Ionizable lipids and lipid nanoparticles and uses thereof

Abstract

Disclosed herein are ionizable lipids, lipid nanoparticles comprising a plurality of lipids, pharmaceutical compositions and methods of use thereof (e.g., for the treatment of HIV).

Description

IONIZABLE LIPIDS AND LIPID NANOPARTICLES AND USES THEREOFCROSS REFERENCE

[0001] This application claims priority to U.S. Provisional Application No. 63 / 638,036, filed April 24, 2024. the content of which is incorporated herein by reference in its entirety.STATEMENT AS TO FEDERALLY FUNDED RESEARCH

[0002] This invention was made with government support under Grants No. R01 MH121402 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML file, created on April 21. 2025, is named UNM-006WO_SL.xml and is 18.1 kilobytes in size.SUMMARY

[0004] Disclosed herein, in some embodiments, are lipids and lipid nanoparticles (LNPs) comprising a plurality of lipids. The lipid nanoparticles may be used to encapsulate and deliver therapeutics, including but not limited to nucleic acid based therapeutics, for the treatment of a variety of diseases (e.g., HIV).

[0005] For example, in some embodiments, the lipids of the present invention may be ionizable lipids. In one aspect, provided is a compound represented by Formula (I):or a pharmaceutically acceptable salt thereof, wherein:(i) each of R1and R?is independently a group represented by Formula (II):wherein: each n is independently an integer from 0 to 5; each m is independently an integer from 0 to 5; each 1 is independently an integer from 0 to 10; and each R2is independently selected from the group consisting of Ci-io alky l, C2-10 alkenyl, and C2-10 alkynyl; or(ii) R1is as defined in (i) and R3is C1-6 alkyl; k is an integer from 1 to 6;L is -N(RL) -, O -, -S-, or 5-10 membered heterocyclylene optionally substituted with one or more substituents each independently selected from the group consisting of C1-6 alkyl, halo. OH, and CN; andRLis H or C1-6 alkyl; wherein the compound of Formula (I) is optionally charged.

[0006] In some embodiments, the compound is selected from:

[0007] In another aspect, provided herein are lipid nanoparticle compositions comprising: an ionizable lipid selected from the group consisting of: a compound disclosed herein (e.g., a compound of Formula (I), (e.g., Bpip, Lpip, LA-DMA, and LA-DMDPA), DLin-MC3-DMA (dilinoleylmethyl-4-dimethylaminobutyrate or MC3), and ALC-0315) and a therapeutic agent. In some embodiments, the lipid nanoparticle further comprises a sterol, a PEG-lipid conjugate, and a helper lipid.

[0008] Another aspect of the invention provides a method of treating or preventing a disease or disorder (e.g., HIV) in a subject in need thereof , comprising administering to the subject a lipid nanoparticle composition described herein.

[0009] Other objects and advantages will become apparent to those skilled in the art from a consideration of the ensuing Detailed Description, Examples, and Claims.BRIEF DESCRIPTION OF THE DRAWINGS

[0010] FIG. 1 is anXH NMR spectrum of the Bpip ionization lipid in CDCk.

[0011] FIG. 2 is MALDI-TOF Mass Spectrometry of the Bpip ionizable lipid by using 2,5-Dihydroxybenzoic acid as a matrix.

[0012] FIG. 3 illustrates the measurement of the size (FIG 3A) and zeta potential (FIG 3B) of various LNPs synthesized from different ionizable lipids namely, Bpip, Lpip, LA-DMA, LA-DMDPA, MC3, and ALC-0315.

[0013] FIG. 4 illustrates the mRNA transfection efficacy of Bpip, Lpip, LA-DMA, LA-DMDPA, MC3, and ALC-0315 (“ALC”). FIG 4A illustrates a schematic presentation of lymphocytic T-cell lines (Jlat and JE6) and monocytic cell line (Ul). FIG 4B illustrates the relative mRNA transfection ability of LNPs synthesized from different ionizable lipids treated into Ul, JLat and JE6 cell lines. Cells were treated at the dose of 1 pg / 106cells for 48h. The dose-dependent transfection ability of MC3 and Bpip LNPs in lymphocytic T-cell line is illustrated in FIG 4C for JE6 and FIG 4D for JLat.

[0014] FIG. 5 illustrates the mRNA dose-dependent cell vitality of Bpip (FIG. 5A) and MC3 LNPs in Ul, JLat, and JE6 cell lines (FIG. 5B). LNPs show more than 80% cell vitality at the dose of lpg / 106cells. .

[0015] FIG. 6 illustrates data from select experiments involving mice. FIG. 6A illustrates a representative biodistribution image of MC3 and Bpip LNPs in BALB / c mice captured under IVIS. LNPs with a Fluc-mRNA dose of 0.5mg / kg were injected via the tail vein, and biodistribution was observed at 6h post-injection. FIG. 6B illustrates the luminescence intensity in total flux in the MC3 and Bpip-treated mice. Bpip shows a significantly higher mRNA translation efficiency than MC3.

[0016] FIG. 7 illustrates the HIV DNA elimination efficiency of Bpip. FIG. 7A is a PCR gel blot of the Bpip LNPs treated HIV-1 latently infected T-lymphocytic JE6 cell line. FIG. 7B is a PCR gel blot of the Bpip LNPs treated HIV-1 latently infected T-lymphocytic JLat cell line. The CRISPR Cas9 and gRNA encapsulated Bpip LNP were prepared at the Cas9 mRNA / gRNA ratio from L I to 180: 1. The LNPs with different Cas9 mRNA / gRNA ratio were treated in JE6 and JLat cell lines at the dose of I pg / 106cell. FIG. 7C illustrates the HIV-1 DNA excision efficiency of LNPs in the JE6 and cell line, quantified by densitometric analysis using ImageJ. FIG. 7D illustrates the HIV-1 DNA excision efficiencyof LNPs in the JLat cell line, quantified by densitometric analysis using ImageJ. The 23: 1 Cas9 mRNA / gRNA is the optimal ratio for maximum excision efficiency..DETAILED DESCRIPTION

[0017] Disclosed herein are embodiments describing novel lipids and lipid nanoparticles (LNPs) comprising a plurality of lipids. The lipid nanoparticles may be used to encapsulate and deliver therapeutics, including but not limited to nucleic acid based therapeutics, for the treatment of a variety of diseases.

[0018] The lipids of the present disclosure may be ionizable lipids. These are lipids that are cationic in acidic pH and are neutral at a neutral pH. These ionizable lipids can be used to form electrostatic complexes with negatively charged nucleic acid compositions and through self-assembly, form into LNPs which may contain additional constituents including but not limited to helper lipids, cholesterol, PEG-lipids.Definitions

[0019] As used herein the specification, ”a ‘ or “an” may mean one or more. As used herein, when used in conjunction with the word "comprising", the words “a” or “an” may mean one or more than one. As used herein “another” may mean at least a second or more. Still further, the terms “having”, “including”, “containing” and “comprising” are interchangeable and one of skill in the art is cognizant that these terms are open ended terms. Some embodiments of the disclosure may consist of or consist essentially of one or more elements, method steps, and / or methods of the disclosure. It is contemplated that any method, compound, or composition described herein can be implemented with respect to any other method, compound, or composition described herein.

[0020] "About" and "approximately" shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values. Where the use of the tenn “about” is before a quantitative value, the present invention also includes the specific quantitative value itself, unless specifically stated otherwise.

[0021] As used herein, “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describes pharmaceutically acceptablesalts in detail in J. Pharmaceutical Sciences (1977) 66: 1-19. Pharmaceutically acceptable salts of the compounds of this disclosure include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide. 2-hydroxy- ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Pharmaceutically acceptable salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(Ci-4alkyl)4 salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.

[0022] As used herein, all numerical values or numerical ranges include whole integers within or encompassing such ranges and fractions of the values or the integers within or encompassing ranges unless the context clearly indicates otherwise. Thus, for example, reference to a range of 90-100%, includes 91%, 92%, 93%, 94%, 95%, 95%, 97%, etc., as well as 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, etc., 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, etc., and so forth. In another example, reference to a range of 1-5,000 fold includes 1, 2, 3, 4, 5. 6, 7, 8, 9. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. fold, etc., as well as 1.1. 1.2. 1.3, 1.4, 1.5. fold, etc., 2.1, 2.2, 2.3, 2.4, 2.5, fold, etc., and so forth. In another example, “Ci-6 alkyl’’ is intended to encompass, Ci, C2, Cs, C4, Cs, Ce, C1-6, C1-5, C1-4, C1-3, C1-2, C2-6, C2-5, C2-4, C2- 3, C3-6, C3-5, Cs 4. C4-6, C4-5, and C5-6 alkyl.

[0023] As used herein, “alkyl’" refers to a radical of a straight-chain or branched saturated hydrocarbon group, e.g.. having 1 to 20 carbon atoms (“C1-20 alkyd”). In some embodiments, an alkyl group has 1 to 10 carbon atoms (“C1-10 alkyl”). In some embodiments, an alkyd group has 1 to 9 carbon atoms (“Ci 9 alk d”). In some embodiments, an alk d group has 1 to 8 carbon atoms (“C1-8 alkyd”). In some embodiments, an alkyl group has 1 to 7 carbon atoms (“C1-7 alkyd”). In some embodiments, an alkyl group has 1 to 6 carbon atoms (“C1-6 alkyl”). In some embodiments, an alkyl group has I to 5 carbon atoms (“C1-5 alkyl”). In some embodiments, an alkyd group has 1 to 4 carbon atoms (“Ci-4 alkyd”). In some embodiments, an alkyl group has 1 to 3 carbon atoms (“C1-3 alkyl”). In some embodiments, an alkyl group has 1 to 2 carbon atoms (“C1-2 alkyl”). In some embodiments, an alkyl group has 1 carbon atom (“Ci alkyl”). Examples of C1-6 alkyd groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, hexyl, and the like.

[0024] The terms “alkenyl” and “alkyn 1” are art-recognized and refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyds described above, but that contain at least one double or triple bond respectively.

[0025] As used herein, “heterocyclyl” or “heterocyclic” refers to a radical of a 3- to 10-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“3-10 membered heterocycly l"’). In some embodiments, in heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment is a carbon or nitrogen atom, as valency permits. In some embodiments, a heterocyclyl group is either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic heterocycly l”), and is saturated or is partially unsaturated. In some embodiments, heterocyclyl bicyclic ring systems include one or more heteroatoms in one or both rings. “Heterocyclyl” also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more cycloalkyl groups wherein the point of attachment is either on the cycloalkyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more phenyl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably.

[0026] In some embodiments, a heterocyclyl group is a 3-10 membered non-aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom isindependently selected from nitrogen, oxygen, and sulfur ("3- 10 membered heterocyclyl”). In some embodiments, a heterocyclyl group is a 4-7 membered non-aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“4-7 membered heterocyclyl”). In some embodiments, a heterocy clyl group is a 5-10 membered non-aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (“5-10 membered heterocyclyl”). In some embodiments, a heterocyclyl group is a 5-8 membered non-aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-8 membered heterocyclyl”). In some embodiments, a heterocyclyl group is a 5-6 membered non-aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-6 membered heterocyclyl”). In some embodiments, the 5-6 membered heterocyclyl has 1-3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 membered heterocyclyl has 1-2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 membered heterocyclyl has one ring heteroatom selected from nitrogen, oxygen, and sulfur.

[0027] “Hetero” when used to describe a compound or a group present on a compound means that one or more carbon atoms in the compound or group have been replaced by a nitrogen, oxygen, or sulfur heteroatom. In some embodiments, hetero is applied to any of the hydrocarbyl groups described above such as alkyl, e.g., heteroalkyl; cycloalkyl, e.g., heterocyclyl; aryl. e.g,. heteroaryl; and the like having from 1 to 5, and particularly from 1 to 3 heteroatoms.

[0028] The terms “halo” and “halogen” as used herein refer to an atom selected from fluorine (fluoro, -F), chlorine (chloro, -Cl), bromine (bromo, -Br), and iodine (iodo, -I). In certain embodiments, the halo group is either fluoro or chloro.

[0029] In general, the term “substituted,” whether preceded by the term “optionally” or not, means that at least one hydrogen present on a group (e.g., a carbon or nitrogen atom) is replaced with a permissible substituent, e.g., a substituent which upon substitution results in a stable compound, e.g., a compound w ich does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a “substituted” group has a substituent at one or more substitutable positions of the group, and when more than one position in any given structure is substituted, the substituent is either the same or different at each position.

[0030] Nitrogen atoms are substituted or unsubstituted as valency permits, and include primary, secondary, tertiary, and quaternary nitrogen atoms.

[0031] As used herein, “pharmaceutically acceptable excipient’’ refers to any substance in a pharmaceutical formulation other than the active pharmaceutical ingredient(s). Exemplary pharmaceutical excipients include those that aid the manufacturing process; protect, support or enhance stability: increase bioavailability; or increase patient acceptability. They may also assist in product identification or enhance the overall safety or function of the product during storage or use.

[0032] As used herein, a “subject” to which administration is contemplated includes, but is not limited to, humans (i.e., a male or female of any age group, e.g., a pediatric subject (e.g., infant, child, adolescent) or adult subject (e.g., young adult, middle-aged adult or senior adult)) and / or a non-human animal, e.g., a mammal such as primates (e.g., cynomolgus monkeys, rhesus monkeys), cattle, pigs, horses, sheep, goats, rodents, cats, and / or dogs. In some embodiments, the subject is a human. In some embodiments, the subject is a nonhuman animal. The terms “human,” “patient,” “subject,” and “individual” are used interchangeably herein. None of these terms require the active supervision of medical personnel.

[0033] Disease, disorder, and condition are used interchangeably herein.

[0034] As used herein, and unless otherwise specified, the terms “treat,” “treating” and “treatment” contemplate an action that occurs while a subject is suffering from the specified disease, disorder or condition, which reduces the severity of the disease, disorder or condition, or reverses or slows the progression of the disease, disorder or condition (also “therapeutic treatment”).

[0035] In general, the “effective amount” of a compound refers to an amount sufficient to elicit the desired biological response. As will be appreciated by those of ordinary skill in this art, the effective amount of a compound of the disclosure may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated, the mode of administration, and the age, weight, health, and condition of the subject. A “therapeutically effective amount” of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of a disease, disorder or condition, or to delay or minimize one or more symptoms associated with the disease, disorder or condition. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapies, which provides a therapeutic benefit in the treatment of the disease, disorder or condition. The term “therapeutically effective amount” canencompass an amount that improves overall therapy, reduces or avoids symptoms or causes of disease or condition, or enhances the therapeutic efficacy of another therapeutic agent. A “prophylactically effective amount” of a compound is an amount sufficient to prevent a disease, disorder or condition, or one or more symptoms associated with the disease, disorder or condition, or prevent its recurrence. A prophylactically effective amount of a compound means an amount of a therapeutic agent, alone or in combination with other agents, which provides a prophylactic benefit in the prevention of the disease, disorder or condition. The term ’‘prophylactically effective amount” can encompass an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent. A “prophylactic treatment” contemplates an action that occurs before a subject begins to suffer from the specified disease, disorder or condition.

[0036] The term “lipid nanoparticle(s)” or “LNP(s)” as used herein, refers to nanoparticles comprising a core and a shell where the core is enclosed by a shell comprising one or more lipids.

[0037] The term “shell” as used herein, refers to the outer portion of the lipid nanoparticle and is typically comprised of different components than the core. The shell is characterized as having an exterior surface, which does not face or is not in contact with the core of the lipid nanoparticle, and an interior surface, which faces or is in contact with the core of the lipid nanoparticle and defines the inner cavity of the lipid nanoparticle. For example, the lipid nanoparticles disclosed herein comprise a shell formed by one or more lipids (such as zwitterionic lipids, cationic lipids, and PEG-lipid conjugates) and is characterized as having an exterior surface comprising a targeting moiety (e.g., a targeting moiety linked to a PEG-lipid conjugate forming part of the shell) and an interior surface that defines the inner cavity of the lipid nanoparticle.

[0038] The term “core” as used herein, refers to the internal portion of the lipid nanoparticle that is enclosed by the shell and is in contact with the interior surface of said shell. The core is typically comprised of different components than the shell. For example, the lipid nanoparticles disclosed herein comprise a core containing one or more nucleic acids (e.g.. a CRISPR nucleic acid complementary to a sequence within an HIV-1 gene) and one or more lipids. In some embodiments, the nucleic acid is encapsulated by one or more lipids (such as zwitterionic lipids and cationic lipids).

[0039] A “vector” as used herein, refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide and which mediates delivery of the polynucleotide to a cell. Examples of vectors include nucleic-based vectors(e.g., plasmids and viral vectors) and liposomes. An exemplary nucleic-acid based vector comprises genetic elements, e.g., regulatory elements, operatively linked to a gene to facilitate expression of the gene in a target.

[0040] As used herein, the term “crRNA” means a non-coding short RNA sequence which bind to a complementary7target DNA sequence. The crRNA sequence binds to a Cas enzyme (e.g., Cas9) and the crRNA sequence guides the complex via pairing to a specific target DNA sequence.

[0041] As used herein, the term ’’tracrRNA" or trans-activating CRISPR RNA means an RNA sequence that base pairs with the crRNA (to form a functional guide RNA (gRNA)). The tracrRNA sequence binds to a Cas enzyme (e.g., Cas9), while the crRNA sequence of the gRNA directs the complex to a target sequence.

[0042] As used herein, the term “gRNA” means the crRNA and a tracrRNA bound together. The gRNA binds to a Cas enzy me (e.g., Cas9) and guides the Cas enzyme to the target sequence.

[0043] As used herein, the term “sgRNA” means a single RNA construct comprising a crRNA sequence and a tracrRNA sequence.

[0044] As used herein, the term “overlapping sequence” or ’‘overlapping exon” means exons or genes that are transcribed in different reading frame from the same part of the DNA sequence.

[0045] As used herein, the term “Bpip” refers to an ionizable lipid with the structure:Bpip can also be referred to by the chemical name ((3,3',3",3"'-((piperazine-l,4- diylbis(propane-3,l-diyl))bis(azanetriyl))tetrakis(propanoyl))tetrakis(oxy))tetrakis(ethane- 2,1-diyl) (9Z,9'Z,9"Z,9'"Z.12Z,12'Z.12"Z,12'"Z)-tetrakis(octadeca-9,12-dienoate).

[0046] As used herein, the term “Lpip” refers to an ionizable lipid with the structure:Lpip can also be referred to by the chemical name ((3,3'-((2-(4-methylpiperazin-l- yl)ethyl)azanediyl)bis(propanoyl))bis(oxy))bis(ethane-2,l-diyl) (9Z,9'Z,12Z,12'Z)- bis(octadeca-9,12-di enoate).

[0047] As used herein, the term "LA-DM A" refers to an ionizable lipid with the structure:LA-DMA can also be referred to by the chemical name ((3,3'-((3-(dimethylamino)propyl)azanediyl)bis(propanoyl))bis(oxy))bis(ethane-2,l-diyl)(9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoate).

[0048] As used herein, the term "‘LA-DMDPA” refers to an ionizable lipid with the structure:LA-DMDPA can also be referred to by the chemical name ((3,3',3",3'"-((N-methyldipropyl- 3,3'-dilylbis(propane-3,l-diyl))bis(azanetriyl))tetrakis(propanoyl))tetrakis(oxy)) tetrakis(ethane-2, 1 -diyl) (9Z,9'Z,9"Z,9"'Z, 12Z, 12'Z, 12"Z, 12"'Z)-tetrakis(octadeca-9, 12- di enoate).Ionizable lipids

[0049] Provided herein, in some embodiments, are ionizable lipids. These are lipids that are cationic in acidic pH and are neutral at a neutral pH. These ionizable lipids can be used to form electrostatic complexes with negatively charged compositions (e.g., nucleic acid compositions) and through self-assembly, form into LNPs which may contain additional constituents including but not limited to helper lipids, cholesterol, PEG-lipids.

[0050] In one aspect, provided is a compound represented by Formula (I):or a pharmaceutically acceptable salt thereof, wherein:(i) each of R1and R3is independently a group represented by Formula (II):wherein: each n is independently an integer from 0 to 5; each m is independently an integer from 0 to 5; each 1 is independently an integer from 0 to 10; and each R2is independently selected from the group consisting of Ci-io alkyl, C2-10 alkenyl, and C2-10 alkynyl; or(ii) R1is as defined in (i) and R3is C1-6 alkyl; k is an integer from 1 to 6;L is -N(RL) -, — O -, -S-, or 5-10 membered heterocyclylene optionally substituted with one or more substituents each independently selected from the group consisting of C1-6 alkyl, halo. OH, and CN; andRLis H or C1-6 alkyl; wherein the compound of Formula (I) is optionally charged.

[0051] In some embodiments, each of R1and R3is independently a group represented by Formula (II):wherein: each n is independently an integer from 0 to 5; each m is independently an integer from 0 to 5; each 1 is independently an integer from 0 to 10; and each R2is independently selected from the group consisting of Ci-io alkyl, C2-10 alkenyl, and C2-10 alkynyl.

[0052] As generally defined above, each n is independently an integer from 0 to 5. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5.

[0053] As generally defined above, each m is independently an integer from 0 to 5. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5.

[0054] As generally defined above, each 1 is independently an integer from 0 to 10. In some embodiments, 1 is 0. In some embodiments, 1 is 1. In some embodiments, 1 is 2. In some embodiments, 1 is 3. In some embodiments. 1 is 4. In some embodiments. 1 is 5. In some embodiments, 1 is 6. In some embodiments, 1 is 7. In some embodiments, 1 is 8. In some embodiments, 1 is 9. In some embodiments, 1 is 10.

[0055] As generally defined above, each R2is independently selected from the group consisting of C1-10 alkyl, C2-10 alkenyl, and C2-10 alkynyl. In some embodiments, R2is C1-10 alkyl. In some embodiments, R2is C2-10 alkenyl. In some embodiments, R2is C2-10 alkynyl. In some embodiments, R2is n-pentyl.

[0056] In some embodiments, R1is as defined in (i) and R3is C1-6 alkyl.

[0057] As generally defined above, k is an integer from 1 to 6. In some embodiments, k is 2 or 3. In some embodiments, k is 1. In some embodiments, k is 2. In some embodiments, k is 3. In some embodiments, k is 4. In some embodiments, k is 5. In some embodiments, k is 6.

[0058] As generally defined above, L is -N(RL) -, -O -, -S-. or 5-10 membered heterocyclylene optionally substituted with one or more substituents each independently selected from the group consisting of C1-6 alkyl, halo, OH, and CN. In some embodiments, L is -N(RL) - or 5-10 membered heterocyclylene.

[0059] In some embodiments, L is 5-10 membered heterocyclylene optionally substituted with one or more substituents each independently selected from the group consisting of C1-6 alkyl, halo, OH, and CN. In some embodiments, L is 5-10 memberedheterocyclylene. In some embodiments, L is 5-10 membered heterocyclylene comprising 1, 2, or 3 N atoms. In some embodiments, L is 5-10 membered heterocyclylene comprising 2 N atoms. In some embodiments, L is 5-10 membered heterocyclylene comprising at least 2 N atoms. In some embodiments, L is a 6-membered heterocyclylene. In some embodiments, L is a 6-membered heterocyclylene comprising 2 N atoms. In some embodiments, L is a 6- membered heterocyclylene comprising at least 2 N atoms. In some embodiments, L is

[0060] As generally defined above, RLis H or Ci-6 alkyl. In some embodiments, RLis H. In some embodiments, RLis Ci-6 alkyl.

[0061] In some embodiments, L is — N(RL) — . In some embodiments, L is.

[0062] In some embodiments, the compound of Formula (I) is not charged. In some embodiments, the compound of Formula (I) is charged. In some embodiments, the compound of Formula (I) is positively charged.

[0063] In some embodiments, the compound is selected from:

[0064] In some embodiments, the compound is selected from:Lipid Nanoparticles (LNPs)

[0065] Provided herein, in some embodiments, are lipid nanoparticles (LNPs) comprising a plurality of lipids. The lipid nanoparticles may be used to encapsulate and deliver therapeutics, including but not limited to nucleic acid based therapeutics, for the treatment of a variety of diseases.

[0066] The lipids of the present invention may be ionizable lipids. These are lipids that are cationic in acidic pH and are neutral at a neutral pH. These ionizable lipids can be used to form electrostatic complexes with negatively charged nucleic acid compositions and through self-assembly, form into LNPs which may contain additional constituents including but not limited to helper lipids, cholesterol, PEG-hpids.

[0067] The ionizable lipid used in the lipid nanoparticles of the present invention may be a compound as described in paragraph Nos.

[0038] -

[0053] .

[0068] In one aspect, provided herein is a lipid nanoparticle composition comprising: one or more ionizable lipids each independently selected from the group consisting of: a compound as described in paragraph Nos.

[0038] -

[0053] , DLin-MC3-DMA (dilinoleylmethyl-4-dimethylaminobutyrate or MC3), and ALC-0315 and a therapeutic agent.

[0069] In another aspect, provided is a lipid nanoparticle composition comprising: an ionizable lipid selected from the group consisting of: a compound as described in paragraph Nos.

[0038] -

[0053] , DLin-MC3-DMA (dilinoleylmethyl-4-dimethylaminobutyrate or MC3), and ALC-0315 and a therapeutic agent.

[0070] In some embodiments, the ionizable lipid is selected from the group consisting of Bpip, Lpip, LA-DMA, and LA-DMDPA.

[0071] The ionizable lipids of the present invention include the following examples:

[0072] The ionizable lipids of the present invention may also include charged versions including, but not limited to:

[0073] Lipid nanoparticles of the present invention may be comprised of one or more lipids. In some embodiments the lipid nanoparticle is comprised of a plurality of lipids. The lipid nanoparticle may comprise a plurality of lipids and lipid types, including but not limited to cationic lipids, anionic lipids, zwitterionic lipids, sterol, PEG-lipid conjugates, and helper lipids.

[0074] Examples of lipids used to produce lipid nanoparticles include, but are not limited to, Bpip, Lpip, LA-DMA, LA-DMDPA, DOTMA (l,2-di-O-octadecenyl-3- trimethylammonium propane). DOSPA (N-( 1 -(2,3- dioleyloxy )propyl)-N-2- (sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoracetate), DOTAP (1,2- dioleoyl-3-trimethylammonium propane), DMRIE (N-(l,2-dimyristyloxyprop-3- yl)-N,N- dimethyl-N-hydroxy ethyl ammonium), DC-cholesterol (3(3-(N-(N’,N’- dimethylaminoethane)-carbamoyl)cholesterol), DOTAP-cholesterol (l,2-dioleoyl-3-trimethylammonium propane;(3S,8S,9S,10R,13R.14S,17R)-10,13-dimethyl-17-[(2R)-6- methylheptan-2-yl]-2,3,4,7,8,9,11.12,14,15,16,17-dodecahydro-lH- cyclopenta[a]phenanthren-3- ol), GAP-DMORIE-DPyPE (Vaxfectin; (±)-N-(3-aminopropyl)- N,N-dimethyl-2,3-bis(cis-9- tetradeceneyloxy)-l-propanaminium;l,2-diphytanoyl-sn- glycero-3 -phosphoethanolamine), and GL67A (GL67-DOPE-DMPE-poly ethylene glycol (PEG) (cholest-5-en-3-ol (30)-,3-[(3- aminopropyl)[4-[(3- amin op ropy l)amino] butyl] carbamate; 1,2- dileoyl-sn-3- phosphoethanolamine;dimyristoylphosphoethanolamine; PEG), and pharmaceutically acceptable salts thereof.

[0075] Ionizable lipids may include, but are not limited to, Bpip, Lpip, LA-DMA, LA-DMDPA, DLin-MC3-DMA (dilinoleylmethyl-4-dimethylaminobutyrate or MC3). and ALC-0315.

[0076] Cationic lipids may include, but are not limited to, l,2-di-O-octadecenyl-3- trimethylammonium propane (DOTMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC). didodecyldimethylammonium bromide (DDAB), N, N-dimethyl2,3- dioleyloxy)propylamine (DODMA). 1 ,2-DiLinoleyloxy-N.N-dimethylaminopropane (DLinDMA), l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2- Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1 ,2-Dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLinDAC). l,2-Dilinoleyoxy-3-morpholinopropane (DLinMA), l,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1.2-Dilinoleylthio-3- dimethyl aminopropane (DLin-S-DMA), 1 -Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), l,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoy 1-3 -trimethylaminopropane chloride salt (DLin-TAP.Cl), l,2-Dilinoleyloxy-3- (Nmethylpiperazino)propane (DLin-MPZ), 3-(N,N-Dilinoleylamino)-l,2- propanediol (DLinAP), 3-(N,N-Diolcylamino)-l,2-propanedio (DOAP), l,2-Dihnoleyloxo-3-(2- N,Ndimethylamino)ethoxypropane (DLin-EG-DMA), 2,2-Dilinoleyl-4- dimethylaminomethyl-[l,3]- dioxolane (DLin-K-DMA), (3aR,5s,6aS)-N,N-dimethyl-2,2- di((9Z,12Z)-octadeca-9,12- dienyl)tetrahydro-3aH-cyclopenta[d][l,3]dioxol-5-amine (ALNY-100), DODAP (1.2-dioleoyl-3- dimethylammonium propane), GL67 (cholest-5-en-3- ol (3|3)-,3-[(3-aminopropyl)[4-[(3- aminopropyl)amino]butyl]carbamate), ethyl PC, DOSPA (N-(l-(2,3-dioleyloxy)propyl)-N-2- (sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoracetate), DOGS (dioctadecylamidoglycyl carboxyspermine), DORIE (N-(2- hydroxyethyl)-N,N-dimethyl-2,3- bis(((Z)-octadec-9-en-l-yl)oxy)propan-l-aminium ), DMRIE (N-(l,2-dimyristyloxyprop-3-yl)- N,N-dimethyl-N-hydroxyethyl ammonium), GAP-DLRIE ((+ / -)-N-(3-aminopropyl)-N,Ndimethyl-2,3-bis (dodecyloxy)- 1-propanaminium), diC 14-ami dine, 3B-[N-(N'.N'- dimethylaminoethane)-carbamoyl]cholesterol (DC-Chol), dimethyldi octadecylammonium (DDA), l,2-dioleoyl-3-trimethylammonium propane (DOTAP), l,2-dimyristoyl-3- trimethylammonium-propane (DMTAP), l,2-stearoyl-3- trimethylammonium-propane (DSTAP) and N-(4-carboxybenzyl)-N.N-dimethyl-2.3- bis(oleoyloxy)propan-l-aminium (DOBAQ), egg phosphatidylcholine, and cholesterolpolyethylene glycol. 98N12-5 (isomer of triethylenetetramine-laurylaminopropionate with a free internal amine, cholesterol, and mPEG2000-C14 glyceride), C12-200 (CAS#: 1220890- 25-4; l,l-((2-(4-(2-((2-(bis(2- hydroxy dodecyl)amino)ethyl)(2 -hydroxy dodecyl) amino)ethyl)piperazin-l- yl)ethyl)azanediyl)bis(dodecan-2-ol)), DLin-KC2-DMA (KC2) (CAS#: 1190197-97-7; 2,2- dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]-dioxolane), , XTC (2,2-dilinoleyl-4- dimethylaminoethyl-[l,3]-dioxolane), MD1 (CKK-E12; 3,6-bis({4-[bis(2- hydroxydodecyl)amino]butyl})piperazine-2, 5-dione), 7C1 (C15 epoxide-terminated lipid), and pharmaceutically acceptable salts thereof.

[0077] Examples of zwitterionic (neutral) lipids may include, but are not limited to, Bpip. Lpip. LA-DMA. LA-DMDPA, DSPC (distearoylphosphatidylcholine), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dioleoyl- phosphatidylethanolamine 4-(Nmaleimidomethyl)-cyclohexane-l- carboxylate (DOPE- mal), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 16-O-monomethyl PE, 16-Odimethyl PE, 18-1 -trans PE, 1 -stearoyl-2-oleoyl- phosphatidy ethanolamine (SOPE), DPSC (distearoylphosphatidylcholine), DPPC (dipalmitoylphosphatidylcholine), POPC (palmitoyloleoylphosphatidylcholine), DOPE (1,2- dileoyl-sn-3-phosphoethanolamine). DSPE (l,2-distearoyl-sn-glycero-3- phosphoethanolamine), DMG (dimyristoyl glycerol), phosphatidylserines, phosphatidylethanolamines, phosphatidylcholines, sphingomyelins, sphingophospholipids, betaine lipids (e.g. lauramidopropyl betaine), and SM (sphingomyelin).

[0078] Anionic lipids may include, but are not limited to, phosphatidylglycerols (PG), phosphatidic acid and phosphatidylinositol phosphates.

[0079] Non-polar lipids may include, but are not limited to, glycerides (mono, di, and triglycerides) and other non-charged lipids.

[0080] In some embodiments, the lipids are modified or conjugated to other molecules. In some embodiments, the lipid is conjugated to a polymer. In some embodiments, the polymer is polyethylene glycol (PEG). In some embodiments, the PEG hasa molecular weight from about 200 g / mol to about 10,000 g / mol. In some embodiments, the PEG has a molecular weight from about 200 g / mol to about 1,000 g / mol. In some embodiments, the PEG has a molecular weight from about 200 g / mol to about 800 g / mol. In some embodiments, the PEG is any molecular weight form of PEG including but not limited to PEG200, PEG300, PEG400, PEG600, PEG1000, PEG2000, PEG3000, PEG6000, and PEG8000. Examples of PEG-lipid conjugates include, but are not limited to, DMGPEG, DSPE-PEG, and DMP-PEG.

[0081] In some embodiments, the PEG-lipid conjugate is selected from the group consisting of DMG-PEG, DSPE-PEG, and DMP-PEG.

[0082] In some embodiments, the lipid nanoparticle composition further comprises a sterol, a PEG-lipid conjugate, and a helper lipid.

[0083] In some embodiments, the lipid nanoparticle composition comprises betw een 40-60 mol% of the ionizable lipid, between 0-20 mol% of the helper lipid, between 25-50 mol% of the sterol, and between 0-15 mol% of the PEG-lipid conjugate.

[0084] In some embodiments, the lipid nanoparticles further comprise a sterol. Exemplary sterols include, but are not limited to, |3-sitosterol and cholesterol. In some embodiments, the sterol is [(-sitosterol or cholesterol. In some embodiments, the sterol is a phytosterol.

[0085] In some embodiments the lipid nanoparticle is further comprised of a helper lipid. Helper lipids include but are not limited to 1.2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), phosphatidylserine (PS), DOTAP, DSPC, and DOPE. In some embodiments, the helper lipid is selected from the group consisting of l,2-dioleoyl-sn-glycero-3-phospho-L- serine (DOPS). phosphatidylserine (PS). DOTAP, DSPC, and DOPE.

[0086] In some embodiments, the lipid nanoparticle comprises ionizable lipids, a sterol, PEG-lipid conjugates, and a helper lipid.

[0087] In some embodiments, the lipid nanoparticle comprises between 30-60% of an ionizable lipid, between 0-20% of a helper lipid, between 25-50% sterol, and between 0-15% PEG-lipid conjugates. In one embodiment the lipid nanoparticle is comprised of 50% ionizable lipid. 10% helper lipid, 37% sterol, and 3% PEG-lipid conjugate.

[0088] Example embodiments of lipid nanoparticle formulations include but are not limited to:Bpip (50 mol%), DSPC (10 mol%), P-sitosterol (37 mol%), and DMG-PEG2000 (3 mol%)Lpip (50 mol%), DSPC (10 mol%), P-sitosterol (37 mol%), and DMG-PEG2000 (3 mol%)LA-DMDPA (50 mol%), DSPC (10 mol%), p-sitosterol (37 mol%), and DMG-PEG2000 (3 mol%)LA-DMA (50 mol%), DSPC (10 mol%), p-sitosterol (37 mol%), and DMG-PEG2000 (3 mol%)MC3 (50 mol%). DSPC (10 mol%), P-sitosterol (37 mol%). and DMG-PEG2000 (3 mol%)ALC-0315 (50 mol%), DSPC (10 mol%), P-sitosterol (37 mol%), and DMG-PEG2000 (3 mol%)

[0089] In some embodiments, the lipid nanoparticle composition is selected from the group consisting of: a composition comprising Bpip (about 50 mol%), DSPC (about 10 mol%), P- sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%); a composition comprising Lpip (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%); a composition comprising LA-DMDPA (about 50 mol%), DSPC (about 10 mol%), P- sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%); a composition comprising LA-DMA (about 50 mol%), DSPC (about 10 mol%), P- sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%): a composition comprising MC3 (about 50 mol%), DSPC (about 10 mol%), P- sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%); and a composition comprising ALC-0315 (about 50 mol%), DSPC (about 10 mol%), P- sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol).

[0090] In some embodiments, the lipid nanoparticle composition comprises Bpip (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%).

[0091] In some embodiments, the lipid nanoparticle composition comprises Lpip (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%). and DMG-PEG2000 (about 3 mol%).

[0092] In some embodiments, the lipid nanoparticle composition comprises LA- DMDPA (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%), and DMG- PEG2000 (about 3 mol%).

[0093] In some embodiments, the lipid nanoparticle composition comprises LA- DMA (about 50 mol%), DSPC (about 10 mol%), 0-sitosterol (about 37 mol%), and DMG- PEG2000 (about 3 mol%).

[0094] In some embodiments, the lipid nanoparticle composition comprises MC3 (about 50 mol%), DSPC (about 10 mol%), 0-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%).

[0095] In some embodiments, the lipid nanoparticle composition comprises ALC- 0315 (about 50 mol%), DSPC (about 10 mol%), 0-sitosterol (about 37 mol%), and DMG- PEG2000 (about 3 mol).

[0096] The lipid nanoparticles of the present invention can be used to package or encapsulate a variety of therapeutics including but not limited to nucleic acid based compositions / therapeutics, small molecules, peptides, and proteins. In some embodiments, the therapeutic agent is a nucleotide based composition. Nucleic acid based compositions / therapeutics include but are not limited to CRISPR RNAs (crRNAs), mRNA, siRNA, shRNA, antisense oligonucleotides, locked nucleic acids. microRNA, RNA and DNA aptamers, RNA decoys, ribozymes, circular RNAs, RNA sponges, and self-amplifying RNA. In some embodiments, the nucleotide based composition is selected from the group consisting of CRISPR RNA (crRNA), mRNA, siRNA, shRNA, antisense oligonucleotide, locked nucleic acid, microRNA, RNA and DNA aptamer. RNA decoy, ribozyme, circular RNA, RNA sponge, and self-amplifying RNA.

[0097] In one embodiment the nucleic acid based composition / therapeutic is used to treat HIV. In one embodiment the nucleic acid based composition / therapeutic is a crRNA. For the treatment of HIV the crRNAs can bind to HIV genes including but not limited to tat, rev, env- gp41. gag-pl, gag-p6, vif, vpr. vpu, and nef. In some embodiments the crRNAs bind to overlapping exons in two or more of these genes.

[0098] In some embodiments, one or more crRNA sequences are complementary7to an HIV-1 gene. In some embodiments, the HIV-1 gene is selected from the group consisting of tat, rev, env-gp41. gag-pl, gag-p6, vif, vpr, vpu, CCR5, LTR-1, gagD. and nef. In some embodiments, the crRNA sequences are complementary7to two or more of an HIV-1 gene each independently selected from the group consisting of tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef.

[0099] In some embodiments, the crRNA is selected from a crRNA of Table 1 below:Table 1.[000100] In some embodiments the crRNA can target HIV genes LTR, CCR5, or gagD.Guide RNAs for LTR1, gagD, and CCR5 include but are not limited to:LTR1 : 5'-GCAGAACTACACACCAGGGCC-3' (SEQ ID NO: 17); gagD: 5'-GGATAGATGTAAAAGACACCA-3' (SEQ ID NO: 18);CCR5 A: 5 -GCGGCAGCATAGTGAGCCCAG-3' (SEQ ID NO: 19);CCR5 B: 5 -TCAGTTTACACCCGATCCAC-3' (SEQ ID NO: 20)[000101] In some embodiments the crRNA is 80%, 85%, 90%, or 95% identical to the sequences provided here.[000102] In some embodiments the crRNA reduces HIV-1 replication between 50- 100%.[000103] In some embodiments, a crRNA disclosed herein is operable with any suitable Cas enzyme. In some embodiments, a crRNA disclosed herein is operable with a Cas enzyme selected from the group consisting of: Cas9, CasPhi (Cas <D), Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl Csy2, Csy3, CaslO, Csm2, Cmr5, CaslO, Csxl l, CsxlO, Csfl, Csn2, Cas4, C2cl, C2c3, Casl2a (Cpfl), Casl2b, Casl2e, Casl3a, Casl3, Casl3c, and Cas 13d. In some embodiments, a crRNA disclosed herein is operable with Cas9.[000104] In some embodiments, a crRNA disclosed herein is part of a single guide RNA C’sgRNA”) sequence wherein the sgRNA sequence comprises the crRNA sequences and a tracrRNA sequence. In some embodiments, the nucleotide based composition furthercomprises a tracrRNA sequence. Any suitable tracrRNA sequence is contemplated for use with a sgRNA disclosed herein. In some embodiments, the sgRNA comprises TatA2 and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatD and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatE and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatE2 and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatF and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatG and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatH and a tracrRNA sequence. In some embodiments, the sgRNA comprises Tati and a tracrRNA sequence.[000105] In some embodiments, the crRNA sequence is a DNA sequence (such as single- or double stranded linear sequences; or plasmid DNA), an RNA sequence, or a recombinantly expressed crRNA / protein fusion (such as ribonucleoprotein (RNP)). In some embodiments, the DNA or RNA sequence comprising the crRNA sequence further comprises a tracrRNA sequence (e.g., a sgRNA sequence) and / or a sequence encoding a Cas9 enzyme. [000106] CRISPR-Cas9 based therapeutics include but are not limited to CRISPR-Cas9 ribonucleoprotein (RNPs). guide RNAs and / or crRNAs that target or are complementary to one or more HIV-1 genes including but not limited to tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, CCR5, LTR-1, gagD, and nef, and plasmids or other constructs containing the guide RNAs and / or crRNAs.[000107] In some embodiments, the CRISPR-Cas9 base therapeutic is encapsulated by the ionizable lipid, which is in turn encapsulated by the remaining lipids (such as the zwitterionic lipid, the PEG-lipid conjugates, and the sterol). In some embodiments, the crRNA loaded into the lipid nanoparticle is selected from any of the sequences listed herein. In some embodiments, the crRNA sequence is encoded in a vector. In some embodiments the crRNA is a mRNA.[000108] In some embodiments, a crRNA disclosed here or sgRNA disclosed is formulated as a lipid nanoparticle (LNP). A LNP refers to any particle having a diameter of less than 1000 nm, 500 nm, 250 nm. 200 nm, 150 nm. 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, a nanoparticle may range in size from 1-1000 nm, 1-500 nm. 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm.[000109] In some embodiments, a crRNA disclosed here or sgRNA disclosed herein is part of a vector. In some embodiments, the Cas enzy me is part of a vector. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme arepart of the same vector. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme are part of separate vectors.[000110] In some embodiments, a crRNA or sgRNA disclosed here is part of a mRNA. In some embodiments, the Cas enzyme is part of a mRNA. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme are part of the same mRNA. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme are part of separate mRNAs.[000111] In some embodiments, a crRNA disclosed here or sgRNA disclosed herein is enveloped in a LNP. In some embodiments, the Cas enzyme enveloped in a LNP. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzy me are enveloped in the same LNP. In some embodiments, the crRNA disclosed here (any of TatA2, TatD, TatE, TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein and the Cas enzyme are enveloped in separate LNPs.[000112] In some embodiments the ratio of Cas9 RNA to guide RNA (e.g. sgRNA) is between 1 : 1 to 180: 1 (Cas9 RNA to guide RNA). In a preferred embodiment the ratio is 23 : 1 Cas9 RNA to guide RNA.[000113] In some embodiments, the nucleotide based composition further comprises a sequence that encodes a Cas protein.[000114] In some embodiments, the nucleic acid encoding a Cas protein is a vector and the nucleic acid encoding the crRNA is a vector.[000115] In some embodiments, the nucleic acid encoding a Cas protein is a mRNA and the nucleic acid encoding the crRNA is a mRNA.[000116] In some embodiments, the nucleotide based composition further comprises a DNA sequence.[000117] In some embodiments, the nucleotide based composition further comprises a RNA sequence. crRNAs (CRISPR RNAs)[000118] Disclosed herein, in some embodiments, are lipid nanoparticles comprising nucleic acids encoding for mosaic crNRA sequences for the treatment and prevention of HIV infections. In some embodiments, the crRNA sequences bind to a DNA sequence within an HIV genome (e.g.. HIV-1 or HIV-2). In some embodiments, the lipid nanoparticles described herein package or encapsulate crRNAs. In some embodiments, the crRNA bind to sequences within an HIV gene including, but not limited to tat, rev, env- gp41, gag-pl, gag-p6, vif, vpr,vpu, and nef. In some embodiments the crRNAs bind to exons found in two or more of these genes (an overlapping exon).[000119] In some embodiments, the crRNAs are “mosaic crRNAs.” In some embodiments, the mosaic crRNA is constructed from a multiple sequence alignment of separate HIV viral strains, for example separate HIV-1 or HIV -2 strains. In some embodiments, the target sequence of the mosaic crRNA is a theoretical composite of an HIV- 1 or HIV-2 DNA sequences, for example sequences that retain a high (> 50%) or low (< 50%) levels of conservation across isolated HIV strains.[000120] The 10 kilobase pair (kb) genome of HIV-1 encodes 3 structural (gag, pol, and env) polyproteins and 6 non-structural (tat, rev, vif, vpu, vpr, and nef) proteins from 3 overlapping alternate reading frames. HIV-1 has four groups. Group M (Major) accounts for a majority of all HIV-1 cases. HIV-1, group M has nine named strains: A, B, C, D, F, G, H, J, and K. Additionally, Different subtypes can combine genetic material to form a hybrid virus, known as a ’circulating recombinant form’ (CRFs). HIV-1, group M, strain B strain is the most common strain of HIV in the U.S. Worldwide, the most common HIV strain is HIV-1, group M. strain C. HIV-1 has three additional groups - groups N. O, and P.[000121] In some embodiments, a mosaic crRNA is constructed from a multiple sequence alignment of two or more HIV-1, group M strains selected from: A, B, C, D, F, G, H, J, and K.[000122] To construct mosaic crRNAs, a consensus HIV sequence can be created. The consensus sequence is based on the most recent alignment for the fullest spectrum of HIV- 1 sequences, for example using the Los Alamos National Laboratory database for HIV sequence (hiv.lanl.gov). The Los Alamos database contains 4004 variant sequences. For example, the first position (location 5831 in the HXB2 reference genome) is an A - most of the sequences of the 4004 variants at location 5831 had an A. From all available sequences, a consensus sequence can be generated. Each nucleotide of the consensus sequence can be determined based on being present on most of the sequences, for example is at least 50% of sequences.[000123] In some embodiments, a mosaic crRNA disclosed herein binds to a plurality of nucleic acids within an HIV-1 gene selected from the group consisting of: tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef. In some embodiments, a mosaic crRNA disclosed herein binds to a plurality' of nucleic acids of a gene encoding an HIV-1 protein selected from the group consisting of: Tat, Rev, Env-gp41, Gag-pl, Gag-p6, Vif, Vpr, Vpu, and Nef.[000124] In some embodiments, a mosaic crRNA disclosed herein targets a consensus sequence derived from over 4000 HIV strains in a non-structural multiexon region. In some embodiments, the mosaic crRNA sequence targets a consensus sequence that is adjacent to an appropriate protospacer adjacent motif (PAM) sequence. In some embodiments, the mosaic crRNA sequence targets a consensus sequence that is adjacent to a S. pyogenes (spCas9) PAM sequence (NGG). In some embodiments, the mosaic crRNA sequence targets a consensus sequence that is adjacent to a S. aureus Cas9 (saCas9) PAM sequence (NNGRRT or NGRRN). PAMs for various Cas enzymes are described in Table 2 below, where “N” can be any nucleotide base.Table 2.[000125] Advantages of the mosaic multi exon cleavage strategy are threefold. (1) First, mosaic crRNAs targeting multiexon regions superiorly reduce viral replication compared to crRNAs targeting LTR promoter DNA and single gene encoding proviral DNA as a result of CRISPR-Cas9 cleavage rather than excision. (2) Second, mosaic crRNAs retain broader coverage against transmitted founder HIV-1 strains compared to conventional CRISPR-Cas9 crRNAs designed against routinely tested laboratory strains of HIV. (3) Third, crRNAs targeting multiexon or regulatory regions display lower likelihood of generating CR1SPR- resistant escape mutants.[000126] In some embodiments, a mosaic crRNA disclosed herein binds to a plurality of nucleic acids within an overlapping exon. In some embodiments, the overlapping exon is part of a nucleic acid sequence of at least two HIV-1 genes selected from the group consisting of: tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef. In some embodiments, the overlapping exon is part of a nucleic acid sequence of at least three HIV-1 genes selected from the group consisting of: tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef. Insome embodiments, the overlapping exon is part of a nucleic acid sequence of HIV- 1 genes tat, rev, and env.[000127] In some embodiments, a mosaic crRNA disclosed herein binds to a plurality of nucleic acids within an HIV-1 sequence (HXB2, complete genome; HIV1 / HTLV-III / LAV reference genome; GenBank: K03455.1) selected from: tat (exon 1, nucleic acids 5831-6045; exon 2. nucleic acids 8379-8469), rev (exon 1, nucleic acids 5970-6045; or exon 2. nucleic acids 8379-8653), env-gp41 (nucleic acids 7758-8795). gag-pl (nucleic acids 2086-2134). gag-p6 ( nucleic acids 2134-2292), vif (nucleic acids 5041-5619), vpr (nucleic acids 5559- 5850), vpu (nucleic acids 6045-6310), and nef (nucleic acids 8797-9417).[000128] In some embodiments, the mosaic crRNA is selected from a crRNA of Table 3 below:Table 3.[000129] In some embodiments, the mosaic crRNA is TatA2 - UAGAUCCUAACCUAGAGCCC (SEQ ID NO. 1). In some embodiments, the mosaic crRNA is TatD - UCUCCUAUGGCAGGAAGAAG (SEQ ID NO: 2). In some embodiments, the mosaic crRNA is TatE - GAAGGAAUCGAAGAAGAAGG (SEQ ID NO: 3). In some embodiments, the mosaic crRNA is TatE2 - GAAAGAAUCGAAGAAGGAGG (SEQ ID NO: 4). In some embodiments, the mosaic crRNA is TatF - CCGAUUCCUUCGGGCCUGUC (SEQ ID NO: 5). In some embodiments, the mosaic crRNA is TatG - UCUCCGCUUCUUCCUGCCAU (SEQ ID NO: 6). In some embodiments,the mosaic crRNA is TatH - GCUUAGGCAUCUCCUAUGGC (SEQ ID NO: 7). In some embodiments, the mosaic crRNA is Tati - GGCUCUAGGUUAGGAUCUAC (SEQ ID NO: 8).[000130] In some embodiments, a crRNA described herein targets one or more HIV genes selected from the group consisting of: LTR, CCR5, or gagD, or a combination thereof. Guide RNAs which target LTR1, gagD, and CCR5 include but are not limited to:LTR1 : 5'-GCAGAACTACACACCAGGGCC-3' (SEQ ID NO: 17); gagD: 5'-GGATAGATGTAAAAGACACCA-3' (SEQ ID NO: 18); CCR5 A: 5 -GCGGCAGCATAGTGAGCCCAG-3' (SEQ ID NO: 19); CCR5 B: 5 -TCAGTTTACACCCGATCCAC-3' (SEQ ID NO: 20)[000131] In some embodiments, the cRNA is 80%, 85%, 90%, or 95% identical to a sequence provided herein.[000132] In some embodiments, the mosaic crRNA is 80%, 85%, 90%, or 95% identical to TatA2 - UAGAUCCUAACCUAGAGCCC (SEQ ID NO. 1). In some embodiments, the mosaic crRNA is 80%, 85%, 90%, or 95% identical to TatD - UCUCCUAUGGCAGGAAGAAG (SEQ ID NO: 2). In some embodiments, the mosaic crRNA is 80%, 85%, 90%, or 95% identical to TatE - GAAGGAAUCGAAGAAGAAGG (SEQ ID NO: 3). In some embodiments, the mosaic crRNA is 80%, 85%, 90%, or 95% identical to TatE2 - GAAAGAAUCGAAGAAGGAGG (SEQ ID NO: 4). In some embodiments, the mosaic crRNA is 80%, 85%, 90%, or 95% identical to TatF - CCGAUUCCUUCGGGCCUGUC (SEQ ID NO: 5). In some embodiments, the mosaic crRNA is 80%. 85%, 90%, or 95% identical to TatG - UCUCCGCUUCUUCCUGCCAU (SEQ ID NO: 6). In some embodiments, the mosaic crRNA is 80%, 85%, 90%, or 95% identical to TatH - GCUUAGGCAUCUCCUAUGGC (SEQ ID NO: 7). In some embodiments, the mosaic crRNA is 80%, 85%, 90%, or 95% identical to Tati - GGCUCUAGGUUAGGAUCUAC (SEQ ID NO: 8).[000133] In some embodiments, a mosaic crRNA disclosed herein reduces HIV-1 replication by at least 50%. In some embodiments, a mosaic crRNA disclosed herein reduces HIV-1 replication by at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, TatD reduces HIV-1 replication by at least 54%. In some embodiments, TatE reduces HIV-I replication by 76%. In some embodiments, co-administration of TatD and TatE (TatDE) reduces HIV-1 replication by an average of 82% in 7 strains, including 6 clade B transmitted founder strains.[000134] In some embodiments, a mosaic crRNA disclosed herein is effective against at least 50% of HIV-1 strains. In some embodiments, a mosaic crRNA disclosed herein is effective against at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of HIV-1 strains. In some embodiments, TatDE therapy is effective against at least 62% of all HIV-1 strains.[000135] In some embodiments, a crRNA disclosed herein is operable with any suitable Cas enzyme. In some embodiments, a crRNA disclosed herein is operable with a Cas enzyme selected from the group consisting of: Cas9, CasPhi (Cas <D), Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl Csy2, Csy3, CaslO, Csm2, Cmr5, CaslO, Csxl l, CsxlO, Csfl, Csn2, Cas4, C2cl, C2c3, Casl2a (Cpfl), Casl2b, Casl2e, Casl3a, Casl3, Casl3c, and Cas 13d. In some embodiments, the Cas enzyme have a preferred PAM sequences. In some embodiments, the crRNA target sequence is designed to accommodate the preferred PAM sequence of a Cas enzyme. In some embodiments, a crRNA disclosed herein is operable with Cas9.[000136] In some embodiments, a crRNA disclosed herein is part of a dual guide RNA system wherein the crRNA sequence and a tracrRNA sequence are part of separate RNA molecules, e.g., a crRNA:tracrRNA chimera. Any suitable tracrRNA sequence is contemplated for use with a crRNA disclosed herein. In some embodiments, the crRNA comprises TatA2 and the tracrRNA is a suitable tracrRNA sequence. In some embodiments, the crRNA comprises TatD and the tracrRNA is a suitable tracrRNA sequence. In some embodiments, the crRNA comprises TatE and the tracrRNA is a suitable tracrRNA sequence. In some embodiments, the crRNA comprises TatE2 and the tracrRNA is a suitable tracrRNA sequence. In some embodiments, the crRNA comprises TatF and the tracrRNA is a suitable tracrRNA sequence. In some embodiments, the crRNA comprises TatG and the tracrRNA is a suitable tracrRNA sequence. In some embodiments, thecr comprises TatH and the tracrRNA is a suitable tracrRNA sequence. In some embodiments, the crRNA comprises Tati and the tracrRNA is a suitable tracrRNA sequence.[000137] In some embodiments, a crRNA disclosed herein is part of a single guide RNA C'sgRNA”) sequence wherein the sgRNA sequence comprises the crRNA sequences and a tracrRNA sequence. Any suitable tracrRNA sequence is contemplated for use with a sgRNA disclosed herein. In some embodiments, the sgRNA comprises TatA2 and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatD and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatE and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatE2 and a tracrRNA sequence. In some embodiments,the sgRNA comprises TatF and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatG and a tracrRNA sequence. In some embodiments, the sgRNA comprises TatH and a tracrRNA sequence. In some embodiments, the sgRNA comprises Tati and a tracrRNA sequence.[000138] In some embodiments, the crRNA and tracrRNA in a sgRNA are connected by a suitable linker or linker loop. In some embodiments, the linker or linker loop is a few nucleotides lone (i.e. less than 20 nucleotides, or less than 10 nucleotides). In some embodiments, the linker or linker loop is a tetraloop. In some embodiments, the linker or linker loop comprises the sequence GAAA.[000139] In some embodiments, the crRNA sequence is a DNA sequence (such as single- or double stranded linear sequences; or plasmid DNA), an RNA sequence, or a recombinantly expressed crRNA / protein fusion (such as ribonucleoprotein (RNP)). In some embodiments, the DNA or RNA sequence comprising the crRNA sequence further comprises a tracrRNA sequence (e.g., a sgRNA sequence) and / or a sequence encoding a Cas9 enzyme. [000140] In some embodiments, the crRNA or sgRNA comprises modifications to a ribose sugar or nucleobase. In some embodiments, the crRNA o sgRNA comprises one or more nucleosides comprising a modified sugar moiety, wherein the modified sugar moiety is a modification of the sugar moiety when compared to the ribose sugar moiety found in deoxyribose nucleic acid (DNA) and RNA. In some embodiments, the modification is within the ribose ring structure. Exemplary modifications include, but are not limited to, replacement with a hexose ring (HNA), a bicyclic ring having a biradical bridge between the C2 and C4 carbons on the ribose ring (e.g., locked nucleic acids (LNA)), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e g., UNA). In some embodiments, the sugar-modified nucleosides comprise bicyclohexose nucleic acids or tricyclic nucleic acids. In some embodiments, the modified nucleosides comprise nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example peptide nucleic acids (PNA) or morpholino nucleic acids.[000141] In some embodiments, the crRNA or sgRNA comprises one or more modified sugars. In some embodiments, the sugar modifications comprise modifications made by altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2 ’-OH group naturally found in DNA and RNA nucleosides. In some embodiments, substituents are introduced at the 2’, 3 ', 4’. or 5’ positions, or combinations thereof. In some embodiments, nucleosides with modified sugar moieties comprise 2’ modified nucleosides, e.g., 2’ substituted nucleosides. A 2’ sugar modified nucleoside, in some embodiments, is anucleoside that has a substituent other than -H or -OH at the 2’ position (2’ substituted nucleoside) or comprises a linked biradical, and comprises 2’ substituted nucleosides and LNA (2’ -4’ biradical bridged) nucleosides. Examples of 2’- substituted modified nucleosides comprise, but are not limited to, 2’-O-alkyl-RNA, 2’-O- methyl-RNA, 2’-alkoxy-RNA, 2’-O- methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro- RNA, and 2'-F-ANA nucleosides. In some embodiments, the modification in the ribose group comprises a modification at the 2’ position of the ribose group. In some embodiments, the modification at the 2’ position of the ribose group is selected from the group consisting of 2’-O- methyl, 2:-fluoro, 2’-deoxy, and 2’-O-(2-methoxyethyl). In some embodiments, the crRNA or sgRNA comprises both intemucleoside linker modifications and nucleoside modifications.[000142] CRISPR-Cas9 based therapeutics include but are not limited to CRISPR-Cas9 ribonucleoprotein (RNPs), guide RNAs and / or crRNAs that target or are complementary to a sequence within one or more HIV-1 genes including but not limited to tat, rev, env-gp41, gag-pl. gag-p6, vif, vpr, vpu, and nef, and plasmids or other constructs containing the guide RNAs and / or crRNAs. In some embodiments, the guide RNAs and / or crRNAs include but are not limited to TatD, TatH, TatE, TatE2, TatA2, TatG, TatF, and / or combinations thereof, and / or plasmids containing TatD, TatH, TatE, TatE2, TatA2, TatG, TatF and / or combinations thereof or RNPs containing TatD, TatH, TatE, TatE2, TatA2, TatG, TatF, and / or combinations thereof as described in PCT / US2021 / 021246 (incorporated by reference herein) and / or mRNAs containing TatD, TatH, TatE, TatE2, TatA2, TatG, TatF and / or combinations thereof. In some embodiments the therapeutic agent is a combination of TatD and TatE guide RNAs and / or crRNAs, plasmids containing TatD and TatE guide RNAs or crRNAs, and / or RNPs containing TatD and TatE guide RNAs and / or crRNAs (the combination of TatD and TatE may be referred to as TatDE), or mRNAs containing TatD and TatE guide RNAs and / or crRNAs. In some embodiments, the CRISPR-Cas9 based therapeutic is encapsulated by the cationic lipid, which is in turn encapsulated by the remaining lipids (such as the zwitterionic lipid, the PEG-lipid conjugates, and the sterol). In some embodiments, the crRNA loaded into the lipid nanoparticle is selected from SEQ ID NO: 1-8. In some embodiments the crRNA loaded into the lipid nanoparticle is crRNA encoding for TatDE. In some embodiments the crRNA loaded into the lipid nanoparticle is selected from SEQ ID NO: 2 and SEQ ID NO: 3. In some embodiments, the crRNA sequence is encoded in a vector. In some embodiments the crRNA is a mRNA.[000143] In some embodiments, a crRNA disclosed here (any of TatA2. TatD, TatE, TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA,TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) is formulated as a lipid nanoparticle (LNP). A LNP refers to any particle having a diameter of less than 1000 nm, 500 nm:250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, a nanoparticle may range in size from 1- 1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm.[000144] In some embodiments, the composition comprises: TatD and TatH (TatD / H). In some embodiments, the composition comprises: TatD and TatE (TatD / E). In some embodiments, the composition comprises: TatE and TatH (TatE / H). In some embodiments, the composition comprises: TatD and TatA2 (TatA2 / D).[000145] In some embodiments, the lipid nanoparticle composition comprises: TatD / tracrRNA and TatH / tracrRNA. In some embodiments, the lipid nanoparticle composition comprises: TatD / tracrRNA and TatE / tracrRNA. In some embodiments, the lipid nanoparticle composition comprises: TatE / tracrRNA and TatH / tracrRNA. In some embodiments, the lipid nanoparticle composition comprises: TatD / tracrRNA and TatA2 / tracrRNA.[000146] In some embodiments, a crRNA disclosed here (any of TatA2, TatD, TatE. TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) is part of a vector. In some embodiments, the Cas enzyme sequence is part of a vector. In some embodiments, the crRNA disclosed here (any of TatA2, TatD, TatE, TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) and the Cas enzyme sequence are part of the same vector. In some embodiments, the crRNA disclosed here (any of TatA2, TatD, TatE, TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) and the Cas enzyme sequence are part of separate vectors. [000147] In some embodiments, a crRNA disclosed here (any of TatA2, TatD, TatE, TatE2, TatF. TatG. TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) is part of a mRNA. In some embodiments, the Cas enzyme sequence is part of a mRNA. In some embodiments, the crRNA disclosed here (any of TatA2, TatD, TatE, TatE2, TatF, TatG. TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA,TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) and the Cas enzyme sequence are part of the same mRNA. In some embodiments, the crRNA disclosed here (any of TatA2, TatD. TatE, TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) and the Cas enzyme sequence are part of separate mRNAs.[000148] In some embodiments, a crRNA disclosed here (any of TatA2, TatD, TatE, TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) is enveloped in a LNP. In some embodiments, the Cas enzyme enveloped in a LNP. In some embodiments, the crRNA disclosed here (any of TatA2, TatD, TatE, TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) and the Cas enzyme are enveloped in the same LNP. In some embodiments, the crRNA disclosed here (any of TatA2, TatD, TatE. TatE2. TatF. TatG. TatH, or Tati) or sgRNA disclosed herein (any of TatA2 / tracrRNA, TatD / tracrRNA, TatE / tracrRNA, TatE2 / tracrRNA, TatF / tracrRNA, TatG / tracrRNA, TatH / tracrRNA, or Tatl / tracrRNA) and the Cas enzyme are enveloped in separate LNPs.[000149] In some embodiments, a crRNA disclosed here or sgRNA disclosed herein is part of a vector. In some embodiments, the Cas enzyme sequence is part of a vector. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme sequence are part of the same vector. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme are part of separate vectors.[000150] In some embodiments, a crRNA or sgRNA disclosed here is part of a mRNA. In some embodiments, the Cas enzyme sequence is part of a mRNA. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme sequence are part of the same mRNA. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme sequence are part of separate mRNAs.[000151] In some embodiments, a crRNA disclosed here or sgRNA disclosed herein is enveloped in a LNP. In some embodiments, the Cas enzyme enveloped in a LNP. In some embodiments, the crRNA disclosed here or sgRNA disclosed herein and the Cas enzyme are enveloped in the same LNP. In some embodiments, the crRNA disclosed here (any of TatA2, TatD, TatE, TatE2, TatF, TatG, TatH, or Tati) or sgRNA disclosed herein and the Cas enzyme are enveloped in separate LNPs.Pharmaceutical Compositions[000152] Disclosed herein, in some embodiments are pharmaceutical compositions comprising: (a) lipid nanoparticles comprising a plurality of lipids, a therapeutic, and (b) a pharmaceutically acceptable excipient.[000153] In some embodiments, the pharmaceutically acceptable excipient is a carrier, solvent, stabilizer, adjuvant, diluent, etc., depending upon the particular mode of administration and dosage form. For example, the nanoparticle composition may comprise one or more pharmaceutically acceptable excipients or accessory ingredients such as, but not limited to, one or more solvents, dispersion media, diluents, dispersion aids, suspension aids, granulating aids, disintegrants, fillers, glidants, liquid vehicles, binders, surface active agents, isotonic agents, thickening or emulsifying agents, buffering agents, lubricating agents, oils, preservatives, and other species. Excipients such as waxes, butters, coloring agents, coating agents, flavorings, and perfuming agents may also be comprised. Pharmaceutically acceptable excipients are well known in the art (see for example Remington’s The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro: Lippincott, Williams & Wilkins, Baltimore, Md., 2006).[000154] Suitable excipients include, for example, carrier molecules that include large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polygly colic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Other exemplary' excipients can include antioxidants (for example and without limitation, ascorbic acid), chelating agents (for example and without limitation, EDTA), carbohydrates (for example and without limitation, cellulose, dextrin).[000155] In some embodiments, the composition has a physiologically compatible pH (e.g., a range from a pH of about 3 to a pH of about 11, about pH 3 to about pH 7, depending on the formulation and route of administration). In some cases, the pH is from about pH 5.0 to about pH 8.[000156] In some embodiments, the composition further comprises a second active ingredient useful in the treatment or prevention of bacterial growth (for example and without limitation, anti-bacterial or anti -microbial agents).Methods of Use[000157] Disclosed herein include methods of treating or preventing a disease or disorder in a subject in need thereof. Diseases include, but are not limited to cancer, CNS (central nervous system) and neurological diseases (including neurodegenerative diseasessuch as Parkinson’s Disease, Alzheimer’s Disease, and Huntington’s Diseases), and infectious diseases including bacterial, fungal and viral infections (e.g. HIV).[000158] In one embodiment, methods for treating or preventing HIV are included. In one embodiment an LNP containing a nucleic acid based composition / therapeutic is administered to an individual in need thereof for the treatment of HIV. Methods comprise administering to the individual LNPs comprising a plurality of lipids and a CRISPR nucleic acid complementary to an HIV-1 gene.[000159] The compositions of the present invention can also be used to transfect T-cells to generate T-cell based therapeutics.[000160] The compositions of the present invention may be administered to an individual in need by any appropriate route including but not limited to enteral, gastroenteral, oral, transdermal, subcutaneous, nasal, intravenous, intravenous bolus, intravenous drip, intraarterial, intramuscular, transmucosal, insufflation, sublingual, buccal, conjunctival, cutaneous, and intrathecal.[000161] Disclosed herein, in some embodiments, are methods of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a lipid nanoparticle composition according to a compound disclosed herein (e.g., a compound of Formula (I)).[000162] In some embodiments, the disease or disorder is selected from the group consisting of cancer. CNS or neurological diseases and infectious diseases. In some embodiments, the disease or disorder is cancer. In some embodiments, the disease or disorder is a CNS or neurological disease. In some embodiments, the disease or disorder is an infectious disease. In some embodiments, the disease or disorder is HIV.[000163] In some embodiments, the CNS or neurological disease is selected from the group consisting of Parkinson’s Disease, Alzheimer’s Disease, and Huntington’s Disease. [000164] In some embodiments, the infectious disease is a bacterial, fungal or viral infection. In some embodiments, the viral infection is HIV.[000165] Disclosed herein, in some embodiments, are methods of treating an HIV-1 infection in an individual in need thereof. Further disclosed herein, in some embodiments, are methods of preventing an HIV-1 infection in an individual in need thereof. Additionally, disclosed herein, in some embodiments, are methods of preventing transmission of an HIV-1 virus from one individual to another (for example, from a pregnant woman to a child, for example during birth or breast feeding).[000166] Also provided herein, in some embodiments, are methods of disrupting the transcription of an exon of an HIV-1 sequence in an individual in need thereof.[000167] Further disclosed herein, in some embodiments, are methods of excising all or a portion of an HIV genome in an HIV infected cell of an individual.[000168] A lipid nanoparticule composition or a pharmaceutical composition disclosed herein is administered by any appropriate route that results in effective treatment in the subject. In some embodiments, a pharmaceutical composition disclosed herein is administered systemically. In some embodiments, a pharmaceutical composition disclosed herein is administered locally. The pharmaceutical composition is administered via a route such as, but not limited to, enteral, gastroenteral, oral, transdermal, subcutaneous, nasal, intravenous, intravenous bolus, intravenous drip, intraarterial, intramuscular, transmucosal, insufflation, sublingual, buccal, conjunctival, cutaneous. Modes of administration include injection, infusion, instillation, and / or ingestion. "Injection" includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intradermal, intraperitoneal, transtracheal, and subcutaneous. In some examples, the route is intravenous.EXAMPLES[000169] The invention now being generally described, will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and is not intended to limit the invention.[000170] Lipid nanoparticle (LNP)-based delivery systems rely on ionizable hpid- mediated endosomal escape and cytosolic delivery of mRNA. Unfortunately, only 1-2% of LNPs can escape the endosomes. Therefore, in this innovation, a library of biodegradable ionizable lipids were synthesized and compared their mRNA transfection efficiency with the commercially available FDA-approved ionizable lipids. D-Lin-MC3-DMA and ALC-0315. The simple two-step synthesis of ionizable lipids is more cost-effective than the FDA- approved one.[000171] The results revealed a substantially higher mRNA transfection efficacy of one of the preferred ionizable lipids-based LNPs than D-Lin-MC3-DMA and ALC-0315-based LNPs. The preferred ionizable lipid-based LNPs demonstrated that the lymphocytic T-cell specific mRNA transfection was higher than that of the monocytic cells. In addition, a single dose of the mentioned LNPs with an optimal CRISPR Cas9 / gRNA ratio demonstrated as high as 62% HIV-1 proviral DNA elimination from the lately infected T-lymphocyte cell line. Thestructurally unique ionizable lipid-based LNP have the potential for T-cell-targeted mRNA delivery in HIV and cancer therapy.Example 1. Preparation of ionizable lipids, lipid nanoparticles[000172] The lipid nanoparticles (LNPs) with efficient mRNA-delivering abilities, low toxicity, and reduced immunogenicity result in their approval by the Food and Drug Administration (FDA) for COVID-19 vaccine delivery. LNPs are a multi-component system with ionizable lipids as a significant constituent. Ionizable lipids become cationic (i.e., positively charged) at the formulation pH (pH ~4.5) and form an electrostatic complex with negatively charged mRNA followed by self-assembly into LNPs with other minor constituents (helper lipid, cholesterol, and PEG-lipid).[000173] Buffer exchange w as performed to bring the pH of the LNPs from acidic (pH4.5) to neutral (pH 7.4). At neutral pH, the charge of the ionizable lipid becomes neutral and therefore becomes nontoxic to the treated cells. After cellular uptake, ionizable lipids again become cationic at the low endosomal pH and start to interact with cell membrane phospholipids more strongly, resulting in their endosomal escape followed by cytosolic mRNA delivery. Surprisingly, only 1-2% of LNPs can escape the endosomes and achieve cytosolic mRNA delivery.[000174] Therefore, there is a vast scope in advancing the therapeutic performance of LNPs by thoroughly understanding the influence of the structure of ionizable lipids on their mRNA transfection efficacy. The general structure of the ionizable lipid consists of a nitrogen-containing ionizable head and hydrophobic tail. It has been reported that the piperazine head containing ionizable lipids showed higher mRNA transfection to the T-cell. Moreover, compared to linear ionizable lipids, lipids containing branched hydrophobic tails with unconjugated cis double bonds aid in improving the endosomal escape. Therefore, considering these two key structural features, a library of biodegradable ionizable lipids has been synthesized. A preferred composition has been selected by comparing their mRNA transfection efficiency with the FDA-approved ionizable lipids.[000175] Unlike commercially available ionizable lipids, which have been synthesized by harsh multi-step reaction conditions, the ionizable lipids of the present disclosure can be synthesized by a simple two-step reaction with a reasonably high yield. The Steglich esterification and 1,4 Michael addition reactions were adopted to synthesize a library of ionizable lipids, Lpip, Bpip, LA-DMA, and LA-DMDPA (Scheme 1).Scheme 1.The chemical structure of synthesized ionizable lipids, Bpip, Lpip, LA-DMDPA, and LA- DMA; and commercially available, FDA-approved ionizable lipids, MC3 and ALC-0315 [000176] The synthesis of the ionizable lipids was confirmed by 'H NMR and MALDI mass spectroscopy (FIG. 1 and FIG. 2). After the structural confirmation, four synthesized and two commercially available FDA-approved ionizable lipids (Scheme 1), D-Lin-MC3- DMA (MC3), and ALC-0315 (ALC), were used to formulate LNPs by microfluidic mixing. A constant composition of ionizable lipid (50 mol%), helper lipid (DSPC, 10 mol%), cholesterol (P-sitosterol 37 mol%), and PEG-lipid (DMG-PEG2000, 3 mol%) was used to formulate six different types of LNPs using Fluc-mRNA as a reporter gene. The LNPs were designated based on the use of their ionizable lipid. The size, zeta potential, and mRNA encapsulation efficiency were evaluated and presented in Table 4.Table 4. A summary of the physiochemical properties of lipid nanoparticles.[000177] All the LNPs show sizes ranging between 60 to 95 nm with nearly neutral zeta potential ranging between -1.8 to -4.4 mV. (FIG 3A and FIG. 3B) To demonstrate the T-cell - specific mRNA delivery, two HIV-1 latently infected T-cell lines, J-Lat8.4 (JLat), Jurkat E6 (JE6), and one monocytic U1 cell line were chosen. These cell lines were then treated with LNPs at the standard mRNA dose of lpg / 106 cells.Example 2. Determination of mRNA Transfection Efficacy[000178] The mRNA transfection efficacy of Bpip, Lpip, LA-DMA, LA-DMDPA, MC3, and ALC was determined by means of their relative FLuc protein expression using the luciferase assay. The luciferase assay demonstrated the highest mRNA transfection efficacy in Bpip-treated cells followed by MC3 and then ALC-0315 (FIG. 4B). Among the Bpip- treated cell lines, T-lymphocytic JE6 and JLat cell lines showed higher transfection than monocytic U1 cell lines. Except for ALC, the trend remained almost the same throughout all the LNPs. In ALC-treated cell lines, the transfection efficiency was higher in the monocytic U1 cell line than in the T-lymphocytic JE6 and Jlat cell lines. Therefore, compared with allthe tested ionizable lipids, Bpip showed the highest transfection efficacy specific to the T-cell line.[000179] Since the transfection efficacy of MC3 was just after the Bpip, MC3 was chosen as a control and measured their dose-dependent protein expression abi 1 i ty. The MC3 and Bpip LNP show a dose-dependent FLuc protein expression (FIG 4C-FIG 4D). The CTB assay revealed above 80% cell viability throughout all the tested cell lines in both the Bpip and MC3 treated groups (FIG. 5A and FIG. 5B).Example 3. In Vivo Experimentation[000180] To translate the mRNA transfection efficacy results to the in vivo setting.MC3, and Bpip LNPs were separately injected into BALB / c mice at the mRNA dose of 0.5 mg / kg via tail vein. At 6h of post-injection, whole-body imaging was performed under IVIS to quantify the FLuc protein expression (FIG. 6A). The IVIS results revealed a substantially higher protein expression in Bpip-treated mice than in MC3 (FIG. 6B). Therefore, Bpip was chosen a preferred ionizable lipid and formulated another set of LNPs using our previously reported gRNA and Cas9-mRNA to demonstrate its HIV DNA elimination efficacy.[000181] To optimize the Cas9-mRNA and gRNA ratio, a series of Bpip LNP with different Cas9-mRNA / gRNA molar ratios from 1 : 1 to 180: 1 was prepared and tested against JLat and JE6 cell lines. The results revealed that 23: 1 is the optimal ratio at which the Bpip LNP shows HIV DNA elimination efficiency as high as 62% in JE6 cell line (FIG. 7A-FIG. 7B) and 10% in JLat cell line (FIG. 7C-FIG. 7D).[000182] Overall, the structurally unique ionizable lipid, Bpip, showed substantially higher mRNA transfection efficiency than FDA-approved commercial ionizable lipids (MC3 and ALC-0315), and mRNA transfection is specific to T-cells. Moreover, a single dose of Bpip LNP shows 62% elimination of HIV DNA from the latently infected T-cell line (JE6), which can be further pushed toward complete elimination by adopting multiple dosing.[000183] This structurally unique ionizable lipid-based LNP aims to deliver mRNA but is not limited to CRISPR-Cas9 mRNA. This practical application of the technology described in the present disclosure addresses the significant limitations of poorly transfected nonspecific gene delivery7. The ionizable lipid-based LNP showed a superior potential in delivering mRNA specifically to the HIV-1 infected CD4+ T cells which will aid in the elimination of HIV DNA from reservoir and curing of HIV- 1.[000184] Currently, available ionizable lipids do not have T-cell-specific mRNA transfection. However, the reported ionizable-based LNPs demonstrated T-cell-specificmRNA transfection. Moreover, they showed a substantially higher mRNA transfection efficacy than tested FDA-approved ionizable lipids. Therefore, those ionizable lipids will be beneficial for T-cell targeted gene delivery in HIV and cancer therapy.

Claims

CLAIMS1. A compound represented by Formula (I):R^L. , R3or a pharmaceutically acceptable salt thereof, wherein:(i) each of R1and R3is independently a group represented by Formula (II):each n is independently an integer from 0 to 5; each m is independently an integer from 0 to 5: each 1 is independently an integer from 0 to 10; and each R2is independently selected from the group consisting of Ci-io alkyl, C2-10 alkenyl, and C2-10 alkynyl; or(ii) R1is as defined in (i) and R3is C1-6 alkyl; k is an integer from 1 to 6;L is -N(RL) -, — O -, -S-, or 5-10 membered heterocyclylene optionally substituted with one or more substituents each independently selected from the group consisting of C1-6 alkyl, halo. OH, and CN; andRLis H or C1-6 alkyl; wherein the compound of Formula (I) is optionally charged.

2. The compound of claim 1 , wherein n is i.

3. The compound of claim 1 or 2, wherein m is 1.

4. The compound of any one of claims 1-3, wherein 1 is 7.

5. The compound of any one of claims 1-4, wherein R2is C1-10 alkyl.

6. The compound of any one of claims 1-5. w herein R2is w-pentyl.

7. The compound of any one of claims 1-6. wherein k is 2 or 3.

8. The compound of any one of claims 1-7. wherein L is -N(RL) - or 5-10 membered heterocyclylene.

9. The compound of any one of claims 1-8, wherein RLis Ci-6 alkyl.

10. The compound of anv one of claims 1-8, wherein L is11. The compound of any one of claims 1-8, wherein L is.

12. The compound of any one of claims 1-11, wherein the compound of Formula (I) is not charged.

13. The compound of any one of claims 1-11, wherein the compound of Formula (I) is charged.

14. The compound of any one of claims 1-11, wherein the compound of Formula (I) is positively charged.

15. The compound of claim 1, wherein the compound is selected from:

16. The compound of claim 1, wherein the compound is selected from:

17. A lipid nanoparticle composition comprising:an ionizable lipid selected from the group consisting of: a compound of any one of claims 1-16, DLin-MC3-DMA (dilinoleylmethyl-4-dimethylaminobutyrate or MC3), and ALC-0315 and a therapeutic agent.

18. The lipid nanoparticle composition of claim 17, wherein the lipid nanoparticle composition further comprises a sterol, a PEG-lipid conjugate, and a helper lipid.

19. The lipid nanoparticle composition of claim 18, wherein the lipid nanoparticle composition comprises between 40-60 mol% of the ionizable lipid, between 0-20 mol% of the helper lipid, between 25-50 mol% of the sterol, and between 0-15 mol% of the PEG-lipid conjugate.

20. The lipid nanoparticle composition of any one of claims 17-19, wherein the ionizable lipid is a compound of any one of claims 1-16.

21. The lipid nanoparticle composition of any one of claims 17-20, wherein the ionizable lipid is selected from the group consisting of Bpip, Lpip, LA-DMA, and LA- DMDPA.

22. The lipid nanoparticle composition of any one of claims 17-21, wherein the helper lipid is selected from the group consisting of l,2-dioleoyl-sn-glycero-3-phospho-L- serine (DOPS), phosphatidylserine (PS), DOTAP, DSPC, and DOPE.

23. The lipid nanoparticle composition of any one of claims 17-22, wherein the sterol is 0-sitosterol or cholesterol.

24. The lipid nanoparticle composition of any one of claims 17-23, wherein the PEG-lipid conjugate is selected from the group consisting of DMG-PEG, DSPE-PEG, and DMP- PEG.

25. The lipid nanoparticle composition of any one of claims 17-24, wherein the lipid nanoparticle composition is selected from the group consisting of:(i) a composition comprising Bpip (about 50 mol%), DSPC (about 10 mol%), 0- sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%);(ii) a composition comprising Lpip (about 50 mol%), DSPC (about 10 mol%), 0- sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%):(iii) a composition comprising LA-DMDPA (about 50 mol%), DSPC (about 10 mol%), 0-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%);(iv) a composition comprising LA-DMA (about 50 mol%), DSPC (about 10 mol%), 0-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%);(v) a composition comprising MC3 (about 50 mol%), DSPC (about 10 mol%), 0- sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%); and(vi) a composition comprising ALC-0315 (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol).

26. The lipid nanoparticle composition of any one of claims 17-25, wherein the lipid nanoparticle composition comprises Bpip (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%).

27. The lipid nanoparticle composition of any one of claims 17-25, wherein the lipid nanoparticle composition comprises Lpip (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%).

28. The lipid nanoparticle composition of any one of claims 17-25, wherein the lipid nanoparticle composition comprises LA-DMDPA (about 50 mol%), DSPC (about 10 mol%). P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%).

29. The lipid nanoparticle composition of any one of claims 17-25, wherein the lipid nanoparticle composition comprises LA-DMA (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%).

30. The lipid nanoparticle composition of any one of claims 17-25, wherein the lipid nanoparticle composition comprises MC3 (about 50 mol%), DSPC (about 10 mol%), P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol%).

31. The lipid nanoparticle composition of any one of claims 17-25, wherein the lipid nanoparticle composition comprises ALC-0315 (about 50 mol%), DSPC (about 10 mol%). P-sitosterol (about 37 mol%), and DMG-PEG2000 (about 3 mol).

32. The lipid nanoparticle composition of any one of claims 17-31, wherein the therapeutic agent is a nucleotide based composition.

33. The lipid nanoparticle composition of claim 32, wherein the nucleotide based composition is selected from the group consisting of CRISPR RNA (crRNA), mRNA, siRNA, shRNA, antisense oligonucleotide, locked nucleic acid, microRNA, RNA and DNA aptamer, RNA decoy, ribozy me, circular RNA, RNA sponge, and selfamplifying RNA.

34. The lipid nanoparticle composition of claim 32 or 33, comprising one or more crRNA sequences that are complementary to an HIV-1 gene.

35. The lipid nanoparticle composition of claim 34, wherein the HIV-1 gene is selected from the group consisting of tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, CCR5, LTR-1, gagD, and nef.

36. The lipid nanoparticle composition of claim 34 or 35, wherein the crRNA sequences are complementary to two or more of an HIV-1 gene each independently selected from the group consisting of tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef.

37. The lipid nanoparticle composition of any one of claims 34-36, wherein each of the crRNA sequences is independently selected from:

38. The lipid nanoparticle composition of any one of claims 32-37, wherein the nucleotide based composition further comprises a tracrRNA sequence.

39. The lipid nanoparticle composition of any one of claims 32-38 wherein the nucleotide based composition further comprises a sequence that encodes a Cas protein.

40. The lipid nanoparticle composition of claim 39, wherein the nucleic acid encoding a Cas protein is a vector and the nucleic acid encoding the crRNA is a vector.

41. The lipid nanoparticle composition of claim 39, wherein the nucleic acid encoding a Cas protein is a mRNA and the nucleic acid encoding the crRNA is a mRNA.

42. The lipid nanoparticle composition of any one of claims 32-41, wherein the nucleotide based composition further comprises a DNA sequence.

43. The lipid nanoparticle composition of any one of claims 32-42, wherein the nucleotide based composition further comprises a RNA sequence.

44. A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a lipid nanoparticle composition according to any one of claims 17-43.

45. A method of preventing a disease or disorder in a subject in need thereof, comprising prophylactically administering to the subject a lipid nanoparticle composition according to any one of claims 17-43.

46. The method of claim 44 or 45. wherein the disease or disorder is selected from the group consisting of cancer, CNS or neurological diseases and infectious diseases.

47. The method of claim 46, wherein the CNS or neurological disease is selected from the group consisting of Parkinson's Disease, Alzheimer’s Disease, and Huntington’s Disease.

48. The method of claim 46, wherein the disease or disorder is cancer.

49. The method of claim 46, wherein the infectious disease is a bacterial, fungal, or viral infection.

50. The method of claim 49, wherein the viral infection is HIV.

51. The method of claim 44 or 45. wherein the disease or disorder is HIV.

Images