Method for detecting foodborne pathogens using bacteriophages

Abstract

The present invention relates to a method for detecting live foodborne pathogens using novel bacteriophages LEC1, LBC9, and LSE2. By using this method, Escherichia coli, Bacillus cereus, and Salmonella spp., which are live foodborne pathogens in food, can be rapidly and accurately detected at the same time, and thus the method can be effectively used for preventing food poisoning.

Description

Method for detecting food poisoning bacteria using bacteriophages

[0001] The present invention relates to a method for detecting food poisoning bacteria using bacteriophages, and more specifically, to a method for detecting live food poisoning bacteria using novel bacteriophages LEC1, LBC9, and LSE2.

[0002]

[0003] Food poisoning is a disease closely related to human survival. According to a recent report by the World Health Organization (WHO), approximately 600 million people worldwide fall ill from consuming contaminated food, resulting in approximately 420,000 deaths annually. Two-thirds of these illnesses are known to be caused by pathogenic foodborne pathogens. The risk of food poisoning is particularly high when contaminated vegetables or fresh produce are consumed without being cooked. Therefore, accurately identifying the specific types of pathogenic foodborne pathogens causing food contamination and identifying the source of contamination are known to be of utmost importance.

[0004] Conventional methods for detecting pathogenic foodborne pathogens include culture, immunology, and nucleic acid-based techniques. However, these methods are time-consuming and can result in false positive results due to reactant contamination. Furthermore, polymerase chain reaction (PCR), a representative example of nucleic acid-based detection, is widely applied to isolates of foodborne pathogens or nucleic acid extracts from food due to its superior speed, sensitivity, and specificity compared to conventional culture and immunoassay techniques while minimizing the risk of contamination. However, despite these advantages, conventional PCR-based methods have limitations: they cannot distinguish between live and dead bacteria, and nucleic acid extraction, which primarily involves heat and chemical lysis, requires a variety of solvents and skilled techniques.

[0005] To overcome these limitations, interest in bacteriophages, viruses that infect foodborne pathogens, is growing. A representative example is phage amplification assays, which rely on the detection of progeny phages released after bacteriophage lysis of host bacteria, and are being utilized as a strategy for pathogenic bacterial detection, combining absorbance, bioluminescence, fluorescence imaging, and PCR analysis. Bacteriophage-based approaches integrate bacterial lysis and DNA extraction into a single step for nucleic acid purification and detection, eliminating the need for additional reagents and simplifying the detection process. Furthermore, because phages can replicate only within viable hosts, they can distinguish between live and dead bacteria.

[0006] Against this backdrop, the present inventors have completed an invention regarding a method for detecting food poisoning bacteria having host specificity and selectivity for live bacteria by using a novel bacteriophage and combining multiplex PCR for simultaneous detection of multiple food poisoning bacteria present in food and for more accurate detection.

[0007]

[0008] The present invention aims to solve the above-mentioned problems and other problems related thereto.

[0009] The purpose of the present invention is to provide a method for detecting food poisoning bacteria using bacteriophage, comprising the steps of: (a) filtering and concentrating food poisoning bacteria from a sample homogenate using a filter; (b) culturing and enriching the concentrated food poisoning bacteria; (c) adding and culturing a bacteriophage composition to the enriched food poisoning bacteria to lyse the food poisoning bacteria and extract DNA; and (d) amplifying the extracted DNA using polymerase chain reaction.

[0010] Another object of the present invention is to provide a bacteriophage composition for detecting food poisoning bacteria, comprising at least one selected from the group consisting of a bacteriophage deposited under the deposit number KCTC 15076BP, a bacteriophage deposited under the deposit number KCTC 15867BP, and a bacteriophage deposited under the deposit number KCTC 15866BP.

[0011] Another object of the present invention is to provide a kit for detecting food poisoning bacteria comprising the bacteriophage composition.

[0012] Another object of the present invention is to provide a use of a bacteriophage composition comprising at least one selected from the group consisting of a bacteriophage deposited under the deposit number KCTC 15076BP, a bacteriophage deposited under the deposit number KCTC 15867BP, and a bacteriophage deposited under the deposit number KCTC 15866BP for detecting food poisoning bacteria.

[0013]

[0014] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0015] In one aspect to achieve the above object, the present invention provides a method for detecting food poisoning bacteria using bacteriophage, comprising the steps of: (a) filtering and concentrating food poisoning bacteria from a sample homogenate using a filter; (b) culturing and enriching the concentrated food poisoning bacteria; (c) adding and culturing a bacteriophage composition to the enriched food poisoning bacteria to lyse the food poisoning bacteria and extract DNA; and (d) amplifying the extracted DNA using polymerase chain reaction.

[0016] In the present invention, the "sample" may be any substance including food poisoning bacteria, including water, agricultural products, marine products, human or animal saliva, food, etc., without limitation, but may specifically be food.

[0017] In the present invention, the “homogeneous liquid” means a uniformly mixed liquid.

[0018] In the present invention, the term "food poisoning" refers to an infectious or toxic disease that is caused or is thought to have been caused by the consumption of food or water.

[0019] In the present invention, the “food poisoning bacteria” refers to bacteria that can cause food poisoning. Specifically, in the present invention, the food poisoning bacteria may be Escherichia coli (E. coli), Bacillus cereus (B. cereus), Salmonella spp. (Salmonella spp.), Cronobacter sakazakii (Cronobacter sakazakii), Staphylococcus aureus (S. aureus), Listeria monocytogenes (L. monocytogenes), Yersinia enterocolitica (Y. enterocolitica) or / and Vibrio parahaemolyticus (V. parahaemolyticus), and preferably, food poisoning bacteria of the genus E. coli, Bacillus cereus or / and Salmonella, but are not limited thereto.

[0020] In the present invention, the food poisoning bacteria may be alive in the sample, but is not limited thereto.

[0021] In the present invention, the above "E. coli" refers to an enteric bacterium belonging to the bacilli and a gram-negative bacterium. Most E. coli are commensal bacteria and not pathogenic bacteria, but E. coli O157:H7 and enterotoxigenic E. coli (ETEC) are pathogenic E. coli and are known to cause food poisoning in humans or diarrhea in various animals such as cattle, pigs, and goats.

[0022] The above pathogenic E. coli is E. coli with virulence factors that inhabits the large intestine of humans or animals, and may be, but is not limited to, enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC), or diffusely adherent E. coli (DAEC).

[0023] In the present invention, the "Bacillus cereus" is an environmental bacterium widely distributed in various foods, including rice, grains, vegetables, and meat, and is a Gram-positive, facultative anaerobic, spore-producing, motile, and rod-shaped bacterium.

[0024] In the present invention, the above "Salmonella spp." is a genus of the Enterobacteriaceae family, and includes S. enterica or S. bongori as subclasses, and S. enterica includes Salmonella Typhimurium (murine typhoid bacteria). In particular, S. Typhimurium has a short incubation period and is known to infect humans or mammals, causing fever, vomiting, food poisoning, enteritis, and typhoid fever.

[0025] In the present invention, the food poisoning bacteria are 10 in the sample. 1 -10 6 It may be included at a concentration of CFU / mL, and specifically, E. coli O157:H7 or S. Typhimurium in the sample is 10 1 -10 6 It may be included at a concentration of CFU / mL, and for B. cereus, 10 3 -10 6 It may be included at a concentration of CFU / mL.

[0026] In a specific embodiment, by the detection method of the present invention, the food poisoning bacteria is 10 3 It was confirmed that E. coli O157:H7, S. Typhimurium, and B. cereus could be successfully detected even when included at a concentration of CFU / mL.

[0027] In the present invention, the "filter" may be one that recovers and filters food poisoning bacteria contaminated in a sample to concentrate them, and specifically, the filter may be CA (Cellulose Acetate), Track Etched (track-etched polycarbonate), PVDF (polyvinylidene fluoride), PTFE (polytetrafluoroethylene), PES (polyethersulfone), NYLON, MCE (mixed cellulose ester), or CN (cellulose nitrate), and preferably PES, but is not limited thereto.

[0028] In the present invention, the term “filtration” means separating and recovering food poisoning bacteria present in a sample homogenate using a filter.

[0029] In the present invention, the "concentration" means reducing the volume to increase the concentration of food poisoning bacteria present in the sample after separating the food poisoning bacteria present in the sample. The food poisoning bacteria may be concentrated to 10 CFU / ml or more based on the solution containing the food poisoning bacteria filtered in step (a), and 10 to 10 10 It may be concentrated to CFU / ml, preferably 10 3 CFU / ml or more 10 10 It may be concentrated to less than CFU / ml, but is not limited as long as it is within the range where the bacteriophage can be active against food poisoning bacteria.

[0030] In the present invention, the "cultivation" of step (b) may be a pre-culture process performed for the purpose of making the food poisoning bacteria filtered and concentrated in step (a) grow better before adding the bacteriophage composition to the food poisoning bacteria, and the food poisoning bacteria may be enriched through the culturing process. In the present invention, the culturing may be performed for 30 minutes to 3 hours, and preferably, for 1 hour. In the present invention, by performing such culturing and enrichment processes, more reliable detection of food poisoning bacteria can be performed.

[0031] In the present invention, the term "enrichment" refers to selectively increasing food poisoning bacteria and increasing their proportion. In the present invention, the terms "concentration" and "enrichment" may refer to increasing the number of food poisoning bacteria per unit volume.

[0032] In the present invention, the "bacteriophage" refers to a bacteria-specific virus that infects a specific bacterium and inhibits or suppresses the growth of the bacterium. It refers to a virus that contains single- or double-stranded DNA or RNA as its genetic material, and is known to be capable of surviving only within viable bacteria. In the present invention, the bacteriophage may have the activity of infecting food poisoning bacteria and suppressing or inhibiting their growth.

[0033] In the present invention, the bacteriophage may be a bacteriophage (LEC1) deposited with the deposit number KCTC 15076BP, a bacteriophage (LBC9) deposited with the deposit number KCTC 15867BP, and a bacteriophage (LSE2) deposited with the deposit number KCTC 15866BP.

[0034] In the present invention, the "bacteriophage composition" means a composition comprising one or more bacteriophages. Specifically, the bacteriophage composition may comprise one or more bacteriophages selected from the group consisting of a bacteriophage (LEC1) deposited with the deposit number KCTC 15076BP, a bacteriophage (LBC9) deposited with the deposit number KCTC 15867BP, and a bacteriophage (LSE2) deposited with the deposit number KCTC 15866BP, and preferably, the composition may be in the form of a cocktail containing all of the bacteriophage deposited with the deposit number KCTC 15076BP, the bacteriophage deposited with the deposit number KCTC 15867BP, and the bacteriophage deposited with the deposit number KCTC 15866BP as active ingredients.

[0035] In the present invention, the cocktail may mean a mixture of several types of bacteriophages, and specifically, may be two or more selected from the group consisting of a bacteriophage (LEC1) deposited with the deposit number KCTC 15076BP, a bacteriophage (LBC9) deposited with the deposit number KCTC 15867BP, and a bacteriophage (LSE2) deposited with the deposit number KCTC 15866BP.

[0036] The above bacteriophage LEC1 may include the base sequence represented by SEQ ID NO: 1 as all or part of the entire gene. In addition, the bacteriophage LEC1 of the present invention may be composed of the base sequence represented by SEQ ID NO: 1 and a functional equivalent of the base sequence. The functional equivalent means a sequence that has a sequence homology of at least 70% or more, specifically 80% or more, more specifically 90% or more, and even more specifically 95% or more to the base sequence represented by SEQ ID NO: 1 as a result of modification or substitution of the base sequence, and exhibits substantially the same physiological activity as the base sequence represented by SEQ ID NO: 1. In addition, the bacteriophage LEC1 of the present invention may be a bacteriophage that has an activity of targeting Escherichia coli and inhibiting or suppressing its growth.

[0037] The above bacteriophage LBC9 may include the base sequence represented by SEQ ID NO: 2 as all or part of the entire gene. In addition, the bacteriophage LBC9 of the present invention may be composed of the base sequence represented by SEQ ID NO: 2 and a functional equivalent of the base sequence. The functional equivalent means a sequence that has at least 70% or more, specifically 80% or more, more specifically 90% or more, and even more specifically 95% or more sequence homology with the base sequence represented by SEQ ID NO: 1 as a result of modification or substitution of the base sequence, and exhibits substantially the same physiological activity as the base sequence represented by SEQ ID NO: 2. In addition, the bacteriophage LBC9 of the present invention may be a bacteriophage that has an activity of targeting Bacillus cereus and inhibiting or suppressing its growth.

[0038] The above bacteriophage LSE2 may include the base sequence represented by SEQ ID NO: 3 as all or part of the entire gene. In addition, the bacteriophage LSE2 of the present invention may be composed of the base sequence represented by SEQ ID NO: 3 and a functional equivalent of the base sequence. The functional equivalent means a sequence that has a sequence homology of at least 70% or more, specifically 80% or more, more specifically 90% or more, and even more specifically 95% or more to the base sequence represented by SEQ ID NO: 3 as a result of modification or substitution of the base sequence, and exhibits substantially the same physiological activity as the base sequence represented by SEQ ID NO: 3. In addition, the bacteriophage LSE2 of the present invention may be a bacteriophage that has an activity of targeting and inhibiting the growth of food poisoning bacteria belonging to the genus Salmonella, and the food poisoning bacteria belonging to the genus Salmonella may be S. enterica or S. Typhimurium.

[0039] In the present invention, the "cultivation" of step (c) means adding a composition containing bacteriophage to concentrated food poisoning bacteria and proliferating the bacteriophage. In the present invention, the culturing may be performed for 30 minutes to 3 hours, preferably for 1 hour to 2 hours, and more preferably for 1 hour, but is not limited thereto.

[0040] According to a specific example, in the method for detecting food poisoning bacteria using the bacteriophage of the present invention, it was confirmed that the optimal culture time was 1 hour when considering the total detection time, the appearance of resistant strains, DNA extraction efficiency, etc.

[0041] In the present invention, the bacteriophage composition of step (c) may be added so that the bacteriophage included in the composition has an MOI (multiplicity of infection) value of 10 or more, preferably 10 to 500, and more preferably 100, but is not limited thereto.

[0042] In the present invention, the above "MOI" means the number of viruses that infect one bacterium on average, and in the present invention means the value obtained by dividing the number of bacteriophages by the number of infected target food poisoning bacteria.

[0043] In the present invention, the term “bacteriophage” means that a bacteriophage infects a bacterium, proliferates inside the bacterium, destroys the bacterial cell wall, and kills the bacterium.

[0044] In the present invention, the "polymerase chain reaction (PCR)" refers to a technology capable of detecting a specific DNA sequence by replicating (amplifying) it in large quantities, and the polymerase chain reaction is composed of steps of denaturation, binding, extension, or synthesis, and can be repeated multiple times to amplify DNA.

[0045] In the present invention, the polymerase chain reaction (PCR) may be conventional PCR, real-time PCR, reverse transcription (RT)-PCR, multiplex PCR, or multiplex real-time PCR, preferably multiplex PCR or multiplex real-time PCR, and more preferably multiplex PCR, but is not limited thereto. The multiplex PCR is a technique capable of simultaneously amplifying a plurality of specific DNA sequences, and can simultaneously amplify target DNA using multiple pairs of primers in one PCR reaction.

[0046] In the present invention, the multiplex PCR may be performed in the following steps: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 30 seconds, annealing at 54°C for 20 seconds, extension at 72°C for 1 minute for 30 cycles, and post-extension at 72°C for 5 minutes.

[0047] In the present invention, the "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be replicated, and can serve as an initiation point for the synthesis of a primer extension product. The length and sequence of the primer must allow for the initiation of the synthesis of the extension product. The specific length and sequence of the primer depend on the complexity of the desired DNA or RNA target, as well as the conditions under which the primer is used, such as temperature and ionic strength.

[0048] In the present invention, the oligonucleotide used as the primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or may include an intercalating agent. In addition, the primer may incorporate additional characteristics that do not change the basic property of the primer to act as an initiation point for DNA synthesis. The primer sequence of the present invention may, if necessary, include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of labels include enzymes (e.g., HRP (horse radish peroxidase), alkaline phosphatase), radioactive isotopes (e.g., 32P), fluorescent molecules, chemical groups (e.g., biotin), etc.

[0049] In the present invention, the primer for detecting food poisoning bacteria includes a primer pair for PCR, and more specifically, but not limited thereto, may refer to a primer pair for multiplex PCR for the DNA genome of each strain of the aforementioned food poisoning bacteria. The primer pair of the present invention includes a forward primer and a reverse primer, and specifically, may be at least one primer pair selected from the group consisting of a primer pair represented by SEQ ID NOS: 4 and 5 capable of detecting food poisoning bacteria; a primer pair represented by SEQ ID NOS: 6 and 7; and a primer pair represented by SEQ ID NOS: 8 and 9, wherein the primer pair represented by SEQ ID NOS: 4 and 5 may be for amplifying DNA of Escherichia coli, the primer pair represented by SEQ ID NOS: 6 and 7 may be for amplifying DNA of food poisoning bacteria belonging to the genus Salmonella, and the primer pair represented by SEQ ID NOS: 8 and 9 may be for amplifying DNA of Bacillus cereus.

[0050] In the present invention, the term "simultaneous" is not limited to cases where the detection occurs in complete temporal synchrony, and may also encompass cases where detection occurs simultaneously within a given analysis process. Specifically, this may encompass cases where the results can be confirmed in a single analysis process using the same experimental method, device, or kit, even if the detection of each food poisoning bacteria occurs sequentially.

[0051] In the present invention, the term “detection” means determining the presence or absence of a specific food poisoning bacteria in a sample or diagnosing whether a sample is contaminated or infected with a specific food poisoning bacteria.

[0052] In the present invention, the method for detecting food poisoning bacteria may further include, after step (d), a step (e) of analyzing the amplified DNA.

[0053] The step of analyzing the amplified DNA may be performed by electrophoresis, DNA chip, gel electrophoresis, urea-polyacrylamide gel electrophoresis (PAGE), radiometric measurement, fluorescence measurement, and phosphorescence measurement, and may be specifically measured by PAGE, but is not limited thereto.

[0054] In the present invention, the method for detecting food poisoning bacteria utilizes a composition containing a novel bacteriophage to lyse food poisoning bacteria and detect DNA using multiplex PCR, thereby enabling faster and more efficient detection than other commercially available methods for detecting food poisoning bacteria. Specifically, the detection method may be performed for 1 to 5 hours, and more specifically, may be performed within 3 hours.

[0055] As another aspect for achieving the above purpose, a bacteriophage composition for detecting food poisoning bacteria is provided, comprising at least one selected from the group consisting of a bacteriophage deposited with the deposit number KCTC 15076BP, a bacteriophage deposited with the deposit number KCTC 15867BP, and a bacteriophage deposited with the deposit number KCTC 15866BP.

[0056] The above “bacteriophage” and “bacteriophage composition” are as described above.

[0057] In the present invention, the bacteriophage composition may be a cocktail composition including a bacteriophage deposited with the deposit number KCTC 15076BP, a bacteriophage deposited with the deposit number KCTC 15867BP, and a bacteriophage deposited with the deposit number KCTC 15866BP, and in this case, it may be used to simultaneously detect food poisoning bacteria such as Escherichia coli, Bacillus cereus, and Salmonella spp. from a sample.

[0058] As another aspect for achieving the above purpose, the present invention provides a kit for detecting food poisoning bacteria comprising the bacteriophage composition.

[0059] The above “bacteriophage”, “bacteriophage composition”, “food poisoning”, “food poisoning bacteria” and “detection” are as described above.

[0060] In the present invention, the "kit" may include one or more primer pairs selected from the group consisting of primer pairs represented by SEQ ID NOs: 4 and 5, primer pairs represented by SEQ ID NOs: 6 and 7, and primer pairs represented by SEQ ID NOs: 8 and 9, and / or additionally a reagent for performing an amplification reaction. For the purpose of the present invention, the reagents for performing an amplification reaction in the kit may include DNA polymerase, dNTPs, and a buffer, and in addition, components necessary for performing electrophoresis to confirm whether a PCR product is amplified may be additionally included in the kit of the present invention.

[0061] In another aspect for achieving the above object, the present invention provides a use of a bacteriophage composition comprising at least one selected from the group consisting of a bacteriophage deposited with the deposit number KCTC 15076BP, a bacteriophage deposited with the deposit number KCTC 15867BP, and a bacteriophage deposited with the deposit number KCTC 15866BP for detecting food poisoning bacteria.

[0062]

[0063] The present invention relates to a method for detecting live food poisoning bacteria using novel bacteriophages LEC1, LBC9 and LSE2, wherein the method for detecting food poisoning bacteria enables the rapid and accurate simultaneous detection of live Escherichia coli, Bacillus cereus and Salmonella spp. food poisoning bacteria in food, and thus can be usefully utilized for preventing food poisoning.

[0064]

[0065] Figure 1 is a graph showing the number of cultured food poisoning bacteria colonies depending on the presence or absence of the bacteriophage of the present invention.

[0066] Figure 2 shows the results of confirming target specificity by treating the bacteriophage of the present invention with three food poisoning bacteria (A: spotting assay, B: fluorescence microscope image analysis).

[0067] Figure 3 is a graph showing the number of colonies of food poisoning bacteria after treating a culture medium containing three types of food poisoning bacteria with the bacteriophage of the present invention (A: E. coli, B: B. cereus, C: S. Typhimurium).

[0068] Figure 4 shows the results of fluorescence spectra for live and dead food poisoning bacteria (Figure 4a) and fluorescence images for live (Figure 4b) and dead (Figure 4c) food poisoning bacteria.

[0069] Figure 5 is a graph showing the relative concentration of DNA extracted according to the DNA extraction method using bacteriophage of the present invention compared to a commercially available DNA extraction kit (A: E. coli, B: B. cereus, C: S. Typhimurium).

[0070] Figure 6 is a schematic flowchart showing a method for detecting food poisoning bacteria using a novel bacteriophage of the present invention.

[0071] Figure 7 shows the concentration (A) of food poisoning bacteria DNA extracted from a food sample using the bacteriophage of the present invention and the result of electrophoresis thereof (B).

[0072] Figure 8 is a graph showing the recovery rate of food poisoning bacteria according to filter material.

[0073] Figure 9 shows a fluorescence microscope image (A) of food poisoning bacteria according to the culture time after bacteriophage treatment of the present invention and a graph (B, C, and D) showing the relative concentration of extracted DNA.

[0074] Figure 10 is a graph showing the change in DNA concentration of extracted food poisoning bacteria according to the concentration of food poisoning bacteria (A: E. coli, B: B. cereus, C: S. Typhimurium).

[0075] Figure 11 shows the results of electrophoresis of the products of multiplex PCR using primer pairs of each food poisoning bacteria (E: E. coli, S: S. Typhimurium, B: B. cereus).

[0076] Figure 12 shows the results of electrophoresis of PCR products of DNA extracted from food poisoning bacteria at various concentrations (A: E. coli, B: S. Typhimurium, C: B. cereus).

[0077]

[0078] Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0079]

[0080] Example 1. Isolation of bacteriophages LEC1, LBC9, and LSE2

[0081] 1.1. Preparation of host food poisoning bacteria

[0082] As host food poisoning bacteria for the bacteriophage to be isolated in the present invention, Escherichia coli NCCP 15739 (O157:H7), Bacillus cereus KCTC 1094, and Salmonella Typhimurium ATCC 14028 were used. All food poisoning bacteria strains were stored frozen at -80°C in 15% glycerol.

[0083]

[0084] 1.2. Isolation of bacteriophages LEC1, LBC9, and LSE2

[0085] A novel E. coli-targeting bacteriophage (LEC1), Bacillus cereus-targeting bacteriophage (LBC9), and S. Typhimurium-targeting bacteriophage (LSE2) were screened using samples collected from sewage and excrement treatment plants in Iksan and Gimje, Jeollabuk-do. To remove impurities and bacteria in the collected samples, the samples were filtered using a 0.45 μm pore size filter. After filtration, 20 mL of the sample was cultured at 37°C for 24 h, and 20 mL of 2 X tryptic soy broth (TSB) and 400 μL of the host food poisoning bacteria strains (E. coli, Bacillus cereus, and S. Typhimurium) cultured overnight were mixed, and 2 mM MgCl2 and CaCl2 were added. After incubation, 1 mL of the culture was centrifuged at 20,000 x g for 2 minutes and the supernatant was filtered using a 0.22 μm pore size filter. To observe single plaques, a plaque-forming assay was performed using 0.4% TSB soft agar inoculated with the host food poisoning bacteria. Thereafter, a single plaque was isolated and eluted in SM buffer (0.1 M NaCl, 8 mM MgSO4 7H2O, and 50 mM Tris-HCl, pH 7.5). The plaque isolation and elution steps were repeated to increase the purity of the single plaque. In addition, the single phage filtrate was incubated with the host food poisoning bacteria cell culture at 37°C for 4 hours for bacteriophage enrichment. Afterwards, the host food poisoning bacteria residues were removed by centrifugation at 20,000Хg for 10 minutes and filtering through a 0.45μm pore size filter.

[0086] The phage lysate was stored overnight at 4°C in the presence of 1 M NaCl with 10% polyethylene glycol 6000 to precipitate the bacteriophage. The precipitate was centrifuged at 20,000 x g for 1 h at 4°C. The precipitated bacteriophage was then resuspended in SM buffer and further purified using CsCl density gradient ultracentrifugation at 81,300 x g for 2 h at 4°C. After purification, the concentrated bacteriophage was dialyzed against 1 L of SM buffer for 1 h to prepare a phage stock, which was stored in glass vials at 4°C.

[0087] Bacteriophages LEC1, LBC9, and LSE2 were deposited with the Korea Research Institute of Bioscience and Biotechnology and assigned accession numbers KCTC 15076BP, KCTC 15867BP, and KCTC 15866BP, respectively. In addition, the genome sequences of bacteriophages LEC1, LBC9, and LSE2 were registered in GenBank under the accession numbers OR791411, OR791410, and OR791409, respectively. The base sequence of the bacteriophage LEC1 is represented by SEQ ID NO: 1, the base sequence of the bacteriophage LBC9 is represented by SEQ ID NO: 2, and the base sequence of the bacteriophage LSE2 is represented by SEQ ID NO: 3.

[0088]

[0089] Example 2. Characterization of bacteriophages LEC1, LBC9, and LSE2

[0090] 2.1. Experimental method

[0091] The activity of the novel bacteriophages LEC1, LBC9, and LSE2 isolated in Example 1 against food poisoning bacteria was analyzed.

[0092] To analyze the lytic activity of bacteriophages against pathogenic food poisoning bacteria, each overnight culture of food poisoning bacteria was diluted 1000-fold with TSB and mixed with E. coli O157:H7, B. cereus, and S. Typhimurium LEC1, LBC9, and LSE2, respectively, to approximately an MOI (multiplicity of infection) of 100. TSB was used as a negative control. The number of viable food poisoning bacteria in the culture medium was measured at 1-hour intervals during 3-hour shaking incubation at 37°C. A portion of each culture was serially diluted 10-fold, and 1 mL was dropped onto a 3M Petrifilm Aerobic Count Plate. Colonies were counted after 24 hours of incubation at 37°C.

[0093]

[0094] 2.2. Results of activity analysis of bacteriophages against food poisoning bacteria

[0095] As shown in Figures 1A to 1C, in the presence of newly isolated bacteriophages LEC1, LBC9, and LSE2 targeting E. coli, B. cereus, and S. Typhimurium, the survival rate of food-borne pathogens was substantially reduced within 1 hour, whereas growth of food-borne pathogens was observed in the absence of phages. All three bacteriophages exhibited strong antibacterial activity, with LEC1 targeting E. coli in particular reducing the number of food-borne pathogens by approximately 10 7 10 in CFU / mL 2 CFU / mL, and LBC9 inhibited B. cereus by approximately 10 6 10 in CFU / ml 3 In CFU / ml, LSE2 inhibits S. Typhimurium by approximately 10 7 10 in CFU / ml 5CFU / ml. Furthermore, optimal lytic activity was observed at an MOI of > 10. Furthermore, all three phages had relatively short incubation periods, with one cycle of phage replication requiring less than 1 hour under standard growth conditions.

[0096]

[0097] Experimental Example 1. Target Specificity Analysis of Bacteriophages LEC1, LBC9, and LSE2

[0098] 1.1. Experimental Method

[0099] Host specificity was confirmed through spotting assay of bacteriophages LEC1, LBC9, and LSE2. In order to verify the target specificity of the bacteriophage of the present invention, in addition to three host food poisoning bacteria (E. coli O157:H7, B. cereus, S. Typhimurium), Cronobacter sakazakii ATCC 29004, Staphylococcus aureus ATCC 12600, Listeria monocytogenes ATCC 15313, Yersinia enterocolitica NCCP 12713, and Vibrio parahaemolyticus ATCC 27969 strains were used. The overnight culture (100 μL) of each food-borne pathogen strain was mixed with 4 mL of 0.4% TSB soft agar and 10 mM CaCl2 and carefully transferred to a tryptic soy agar plate (TSA). The mixture was then allowed to solidify at room temperature for approximately 15 minutes. 10 μL of a bacteriophage solution was then added thereto and dried at room temperature for approximately 30 minutes. E. coli, S. Typhimurium, C. sakazakii, S. aureus, and L. monocytogenes were cultured at 37°C, and B. cereus, V. parahaemolyticus, and Y. enterocolitica were cultured at 30°C, and the formation of lytic zones by phages was evaluated.

[0100] In addition, the target specificity of the bacteriophage was further confirmed using fluorescence imaging. The morphology of each target food poisoning bacteria was observed according to the observed morphological changes by applying it to each food poisoning bacteria targeting LEC1, LBC9, and LSE2. Specifically, three pathogenic food poisoning bacteria (E. coli O157:H7, B. cereus, and S. Typhimurium) were cultured in TSB overnight with gentle shaking. The concentration of each food poisoning bacteria was 10 through serial dilution. 6 The prepared food poisoning bacteria solution was adjusted to CFU (colony forming unit) / mL. The same amount of bacteriophage (10 10 PFU / mL) were mixed. To induce lysis of food-borne pathogen cells, the mixture was incubated at 37°C with constant shaking at 200 rpm. After incubation for 1 h, 1 mL of each reaction solution was passed through a nanoporous AAO membrane. After that, the membrane was washed by filtering 2 mL of RNase-free water and dried in the air. The pretreated AAO membrane was stained with 100 μL of SYTO9 solution (Live / Dead viability kit, Invitrogen), which is permeable to living and dead cells, for 20 min in the dark. After staining, the membrane was observed, and fluorescence images were obtained using a Nikon Eclipse 80i epifluorescence microscope equipped with a DS-Fi1 camera head (Nikon, Tokyo, Japan). The above AAO membrane (Anodisc, pore diameter 20 nm, disk diameter 25 mm, thickness 60 μm) was purchased from Whatman (Maidstone, UK).

[0101] Additionally, considering the diversity of food poisoning bacteria strains within a species, the lytic activity of bacteriophages against various strains within the same species was measured. The method for measuring lytic activity is as described above. The results of evaluating the lytic activity of bacteriophages according to the strains of food poisoning bacteria within a species are shown in Tables 1 to 3 below. S. Typhimurium is Salmonella enterica serovar Typhimurium, and the lytic activity of the bacteriophages of the present invention was evaluated against strains belonging to Salmonella enterica. +++ indicates a transparent plaque, ++ indicates a slightly turbid plaque, and + indicates a turbid plaque.

[0102] In addition, to confirm the selective lysis of target bacteria by bacteriophages in mixed culture samples, E. coli O157:H7, B. cereus, and S. Typhimurium strains were cultured overnight in individual tubes and then mixed in a 1,000-fold dilution in TSB medium. The mixed culture containing each of the three food-borne pathogenic bacteria strains was divided into four flasks, and LEC1, LBC9, and LSE2 bacteriophages were mixed in three flasks to an MOI of 100. TSB was mixed in the remaining flasks instead of the bacteriophage solution as a negative control. These cultures were agitated at 37°C, and after 1 hour, the number of viable bacteria was determined for each of the four cultures on selective media (CT-MacConkey Sorbitol agar for E. coli O157:H7, mannitol-egg yolk-polymyxin agar for B. cereus, and xylose lysine desoxycholate agar for S. Typhimurium).

[0103]

[0104] 1.2. Experimental Results

[0105] As shown in Figure 2A, each bacteriophage formed a transparent lytic zone only against its respective target food-borne pathogen. Specifically, LEC1 formed a lytic zone against E. coli O157:H7, whereas LBC9 and LSE2 formed lytic zones against B. cereus and S. Typhimurium, respectively.

[0106] Furthermore, as shown in Figure 2B, unlike the non-target food poisoning bacteria, the target food poisoning bacteria appeared to lose their original shape and spread out 1 hour after phage inoculation. Furthermore, dye fluorescence was observed in the overall background. The non-target food poisoning bacteria maintained their characteristics and proliferated regardless of the bacteriophage inoculation. This confirmed the target specificity of each bacteriophage for the target food poisoning bacteria.

[0107] In addition, as shown in Tables 1 to 3 below, considering the diversity of food poisoning bacteria strains within the species of the bacteriophage of the present invention, the lytic activity of the bacteriophage against various strains within the same species was measured, and it was confirmed that the lytic activity was exhibited against a wide range within each target food poisoning bacteria species. Therefore, the bacteriophage of the present invention not only exhibits specificity for lysing only the target food poisoning bacteria, but also exhibits the ability to detect a wide range of strains within each food poisoning bacteria species.

[0108] Bacteria strainLEC11E. coliDH5α-+++2E. coliDH10B-+3E. coliBL21(DE3)-+++4E. coliER2738-++5E. coliATCC 47000-++6E. coliATCC 10536-+7E. coliATCC 9637-+8E. coliATCC 8739-++9E. coliNCCP 13937O103+10E. coliOE50O157:H7+++11E. coliNCTC 12079O157:H7+++12E. coliATCC 43890O157:H7++13E. coliATCC 43889O157:H7++14E. coliATCC 43894O157:H7++15E. coliATCC 35150O157:H7+++16E. coliNCCP 11091O157:H7++17E. coliATCC 43895O157:H7+++18E. coliNCCP 12537O103++19E. coliNCCP 12551O121+20E. coliNCCP 13667O26+++21E. coliNCCP 14020O157:H7+++22E. coliNCCP 14538O157++23E. coliNCCP 15647O104+24E. coliNCCP 15739O157:H7++25E. coliNCCP 15954O145+26E. coliNCCP 15956O103++27E. coliNCCP 15961O26+++

[0109]

[0110] Bacteria strainLBC91B. cereusATCC 11778+++2B. cereusATCC 14579+3B. cereusKCTC 1094+4B. cereusKFDA 164+5B. cereusKFDA 229+6B. cereusKFDA 250+7B. cereusNCCP 14796+8B. cereusisolate 1+++9B. cereusisolate 2+++10B. cereusisolate 3+11B. cereusisolate 4++12B. cereusisolate 5++13B. cereusisolate 6+++14B. cereusisolate 7+15B. cereusisolate 8++16B. cereusisolate 9++17B. cereusisolate 10+18B. cereusisolate 11+++19B. cereusisolate 12++20B. cereusisolate 13+21B. cereusisolate 14+22B. cereusisolate 15+23B. cereusisolate 16++24B. cereusisolate 17++25B. cereusisolate 18+26B. cereusisolate 19+27B. cereusisolate 20+28B. cereusisolate 21+29B. cereusisolate 22+++30B. cereusisolate 23++31B. cereusisolate 24+32B. cereusisolate 25+++33B. cereusisolate 26+34B. cereusisolate 27+35B. cereusisolate 28+

[0111]

[0112] Bacteria strainLSE21S. entericaDublinNCCP 12232+2S. entericaEnteritidisATCC 13076++3S. entericaEnteritidisKCCM 12021+4S. entericaEnteritidisNCCP 14547++5S. entericaEnteritidisNCCP 14771++6S. entericaEnteritidisNCCP 16206++7S. entericaTyphiNCCP 14641+8S. entericaTyphimuriumATCC 14028+9S. entericaTyphimuriumATCC 43971+10S. entericaTyphimuriumDT104+11S. entericaTyphimuriumNCCP 12241+12S. entericaTyphimuriumNCCP 16207+

[0113]

[0114] In addition, as a result of confirming the selective lysis of target bacteria by bacteriophages in mixed culture samples, as shown in Fig. 3, when one bacteriophage was introduced into a mixture containing E. coli O157:H7, B. cereus, and S. Typhimurium, the target food poisoning bacteria for the bacteriophage were lysed, but non-target food poisoning bacteria continued to grow and were not affected in any way. This means that the target specificity of a bacteriophage exhibits selective efficacy by selectively lysing target food poisoning bacteria without being affected by the presence of other food poisoning bacteria in a sample containing various food poisoning bacteria species.

[0115]

[0116] Experimental Example 2. Confirmation of the selective activity of bacteriophages against live food-borne pathogens.

[0117] 2.1. Experimental method

[0118] Since most foodborne illnesses are caused by live foodborne pathogens, selectively detecting only live foodborne pathogens is more accurate and efficient. Therefore, experiments were conducted to confirm the selectivity of the bacteriophages LEC1, LBC9, and LSE2 of the present invention against live host foodborne pathogens.

[0119] Specifically, three food-borne pathogens cultured overnight were incubated in TSB for approximately 10 9CFU / mL and treated with 70% isopropyl alcohol for 1 hour to prepare a dead cell suspension. Live and dead food poisoning bacteria were prepared using the LIVE / DEAD BacLight Bacterial Viability Kit (Invitrogen) according to the manufacturer's instructions. Live food poisoning bacteria were obtained by replacing the culture medium with 0.85% NaCl and centrifuging at 10,000 x g (twice). Dead food poisoning bacteria suspension was prepared by culturing live food poisoning bacteria in 70% isopropyl alcohol at room temperature for 60 minutes, washing with 0.85% NaCl, centrifuging at 10,000 x g twice, and finally suspending live and dead food poisoning bacteria in a 0.85% NaCl solution. Live and dead samples of three food-borne pathogens were incubated in the dark for 15 min at room temperature with 1.5 μL of 3.34 mM SYTO9 (permeable to both live and dead cells) and 1.5 μL of 30 mM propidium iodide (PI) (permeable only to dead cells). Afterwards, fluorescence spectra were measured to investigate fluorescence intensity. Fluorescence intensity images of the stained food-borne pathogen suspensions were obtained using a Nikon Eclipse 80i w / DS-Fi1 epi-fluorescence microscope (Nikon, Tokyo, Japan) without a DS-Fi1 camera head, and analyzed using a fluorescence microplate reader (Infinite M200; Tecan, Grodig, Austria).

[0120] Conversely, purification of genomic DNA of food poisoning bacteria from live and dead cells was performed using a conventional spin column-based bacterial genomic DNA extraction kit starting from the lysis step depending on whether the food poisoning bacteria were Gram-positive or Gram-negative. A mixture of prepared live and dead food poisoning bacteria (1:1 ratio) was cultured with shaking at 200 rpm for 1 hour at 37°C, and an equal volume of bacteriophage (10) was added to TSB. 10 PFU / mL) was added to induce lysis of food-borne pathogen cells. Genomic DNA of food-borne pathogens was purified using a bacterial genomic DNA extraction mini kit (iNtRON Biotechnology) according to the manufacturer's protocol, excluding the lysis step. Genomic DNA was recovered from the silica membrane by adding 100 μL of deionized water and centrifuging.

[0121] The concentration of genomic DNA of the recovered foodborne pathogens was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific), and the DNA fragments were further verified using agarose gel electrophoresis. The spin column-based bacterial genomic DNA extraction kit (iNtRON Biotechnology, Seongnam, Korea) was provided. SYTO9 exhibits strong green fluorescence under blue excitation, and PI exhibits red fluorescence under green excitation.

[0122] Additionally, the relative DNA concentrations of the DNA extracted by lysing food poisoning bacteria using the bacteriophage of the present invention and the commercially available DNA extraction kit (G-spin™ Genomic DNA Extraction Kit (for Bacteria), iNtRON Biotechnology) were compared. Live samples and dead samples of three food poisoning bacteria strains were inoculated with the same diluted bacteriophage solution and cultured. Subsequently, the DNA was purified and quantified. The relative DNA concentration was expressed as the amount of DNA extracted using the bacteriophage of the present invention / the amount of DNA extracted using the commercially available DNA extraction kit (%).

[0123]

[0124] 2.2. Experimental Results

[0125] As a result, as shown in Fig. 4a, similar fluorescence spectra were observed in all three food poisoning bacteria strains. At 475 nm, which corresponds to the extension value of SYTO9, live and dead samples exhibited high and low fluorescence intensities, respectively. At 530 nm, which corresponds to the extension value of PI, almost no fluorescence was measured in live samples, but significantly higher fluorescence was observed in dead samples. In other words, the application of the two dyes confirmed that two samples with different fluorescence spectra were present, confirming that both live and dead samples were included.

[0126] Additionally, when live food poisoning bacteria (Fig. 4b) and dead food poisoning bacteria (Fig. 4c) were analyzed through fluorescence microscopy imaging, the live samples of the food poisoning bacteria strains exhibited strong green fluorescence under blue excitation and no fluorescence under green excitation. In contrast, the dead samples responded to both blue and green excitation (Fig. 4a), but a stronger response was observed under green excitation conditions. This confirmed the existence of live and dead samples for the three food poisoning bacteria strains.

[0127] In addition, as a result of comparing the relative DNA concentration of the DNA extracted by lysing the food poisoning bacteria using the bacteriophage of the present invention and the DNA extraction kit sold on the market, in the case of E. coli O157:H7, the purification efficiency was 147.3 ± 1.0% in the live sample and 32.5 ± 0.1% in the dead sample when DNA was extracted using bacteriophage compared to when DNA was purified using the kit, confirming that the purification efficiency was much higher in the live sample. In the case of S. Typhimurium, the results were 129.6 ± 0.2% in the live sample and 32 ± 0.3% in the dead sample, similar to the results of E. coli O157:H7. That is, the activity of LEC1 and LSE2 against the live food poisoning bacteria of each host food poisoning bacteria was confirmed. However, B. In the case of cereus, the live samples showed low values ​​of about 77.8±0.4% and the dead samples showed low values ​​of 82.5±1.5%, showing no significant difference between the live and dead samples.

[0128] To interpret these results, similar experiments were performed under identical conditions using other Gram-positive S. aureus strains and their bacteriophages. Similar to B. cereus, S. aureus exhibited similar DNA concentrations in live and dead samples. This suggests that the cell walls of Gram-positive bacteria are thicker and stronger than those of Gram-negative bacteria, making it relatively difficult for bacteriophages to effectively destroy them. Therefore, it was confirmed that the amount of DNA from Gram-positive bacteria obtained at the same extraction time may be relatively less than that from Gram-negative bacteria.

[0129]

[0130] Experimental Example 3. Multiple detection method for food poisoning bacteria in food using bacteriophages.

[0131] 3.1. Experimental method

[0132] The method for detecting food poisoning bacteria of the present invention is schematically illustrated in Fig. 6. The method for detecting food poisoning bacteria of the present invention includes the steps of filtering and concentrating target food poisoning bacteria from contaminated food, culturing and enriching the concentrated food poisoning bacteria, lysing the food poisoning bacteria with a bacteriophage cocktail containing three types of bacteriophages LEC1, LBC9, and LSE2, and detecting the DNA of the target food poisoning bacteria through multiplex PCR.

[0133] Multiplex PCR was performed in a total volume of 20 μL, including 9 μL of phage-treated sample for each target gene, 8 μL of DNase / RNase-free DI water, 1.5 μL of forward primer, and 1.5 μL of reverse primer.

[0134] The multiplex PCR cycle was as follows: pre-denaturation at 95°C for 10 min; 30 cycles of denaturation at 95°C for 30 s, annealing at 54°C for 20 s, extension at 72°C for 1 min, and post-extension at 72°C for 5 min.

[0135] After the PCR reaction, 10 μL of the reaction solution and 10 μL of the sample buffer were loaded onto a 15% urea-polyacrylamide gel electrophoresis (PAGE) gel and stained with 1 x SYBR Green I and II for 15 minutes. Finally, the stained gel was analyzed using a Gel Documentation System (Uvitec, Cambridge, UK). All DNA primers used for multiplex PCR were synthesized by Bioneer (Daejeon, South Korea). The DNA primer sequences used for each food poisoning bacteria are shown in Table 4 below. Samples treated with three bacteriophages were used as templates to amplify the genes of the target food poisoning bacteria (VT2 was used for E. coli O157:H7, ttr for S. Typhimurium, and hblD for B. cereus). Multiplex PCR PreMix (Bioneer) was used, SYBR Green I and II and TBE-Urea gel (15%, 12 well) were purchased from Invitrogen, TBE / Urea sample buffer was purchased from Bio-Rad (Hercules, CA, USA), and DNA ladder was purchased from Takara (Kyoto, Japan).

[0136] Target cellTarget gene (size)PrimersSequences(5'→3')SEQ ID NO:Escherichia coliO157:H7VT2(255 bp)ForwardGGCACTGTCTGAAACTGTCC4ReverseTCGCCAGTTATCTGACATTCTG5SalmonellaTyphimuriumttr(94 bp)ForwardATTACAACATGGCTCACCAGGAG6ReverseGCTCAGACCAAAAGTGACCAT7Bacillus cereushblD(829 bp)ForwardACCGGTAACACTATTCATGCATT8ReverseGGAGTCCATATGCTTAGATGCTG9

[0137]

[0138] The method for detecting food poisoning bacteria of the present invention as described above was applied to foods contaminated with food poisoning bacteria. First, genomic DNA extraction by bacteriophage cocktail treatment was evaluated from cabbage kimchi samples contaminated with one or more of the three target food poisoning bacteria. Cabbage kimchi was purchased from a traditional market in Jeonju, South Korea. Cabbage kimchi leaves weighing approximately 25 g were washed three times with saline solution, and 10 kimchi leaves were each inoculated with 10 kimchi phage cocktail. 3Food poisoning bacteria (E. coli O157:H7, B. cereus, and S. Typhimurium) were injected at 10 CFU / mL to artificially infect food samples. The infected food samples were placed in a stomach bag, 225 mL of 0.85% NaCl solution was added, and the stomach bag was mixed for 10 seconds using a homogenizer to prepare a sample homogenate. Each sample homogenate was prepared by adding E (E. coli only), ES (E. coli and S. Typhimurium added), and ESB (E. coli, S. Typhimurium, and B. cereus added) to kimchi. The prepared sample homogenate was filtered using a vacuum pump equipped with a 45 mm diameter polyethersulfone (PES) membrane filter (pore size 0.45 μm). In actual food samples, the efficiency of recovering food poisoning bacteria can vary depending on the sampling method or contamination status, and false negative results can also occur. Therefore, a pre-culture process is necessary for reliable detection of multiple contaminated food poisoning bacteria. Therefore, target food poisoning bacteria were filtered from artificially contaminated kimchi using a polyethersulfone (PES) filter and enriched through a 1-hour pre-culture process. Specifically, the food poisoning bacteria were concentrated on the filter through solution filtration using a polyethersulfone filter, and the filter containing the concentrated food poisoning bacteria was recovered and inverted into a sample cup containing 1.9 mL of TSB solution. Afterwards, the sample cup was placed in a shaking incubator at 37°C for 1 hour at 200 rpm to enrich the food poisoning bacteria. The concentration factor due to filtration and cultivation using a polyethersulfone filter was evaluated using the colony counting method, and as can be seen in Table 5 below, the concentration and enrichment was approximately 1000 times or more.The concentration factor was calculated as log(cell concentration in the recovered sample / cell concentration in the initial sample). It was confirmed that simple and rapid concentration and enrichment were possible through the aforementioned concentration and enrichment methods.

[0139] Target cellNumber of bacteriaConcentration factor*Initial sample(250 mL)Recovered sample(1.9 mL)Escherichia coliO157:H77.3 Х10 3 6.3 Х10 4 3.1Salmonella Typhimurium8.4 Х10 3 9.5 Х10 4 3.2Bacillus cereus5.1 Х10 3 8.3 Х10 4 3.3

[0140]

[0141] Next, a bacteriophage cocktail solution (10 10PFU / mL) was added and cultured in a shaking incubator for 1 hour. Genomic DNA was extracted according to the manufacturer's protocol of the bacterial genomic DNA extraction mini kit as performed in Experimental Example 2, excluding the lysis step. The extraction was performed by adding binding buffer to 450 μL of culture sample solution, and then adding 100 μL of distilled water to elute the genomic DNA. The concentration of the extracted genomic DNA was quantified using a NanoDrop spectrophotometer and further verified using multiplex PCR. The multiplex PCR experimental method was the same as Experimental Example 3. The cell number was confirmed by colony counting on selective agar medium (CT-MacConkey Sorbitol agar for E. coli O157:H7, mannitol-egg yolk-polymyxin agar for B. cereus, and xylo-se-lysine-desoxycholate agar for Salmonella). In addition, a commercial kit (Spin column-based bacterial genomic DNA extraction kit, iNtRON Biotechnology, Seongnam, Korea) was used as a positive control (PC) to extract nucleic acids from three target foodborne pathogens in E, ES, and ESB samples using bacteriophage. DNA was amplified using multiplex PCR, and analysis was performed using PAGE.

[0142] All analyses were performed in triplicate, and data are presented as mean ± standard deviation. One-way analysis of variance (ANOVA) and Tukey's post hoc test were performed using GraphPad Prism 10.1 (GraphPad, San Diego, CA, USA).

[0143] The recovery rate of food poisoning bacteria may vary depending on the surface charge of each microorganism, the surface charge of the filter material, and the pH of the food. To select an appropriate filter, the recovery rate (%) of food poisoning bacteria was evaluated for each filter (CA, Track Etched, PVDF, PTFE, PES, NYLON, MCE, or CN).

[0144]

[0145] 3.2 Experimental Results

[0146] As a result, as shown in Fig. 7A, the DNA concentration of the sample (E) containing only E. coli O157:H7 was 14 ± 0.9 ng / μL, the DNA concentration of the sample (ES) containing both E. coli O157:H7 and S. Typhimurium was 15.1 ± 1.9 ng / μL, and the DNA concentration of the sample (ESB) containing all three strains including B. cereus was 21.5 ± 2.5 ng / μL. That is, the amount of nucleic acid obtained gradually increased from the single type (E) to the triple mixed type (ESB) depending on the number of contaminated food poisoning bacteria. However, the rate of increase in nucleic acid was not consistent as the type of contaminated food poisoning bacteria increased from the single type to the triple mixed type. The DNA concentration obtained from the mixed sample of E. coli O157:H7 and S. Typhimurium was 15.1 ± 1.9 ng / μL, and the DNA concentration of the mixed sample of E. The growth rate was lower than that obtained from samples contaminated with coliO157:H7 alone. This result was confirmed to be due to the relatively low bactericidal activity of the LSE2 phage specific for S. Typhimurium (see Figs. 1 and 3).

[0147] In addition, the results of analyzing the recovery rates of three types of food poisoning bacteria according to the filtration method according to the filter material are shown in Fig. 8. As shown in Fig. 8, the PES filter showed relatively low recovery characteristics for S. Typhimurium. Accordingly, the DNA concentration obtained from the mixed sample of E. coli O157:H7 and S. Typhimurium in Fig. 7A may have shown a lower increase rate than that obtained from the sample contaminated with E. coli O157:H7 alone.

[0148] In addition, as shown in Figure 7B, the results of gel electrophoresis of the multiplex PCR amplification products showed that a single band (255 bp) was observed in the E. coli O157:H7 sample (E). Double bands (255 and 94 bp) were observed in the mixed sample of E. coli O157:H7 and S. Typhimurium (ES). Triple bands (255, 94, and 829 bp) were observed in the mixed sample of E. coli O157:H7, S. Typhimurium, and B. cereus (ESB). The relatively thin amplicon band (94 bp) of S. Typhimurium was expected to be due to the low bactericidal activity of the LSE2 phage and purification filter as described above. Triple bands were observed in the positive control (PC). That is, using the detection method of the present invention, the type of contaminated food poisoning bacteria in a food sample could be clearly identified, and non-specific amplification products due to side reactions were not observed.

[0149] Therefore, the method of detecting food poisoning bacteria of the present invention using a bacteriophage cocktail and multiplex PCR has been confirmed to have a synergistic effect between the binding specificity of primers for target genes and the selective recognition of target food poisoning bacteria by bacteriophages, and thus it has been confirmed that it can serve as a distinct advantage in an environment where multiple food poisoning bacteria must be identified simultaneously.

[0150]

[0151] Experimental Example 4. Analysis of the efficiency of bacteriophage-based food poisoning bacteria genomic DNA purification according to culture time and food poisoning bacteria concentration.

[0152] 4.1. Experimental Method

[0153] After injecting bacteriophages into food-borne pathogen cultures, it was observed that the DNA quantification efficiency and the morphology of food-borne pathogens varied with the incubation time. Bacteriophages (10) contained in TSB 10 PFU / mL) and live target foodborne pathogens (10 6 CFU / mL) and the mixture was cultured at 37°C with continuous shaking at 200 rpm for 3 hours. Then, as performed in Experimental Example 2, the genomic DNA of food poisoning bacteria was purified at 1-hour intervals using a bacterial genomic DNA extraction mini kit according to the manufacturer's instructions. The concentration of the recovered genomic DNA of food poisoning bacteria was quantified using a NanoDrop spectrophotometer and further verified using agarose gel electrophoresis.

[0154] Bacteriophage-based lytic capacity for purifying genomic DNA of foodborne pathogens 10 1 -10 6 Tests were conducted at a cell concentration of 10 CFU / mL of live target foodborne pathogens. To induce cell lysis, bacteriophages (10 10(PFU / mL) was added to an equal volume of fresh food poisoning bacteria solution and incubated at 37°C, followed by continuous shaking at 200 rpm for 1 hour. Genomic DNA was then recovered and analyzed. Fluorescence microscopy images of food poisoning bacteria cells at various incubation times were observed, and DNA extraction and purification efficiencies according to incubation time were compared. To confirm the difference according to incubation time, the DNA extraction efficiency of each sample was calculated as the relative ratio of the sample incubated for 1 hour. The fluorescence image analysis method was performed in the same manner as described in Experimental Example 2.

[0155] Additionally, to determine the influence of the optimal foodborne pathogen concentration on bacteriophage activity, three foodborne pathogen strains were tested at 10 4 -10 6 Prepared at a concentration of CFU / mL and the same concentration (10 8 After introducing bacteriophage (PFU / mL), the cultured medium was purified using the same experimental method as above, and the purified DNA was quantified using a NanoDrop spectrophotometer.

[0156] Subsequently, to verify the purified DNA, target gene-specific PCR assays were performed on each food poisoning bacteria sample, followed by gel electrophoresis. In Experimental Example 3, the three primer pairs (VT2, ttr, and hblD) selected for multiplex PCR were verified to specifically function against each target food poisoning bacteria.

[0157] In addition, in order to confirm the results of the sensitivity verification of the food poisoning bacteria detection method, the minimum concentration of food poisoning bacteria required for DNA extraction using the bacteriophage of the present invention was confirmed. Specifically, various concentrations (10 1 10 inland 6Gel electrophoresis was performed on PCR products using food poisoning bacteria samples (10 CFU / mL). A commercial DNA extraction kit (spin column-based bacterial genomic DNA extraction kit, iNtRON Biotechnology, Seongnam, Korea) was used as a control.

[0158]

[0159] 4.2. Analysis of DNA purification efficiency according to culture time

[0160] As a result of analyzing the DNA purification efficiency according to the incubation time, as shown in Fig. 9A, most of the food poisoning bacteria were observed in an intact form at the beginning (0 h), and the sample after incubation for 1 hour (1 h) had a form similar to Fig. 2B. That is, after incubation for 1 hour (1 h), it was confirmed that most of the food poisoning bacteria forms were destroyed in E. coli O157:H7. In the sample after incubation for 1 hour (1 h), it was confirmed that the original forms of B. cereus and S. Typhimurium were destroyed, although not uniformly. In addition, after incubation for 2 hours (2 h), E. coli O157:H7 remained mostly destroyed. After incubation for 2 hours (2 h), significant morphological changes were observed in B. cereus and S. Typhimurium compared to the forms after incubation for 1 more hour. However, E. In the case of coli O157:H7 and S. Typhimurium, after 3 hours of incubation (3 h), relatively clear and diffuse forms of food poisoning bacteria coexisted. This suggests that phage-resistant strains develop over time.

[0161] The results comparing the purified DNA concentration according to the incubation time are shown in Figures 9B to 9D. The extraction efficiency of E. coli O157:H7 was 99.7 ± 2.1% when incubated for 1 hour, 89.1 ± 4.2% when incubated for 2 hours, and 113.3 ± 1.7% when incubated for 3 hours, indicating that the DNA extraction efficiency increased with the incubation time. In addition, in the case of B. cereus, the DNA extraction efficiency of the sample incubated for 1 hour was 97.2 ± 4.4%, but there was almost no change thereafter. On the other hand, S. Typhimurium showed the highest increase rate according to the incubation time, slightly increasing to 101.9 ± 1.9% for the sample incubated for 1 hour, 129.6 ± 2.6% for the sample incubated for 2 hours, and 137 ± 1.5% for the sample incubated for 3 hours. That is, DNA concentration increased somewhat over time in E. coli O157:H7 and S. Typhimurium, but there was little difference in B. cereus.

[0162] From these results, it was confirmed that 1 hour was required as the optimal culture condition, considering the total detection time for simultaneous detection of all three food poisoning bacteria, the emergence of resistant strains, and DNA extraction efficiency.

[0163]

[0164] 4.3. Analysis of DNA purification efficiency according to food poisoning bacteria concentration

[0165] The results of confirming the influence of food poisoning bacteria concentration on bacteriophage activity are shown in Fig. 10. Specifically, in the case of E. coli, 10 6 In samples containing CFU / mL, the concentration of extracted DNA was 15.9 ± 0.4 ng / μL, 10 5 In samples containing CFU / mL, 11.3 ± 1.8 ng / μL, 10 4In the sample containing CFU / mL, it was measured as 10.3 ± 1.8 ng / μL. That is, as the number of E. coli decreased, the concentration of DNA decreased, and the margin of error of the experimental results increased. In the case of B. cereus, it was measured as 13.7 ± 0.8, 10.6 ± 1.1, and 8.1 ± 0.7 ng / μL, respectively. In the case of S. Typhimurium, it was measured as 8.9 ± 0.9, 7.0 ± 0.4, and 5.6 ± 0.1 ng / μL, respectively, although the difference was small, but like other strains, the DNA concentration showed a tendency to decrease. That is, it indicated that the decrease in the concentration of food poisoning bacteria was related to the decrease in the DNA concentration.

[0166]

[0167] 4.4. Verification results using multiplex PCR of purified DNA

[0168] Additionally, as shown in Fig. 11, the sizes of the amplicons for E. coli O157:H7 (E), S. Typhimurium (S), and B. cereus (B) were 255, 94, and 829 bp, respectively, and it was confirmed that the three primer pairs (VT2, ttr, and hblD) selected for multiplex PCR did not cause cross-amplification between each target food poisoning bacteria.

[0169]

[0170] 4.5. Results of sensitivity verification of food poisoning bacteria detection method

[0171] Next, as shown in Fig. 12, various concentrations (10 1 10 inland 6 As a result of performing multiplex PCR on food poisoning bacteria samples (CFU / mL), 10 for E. coli O157:H7 (Fig. 12A) and S. Typhimurium (Fig. 12B) 1 -10 6 CFU / mL, 10 for B. cereus (Fig. 12C) 3 -10 6The target band of the PCR product was confirmed at a concentration of 10 CFU / mL of food poisoning bacteria. That is, the minimum food poisoning bacteria was 10 3 We confirmed that E. coli O157:H7, S. Typhimurium, and Bacillus cereus could be detected when included in CFU / mL. Furthermore, results were almost identical to those obtained using commercially available kits, confirming that similar amounts of PCR products were generated despite the distinct activities and mechanisms of action of each phage.

[0172]

[0173] Experimental Example 5. Comparison of the detection time of food poisoning bacteria according to the detection method of the present invention and the existing detection method.

[0174] The effectiveness of the present invention's method for detecting food poisoning bacteria using bacteriophages was evaluated by comparing it with previously studied methods for detecting food poisoning bacteria. The compared existing methods for detecting food poisoning bacteria are shown in Table 6 below, and the results described in each reference paper were compared.

[0175]

[0176]

[0177] As a result, as shown in Table 6 above, it was confirmed that the method for detecting food poisoning bacteria using bacteriophage of the present invention not only enables detection of multiple food poisoning bacteria, unlike other methods, but also has a relatively short detection time (<3 h).

[0178] That is, it was confirmed that the method for detecting food poisoning bacteria of the present invention has the potential to serve as a rapid and efficient detection method for food poisoning bacteria in the food industry where rapid identification of food poisoning bacteria is essential.

[0179] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

[0180]

[0181] [Accession number]

[0182] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0183] Accession number: KCTC15076BP

[0184] Date of acceptance: 20220919

[0185]

[0186] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0187] Accession number: KCTC15866BP

[0188] Date of acceptance: 20240404

[0189]

[0190] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0191] Accession number: KCTC15867BP

[0192] Date of acceptance: 20240404

[0193]

[0194]

[0195]

[0196]

Claims

1. (a) A step of filtering and concentrating food poisoning bacteria from a sample homogenate using a filter; (b) a step of culturing and enriching the concentrated food poisoning bacteria; (c) a step of adding a bacteriophage composition to the above-mentioned food poisoning bacteria and culturing it to lyse the food poisoning bacteria and extract DNA; and (d) A method for detecting food poisoning bacteria using bacteriophage, comprising a step of amplifying the extracted DNA using polymerase chain reaction.

2. In paragraph 1, A detection method wherein the food poisoning bacteria of step (a) above are live.

3. In paragraph 1, A detection method wherein the sample of step (a) above is a food.

4. In paragraph 1, A detection method, wherein the food poisoning bacteria of step (a) above is at least one selected from the group consisting of Escherichia coli, Bacillus cereus, and Salmonella spp.

5. In paragraph 1, A detection method, wherein the filter of the above step (a) is CA, Track Etched, PVDF, PTFE, PES, NYLON, MCE or CN.

6. In paragraph 1, A detection method, wherein the bacteriophage composition of step (c) above comprises at least one bacteriophage selected from the group consisting of a bacteriophage deposited with the deposit number KCTC 15076BP, a bacteriophage deposited with the deposit number KCTC 15867BP, and a bacteriophage deposited with the deposit number KCTC 15866BP.

7. In paragraph 6, A detection method, wherein the above bacteriophage composition is a cocktail-type composition comprising a bacteriophage deposited with the deposit number KCTC 15076BP, a bacteriophage deposited with the deposit number KCTC 15867BP, and a bacteriophage deposited with the deposit number KCTC 15866BP.

8. In paragraph 7, The above detection method is a detection method that simultaneously detects food poisoning bacteria of the genus Escherichia coli, Bacillus cereus, and Salmonella.

9. In paragraph 1, A detection method wherein the culturing in step (c) is performed for 30 minutes to 3 hours.

10. In paragraph 1, A detection method wherein the polymerase chain reaction of the above step (d) is a multiplex PCR or multiplex real-time PCR.

11. In paragraph 10, A detection method, wherein the polymerase chain reaction is performed using one or more primer pairs selected from the group consisting of a primer pair represented by SEQ ID NOs: 4 and 5; a primer pair represented by SEQ ID NOs: 6 and 7; and a primer pair represented by SEQ ID NOs: 8 and 9.

12. In paragraph 1, The above detection method (e) A detection method further comprising a step of analyzing the amplified DNA.

13. In paragraph 12, A detection method, wherein the step of analyzing the amplified DNA is performed by electrophoresis.

14. In paragraph 1, A detection method, wherein the above detection method is performed for 1 to 5 hours.

15. A bacteriophage composition for detecting food poisoning bacteria, comprising at least one selected from the group consisting of a bacteriophage deposited under the deposit number KCTC 15076BP, a bacteriophage deposited under the deposit number KCTC 15867BP, and a bacteriophage deposited under the deposit number KCTC 15866BP.

16. In paragraph 15, A bacteriophage composition, wherein the food poisoning bacteria is at least one selected from the group consisting of Escherichia coli, Bacillus cereus, and Salmonella spp.

17. In paragraph 15, The above bacteriophage composition is a cocktail-type composition comprising a bacteriophage deposited with the deposit number KCTC 15076BP, a bacteriophage deposited with the deposit number KCTC 15867BP, and a bacteriophage deposited with the deposit number KCTC 15866BP.

18. In paragraph 17, A bacteriophage composition, wherein the above bacteriophage composition is used to simultaneously detect food poisoning bacteria of the genus Escherichia coli, Bacillus cereus and Salmonella spp. from a sample.

19. A kit for detecting food poisoning bacteria comprising a bacteriophage composition according to any one of claims 15 to 18.

20. In paragraph 19, The above kit is a multiplex PCR or multiplex real-time PCR kit.

21. In paragraph 19, A kit comprising at least one primer pair selected from the group consisting of a primer pair represented by SEQ ID NOs: 4 and 5; a primer pair represented by SEQ ID NOs: 6 and 7; and a primer pair represented by SEQ ID NOs: 8 and 9.

22. Use of a bacteriophage composition comprising at least one selected from the group consisting of a bacteriophage deposited with the deposit number KCTC 15076BP, a bacteriophage deposited with the deposit number KCTC 15867BP, and a bacteriophage deposited with the deposit number KCTC 15866BP for detecting food poisoning bacteria.

Images