipotent / pluripotent stem cells are porcine EPSCs. In some embodiments, the evaluation of immune responses is selected from the group consisting of evaluation of xeno-antigen expression, complement-mediated cytotoxicity, antibody binding, and macrophage phagocytosis.

[0137] In some embodiment, the cells and / or organoids are cardiomyocytes and / or heart organoids, and the xenotransplantation is a cardiac transplantation. In some embodiment, the cells and / or organoids are hepatocytes and / or liver organoids, and the xenotransplantation is a liver transplantation. In some embodiment, the cells and / or organoids are skin keratinocytes and / or skin organoids, and the xenotransplantation is a skin transplantation. In some embodiment, the cells and / or organoids are pancreatic beta cells and / or islets, and the xenotransplantation is an islet transplantation. In some embodiment, the cells and / or organoids are intestinal epithelial cells and / or gut organoids, and the xenotransplantation is a gut transplantation. In some embodiment, the cells and / or organoids are blood cells, and the xenotransplantation is blood transfusion. In some embodiment, the cells and / or organoids are retinal pigment epithelium (RPE) cells, and the xenotransplantation is a RPE transplantation. In some embodiments, the cells are endothelial cells, and the xenotransplantation is selected from the group consisting of cardiac transplantation, liver transplantation, skin transplantation, islet transplantation, gut transplantation, blood transfusion, and RPE transplantation.

[0138] In some embodiments, the evaluation of immune responses comprises evaluation of xeno-antigen expression. For instance, in some embodiments, the xeno-antigen to be evaluated is α-gal, Neu5Gc, and / or Sda. The expression of a xeno-antigen can be analyzed by quantitative polymerase chain reaction (RT-qPCR) , microarray, RNA sequencing, Western blot, immunofluorescence, flow cytometry, and / or enzyme-linked immunosorbent assay (ELISA) .

[0139] In some embodiments, the evaluation of immune responses comprises evaluation of complement-mediated cytotoxicity. Complement-mediated cytotoxicity is an immune response in which target cells (for example, cells of a xenograft) are lysed through activation and recruitment of the complement cascade to the targeted cell surface. Complement system is efficiently activated by human IgG1, IgG3 and IgM antibodies, and weakly by IgG2 antibodies. Methods for assessing complement-mediated cytotoxicity are known in the art. For example,  et al. (Methods Mol Biol. 2013 1034: 257-83) describes the complement-dependent cytotoxic crossmatch method, which is incorporated herein in its entirety.

[0140] In some embodiments, the evaluation of immune responses comprises evaluation of antibody binding. In some embodiments, the evaluation of immune responses comprises evaluation of human antibody binding. In some embodiments, the evaluation of immune responses comprises evaluation of human IgG-555 binding. In some embodiments, the evaluation of immune responses comprises evaluation of human IgM-488 binding. Methods for assessing antibody binding are known in the art (See, e.g., Yue et al., Nat Biomed Eng, 2021. 5 (2) : p. 134-143, which is incorporated herein in its entirety) .

[0141] In some embodiments, the evaluation of immune responses comprises evaluation of macrophage phagocytosis. In some embodiments, the evaluation of immune responses comprises evaluation of human macrophage phagocytosis. Macrophages have been shown to play a critical role in inflammation, coagulation, and phagocytosis in xenograft rejection. Macrophage phagocytosis can be assessed by macrophage phagocytosis assay. For example, in some embodiments, macrophage phagocytosis is assessed by coculturing human macrophages with target cells (e.g., pig EPSC-derived endothelial cells) and determining cell death and / or macrophage engulfment percentage.

[0142] In some embodiments, the method further comprises comparing the immune responses of genetically modified cells and / or organoids (such as EPSC-derived endothelial cells) to the immune responses of wild-type cells and / or organoids (e.g., endothelial cells differentiated from unmodified EPSCs) .

[0143] In some embodiments, the method further comprises differentiating the totipotent / pluripotent stem cells into the cells and / or organoids. It is to be understood by a person of ordinary skill in the art that the cells and / or organoids (such as endothelial cells) described herein can be derived from totipotent / pluripotent stem cells (such as EPSCs) using methods known in the art, as well as novel methods discussed in the sections below.

[0144] Thus in some embodiments, provided herein is a method of evaluating the suitability of a composition comprising porcine EPSCs for xenotransplantation, comprising evaluation of immune responses caused by the porcine EPSCs and / or organoids differentiated from the porcine EPSCs. 3. Method of Differentiating Totipotent / Pluripotent Stem cells

[0145] One aspect of the present invention also provides a method of generating a population of differentiated cells / organoids from totipotent / pluripotent stem cells. In some embodiments, provided herein is a method of generating a population of endothelial cells from porcine EPSCs, comprising (a) subjecting the porcine EPSCs to a first condition that differentiates the EPSC into mesodermal cells; and (b) subjecting the mesodermal cells to a second condition that differentiates the mesodermal cells into endothelial cells. In some embodiments of the present invention, the process of generating endothelial cells from porcine EPSCs mimics the differentiation process of endothelial cells in pigs. In some embodiments, the EPSCs are genetically modified.

[0146] In some embodiments, the totipotent / pluripotent stem cells are feeder cell free. Methods of removing feeder cells are known in the art (See, for example, Gao et al., Nat Cell Biol, 2019.21 (6) : p. 687-699, which is incorporated herein in its entirety) .

[0147] In some embodiments, the first condition comprises a mesoderm induction medium. In some embodiments, the mesoderm induction medium comprises one or more of the group consisting of: Chir99021, BMP4, FGF2, and Activin A. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are subjected to the first condition for about 24 hours to about 96 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are subjected to the first condition for about 24 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are subjected to the first condition for about 48 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are subjected to the first condition for about 72 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are subjected to the first condition for about 96 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are subjected to the first condition until they differentiate (such as differentiated into mesodermal cells) . In some embodiments, the mesodermal cells are assessed based on the cells being Brachyury+ and OCT4-.

[0148] In some embodiments, the second condition comprises an endothelial cell induction medium. In some embodiments, the endothelial cell induction medium comprises one or more of the group consisting of: VEGF, forskolin and BMP4. In some embodiments, the cells (such as mesodermal cells) are subjected to the second condition for about 24 hours to about 120 hours. In some embodiments, the cells (such as mesodermal cells) are subjected to the second condition for about 24 hours. In some embodiments, the cells (such as mesodermal cells) are subjected to the second condition for about 48 hours. In some embodiments, the cells (such as mesodermal cells) are subjected to the second condition for about 72 hours. In some embodiments, the cells (such as mesodermal cells) are subjected to the second condition for about 96 hours. In some embodiments, the cells (such as mesodermal cells) are subjected to the second condition for about 120 hours. In some embodiments, the cells (such as mesodermal cells derived from porcine EPSCs) are subjected to the second condition until they further differentiate (such as further differentiate into endothelial cells) . In some embodiments, the endothelial cells are assessed based on the cells being Von Willebrand factor (VWF) +, CD31, and angiotensin-converting enzyme (ACE / CD143) +.

[0149] The status of differentiation can be assessed by features such as cell morphology and expression of marker genes, such as endothelial cell marker genes, including cobble stone cell morphology, the presence of Weibel-Palade bodies in the cells, Von Willebrand factor (VWF) expression, PECAM1, CDH5, ENG, and angiotensin-converting enzyme (ACE / CD143) , which can be used to identify endothelial cells.

[0150] In some embodiments, the method further comprises culturing the totipotent / pluripotent stem cells (such as porcine EPSCs) in a priming medium before subjecting the totipotent / pluripotent stem cells (such as porcine EPSCs) to the first condition. In some embodiments, the priming medium is Essential 8 medium. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are cultured in the priming medium for about 24 hours to about 96 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are cultured in the priming medium for about 24 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are cultured in the priming medium for about 48 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are cultured in the priming medium for about 72 hours. In some embodiments, the totipotent / pluripotent stem cells (such as porcine EPSCs) are cultured in the priming medium for about 96 hours.

[0151] In some embodiments, the method further comprises (c) subjecting the differentiated cells (such as endothelial cells) to a third condition that differentiates the differentiated cells (such as endothelial cells) into hemogenic cells after step (b) . In some embodiments, the third condition comprises endothelial expansion medium. In some embodiments, the differentiated cells (such as endothelial cells) are subjected to the third condition for about 24 hours to about 96 hours. In some embodiments, the differentiated cells (such as endothelial cells) are subjected to the third condition for about 24 hours. In some embodiments, the differentiated cells (such as endothelial cells) are subjected to the third condition for about 48 hours. In some embodiments, the differentiated cells (such as endothelial cells) are subjected to the third condition for about 72 hours. In some embodiments, the differentiated cells (such as endothelial cells) are subjected to the third condition for about 96 hours.

[0152] In some embodiments, the method of generating a population of endothelial cells from porcine EPSCs comprises culturing the EPSCs in a priming medium, subjecting the porcine EPSCs to a first condition that differentiates the EPSC into mesodermal cells, subjecting the mesodermal cells to a second condition that differentiates the mesodermal cells into endothelial cells, and subjecting the endothelial cells to a third condition that differentiates the endothelial cells into hemogenic cells.

[0153] In some embodiments, the method of generating a population of endothelial cells from porcine EPSCs comprises culturing the EPSCs in Essential 8 medium; culturing the porcine EPSCs in a mesoderm induction medium that differentiates the EPSC into mesodermal cells comprising one or more of the group consisting of: Chir99021, BMP4, FGF2, and Activin A; culturing the mesodermal cells in an endothelial cell induction medium that differentiates the mesodermal cells into endothelial cells comprising one or more of the group consisting of: VEGF, forskolin and BMP4; culturing the endothelial cells in an endothelial expansion medium that differentiates the endothelial cells into hemogenic cells.

[0154] In some embodiments, the method of generating a population of endothelial cells from porcine EPSCs comprises culturing the EPSCs in Essential 8 medium for about 24 hours to about 96 hours; culturing the porcine EPSCs in a mesoderm induction medium that differentiates the EPSC into mesodermal cells comprising one or more of the group consisting of:Chir99021, BMP4, FGF2, and Activin A for about 24 hours to about 96 hours; culturing the mesodermal cells in an endothelial cell induction medium that differentiates the mesodermal cells into endothelial cells comprising one or more of the group consisting of: VEGF, forskolin and BMP4 for about 24 hours to about 120 hours; culturing the endothelial cells in an endothelial expansion medium that differentiates the endothelial cells into hemogenic cells for about 24 hours to about 96 hours.

[0155] In some embodiments, the differentiated cells (such as endothelial cells) obtained from the methods disclosed herein could undergo multiple passages and freeze-thaw cycles, while maintaining their integrity without noticeable differences. In some embodiments, the differentiated cells (such as endothelial cells) could undergo 2 passages without noticeable differences. In some embodiments, the differentiated cells (such as endothelial cells) could undergo 3 passages without noticeable differences. In some embodiments, the differentiated cells (such as endothelial cells) could undergo 4 passages without noticeable differences. In some embodiments, the differentiated cells (such as endothelial cells) could undergo 5 passages without noticeable differences. In some embodiments, the differentiated cells (such as endothelial cells) could undergo 6 passages without noticeable differences. In some embodiments, the differentiated cells (such as endothelial cells) could undergo 7 passages without noticeable differences. In some embodiments, the differentiated cells (such as endothelial cells) could undergo 8 passages without noticeable differences. However, an extended passage number might lead to a decrease in the proliferative capacity of the differentiated cells (such as endothelial cells) . In some embodiments, the differentiated cells (such as endothelial cells) are subject to no more than 20 passages prior to subsequent use. In some embodiments, the differentiated cells (such as endothelial cells) are subject to no more than 15 passages prior to subsequent use. In some embodiments, the differentiated cells (such as endothelial cells) are subject to no more than 10 passages prior to subsequent use. EXEMPLARY EMBODIMENTS

[0156] Embodiment 1: A composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in TP53.

[0157] Embodiment 2: The composition of embodiment 1, wherein the porcine totipotent / pluripotent stem cells are further modified to contain an inactivating mutation in a xeno-antigen related gene.

[0158] Embodiment 3: A composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in a xeno-antigen related gene.

[0159] Embodiment 4: The composition of embodiment 2 or 3, wherein the xeno-antigen related gene is selected from the group consisting of GGTA1, CMAH, and B4GALNT2.

[0160] Embodiment 5: The composition of any one of embodiments 2-4, wherein the porcine totipotent / pluripotent stem cells contain an inactivating mutation in GGTA1.

[0161] Embodiment 6: The composition of any one of embodiments 2-5, wherein the porcine totipotent / pluripotent stem cells contain an inactivating mutation in CMAH.

[0162] Embodiment 7: The composition of any one of embodiments 2-6, wherein the porcine totipotent / pluripotent stem cells contain an inactivating mutation in B4GALNT2.

[0163] Embodiment 8: The composition of any one of embodiments 1-7, wherein the porcine totipotent / pluripotent stem cells further contain an inactivating mutation in a gene associated with organ growth.

[0164] Embodiment 9: The composition of embodiment 8, wherein the gene associated with organ growth is GHR.

[0165] Embodiment 10: The composition of any one of embodiments 1-9, wherein the inactivating mutation is a gene knockout.

[0166] Embodiment 11: The composition of any one of embodiments 10, wherein the inactivating mutation is introduced by gene editing.

[0167] Embodiment 12: The composition of any one of embodiments 1-11, wherein the porcine totipotent / pluripotent stem cells further comprise a heterologous nucleic acid.

[0168] Embodiment 13: The composition of embodiment 12, wherein the heterologous nucleic acid encodes an immune modulating protein.

[0169] Embodiment 14: The composition of embodiment 13, wherein the immune modulating protein is CD47.

[0170] Embodiment 15: The composition of any one of embodiments 12-14, wherein the heterologous nucleic acid is integrated into the genome of the totipotent / pluripotent stem cells at a safe harbor locus.

[0171] Embodiment 16: The composition of embodiment 15, wherein the safe harbor locus is ROSA26.

[0172] Embodiment 17: The composition of embodiment 15 or 16, wherein the heterologous nucleic acid is integrated into the genome of the totipotent / pluripotent stem cells by a recombinase.

[0173] Embodiment 18: The composition of embodiment 17, wherein the recombinase is a Cre recombinase.

[0174] Embodiment 19: The composition of any one of embodiments 12-18, wherein the heterologous nucleic acid further comprises a lox71 site at a 5’ end of the heterologous nucleic acid and a lox2272 sites at a 3’ end of the heterologous nucleic acid, or the heterologous nucleic acid further comprises a lox71 site at a 3’ end of the heterologous nucleic acid and a lox2272 sites at a 5’ end of the heterologous nucleic acid.

[0175] Embodiment 20: The composition of any one of embodiments 1-19, wherein the porcine totipotent / pluripotent stem cells are genetically and epigenetically stable.

[0176] Embodiment 21: The composition of any one of embodiments 1-20, wherein the porcine totipotent / pluripotent stem cells are pluripotent.

[0177] Embodiment 22: The composition of any one of embodiments 1-21, wherein the porcine totipotent / pluripotent stem cells have broad differentiation potential.

[0178] Embodiment 23: The composition of any one of embodiments 1-22, wherein the porcine totipotent / pluripotent stem cells are Expanded Potential Stem Cells (EPSCs) .

[0179] Embodiment 24: A method of xenotransplantation, comprising introducing the composition of any one of embodiments 1-23 to an individual in need thereof.

[0180] Embodiment 25: The method of embodiment 24, wherein the individual is a human.

[0181] Embodiment 26: An in vitro evaluation system for evaluating suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, wherein the system comprises cells and / or organoids differentiated from the totipotent / pluripotent stem cells.

[0182] Embodiment 27: The in vitro evaluation system of embodiment 26, wherein the cells and / or organoids are selected from the group consisting of: endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids.

[0183] Embodiment 28: The in vitro evaluation system of embodiment 26 or 27, wherein the totipotent / pluripotent stem cells are genetically modified.

[0184] Embodiment 29: The in vitro evaluation system of any one of embodiments 26-28, wherein the composition comprising totipotent / pluripotent stem cells is a composition according to any one of embodiments 1-23.

[0185] Embodiment 30: The in vitro evaluation system of any one of embodiments 26-29, wherein the totipotent / pluripotent stem cells are unmodified.

[0186] Embodiment 31: The in vitro evaluation system of any one of embodiments 26-30, wherein the totipotent / pluripotent stem cells are EPSCs.

[0187] Embodiment 32: The in vitro evaluation system of any one of embodiments 26-30, wherein the totipotent / pluripotent stem cells are porcine totipotent / pluripotent stem cells.

[0188] Embodiment 33: The in vitro evaluation system of any one of embodiments 26-32, wherein the totipotent / pluripotent stem cells are porcine EPSCs.

[0189] Embodiment 34: A method of evaluating the suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, comprising evaluation of immune responses caused by the totipotent / pluripotent stem cells and / or organoids differentiated from the totipotent / pluripotent stem cells.

[0190] Embodiment 35: The method of embodiment 34, wherein the cells and / or organoids are selected from the group consisting of: endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids.

[0191] Embodiment 36: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the composition comprising totipotent / pluripotent stem cells are for use in generating cloned animals for xenotransplantation.

[0192] Embodiment 37: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the cells and / or organoids are cardiomyocytes and / or heart organoids, and the xenotransplantation is a cardiac transplantation.

[0193] Embodiment 38: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the cells and / or organoids are hepatocytes and / or liver organoids, and the xenotransplantation is a liver transplantation.

[0194] Embodiment 39: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the cells and / or organoids are skin keratinocytes and / or skin organoids, and the xenotransplantation is a skin transplantation.

[0195] Embodiment 40: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the cells and / or organoids are pancreatic beta cells and / or islets, and the xenotransplantation is an islet transplantation.

[0196] Embodiment 41: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the cells and / or organoids are intestinal epithelial cells and / or gut organoids, and the xenotransplantation is a gut transplantation.

[0197] Embodiment 42: The in vitro evaluation system of any one of embodiments 26-33 the method of embodiment 34 or 35, wherein the cells and / or organoids are blood cells, and the xenotransplantation is blood transfusion.

[0198] Embodiment 43: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the cells and / or organoids are retinal pigment epithelium (RPE) cells, and the xenotransplantation is a RPE transplantation.

[0199] Embodiment 44: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the cells and / or organoids are kidney organoids, and the xenotransplantation is a renal transplantation.

[0200] Embodiment 45: The in vitro evaluation system of any one of embodiments 26-33 or the method of embodiment 34 or 35, wherein the cells are endothelial cells, and the xenotransplantation is selected from the group consisting of cardiac transplantation, liver transplantation, skin transplantation, islet transplantation, gut transplantation, blood transfusion, and RPE transplantation.

[0201] Embodiment 46: The method of any one of embodiments 34-45, wherein the totipotent / pluripotent stem cells are porcine EPSCs.

[0202] Embodiment 47: The method of any one of embodiments 34-46, further comprising differentiating the totipotent / pluripotent stem cells into the cells and / or organoids.

[0203] Embodiment 48: The method of embodiment 47, comprising differentiating the porcine EPSCs into the endothelial cells.

[0204] Embodiment 49: The method of any one of embodiments 34-48, wherein the totipotent / pluripotent stem cells are genetically modified.

[0205] Embodiment 50: The method of embodiment 49, wherein the composition comprising genetically modified totipotent / pluripotent stem cells is a composition according to any one of embodiment 1-23.

[0206] Embodiment 51: The method of any one of embodiments 34-50, wherein the evaluation of immune responses is selected from the group consisting of evaluation of xeno-antigen expression, complement-mediated cytotoxicity, antibody binding, and macrophage phagocytosis.

[0207] Embodiment 52: The method of embodiment 51, wherein the evaluation of immune responses comprises evaluation of human antibody binding.

[0208] Embodiment 53: The method of embodiment 51 or 52, wherein the evaluation of immune responses comprises evaluation of human macrophage phagocytosis.

[0209] Embodiment 54: The method of any one of embodiments 49-53, further comprising comparing the xeno-antigen activity of the composition comprising cells and / or organoids differentiated from genetically modified totipotent / pluripotent stem cells with a composition comprising cells and / or organoids differentiated from unmodified totipotent / pluripotent stem cells.

[0210] Embodiment 55: A method of generating a population of endothelial cells from porcine expanded potential stem cells (EPSCs) , comprising (a) subjecting the porcine EPSCs to a first condition that differentiates the EPSC into mesodermal cells; and (b) subjecting the mesodermal cells to a second condition that differentiates the mesodermal cells into endothelial cells.

[0211] Embodiment 56: The method of embodiment 55, wherein the EPSCs are genetically modified.

[0212] Embodiment 57: The method of embodiment 55 or 56, further comprising (c) subjecting the endothelial cells to a third condition that differentiates the endothelial cells into hemogenic cells.

[0213] Embodiment 58: The method of any one of embodiments 55-57, further comprising culturing the EPSCs in a priming medium before subjecting the porcine EPSCs to the first condition.

[0214] Embodiment 59: The method of any one of embodiments 55-58, wherein the first condition comprises a mesoderm induction medium.

[0215] Embodiment 60: The method of any one of embodiments 55-59, wherein the second condition comprises an endothelial cell induction medium. EXAMPLES Example 1: Methods 1. Porcine EPSCs derived from pre-implantation embryos

[0216] The pig EPSC PK7 cell line (Gao et al., Nat Cell Biol, 2019.21 (6) : p. 687-699) was employed in the following experiments. SNL (76 / 7) feeder cells were prepared at least 24 hours before harvesting pig embryos. Porcine uteri were obtained from a local slaughterhouse and transported to the laboratory in a temperature-controlled container. Embryos were flushed from the pig uteri using a 30 mL syringe and emcare flushing solution (ICPbio Reproduction,  ) , and pig embryos were manually collected under a dissection microscope and then transferred onto feeder plates and cultured in pEPSC medium supplemented with 10 μM Y-27632 (MCE, HY-10071) . The plates were incubated at 37℃ with 5%CO2 without disruption until the embryos attached. Approximately 48 hours after seeding the embryos, half-medium change was performed to minimize embryo disturbance. Outgrowth from the culture well was monitored throughout the process. By around day 5 to 7, the first outgrowths were observed, and by approximately day 12-14, colonies with diameters of around 100-200 μm were observed. The colonies were then picked and transferred to a new feeder plate, referred to as P0.

[0217] The PK7 pig EPSCs were cultured on SNL (76 / 7) feeder cells in accordance with the published protocol, with minor modifications. In brief, the EPSC medium consisted of an N2B27 basal medium supplemented with the following components: 0.2 μM CHIR99021 (Tocris, catalog no. 4423) , 0.02 μM A419 (Tocris, 3914) , 2.0 μM XAV939 (Sigma, X3004) , 1.0 μM IWR-1 (Tocris, 3532) , 65.0 μg / ml Vitamin C (Sigma, 49752-100G) , 10.0 ng / ml LIF (Stem Cell Institute, University of Cambridge) , and 20.0 ng / ml Activin (Stem Cell Institute) . Passaging of the cells was performed every 3 to 5 days, with a typical passage ratio of 1: 10 to 1: 20. 2. Derivation of endothelial cells from porcine EPSCs

[0218] To initiate the differentiation of porcine endothelial cells, 5000 pig EPSCs without feeder cells were harvested and placed onto 1%Matrigel-coated 12-well plates (Matrigel, Corning, 356231) . The removal of feeder cells is described in more details in the section “pig EPSC feeder removal” below. Subsequently, the pig EPSCs were primed in Essential 8 medium (Gibco, A1517001) for 48 hours. Following the priming phase, the cells transitioned to the “post-implantation” -like stage, referred to as Day 0.

[0219] The primed pig EPSCs were directed towards mesoderm differentiation by exposing them to mesoderm induction medium (STEMCELL Technologies, 05220) for 48 hours without disturbance. Subsequently, on Day 2, the cells were further guided towards the endothelial lineage through the utilization of endothelial cell induction medium (STEMCELL Technologies, 08005) , which was maintained for an additional 4 days, with medium changes every other day.

[0220] By Day 6, the cells had effectively committed to the endothelial lineage, making them suitable for either subculturing or more extensive analyses. During this period, their CD31 positivity was evaluated via flow cytometry, with a median CD31+ rate of approximately 73.3%. These endothelial cells, coexisting with other miscellaneous cell types within the culture, were identified as passage 0 (P0) and could be further expanded utilizing endothelial expansion medium (STEMCELL Technologies, 08007) . It is noteworthy that the endothelial cells generated through this protocol were readily applicable for evaluation of immune responses. Furthermore, these cells could undergo multiple passages and freeze-thaw cycles, maintaining their integrity up to passage 8 without noticeable differences. When the cells reached full confluence, they could be passaged onto Matrigel-coated plates, with a passage ratio of 1: 3. However, an extended passage number might lead to a decrease in their proliferative capacity. 3. Pig EPSC feeder removal for endothelial differentiation

[0221] The removal of feeder cells follows established pig EPSC passage protocols, with slight modifications as previously detailed by Gao et al. (Nat Cell Biol, 2019.21 (6) : p. 687-699) . This procedure is crucial for isolating pure pig EPSCs and relies on the differential detachment characteristics observed when using detaching agents such as EDTA or ReLeSR (STEMCELL Technologies, 100-0483) .

[0222] Pure pig EPSCs were collected when they reached a confluence of 70-90%. Initially, the cells were rinsed with DPBS, followed by the addition of 0.5 mM EDTA and incubation at 37℃ for 7 to 10 minutes. Alternatively, ReLeSR can be added, followed by a 5 to 7-minute incubation. Subsequently, the detachment of EPSC colonies from the culture plate could be confirmed under a microscope. Gentle swirling and tapping of the plate's bottom helped facilitate the detachment process.

[0223] To further enhance detachment while simultaneously neutralizing the dissociation process, a P1000 pipette was used to carefully dispense an equivalent volume of M10 medium drop by drop. Some residual feeder cells may be present in the supernatant; however, this presence does not negatively impact the overall differentiation process.

[0224] The supernatant containing EPSC colonies was collected into a 15ml tube and subjected to centrifugation at 200g for 2 minutes at room temperature. Following centrifugation, the resulting pellet was resuspended in culture medium until subsequent experiments. 4. Human macrophage culture

[0225] The macrophages used in the phagocytosis assay were derived from THP1 cells, generously provided by Dr. Rio Sugimura from The University of Hong Kong. THP1 cell maintenance adhered to ATCC recommendations (https:  / / www. atcc. org / products / tib-202) . The cells were cultured in RPMI-based medium (Gibco, Cat: 22400-71) containing 10%heat-inactivated FBS, 200 g / L glucose (Gibco, Cat: A24940-01) , 1 mM sodium pyruvate (Gibco, Cat: 11360070) , and 55 μM 2-mercaptoethanol (Gibco, Cat: 21985023) . The seeding density ranged from 2 to 5 × 105 / mL, with medium replacement every 2 to 3 days. Passage was typically performed when cells reached 1 to 2 × 106 / mL, with a split ratio of 1: 4 to 1: 6. Confluency was usually achieved within 3 to 5 days post-passage. Cells were maintained at 5%CO2 and 37℃.

[0226] The differentiation from THP1 to macrophage was performed when THP1 reached the logarithmic growth phase. 150 nM PMA was added to THP1 culture medium for 24 hours. The macrophage status was signified by the transition from suspension to an attached state. These attached macrophage cells could be polarized into the pro-inflammatory M1 subtype by introducing 20 ng / mL IFN-γ and 10 pg / mL LPS into the THP1 medium (without PMA) for 2 days. Once polarized, the cells were suitable for phagocytosis assays. 5. Genetic engineering of the porcine EPSCs

[0227] CRISPR / Cas9-mediated genetic knockout was performed in pig PK7 EPSCs targeting (GGTA1, CMAH, B4GALNT2, and GHR) . Two sets of sgRNA were designed to generate band shifting to perturb gene functions. The genotyping primers were designed to amplify the targeting region and detect band shifting via agarose gel electrophoresis between wild-type and mutant PK7 EPSCs. The genomic sequences were downloaded from the Ensembl database (www. ensembl. org) , and a targeting region of interest within the genome would be uploaded to CRISPOR (http:  / / crispor. tefor. net / ) to select the sgRNA with high specificity and low off-target.

[0228] The knockin guide RNA and homologous arm (HA) sequence design for foreign gene insertion at the pig ROSA26 locus was detailed by Gao et al. (Nat Cell Biol, 2019.21 (6) : p. 687-699) . The 5' and 3' junction PCR primers were used to detect the successful integration.

[0229] The guide RNAs were ordered and synthesized via Synthego (https:  / / www. synthego. com / ) . The genotyping primers were ordered from IDT. The guide RNA sequences and genotyping primer sequences are listed in Tables E1 and E2. Table E1. Guide RNA Sequences Table E2. Genotyping Primer Sequences 6. Electroporation

[0230] Three or four hours before electroporation, the pig EPSCs were refreshed with 10%FBS in pig EPSC medium. Approximately 1 to 2 × 105 pig EPSCs were used in a 10μl Neon transfection system (Invitrogen, MPK1025) . Pig EPSCs were digested by TrypLE (Gibco, 12604021) at 37℃ for 5 minutes, followed by gentle pipetting to dissociate the cells. Pig EPSC / feeder mixture was then flowed through a 40μm cell strainer to remove most feeders and obtain a single EPSC suspension. Pig EPSC cell number was counted at a density of 2-4 × 107 in Resuspension buffer R (Invitrogen, MPK1025) . 5μl of cells containing 1-2 × 105 EPSCs was transferred in Resuspension buffer R to a 1.5mL tube, which already contained another 7μl DNA in Resuspension Buffer R, making a total volume of 12μl for one electroporation. For knockout experiments, the DNA mixture contained 400ng Cas9 protein (Thermo, A36498) , two sets of 1.2 pmol sgRNA (sgRNA synthesized from Synthego) . For knock-in experiments, the DNA mixture contained 200 ng Cas9 protein, 1.2 pmol sgRNA, and 1.5-3μg donor plasmid. The total volume of Cas9 protein, sgRNA, and donor plasmid was less than 1μl. For Cre-mediated cassette exchange, 1μg Cre plasmid and 500ng-1μg donor DNA were used. Electroporation was performed with 1200 V, 20 ms, 2 pulses for the pig EPSCs, after which the electroporated EPSCs were seeded in two feeder wells prewarmed with 10%FBS in pig EPSC medium plus 10μM Y27632 (MCE, HY-10071) and then changed to normal pig EPSC medium on the next day. The single electroporated pig EPSC-derived colonies emerged around day 10. 7. Genotyping

[0231] One week after electroporation, when multiple colonies have emerged, one well of cells was collected for genomic DNA extraction. Wild-type genomic DNA was used as a control. The DNA samples from the electroporated pig EPSC-derived colonies and the control were amplified by PCR and gel electrophoresis was performed afterwards to analyze the band sizes between the electroporated pig EPSC sample and the wildtype control to assess the general gene-editing efficiency. For knockout experiments using two sgRNAs, two bands were expected, with the upper band representing the wildtype band and the lower band representing the knockout band. The brightness of the knockout band can indicate the knockout efficiency. For knockin experiments, DNA from electroporated pig EPSC was used to test various junction PCR conditions, and wild-type genomic DNA was used as a control. The right band size indicated the successful integration of the foreign cassette. 8. Colony picking and Sanger sequencing

[0232] Single EPSC colonies were picked around day 12 when they were visible to the naked eye based on the bulk genotyping results. The picked single pig EPSC colony was digested in TrypLE plus 10μM Y27632 for 3 minutes at 37℃. Half of the colony was directly lysed for genotyping PCR amplification. The other half was further cultured and expanded. The genomic editing results were further validated by Sanger sequencing. 9. RMCE vector construction for ROSA26 targeting

[0233] The foreign cassette was flanked by lox66 (5’ ) and lox2272 (3’ ) and contained the PurοΔTK driven by CAG promoter (CAG-PuroΔTK) . The pig ROSA26 5’ and 3’ homologous arms were previously cloned into pRosa26-EF1a-H2b-mCherry vector. The EF1a-H2b-mCherry fragment was replaced with CAG-PuroΔTK flanked by lox66 and lox2272 cassette, which was then used for targeting. The pRosa26-EF1a-H2b-mCherry vector was detailed in Gao et al. (Nat Cell Biol, 2019.21 (6) : p. 687-699) . 10. Cre-mediated cassette exchange of human CD47 at the pig ROSA26 locus

[0234] The human CD47 cDNA with CAG promoter and poly A signal was PCR amplified from 4Tg plasmid (kindly shared by Dr.  Petersen) . To allow for the Cre-mediated cassette exchange, 34bp overhangs with lox sequences were included in the PCR primers. Specifically, the forward primers were designed to include the following lox71 sequence, from 5’ to 3’ : ATAACTTCGTATAATGTATGCTATACGAACGGTACCAGATATACGCGTTGATCTC C (SEQ ID NO: 22) . The reverse primers were designed to include the following lox2272 sequence, from 5’ to 3’ : ATAACTTCGTATAGGATACTTTATACGAAGTTATGCTAGCTGAGGATCGATACGA C (SEQ ID NO: 23) . The PCR-amplified human CD47 exchange cassette was further analyzed by gel electrophoresis and further confirmed by Sanger sequencing. The amplified PCR product was further purified by a spin column for targeting (TIANGEN, 4992196) . 11. Drug selection for genetic engineered cells

[0235] To enrich the RMCE master line, 2μg / ml puromycin (InvivoGen, ant-pr-1) was used for positive selection. For negative selection during human CD47 integration at the ROSA26 locus, 2μM Ganciclovir (MCE, HY-13637) was used. Drug exposure was maintained for 2 days after electroporation to enrich correctly targeted cells. 12. Human antibody binding assay

[0236] Pooled normal human male AB serum (Innovative Research, ISER50ML) was heat-inactivated at 56℃ in a water bath for 30 minutes and centrifuged at 1000rpm for 5 minutes to remove solid components. Then, the serum was diluted in FACS buffer (0.2%BSA, 5mM EDTA in DPBS) and incubated with pig EPSC-derived endothelial cells for 30 minutes at room temperature. After rinsing with cold HBSS for three times, diluted anti-human IgG-555 (Thermo Fisher, A-21433) and anti-human IgM-488 (Thermo Fisher, A-21215) were added to the cells and incubated at room temperature for 30 minutes, followed by nuclear staining using DAPI. For flow cytometry, cells were analyzed with ACEA NovoCyte Quanteon and FlowJo software; alternatively, for imaging, cells were fixed with 4%PFA before fluorescent image capture. This protocol was adapted from Yue et al. (Nat Biomed Eng, 2021. 5 (2) : p. 134-143) . 13. Complement-mediated cytotoxicity

[0237] Heat-inactivated human serum (diluted 50%) was incubated with targeted cells at 4℃ for 30 minutes. A control group without human serum was used to establish background cell viability. After rinsing with cold HBSS for three times, diluted baby rabbit complement (Bio-Rad, C12CA. 1) in FACS buffer at a 1: 5 ratio was applied, and incubated at 37℃ for 30 minutes. Washing was repeated, after which the cells were resuspended in 100 μl of cold Live / Dead staining solution containing 1 μg / mL FDA + 0.1 μg / mL DAPI.

[0238] The cells were then analyzed using the ACEA NovoCyte Quanteon flow machine. Quadruple gating was employed based on FDA and DAPI staining to distinguish between live and dead cells, with dead cells defined as FDA-negative and DAPI-positive. To calculate cytotoxicity scores, we used the formula shown in FIG. 9D. 14. Macrophage phagocytosis assay

[0239] THP1 differentiation into M1 macrophages was achieved by a 24-hour treatment with 150nM PMA, followed by a 48-hour exposure to 10ng / ml LPS and 25ng / ml IFN-γ. Subsequently, target cells (pig EPSC-derived endothelial cells; PED) were labeled with DiOC (Thermo Fisher, L7010) by adding 2μl of DiOC per 1mL of culture medium and incubation at 37℃ overnight. After DPBS washes, the labeled cells were collected, counted, and resuspended at a concentration of 106 cells per 1000μl of M1 medium. For coculture experiments, DiOC-labeled target cells were cocultured with an equal number of macrophages (i.e., E: T ratio was 1: 1) at 37℃ for 4 hours. Two control groups, namely target-only and effector-only, received the same treatment. The macrophages were then labeled with CD11b-APC-Cy7 antibody (BD, 560914) in the dark for 30 minutes on ice, followed by live cell staining with DAPI. Flow cytometry was performed using the ACEA NovoCyte Quanteon, and FlowJo software was used for subsequent analysis. Example 2: Generation of Genetically Modified Porcine Expanded Potential Stem Cells  (EPSCs) 1. Porcine xeno-antigen removal to obtain triple knockout EPSCs (TKO-EPSC)

[0240] To disrupt xeno-antigen expression, GGTA1, CMAH, and B4GALNT2 involved in the synthesis of α-galactosyl, Neu5Gc, and Sda antigen epitopes in pigs were simultaneously targeted and knocked out by CRISPR / Cas9 as described in Example 1. Three pairs of sgRNA targeting at GGTA1, CMAH, and B4GALNT2 respectively were introduced to generate triple knockout (TKO) porcine EPSCs in a single electroporation (FIG. 1A) . The one-shot electroporation minimized the need for multiple rounds of genetic modifications, streamlining the process and reducing the amount of time required.

[0241] Specifically, to perturb GGTA1 gene function, exon 7 was targeted by two sgRNAs to delete the C-terminal catalytic domain. Sanger sequencing analysis revealed a 454 bp out-of-frame deletion (FIG. 1E) . Similarly, exon 1 of CMAH was successfully targeted, leading to a precise 136 bp out-of-frame deletion (FIG. 1E) . Furthermore, the exon 3 of B4GALNT2 also achieved the desired outcome with a 2 bp out-of-frame deletion (FIG. 1E) . The sequences in FIG. 1E are shown in Table E3. Table E3. Sequences in FIG. 1E

[0242] As demonstrated in FIGs. 1C and 1F, the genotyping analysis of GGTA1 showed 11%of the colonies showing a homozygous knockout bands, 20%displaying a heterozygous knockout bands; CMAH genotyping revealed a higher rate of homozygous knockout bands at 33%, 39%of heterozygous knockout bands; while on the other hand, genotyping of B4GALNT2 displayed a much lower frequency of successful knockouts, 96%displaying miscellaneous, indel, or unedited patterns displayed on agarose gel image, with only 4%of them showed 2bp deletions in sanger sequencing. The overall efficiency of achieving the TKO was found to be 4%of the total 46 colonies. 2. Porcine GHR removal (QKO-EPSC)

[0243] Given that the PK7 EPSC cell line was derived from the German landrace, which can attain a maximum body weight of 300 kg when fully matured, it was crucial to control the overgrowth of the porcine xenografts. It has been reported that GHR mutations in both humans and pigs do not compromise their reproductive capabilities, while resulting in smaller-sized organs. Therefore, another round of genetic engineering was performed to perturb the growth hormone receptor gene GHR to reduce the organ size (FIG. 1A) , based on the first round of targeting (TKO-EPSCs) described above.

[0244] To disrupt the function of the GHR gene in pig TKO-EPSCs, two sgRNAs were designed to target exon 7 (Table E1) . Out of a total of 16 colonies selected from TKO-EPSCs, 3 colonies (19%) exhibited a homozygous KO band (FIG. 1D and FIG. 1F) , which were subsequently confirmed through Sanger sequencing, revealing a 110bp out-of-frame deletion (FIG. 1E) .

[0245] Thus the quadruple knockout (QKO) PK7 EPSC cells line was successfully generated using two rounds of CRISPR / Cas9 targeting. 3. Porcine RMCE master cell line generation (QKO-RMCE-EPSC)

[0246] To enable further modifications, we established a master cell line based on both PK7 wild-type (WT) EPSCs and QKO EPSCs as described above. The utilization of the Cre-loxP system enables efficient cassette exchange between two lox sites, providing a versatile platform for gene modification (FIG. 1B) .

[0247] The introduction of specific gene modifications via recombinase-mediated cassette exchange (RMCE) method involved two sequential steps (FIG. 1B) . Firstly, a puroΔTK fragment containing the CAG promoter flanked by lox66 and lox2272 sites was introduced at the ROSA26 locus. The puroΔTK was assembled into the donor vector plasmid, or RMCE plasmid, which also contained 5’ and 3’ homologous arms targeting the porcine ROSA26 locus. Through the use of CRISPR / Cas9-mediated double-strand breaks at the knockin site and the presence of an exogenous homologous repair template, the donor fragment was introduced into the target site. Puromycin drug selection was then employed to sort cells that had gone through either random or precise integration of the donor fragment. Genotyping analysis by junction PCR was performed on the single puromycin drug-resistant colony, and further confirmation was achieved through Sanger sequencing.

[0248] The targeting efficiency of the porcine RMCE master cell line construction in QKO-EPSCs was evaluated by analyzing the genotyping results (FIG. 1G) . Out of a total of 42 colonies examined, 27 colonies (64.3%) showed successful integration at the 5’ junction, while 24 colonies (57.1%) displayed successful integration at the 3’ junction, and a total of 22 colonies (52.4%) exhibited successful integration at both the 5’ and 3’ junctions. These results indicate a moderate to high site-specific integration efficiency in generating the desired RMCE master cell line.

[0249] In the subsequent step, based on the RMCE master cell line in QKO and WT EPSCs, we successfully introduced the gene of interest (GOI) , such as various immune modulation genes, through cassette exchange (FIG. 1B) , which was mediated by Cre recombinase when the direction of the two lox sites are the same. The GOI fragment was incorporated into a donor fragment containing lox71 and lox2272 sites at both ends. This modified lox sequence prevented the cycling of the fragment between the donor and pig genome, ensuring high efficiency. Negative selection using Ganciclovir was employed to select the GOI integration cell line. To determine the optimal Ganciclovir concentration for selection, a drug titration experiment was conducted, revealing that 2 μM Ganciclovir treatment for 2 days provided suitable conditions for efficient selection. This combined positive and negative drug selection approach yielded a high targeting efficiency.

[0250] To validate the efficacy of this master cell line platform, EGFP was used as the GOI. Following successful exchange facilitated by Cre recombinase and Ganciclovir selection, the CAG promoter-driven EGFP integrated into the ROSA26 locus, resulting in a visible green color, which was depicted in FIGs. 2A-2E. Remarkably, the targeting efficiency was found to be 100%, as both of the two green colonies picked displayed the desired genotyping and Sanger sequencing results. The EGFP-QKO-EPSC cell lines were expanded to facilitate their future applications, such as the identify donor contribution in the chimera assay, to trace the location and identity of donor cells during co-culture and other molecular experiments. The sequences in FIG. 2D are shown in Table E4. Table E4. Sequences in FIG. 2D 4. Humanization gene integration (QKO-hCD47-EPSC)

[0251] Following the establishment of the master EPSC cell platform, the human CD47 cDNA was chosen as the first GOI to be integrated into QKO-EPSCs (FIG. 1A) . Human CD47 plays a crucial role in the “don’ t eat me” signal transmitted to macrophages. In the context of pig-to-human xenotransplantation, the expression of porcine CD47 on the cell surface hampers the effective transmission of this self-tolerance signal to human macrophages, leading to the phagocytosis of porcine xenografts.

[0252] The integration of human CD47 at the pig ROSA26 locus using RMCE in QKO-EPSCs is depicted in FIG. 3. Briefly, the human CD47 cDNA was driven by CAG promoter, and this donor fragment was further flanked by lox71 and lox2272. Genotyping results confirmed the targeted integration of human CD47 at the ROSA26 locus, which was further validated through Sanger sequencing. The targeting efficiency was determined to be 92%, with 11 out of 12 colonies exhibiting the desired integration (FIG. 1H) . The hCD47-QKO-EPSCs demonstrated robust growth in culture, characterized by domed-shaped colonies and a high nuclear-to-cytoplasm ratio (FIGs. 4A-4E) . CD47 integration was also confirmed by Sanger sequencing (FIG. 4E) . The sequences in FIG. 4E are shown in Table E5. Immunofluorescence staining of human CD47 confirmed its expression in QKO-hCD47-EPSCs, while no expression was observed in wildtype EPSCs (FIG. 1D) . This observation confirms the successful integration and expression of the human CD47 gene in QKO-hCD47-EPSCs, thus establishing a valuable cell line for future investigations in the field of pig-to-human transplantation. Table E5. Sequences in FIG. 4E Example 3: Molecular Characterization of Genetically Modified Porcine EPSCs

[0253] Molecular characterization was performed to investigate the potential impact of multiple gene modifications, including the knock-out of xeno-related genes (GGTA1, CMAH, B4GALNT2) and the insertion of the humanization-related gene (human CD47) at ROSA26 locus, on the pluripotency, differentiation potential, and genome stability of EPSCs.

[0254] Despite having undergone multiple gene editing events including the knock-out of xeno-related genes and the insertion of the human CD47 gene, the genetically modified porcine EPSCs retained their pluripotency, demonstrated normal chromosome numbers, and maintained their developmental potential (FIGs. 5-6) . Example 4: Endothelial Cell Differentiation from Porcine EPSCs

[0255] This example shows the differentiation of porcine EPSCs into endothelial cells.

[0256] The differentiation process involved three steps (FIGs. 7A and 7C) . Firstly, the cells were cultured in the Essential 8 medium, which mimicked the post-implantation stage and primed the cells for differentiation. Next, a mesoderm medium was added for two days to promote commitment to the mesoderm lineage. Finally, an endothelial cell induction medium was used to generate early endothelial progenitors.

[0257] During the differentiation process, on day 7 to day 9, endothelial cells were collected for CD31 analysis or further passaged and expanded for downstream experiments. Hemogenic endothelial cell aggregates, indicative of hematopoietic potential, were observed after one day of endothelial medium induction (FIG. 7C) . Flow cytometry analysis revealed a differentiation efficiency of approximately 68%for the initial batch of endothelial differentiation. Subsequent differentiation batches using different CD31 antibodies showed over 90%efficiencies, similar to porcine immortalized endothelial cells PED (FIG. 7D) . Morphologically, the porcine EPSC-derived endothelial cells exhibited cobble stone-like structures similar to porcine immortalized endothelial cell lines (FIG. 7C) . PCA analysis showed that the gene expression pattern of PED and EPSC-derived endothelial cells (WT-endo, Q47-endo) were similar, both with increased endothelial marker gene expression, PECAM1, CDH5, ENG and vWF (FIG. 7F) , while PEF and WT-EPSC distributed further, indicating the transcriptomic differences. These findings demonstrate the successful differentiation of porcine EPSCs into endothelial cells using the optimized three-step protocol. Example 5: Evaluation of Immune Responses of Porcine EPSC-Derived Endothelial  Cells

[0258] This example demonstrates the evaluation of immune responses of porcine EPSC-derived endothelial cells.

[0259] To assess α-Gal expression, flow cytometry analysis was performed on EPSC-derived endothelial cells. While normal porcine EPSCs exhibit minimal α-Gal (FIG. 8A) , wildtype porcine EPSCs-derived endothelial cells exhibited 96.6%positive staining for α-Gal expression (FIG. 8B) . In contrast, QKO-hCD47 endothelial cells, where the GGTA1 gene had been functionally knocked out, showed a significantly reduced level of α-Gal expression, with only 2.55%positive staining.

[0260] Complement-mediated cytotoxicity, a crucial aspect of immune rejection in pig-to-human xenotransplantation, is primarily triggered by the presence of α-Gal epitopes on the cell surface. To assess the susceptibility of EPSC-derived endothelial cells to complement-mediated cytotoxicity, we conducted a complement-killing assay. We performed a live / dead flow cytometry experiment using QKO-hCD47-EPSC-derived endothelial cells (Q47-endo) , wild-type endothelial cells (WT-endo) , and the porcine PED cell line (positive control) . The results (FIGs. 9C and 9D) demonstrated that QKO-hCD47-endo exhibited a substantially lower death percentage (34.1%) compared to wild-type endothelial cells (68.5%) and PED (55%) , indicating that genetic modification of EPSC-derived endothelial cells confers enhanced protection against complement-mediated cytotoxicity.

[0261] Furthermore, immunofluorescence and flow cytometry analyses were performed to assess the binding of human immunoglobulins (IgG and IgM) to EPSC-derived endothelial cells (FIGs. 9E and 9F) . Consistent with the complement killing assay, it was observed that Q47-endo cells showed a reduced binding capacity for human immunoglobulins compared to wild-type endothelial cells. This finding suggests that the genetic modification of porcine EPSC cells with xeno-antigen removal and human CD47 integration effectively prevented the binding of human immunoglobulins, thereby reducing the risk of antibody-mediated immune rejection.

[0262] To assess the potential protective effect of transgenic human CD47 expression against macrophage phagocytosis, an in vitro co-culture assay was conducted. Macrophages displayed varying levels of phagocytosis toward different cell types (FIG. 9G) . The porcine PED cell line exhibited the highest susceptibility to phagocytosis (46.6%) , followed by WT-endo cells (40.5%) . In contrast, Q47-endo cells comprising modifications such as knockout of GGTA1, CMAH, B4GALNT2, and GHR genes, and insertion of human CD47, showed lower susceptibility to macrophage phagocytosis (19%) . These findings indicate that the incorporation of human CD47 cDNA may confer protection against macrophage phagocytosis. This protective effect could be attributed to the downregulation of xeno-antigens and the interaction between human CD47 and its receptor on macrophages, thus inhibiting phagocytosis.

[0263] These findings showed the potential and uniqueness of EPSC-derived endothelial cells as a valuable tool for assessing the immune responses of different genetic modification strategies and ultimately paving the way for the development of improved strategies in xenotransplantation.

Claims

1.A composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in TP53.2.The composition of claim 1, wherein the porcine totipotent / pluripotent stem cells are further modified to contain an inactivating mutation in a xeno-antigen related gene.3.A composition comprising porcine totipotent / pluripotent stem cells, wherein the porcine totipotent / pluripotent stem cells are genetically modified to contain an inactivating mutation in a xeno-antigen related gene.4.The composition of claim 2 or 3, wherein the xeno-antigen related gene is selected from the group consisting of GGTA1, CMAH, and B4GALNT2.5.The composition of any one of claims 1-4, wherein the porcine totipotent / pluripotent stem cells further contain an inactivating mutation in a gene associated with organ growth.6.The composition of claim 5, wherein the gene associated with organ growth is GHR.7.The composition of any one of claims 1-6, wherein the inactivating mutation is a gene knockout.8.The composition of any one of claims 1-7, wherein the porcine totipotent / pluripotent stem cells further comprise a heterologous nucleic acid.9.The composition of claim 8, wherein the heterologous nucleic acid encodes an immune modulating protein.10.The composition of claim 9, wherein the immune modulating protein is CD47.11.The composition of any one of claims 8-10, wherein the heterologous nucleic acid is integrated into the genome of the totipotent / pluripotent stem cells at a safe harbor locus.12.The composition of claim 11, wherein the safe harbor locus is ROSA26.13.The composition of claim 11 or 12, wherein the heterologous nucleic acid is integrated into the genome of the totipotent / pluripotent stem cells by a recombinase.14.The composition of claim 13, wherein the recombinase is a Cre recombinase.15.The composition of any one of claims 8-14, wherein the heterologous nucleic acid further comprises a lox71 site at a 5’ end of the heterologous nucleic acid and a lox2272 sites at a 3’ end of the heterologous nucleic acid, or the heterologous nucleic acid further comprises a lox71 site at a 3’ end of the heterologous nucleic acid and a lox2272 sites at a 5’ end of the heterologous nucleic acid.16.The composition of any one of claims 1-15, wherein the porcine totipotent / pluripotent stem cells are Expanded Potential Stem Cells (EPSCs) .17.A method of xenotransplantation, comprising introducing the composition of any one of claims 1-16 to an individual in need thereof.18.The method of claim 17, wherein the individual is a human.19.An in vitro evaluation system for evaluating suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, wherein the system comprises cells and / or organoids differentiated from the totipotent / pluripotent stem cells.20.The in vitro evaluation system of claim 19, wherein the cells and / or organoids are selected from the group consisting of: endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids.21.The in vitro evaluation system of claim 19 or 20, wherein the totipotent / pluripotent stem cells are genetically modified.22.The in vitro evaluation system of any one of claims 19-21, wherein the composition comprising totipotent / pluripotent stem cells is a composition according to any one of claims 1-16.23.The in vitro evaluation system of any one of claims 19-22, wherein the totipotent / pluripotent stem cells are EPSCs.24.The in vitro evaluation system of any one of claims 19-23, wherein the totipotent / pluripotent stem cells are porcine EPSCs.25.A method of evaluating the suitability of a composition comprising totipotent / pluripotent stem cells for xenotransplantation, comprising evaluation of immune responses caused by the totipotent / pluripotent stem cells and / or organoids differentiated from the totipotent / pluripotent stem cells.26.The method of claim 25, wherein the cells and / or organoids are selected from the group consisting of: endothelial cells, cardiomyocytes, heart organoids, hepatocytes, liver organoids, skin keratinocytes, skin organoids, pancreatic beta cells, islets, intestinal epithelial cells, gut organoids, blood cells, retinal pigment epithelium (RPE) cells, and kidney organoids.27.The in vitro evaluation system of any one of claims 19-24 or the method of claim 25 or 26, wherein the cells are endothelial cells, and the xenotransplantation is selected from the group consisting of cardiac transplantation, liver transplantation, skin transplantation, islet transplantation, gut transplantation, blood transfusion, and RPE transplantation.28.The method of any one of claims 25-27, wherein the totipotent / pluripotent stem cells are porcine EPSCs.29.The method of any one of claims 25-28, further comprising differentiating the totipotent / pluripotent stem cells into the cells and / or organoids.30.The method of claim 29, comprising differentiating the porcine EPSCs into the endothelial cells.31.The method of any one of claims 25-30, wherein the totipotent / pluripotent stem cells are genetically modified.32.The method of claim 31, wherein the composition comprising genetically modified totipotent / pluripotent stem cells is the composition according to any one of claims 1-16.33.The method of any one of claims 25-32, wherein the evaluation of immune responses is selected from the group consisting of evaluation of xeno-antigen expression, complement-mediated cytotoxicity, antibody binding, and macrophage phagocytosis.34.The method of any one of claims 25-33, further comprising comparing the xeno-antigen activity of the composition comprising cells and / or organoids differentiated from genetically modified totipotent / pluripotent stem cells with a composition comprising cells and / or organoids differentiated from unmodified totipotent / pluripotent stem cells.35.A method of generating a population of endothelial cells from porcine expanded potential stem cells (EPSCs) , comprising (a) subjecting the porcine EPSCs to a first condition that differentiates the EPSC into mesodermal cells; and (b) subjecting the mesodermal cells to a second condition that differentiates the mesodermal cells into endothelial cells.36.The method of claim 35, wherein the EPSCs are genetically modified.37.The method of claim 35 or 36, further comprising (c) subjecting the endothelial cells to a third condition that differentiates the endothelial cells into hemogenic cells.38.The method of any one of claims 35-37, further comprising culturing the EPSCs in a priming medium before subjecting the porcine EPSCs to the first condition.39.The method of any one of claims 35-38, wherein the first condition comprises a mesoderm induction medium.40.The method of any one of claims 35-39, wherein the second condition comprises an endothelial cell induction medium.

Citation Information

Patent Citations

  • Means and methods for producing stabilized cells of interest

    JP2008509663A

  • Method of efficiently establishing induced pluripotent stem cells

    WO2009157593A1

  • Compositions and methods for chimeric embryo-assisted organ production

    WO2017075276A2

  • Method of reducing the tumorigenic potential of a population of mammalian stem cells after genome editing

    WO2022162353A1