Composition for reducing skin wrinkles or whitening skin comprising mitochondria-derived peptide with high skin permeability
A mitochondrial-derived peptide with high skin permeability addresses skin aging by inhibiting melanin production and enhancing collagen and elastin expression, effectively improving wrinkles and skin tone.
Patent Information
- Application Number
- PCT/KR2024/006036
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-30
- Filing Date
- 2024-05-03
- Publication Date
- 2025-11-06
AI Technical Summary
Existing skin care products are ineffective in addressing skin aging issues such as wrinkles and hyperpigmentation caused by UV exposure, as they fail to inhibit melanin production and promote collagen and elastin degradation.
A mitochondrial-derived peptide with high skin permeability, represented by SEQ ID NO: 1 or 2, is used in compositions to inhibit melanin production and enhance collagen and elastin expression, thereby improving skin elasticity and reducing wrinkles.
The peptide effectively inhibits melanin synthesis, enhances collagen and elastin production, and promotes skin regeneration, providing significant wrinkle improvement and skin whitening effects.
Smart Images

Figure KR2024006036_06112025_PF_FP_ABST
Abstract
Description
Composition for improving or whitening skin wrinkles comprising a mitochondrial-derived peptide with high skin permeability
[0001] The present invention relates to a novel use of a mitochondrial-derived peptide having high skin permeability, and more particularly, to a composition for improving skin condition comprising the peptide.
[0002] Skin is the product of skin cells that form skin tissue. Skin tissue is broadly divided into the epidermis, dermis, and fat layers. Melanocytes, which produce melanin, the pigment that determines skin color, are located in the basal layer of the epidermis, while fibroblasts, which produce collagen and elastin, reside in the dermis. Wrinkles and loss of elasticity, which are characteristic of skin aging, occur as these components decline in the dermis.
[0003] The primary factor causing melanin and wrinkles in everyday life is ultraviolet rays from sunlight. UV rays induce the secretion of melanocyte-stimulating hormone (α-MSH) from melanocytes. α-MSH increases the phosphorylation (Ser133-phosphorylation) of the CREB protein, which in turn activates the MITF transcription factor, tyrosinase, a key enzyme in melanin biosynthesis, leading to melanin production. In other words, inhibition of tyrosinase activity and expression suppresses melanin production. In addition to tyrosinase, TYRP-2 is known to play a role in melanin biosynthesis at a downstream level. Furthermore, UV rays decrease the expression of collagen and elastin genes in fibroblasts and increase the expression of collagen-degrading enzymes MMP-1 and -2.
[0004] Accordingly, the inventors of the present invention discovered the mitochondrial-derived peptide of the present invention while searching for a novel anti-aging agent. The mitochondrial-derived peptide of the present invention not only exhibits high skin permeability, but also exhibits excellent wrinkle improvement and whitening effects, thereby completing the present invention.
[0005] Accordingly, the purpose of the present invention is to provide a skin whitening composition comprising a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2.
[0006] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating melanin hyperpigmentation disease, comprising a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2.
[0007] Another object of the present invention is to provide a composition for improving skin wrinkles, preventing skin wrinkles, or improving skin elasticity, comprising a peptide represented by the amino acid sequence of SEQ ID NO: 2.
[0008] Another object of the present invention is to provide a pharmaceutical composition for improving skin wrinkles or treating skin wounds, comprising a peptide represented by the amino acid sequence of SEQ ID NO: 2.
[0009] Another object of the present invention is to provide a method for preventing or treating a melanin hyperpigmentation disease, comprising administering a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 to a subject in need thereof.
[0010] Another object of the present invention is to provide a method for improving skin wrinkles or treating skin wounds, comprising administering a peptide represented by the amino acid sequence of SEQ ID NO: 2 to a subject in need thereof.
[0011] To achieve the above purpose, the present invention provides a cosmetic composition for skin whitening comprising a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2.
[0012] The present invention also provides a skin whitening food composition comprising a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2.
[0013] In addition, the present invention provides a health functional food composition for skin whitening comprising a peptide represented by the amino acid sequence of sequence number 1 or 2.
[0014] In addition, the present invention provides a cosmetic composition for improving skin wrinkles, preventing skin wrinkles, or improving skin elasticity, comprising a peptide represented by the amino acid sequence of sequence number 2.
[0015] The present invention also provides a pharmaceutical composition for preventing or treating melanin hyperpigmentation disease, comprising a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2.
[0016] In addition, the present invention provides a food composition for improving skin wrinkles, preventing skin wrinkles, or improving skin elasticity, comprising a peptide represented by the amino acid sequence of sequence number 2.
[0017] In addition, the present invention provides a health functional food composition for improving skin wrinkles, preventing skin wrinkles, or improving skin elasticity, comprising a peptide represented by the amino acid sequence of sequence number 2.
[0018] The present invention also provides a pharmaceutical composition for improving skin wrinkles or treating skin wounds, comprising a peptide represented by the amino acid sequence of sequence number 2.
[0019] The present invention also provides a method for preventing or treating a melanin hyperpigmentation disease, comprising administering a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 to a subject in need thereof.
[0020] The present invention also provides a method for improving skin wrinkles or treating skin wounds, comprising administering a peptide represented by the amino acid sequence of SEQ ID NO: 2 to a subject in need thereof.
[0021] The mitochondrial-derived peptide according to the present invention not only has high skin permeability but also has excellent skin wrinkle improvement and whitening effects, and thus can be utilized in various fields of cosmetics and foods related to skin wrinkle improvement or whitening.
[0022] Figure 1 is a diagram showing the results of confirming the cytotoxicity of a mitochondrial-derived peptide according to the present invention.
[0023] Figure 2a is a diagram showing the results of confirming the expression of genes related to skin elasticity and wrinkle improvement following treatment with mitochondrial-derived peptide PEP#1 according to the present invention.
[0024] Figure 2b is a diagram showing the results of confirming the expression of genes related to skin elasticity and wrinkle improvement following treatment with mitochondrial-derived peptide PEP#2 according to the present invention.
[0025] Figure 3a is a diagram showing the results of confirming the expression of melanin biosynthesis genes according to treatment with mitochondrial-derived peptide PEP#1 according to the present invention.
[0026] Figure 3b is a diagram showing the results of confirming the expression of melanin biosynthesis genes according to treatment with mitochondrial-derived peptide PEP#2 according to the present invention.
[0027] Figure 4 is a diagram showing the results of measuring the intracellular melanin content according to treatment with mitochondrial-derived peptides PEP#1 and PEP#2 according to the present invention.
[0028] Figure 5 is a diagram showing the results of confirming the skin regeneration effect according to treatment with mitochondrial-derived peptides PEP#1 and PEP#2 according to the present invention.
[0029] Figure 6a is a diagram showing the results of analyzing ATP levels and mitochondrial respiration according to treatment with mitochondrial-derived peptides PEP#1 and PEP#2 according to the present invention in non-UV-irradiated cells.
[0030] Figure 6b is a diagram showing the results of analyzing ATP levels and mitochondrial respiration according to treatment with mitochondrial-derived peptides PEP#1 and PEP#2 according to the present invention in ultraviolet irradiated cells.
[0031] Figure 7 is a diagram showing the results of observing the movement of mitochondria following treatment with the mitochondrial-derived peptide PEP#1 according to the present invention.
[0032] Figure 8 is a diagram showing the results of observing the skin absorption of the mitochondrial-derived peptide PEP#1 according to the present invention.
[0033] Hereinafter, the present invention will be described in detail.
[0034] According to an aspect of the present invention, the present invention provides a skin whitening composition comprising a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2. The skin whitening composition may be a cosmetic, food, or health functional food composition.
[0035] According to another aspect of the present invention, a composition for improving skin wrinkles, preventing skin wrinkles, or improving skin elasticity is provided, comprising a peptide represented by the amino acid sequence of SEQ ID NO: 2. The composition for improving skin wrinkles, preventing skin wrinkles, or improving skin elasticity may be a cosmetic, food, or health functional food composition.
[0036] In the present invention, a peptide refers to a linear molecule formed by amino acid residues linked together by peptide bonds. The peptide may be manufactured using chemical synthesis methods known in the art, preferably using solid-phase synthesis techniques, but is not limited thereto.
[0037] In a specific embodiment of the present invention, the peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 is preferably derived from mitochondria. The present inventors discovered a mitochondrial-derived peptide and named it 'Mitos-oligoPep-1 (SEQ ID NO: 1)'. In addition, the C-terminus of Mitos-oligoPep-1 was cleaved to obtain a fragment, and the obtained fragment was named 'Mitos-oligoPep-2 (SEQ ID NO: 2)'.
[0038] In an embodiment of the present invention, it was experimentally confirmed that the peptide represented by the amino acid sequence of sequence number 1 or 2 is non-cytotoxic, has high skin permeability, and has excellent skin wrinkle improvement and whitening effects.
[0039] The scope of the present invention includes functional equivalents of the peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2.
[0040] In the present invention, a functional equivalent refers to a peptide that has at least 80%, preferably 90%, and more preferably 95% sequence homology (i.e., identity) with the amino acid sequence represented by SEQ ID NO: 1 or 2 as a result of addition, substitution, or deletion of amino acids, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology, and exhibits substantially the same physiological activity as the peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2. In addition, the peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 of the present invention includes not only a protein having its native amino acid sequence but also an amino acid sequence variant thereof within the scope of the present invention. A variant of the peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 refers to a peptide having a sequence that differs from the native amino acid sequence of the peptide by deletion, insertion, non-conservative or conservative substitution of one or more amino acid residues, or a combination thereof. Amino acid exchanges in proteins and peptides that do not alter the overall activity of the molecule are well known in the art. The peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 or a variant thereof may be extracted from nature, synthesized, or produced by a genetic recombination method based on a DNA sequence.
[0041] Furthermore, the sequence homology can be determined by standard methods commonly used to compare similar portions of amino acid sequences that constitute peptides. Computer programs such as BLAST or FASTA align two or more proteins so that the amino acids constituting each protein optimally match (along the full-length sequence of one or both sequences or along predicted portions of one or both sequences). These programs provide a default opening penalty and a default gap penalty, and provide a scoring matrix such as PAM250 (a standard scoring matrix; Dayhoff et al., in Atlas of Protein Sequence and Structure, vol. 5, supp. 3, 1978) that can be used in conjunction with the computer program. For example, sequence homology expressed as a percentage can be calculated as follows: multiply the total number of indentical matches by 100 and then divide by the sum of the length of the longer sequence within the corresponding span and the number of gaps introduced into the longer sequence to align the two sequences.
[0042] In the present invention, substantially identical physiological activity means improvement of skin wrinkles or whitening.
[0043] Additionally, the scope of the above functional equivalents includes derivatives in which the basic backbone of the peptide represented by the amino acid sequence of SEQ ID NO. 1 or 2 and some of the chemical structures of the constituent amino acids are modified while maintaining the skin wrinkle improvement and whitening activity. This includes, for example, structural modifications to alter the stability, storability, volatility, or solubility of the protein.
[0044] In the present invention, “improvement” means any action that at least reduces the degree of a symptom, for example, a parameter related to alleviation or treatment of a condition.
[0045] In the present invention, 'improvement of skin wrinkles' means all actions that prevent the formation of wrinkles in the skin or improve pre-formed wrinkles by inhibiting collagenase activity or through cell regeneration.
[0046] In the present invention, “skin whitening” means any action that inhibits or prevents the deposition of melanin on the skin by inhibiting the synthesis of melanin.
[0047] In a specific example of the present invention, the peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 may promote mitochondrial activity, and preferably, the mitochondrial activity may be mitochondrial migration or an increase in the level of ATP (adenosine triphosphate), but the scope of the present invention is not limited thereto.
[0048] In a specific example of the present invention, the peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 can be absorbed into the skin percutaneously or through the dermal layer, and thus can be used for percutaneous administration or dermal administration.
[0049] In a specific embodiment of the present invention, the composition may contain a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 at a concentration of 0.01 to 100 μM, preferably 0.05 to 50 μM, more preferably 0.1 to 10 μM, and most preferably 0.2 to 0.5 μM.
[0050] When the composition of the present invention is a cosmetic composition, the cosmetic composition of the present invention may further include conventional auxiliary ingredients and carriers, such as antioxidants, stabilizers, solubilizers, vitamins, pigments, fragrances, etc., which are conventionally used in cosmetic compositions, in addition to the above-mentioned effective ingredients. For example, the cosmetic composition may further include auxiliary ingredients, such as glycerin, butylene glycol, polyoxyethylene hydrogenated castor oil, tocopheryl acetate, citric acid, panthenol, squalane, sodium citrate, and allantoin.
[0051] Since the cosmetic composition of the present invention is basically applied to the skin, it can be manufactured into any formulation that is commonly manufactured with reference to cosmetic compositions in the art. For example, it can be formulated into a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited thereto. More specifically, it can be manufactured into the formulation of a flexible toner, a nourishing toner, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, cleansing water, a mask pack, a spray, or a powder.
[0052] When the formulation of the present invention is a paste, cream or gel, the carrier component may include animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc.
[0053] When the formulation of the present invention is a powder or spray, the carrier component may include lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, etc., and in particular, when it is a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, dimethyl ether, etc.
[0054] When the formulation of the present invention is a solution or emulsion, the carrier component may include a solvent, a solubilizer, an emulsifier, etc., and specifically, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, fatty acid ester of sorbitan, etc.
[0055] When the formulation of the present invention is a suspension, the carrier component may include a liquid diluent such as water, ethanol, or propylene glycol; a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, or polyoxyethylene sorbitan ester; microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tragacanth.
[0056] When the formulation of the present invention is a surfactant-containing cleansing agent, the carrier component may include fatty alcohol sulfate, fatty alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, ethoxylated glycerol fatty acid ester, etc.
[0057] The food composition according to the present invention can be used as a health functional food, food additive or dietary supplement.
[0058] When the peptide represented by the amino acid sequence of the above sequence number 1 or 2 is used as a food additive, it can be used appropriately according to a conventional method, such as adding the mixture as is or mixing it with other foods or food ingredients.
[0059] In addition, the mixed amount of the peptide represented by the amino acid sequence of the above sequence number 1 or 2 may be suitably changed depending on the purpose of use (prevention, health or therapeutic treatment), and is preferably included in an amount of 0.01 to 95 wt% based on the total weight of the food composition, and more preferably in an amount of 1 to 80 wt%. If the content is less than 0.01 wt%, the skin wrinkle improvement or whitening effect may be minimal, and if it exceeds 95 wt%, the effect increase rate compared to the amount used may be low, which may be uneconomical.
[0060] As a specific example, when manufacturing food or beverage, the peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, to the raw material. However, when consumed for a long period of time for the purpose of health and hygiene or health control, it may be added in an amount below the above range, and since there is no problem in terms of safety, the active ingredient may also be used in an amount above the above range.
[0061] There is no particular limitation on the type of the above food, but examples of foods to which the peptide represented by the amino acid sequence of sequence number 1 or 2 of the present invention can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and include all health functional foods in the conventional sense.
[0062] When the food composition of the present invention is manufactured into a beverage, it may contain various flavoring agents or additional ingredients such as natural carbohydrates, as in conventional beverages. The natural carbohydrates may include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; natural sweeteners such as dextrin and cyclodextrin; and synthetic sweeteners such as saccharin and aspartame. The natural carbohydrates are contained in an amount of 0.01 to 10 wt%, preferably 0.01 to 0.1 wt%, based on the total weight of the food composition of the present invention.
[0063] The food composition of the present invention may include various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., and may include fruit pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages, but is not limited thereto. These components may be used independently or in combination. The proportion of the above additives is not particularly limited, but is preferably included within the range of 0.01 to 0.1 wt% based on the total weight of the food composition of the present invention.
[0064] In the case of long-term consumption for the purpose of health and hygiene or health control, the food composition of the present invention can be taken for a long period of time because there is no problem in terms of safety.
[0065]
[0066] According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating melanin hyperpigmentation disease, comprising a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2. The present invention also provides a pharmaceutical composition for improving skin wrinkles or treating skin wounds, comprising a peptide represented by the amino acid sequence of SEQ ID NO: 2.
[0067] In a specific embodiment of the present invention, the melanin hyperpigmentation disease may be freckles, age spots, chloasma, liver spots, brown or black spots, solar pigment spots, cyanic melasma, post-drug hyperpigmentation, gravidic chloasma, or post-inflammatory hyperpigmentation due to wounds or dermatitis.
[0068] In the present invention, 'wound treatment' means an action of treating a damaged area (i.e., a wound) by increasing the number of cells and promoting cell migration.
[0069] The pharmaceutical composition of the present invention can be formulated and used in various forms according to conventional methods. For example, it can be formulated in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, and syrups, and can be formulated and used in the form of topical preparations, suppositories, and sterile injectable solutions. However, it is most preferable that the composition of the present invention be provided in the form of a topical preparation for skin. Specifically, it can be used in the form of a liquid, ointment, cream, lotion, spray, patch, gel, or aerosol.
[0070] In addition, it may further include pharmaceutically acceptable carriers, excipients, and diluents depending on each formulation. In addition, it may be formulated and used in the form of external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. and sterile injection solutions according to conventional methods, and preferably may have a cream, gel, patch, spray, ointment, oral preparation, lotion, liniment, paste, or cataplasma preparation. For example, in the case of external preparations for skin used locally on the relevant area, it may include conventional additives such as preservatives, solvents that assist drug penetration, and emollients in the case of ointments and creams, and may contain conventional carriers such as ethanol or oleyl alcohol. Suitable formulations known in the art are preferably those disclosed in a literature (Remington's Pharmaceutical Science, recently, Mack Publishing Company, Easton PA), but are not limited thereto.
[0071] The carrier, excipient and diluent include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, etc. When formulating or formulating the pharmaceutical composition, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants and surfactants that are commonly used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are prepared by mixing the composition with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, etc. Non-aqueous solvents and suspending agents may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases may include witepsol, macrogol, Tween 61, cacao butter, laurin, and glycerogelatin. These ingredients may be added independently or in combination with the active ingredient, i.e., the peptide.
[0072] In the present invention, administration means providing the pharmaceutical composition of the present invention to a subject by any appropriate method.
[0073] The pharmaceutical composition of the present invention may be administered in a therapeutically effective amount, which is an amount of the active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue, animal, or human, as considered by a researcher, veterinarian, physician, or other clinician, i.e., an amount that induces alleviation of the symptoms of the disease or disorder being treated. It will be apparent to those skilled in the art that the therapeutically effective dosage and frequency of administration of the pharmaceutical composition of the present invention will vary depending on the desired effect. Therefore, the optimal dosage to be administered can be readily determined by those skilled in the art, and can be adjusted according to various factors, including the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of formulation, the patient's age, weight, general health, sex, and diet, the time of administration, the route of administration, and the excretion rate of the composition, the treatment period, and concurrently used drugs.
[0074] The pharmaceutical composition of the present invention can be administered in an amount of 1 to 10,000 mg / kg / day, preferably 1 to 200 mg / kg / day, and can be administered once a day or divided into several doses.
[0075]
[0076] According to another aspect of the present invention, there is provided a method for preventing or treating a melanin hyperpigmentation disease, comprising administering to a subject in need thereof a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2. The present invention also provides a method for improving skin wrinkles or treating skin wounds, comprising administering to a subject in need thereof a peptide represented by the amino acid sequence of SEQ ID NO: 2.
[0077] In a specific example of the present invention, the subject may be, but is not limited to, a subject expected to develop or develop a melanin hyperpigmentation disease; a wound; or a wrinkle; a subject that has developed the disease; or a subject that has been judged to be cured.
[0078]
[0079] Duplicate contents are omitted in consideration of the complexity of this specification, and terms not otherwise defined in this specification have meanings commonly used in the technical field to which the present invention belongs.
[0080] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.
[0081]
[0082] <Example 1> Investigation of mitochondrial-derived peptides and cytotoxicity
[0083] 1-1. Mitochondrial-derived peptides
[0084] A mitochondrial-derived peptide was discovered and named 'Mitos-oligoPep-1.' Furthermore, the C-terminus of Mitos-oligoPep-1 was truncated to obtain a fragment, which was named 'Mitos-oligoPep-2.' The amino acid sequences of Mitos-oligoPep-1 and Mitos-oligoPep-2 are as follows.
[0085]
[0086] - Mitos-oligoPep-1 (SEQ ID NO: 1): MRWQEMGYIFYPRKLR
[0087] - Mitos-oligoPep-2 (SEQ ID NO: 2): MRWQEMGYIFYP
[0088]
[0089] In the experiments described below, Mitos-oligoPep-1 and Mitos-oligoPep-2 are referred to as PEP#1 and PEP#2, respectively.
[0090]
[0091] 1-2. Cytotoxicity test
[0092] The cytotoxicity of PEP#1 and PEP#2 was confirmed through MTT assay. Specifically, human dermal fibroblast cell line (NHDF) was seeded in a 96-well plate at a density of 1X10 per well. 4 Each cell was divided into culture medium (DMEM; Dulbecco's modified Eagle's medium, 10% fetal bovine serum; FBS, 1% antibiotics) and cultured in a 37℃, 5% CO2 incubator for 24 hours. The next day, PEP#1 and PEP#2 were treated at various concentrations (0, 2.5, 5, 10, 20 μM) and cultured for 24 hours. After 24 hours, the medium was removed, and MTT reagent (Ez-Cytox, cat#EZ-3000, DoGenBio) was mixed in DMEM medium without FBS according to the manufacturer's manual, and the cells were treated for 1 hour. After that, the medium was recovered, and cytotoxicity was confirmed by measuring the absorbance at 450 nm. The results of cytotoxicity confirmation are shown in Figure 1, and were converted into a percentage based on the average absorbance of the control group that was not treated with the peptide.
[0093] As shown in Figure 1, PEP#1 and #2 were confirmed to have no cytotoxicity.
[0094]
[0095] <Example 2> Investigation of the effect of mitochondrial-derived peptides on gene expression related to skin elasticity and wrinkle improvement.
[0096] The expression of genes related to skin elasticity and wrinkle improvement was confirmed by mitochondrial-derived peptides PEP#1 and PEP#2. The genes related to skin elasticity and wrinkle improvement are collagen (COL1A1), elastin, MMP-1, and MMP-2. Gene expression was investigated by Q-PCR. Specifically, 3X10 human dermal fibroblasts (NHDF) were seeded in 6-well cell culture dishes. 5 Each cell was mixed in a culture medium (DMEM, 10% FBS, 1% antibiotics), dispensed, and cultured for 24 hours at 37°C in a 5% CO2 incubator. The next day, the medium was removed, the culture dish was filled with PBS, and irradiated with UV (40 J / 3 min). Then, the medium was replaced again, and PEP#1 or PEP#2 was treated (0.5 μM) and cultured for 24 hours. After culture, the cells were washed once with 1x PBS, harvested, and RNA was extracted. cDNA was synthesized and Q-PCR was performed using the extracted RNA. Each process was performed according to the manufacturer's manual using AccuPrep® Universal RNA Extraction Kit (cat# K-3140, Bioneer), SuperScript™ II (cat# 18064014, Invitrogen), and GoTaq qPCR Master Mix (Promega). Q-PCR values were measured using an AriaMx Real-Time PCR instrument (Agilent). The genetic primer sequences and reaction conditions used in Q-PCR are shown in Tables 1 and 2.
[0097] Primer name Sequence number Sequence (5'-> 3') Gene name Species Elastin_Forward3CCGCTAAGGCAGCCAAGTATGGAElastinHumanElastin Reverse4AGCTCCAACCCCGTAAGTAGGAATElastinHumanCOL1A1_Forward5GGGCAAGACAGTGATTGAATACOL1A1HumanCOL1A1_Reverse6ACGTCGAAGCCGAATTCCTCOL 1A1HumanMMP1_Forward7CGACTCTAGAAACACAAGAGMMP1HumanMMP1_Reverse8AAAGTTAGCTTACTGTCACACGTTMMP1HumanMMP-2-Forward9CACCTACACCAAGAACTTC CMMP2HumanMMP-2-Reverse10AACACAGCCTTCTCCTCCTGMMP2HumanTyrosinase_Forward11GCACTGGTGGGAGCTGTTATTyrosinaseMouseTyrosinase_Reverse12 CAGCAAGCTGTGGTAGTCGTtyrosinaseMouseTYRP-2_Forward13CAGTTTCCCCGAGTCTGCATTYRP-2MouseTYRP-2_Reverse14GTCTAAGGCGCCCAAGAACTTYRP-2Mouse
[0098] Step Temperature Time Preparation (Initialization) 95℃ 2 min Denaturation (Denaturation) 95℃ 15 sec 1-cycle Annealing (Annealing) 60℃ 30 sec Elongation (Elongation) 72℃ 30 sec Number of cycles (Cycles) 40
[0099] The mRNA expression level of each gene was calculated using the standard curve method from the Cq value read from the device, and then corrected with the expression level of the housekeeping gene (Actin or GAPDH) of each sample to determine the final expression level. In addition, the relative quantification was performed against the negative control group that was not treated with peptide or irradiated with UV, and the mean value and standard error value were graphed. Statistical analysis was performed using the unpaired t-test method, and *, p<0.05; **, p<0.01; ***; p<0.001. The results of quantifying the expression of genes related to skin elasticity and wrinkle improvement in PEP#1 and PEP#2 are shown in Figures 2a and b, respectively.
[0100] As shown in Figure 2a, PEP#1 was confirmed to restore the expression of collagen (COL1A1) and elastin genes reduced by UV irradiation, and in particular, the expression of the elastin gene was higher than that of the negative control group. In addition, PEP#1 was confirmed to significantly reduce the expression of MMP-1 and MMP-2 genes increased by UV irradiation.
[0101] As shown in Fig. 2b, PEP#2 was confirmed to restore the expression of collagen (COL1A1) and elastin genes decreased by UV irradiation to a level higher than that of the negative control group. PEP#2 was confirmed to significantly reduce the expression of MMP-2 genes increased by UV irradiation.
[0102]
[0103] <Example 3> Investigation of the effect of mitochondrial-derived peptides on melanin biosynthesis gene expression.
[0104] Expression of melanin biosynthesis genes (Tyrosinase, TYRP-2) according to PEP#1 and PEP#2 treatment was confirmed through Q-PCR. Specifically, 3X10 murine melanoma cells (B16F10) were seeded in 6-well cell culture dishes. 5 Each cell was divided into RPMI medium (10% FBS, 1% antibiotics), seeded, and cultured in a cell culture incubator for 24 hours. The following day, the medium was removed, washed once with 1x PBS, and replaced with RPMI medium without 10% FBS, and left for 24 hours. After 24 hours, 100 nM α-MSH was treated to the cells alone or mixed with peptide (0.2 or 0.5 μM) for 2 hours. The negative control group was not treated with α-MSH or peptide. After 2 hours, the cells were washed once with 1x PBS, harvested, and RNA was extracted. cDNA synthesis and Q-PCR were performed using the extracted RNA. The Q-PCR method was performed in the same manner as in Example 3. The results of quantifying the expression of melanin biosynthesis-related genes of #PEP1 and #PEP2 are shown in Figures 3a and b, respectively.
[0105] As shown in Figures 3a and b, it was confirmed that UV irradiation increased the expression of melanin biosynthesis-related genes (Tyrosinase, TYRP-2). When UV-irradiated cells were treated with PEP#1 or PEP#2, it was confirmed that the expression of melanin biosynthesis-related genes was decreased in a concentration-dependent manner.
[0106]
[0107] <Example 4> Investigation of the effect of mitochondrial-derived peptides on melanin production.
[0108] In the above Example 3, it was confirmed that PEP#1 and PEP#2 inhibited the expression of genes related to melanin biosynthesis. Therefore, in this Example, the intracellular melanin content according to PEP#1 or PEP#2 treatment was measured. Specifically, 3X10 mouse-derived melanoma cells (B16F10) were seeded in a 6-well cell culture dish. 5 Cells were seeded individually and cultured in a 37℃, 5% CO2 incubator for 24 hours. The next day, the medium was replaced with fresh medium, and 100 nM α-MSH, alone or mixed with peptides, was treated to the cells and cultured for 4 days. Mitochondrial-derived peptides (PEP#1 or PEP#2) were treated at a concentration of 0.5 or 1 μM. The positive control group was treated with 570 μM Vitamin / (+)α-MSH, and the negative control group was α-MSH-treated cells and untreated cells. After 4 days, the cells were washed twice with 1x PBS and harvested. Proteins were extracted using cell lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, and 5% glycerol), and the extracted proteins were quantified using the Bradford method. To measure the intracellular melanin content, 200 μl of 1 N NaOH solution containing 10% DMSO was added to the cell pellet remaining after protein extraction and left at 95°C for 20 minutes. The mixture was then measured for absorbance at 405 nm. The final melanin content of each sample was calculated as a relative value to the untreated negative control after correcting for the total protein amount of each sample, and the results are shown in Fig. 4. Fig. 4 shows the mean and standard error of each sample, and statistical analysis was performed using an unpaired t-test (*, p<0.05; **, p<0.01; ***; p<0.001).
[0109] As shown in Fig. 4, intracellular melanin content significantly increased following α-MSH treatment. The PEP#1 and PEP#2 treatment groups showed a significant decrease in the increased melanin content following α-MSH treatment. In particular, the melanin content of the PEP#1 1 μM treatment group, the PEP#2 0.5 μM treatment group, and the PEP#2 1 μM treatment group was similar to that of the positive control group (Vitanin C). The above results indicate that PEP#1 and PEP#2 have excellent melanin synthesis inhibitory effects.
[0110]
[0111] <Example 5> Confirmation of the skin regeneration effect of mitochondrial-derived peptides.
[0112] To confirm the skin regeneration effect of PEP#2, human fibroblasts were seeded at 1X10 in a 6-well cell culture dish. 6 Each cell was divided into individual cells and cultured for 24 hours. After culture, the medium was removed, the cells were filled with PBS, and UV irradiation (40 J / 3 min) was performed. The UV-irradiated cells were washed once with PBS, and the medium was replaced. The cells were scratched using a yellow micropipette tip. Afterwards, PEP#2 was added to the cells at various concentrations (0.2, 0.5 μM) and cultured for 24 hours. The scraped area was confirmed to be filled with cells using a microscope, and the results are shown in Figure 5.
[0113] As shown in Figure 5, cells exposed to UV did not regenerate wounds. Conversely, the PEP#2-treated group showed better wound healing than the negative and positive control groups. These results indicate that PEP#2 possesses excellent skin regeneration properties.
[0114]
[0115] <Example 6> Investigation of the effect of mitochondrial-derived peptides on mitochondrial ATP levels
[0116] The mitochondrial oxygen consumption rate (OCR) was measured according to PEP#1 and PEP#2 treatment to investigate the effect of the peptides on mitochondrial oxygen respiration rate and ATP level. Specifically, 2X10 5 Human dermal fibroblasts (NHDFs) from dogs were seeded and cultured in a cell culture incubator for 24 hours.
[0117] Cultured cells were divided into UV-irradiated and non-irradiated groups. First, the UV-irradiated group was exposed to UV (40 J / 3 min) after removing the medium and replacing it with PBS. The UV-irradiated cells were washed once with PBS, the medium was replaced, and then treated with peptides for 24 hours. The non-UV-irradiated group was treated with peptides for 24 hours after replacing the medium.
[0118] OCR of the peptide-treated UV-irradiated and non-irradiated groups was measured. OCR measurements were performed according to the manufacturer's manual for the OCR measurement kit (Agilent Seahorse XF Cell Mito Stress Test Kit 103015-100, Agilent). The OCR measurement results of the UV-irradiated and non-irradiated groups are shown in Figures 6a and b, respectively.
[0119] As shown in Figures 6a and b, both the UV-irradiated and non-irradiated groups showed significant increases in ATP levels and basal and maximal aerobic respiration following peptide (PEP#1 and PEP#2) treatment. These results suggest that PEP#1 and PEP#2 promote mitochondrial respiration and increase ATP levels.
[0120]
[0121] <Example 7> Investigation of the effect of mitochondrial-derived peptide PEP#1 on mitochondrial movement
[0122] The effect of PEP#1 on mitochondrial movement was investigated through staining with a mitochondrial marker (MitoTracker® Mitochondrion-Selective Probe, cat# M7512, Invitrogen). The mitochondrial marker appears red when observed under a fluorescence microscope. Specifically, human dermal fibroblasts (NHDFs) were seeded at 5 × 10 in a 24-well cell culture dish equipped with a sterilized glass coverslip. 4 Cells were seeded individually and cultured for 24 hours. The cultured cells were treated with 10 μM of PEP#1 (PEP#1-FITC) labeled with the green fluorescent substance FITC and cultured for 24 hours. After culture, 100 nM MitoTracker Probe was treated, and the cells were cultured in a cell incubator for 30 minutes and washed three times with 1x PBS. The washed cells were fixed with 4% PFA for 15 minutes at 37°C. The fixed cells were washed three times with 1x PBS and treated with 0.2% TrixtonX-100. After washing the cells three times with 1x PBS, glass coverslips were mounted on glass slides, and the cell nuclei were stained with DAPI mounting reagent. Mitochondrial movement was photographed using a confocal fluorescence microscope (400x). The results of observing mitochondrial movement according to PEP#1 treatment are shown in Figure 7.
[0123] As shown in Figure 7, the locations of PEP#1 (green) and mitochondria (red) were confirmed to be identical. This result suggests that PEP#1 translocates to mitochondria, promoting mitochondrial aerobic respiration and increasing ATP levels.
[0124]
[0125] <Example 8> Measurement of skin absorption of mitochondrial-derived peptide PEP#1
[0126] The skin absorption of PEP#1 was observed using rat skin tissue. Specifically, the hair on the back of the rat was shaved, and PEP#1-FITC (10 μM) diluted in 100 μL of PBS was applied and left for 1 hour. After the reaction was completed, the skin tissue was removed, fixed in 4% PFA for 24 hours, and washed three times with PBS for 5 minutes each. The washed tissue was immersed in a 30% sucrose solution and treated, and then OCT frozen sections were prepared. The prepared frozen sections were placed on slide glass and observed under a fluorescence microscope. The results of observing the skin absorption of PEP#1 are shown in Figure 8.
[0127] As shown in Figure 8, it was confirmed that PEP#1 was absorbed into the dermal layer of the skin.
[0128]
[0129] In summary, the present inventors have derived mitochondrial-derived peptides, Mitos-oligoPep-1 and -2, and confirmed that the peptides regulate the mRNA expression of skin aging markers (Col1A1, Elastin: increased expression / MMP-1, MMP-2: suppressed expression), have remarkable wound healing ability in UV-irradiated skin cells, and have high skin permeability. This means that the mitochondrial-derived peptides of the present invention exhibit excellent wrinkle improvement and skin whitening effects, and can be utilized in various fields such as cosmetics and foods.
[0130]
[0131] While specific aspects of the present invention have been described in detail, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A cosmetic composition for skin whitening comprising a peptide represented by the amino acid sequence of sequence number 1 or 2.
2. A composition according to claim 1, wherein the peptide represented by the amino acid sequence of sequence number 1 or 2 promotes mitochondrial activity.
3. A composition according to claim 2, wherein the mitochondrial activity is mitochondrial migration or an increase in the level of ATP (adenosine triphosphate).
4. A composition according to claim 1, wherein the peptide represented by the amino acid sequence of sequence number 1 or 2 penetrates the skin or dermis.
5. A composition according to claim 1, wherein the composition comprises a peptide represented by the amino acid sequence of SEQ ID NO: 1 or 2 at a concentration of 0.01 to 100 μM.
6. A food composition for skin whitening comprising a peptide represented by the amino acid sequence of sequence number 1 or 2.
7. A pharmaceutical composition for preventing or treating melanin hyperpigmentation disease, comprising a peptide represented by the amino acid sequence of sequence number 1 or 2.
8. A cosmetic composition for improving skin wrinkles, preventing skin wrinkles, or improving skin elasticity, comprising a peptide represented by the amino acid sequence of sequence number 2.
9. A food composition for improving skin wrinkles, preventing skin wrinkles, or improving skin elasticity, comprising a peptide represented by the amino acid sequence of sequence number 2.
10. A pharmaceutical composition for improving skin wrinkles or treating skin wounds, comprising a peptide represented by the amino acid sequence of sequence number 2.
11. A method for preventing or treating a melanin hyperpigmentation disease, comprising administering to a subject in need thereof a peptide represented by the amino acid sequence of sequence number 1 or 2.
12. A method for improving skin wrinkles or treating skin wounds, comprising administering a peptide represented by the amino acid sequence of sequence number 2 to a subject in need thereof.
Citation Information
Patent Citations
Cosmetic composition for skin whitening containing dipeptide
KR101222685B1
Method of manufacturing current collector for secondary battery
KR1020200132141A
Tripeptide, and cosmetic composition comprising same and having Anti-aging, Anti-wrinkle, whitening, and Anti-inflammatory effects
WO2013129801A1