Activation of piezo proteins for therapeutic application in treatment and cure of disease

Abstract

The invention encompasses the activation of PIEZO proteins for therapeutic application in treatment and cure of disease. An example of this inventive activation is a method of using a PIEZO-type mechanosensitive ion channel component 1 (PIEZO1) agonist, such as Yoda1, as a latency reversal agent (LRA) in human immunodeficiency virus type-1 (HIV-1) infection.

Description

[0001] ACTIVATION OF PIEZO PROTEINS FOR THERAPEUTIC APPLICATION IN TREATMENT AND CURE OF DISEASE

[0002] Field of the Invention

[0003] The invention generally relates to activation of PIEZO (mechanosensitive ion channel) proteins for therapeutic applications in treatment and cure of disease. An example of this inventive application relates to the development of a cure for human immunodeficiency virus ty pe- 1 (HIV-1) infection, methods for eliminating reservoirs of latent HIV-1 that block a complete cure for HIV-1 infection, and methods of using the PIEZO-type mechanosensitive ion channel component 1 (PIEZO 1) agonist Yodal as a latency reversal agent in HIV- 1 infection.

[0004] Background

[0005] HIV remains a paramount global health problem. According to the World Health Organization (WHO) in 2022, an alarming 39 million individuals worldwide were living with HIV. Tragically, during the same year, 630,000 lives were lost to HIV-related illnesses, and 1.3 million new infections were diagnosed (website of WHO). These statistics underscore the urgent need for the development of an effective vaccine and preventive treatment or cure for HIV.

[0006] Since its emergence as a pandemic in the early 1980s, substantial progress in drug discovery' has transformed HIV infection into a manageable chronic condition. Nevertheless, a definitive cure remains elusive. The primary obstacle to achieving a complete cure is the presence of a subset of infected cells in which the integrated virus remains in a latent state in infected individuals1. This reservoir population is primarily responsible for the resurgence of the virus when antiretroviral therapy (ART) is discontinued. It is of vital importance to target these reservoir cells for the complete eradication of the virus within the host because latent HIV exists solely as an integrated genome and in the absence of viral proteins, it is difficult to identify viable therapeutic targets. One approach to overcoming this challenge involves viral reactivation before the elimination of reservoir cells (FIG. 2). As illustrated in FIG. 25A, the "kick-and-kill" approach2has been investigated and has shown promise in early research stages3'5. However, the data suggests the necessity of using multiple compounds to induce satisfactory HIV reactivation3. In addition, the identification of compounds capable of inducing viral reactivation with minimal side effects remains a significant challenge.

[0007] The instant inventors are the first to investigate the involvement of PIEZO 1 in the reactivation of latent HIV. PIEZO 1 (FIGS. 1 and 3), as described by Coste et al6, is an integral membrane protein associated with mechanical signal transduction. Under physiological conditions, when cell membranes are exposed to mechanical stress, PIEZO1 is activated, leading to a conformational rearrangement that exposes a channel permeable to bivalent cations, including calcium7(FIGS. 1-2). Intracellular calcium has been extensively studied due to its correlation with the induction of a wide spectrum of cellular processes, including inflammation and immune response8. Thus, it is possible that PIEZO-mediated activation pathways are important in the virus reactivation of latent HIV infected cells.

[0008] Calcium intake activates a multitude of cellular proteins, triggering a diverse range of cellular processes. Some of these proteins include PKC9, Calmodulin10, Calcineurin11, Calreticulin12, and S10013; these proteins are all capable of sensing calcium fluctuations and initiating immunological activation, inflammation, chromatin remodeling, and metabolic responses. The various pathways of calcium signaling cascades involve important expression activators such as NF AT (11,14), NF-Kb (10,15), CREB (16), and c / ebp17'20, which have been shown to play a role in the expression of the HIV provirus (21), which also has the ability- to revert viral latency in cell reservoirs15, 20’21. Consistent with these observations, the preliminary proteomic study of the inventors revealed that Yodal-treated ACH-2 cells showed a substantial increase in several S100 family members (including isoforms A8, A9, A7, A10, and Al 1) in association with a modest increase in the expression of NF-kb2 (also known as plOO).

[0009] As a PIEZO 1 agonist, Y odal is an attractive therapeutic candidate compound in the eradication of HIV reservoirs. The role of PIEZO1 activation in the context of HIV infection is a novel finding. No previous studies have demonstrated the role of PIEZO1 in HIV replication and reactivation. Yodal is a selective agonist for PIEZO 1 both in humans and in mice. In line with its ability to partially activate PIEZO 1 in absence of mechanical stimuli, it has been correlated with several calcium-dependent processes22-23. Previous studies have demonstrated its good tolerance in vitro and in animals24. Based on both the safety profile of Yodal and its ability to activate PIEZO, Yodal could be a promising candidate for the kick-and-kill approach (illustrated in FIG. 25 A) for eradication of latent virus leading to a potential cure of HIV infection.

[0010] Summary of the Invention

[0011] PIEZO proteins are large transmembrane proteins that rearrange to form an ion channel in the cell membrane7, 29. Under physiological conditions, pressure and / or mechanical stimuli on the cell membrane induces a conformational change in the proteins which opens the ion channel7, 28, 29. The protein structure enables conversion of mechanical stimuli into electrical signals that alter cellular behavior29. PIEZO proteins include, but are not limited to, PIEZO 1, PIEZO2, PIEZO-like proteins, and isoforms thereof. PIEZO-like proteins include proteins having a function similar to that of PIEZO proteins. PIEZO protein isoforms include functionally similar proteins with similar, although not identical amino acid sequences. PIEZO proteins have a structure as shown in FIG. 1 in which PIEZO 1 channel function is illustrated7.

[0012] Activation of a PIEZO protein refers to any manipulation which initiates function of the PIEZO protein. Any type of activation of PIEZO proteins is contemplated by the invention, including, but not limited to. activation with mechanical force, activation without mechanical force, and activation by specific PIEZO agonists and / or activators. Non-limiting examples of PIEZO agonists and / or activators are Yodal, Yoda2, KC159, Jedil, and Jedi27-28'30(FIG. 1).

[0013] The mechanism of PIEZO proteins opens new paths of investigation into the roles of PIEZO proteins in diseases and potential new therapeutic strategies29. The invention contemplates activation of PIEZO proteins in treatment and / or cure of any disease or condition in which PIEZO+ cells are involved. PIEZO+ cells are cells positive for expression of PIEZO protein.

[0014] In a most general aspect, the invention involves manipulation of membrane ion channels to alter cellular behavior.

[0015] In a general aspect, the invention indicates PIEZO protein activation as a therapeutic strategy in treatment and cure of disease.

[0016] In an embodiment, the invention provides a method for activating PIEZO protein in cells positive for the PIEZO protein. PIEZO+ cells are cells positive for expression of PIEZO protein. The method includes providing an activator of the PIEZO protein and administrating the activator of the PIEZO protein to the cells, thereby activating the PIEZO protein in the cells. The PIEZO protein is contemplated to be any protein having the structure as shown in FIG. 1 or a structure similar to that as shown in FIG. 1. Non-limiting examples of PIEZO proteins are PIEZO 1 and PIEZO2. The activator of the PIEZO protein is contemplated to be a PIEZO agonist, such as, but not limited to Yodal, Yoda2, KC159, Jedil, and Jedi2.

[0017] In another embodiment, the invention provides a method for treating a disease in a subject in need thereof. The method includes providing a therapeutically effective amount of a PIEZO activator and administering the therapeutically effective amount of the PIEZO activator to the subject, thereby treating the disease in the subject. Although preferably a human or human patient, the subject is not limited thereto. A “subject” refers to any human or animal that can benefit from the methods and treatments disclosed herein. The disease is contemplated to be any disease that responds to an / or can respond to PIEZO activation. Further, the disease is contemplated to be any disease that can be treated and / or cured by manipulation of PIEZO proteins, preferably, but not limited to, activation of PIEZO proteins. A non-limiting example of such a disease is a human immunodeficiency virus type-1 (HIV-1) infection, either active or latent. The activator of the PIEZO protein is contemplated to be a PIEZO agonist, such as, but not limited to Yodal, Yoda2, KC159, Jedi 1, and Jedi2. The PIEZO activator can be administered in combination with at least one pharmaceutically acceptable carrier suitable for administration of the PIEZO activator.

[0018] In another general aspect, the invention relates to management of and treatment of human immunodeficiency virus type-1 (HIV-1) infection, either active or latent.

[0019] Although HIV-1 infection is no longer a death sentence, there is no definitive cure. A barrier to finding a cure is the ability of HIV- 1 to integrate into the host cell genome and remain latent. HIV-1 can persist for many years in this latent (non-expressing) state in individuals treated with antiretroviral therapy (ART)3. One potential approach to overcoming this barrier is elimination of the reservoir of cells harboring the latent virus which involves inducing the cells to express viral proteins, exposing the cells and allowing them to be killed by virus-mediated cytotoxicity' and / or by the immune response3(FIG. 2).

[0020] In this invention, the instant inventors investigated the potential role of the PIEZO 1 activator, Yodal, in HIV viral reactivation. Using ACH-2 cells as an in vitro model for HIV latency, it was observed that Yodal increased viral production in the HIV reservoir cell line ACH-2 (FIG. 7). Based on this observation, PIEZO 1 appears to be a possible therapeutic target and Yodal could be a possible therapeutic compound to reactivate late HIV infection.

[0021] Thus, in another general aspect, the invention provides a pathway to a potential cure for HIV infection, either active or latent.

[0022] In a general aspect, the invention indicates PIEZO activation as a therapeutic strategy'. A preferred, but non-limiting, example of a PIEZO protein for activation in the therapeutic strategy' is PIEZO 1.

[0023] In a general aspect, the invention indicates PIEZO, such as, but not limited to, PIEZO 1 as a therapeutic target for HIV infection.

[0024] In another general aspect, the invention indicates Y odal as a therapeutic agent for treatment and / or cure of HIV infection.

[0025] In yet another general aspect, the invention provides a method, such as. but not limited to, treatment with PIEZO 1, for reducing or eliminating the need for antiretroviral therapy (ART) in patients having HIV-1 infection.

[0026] In an embodiment, the invention provides a method for reactivating human immunodeficiency virus type-1 (HIV-1) in cells harboring latent HIV-l(also referred to as "reservoir cells"). A latent virus, such as, but not limited to, HIV-1, can persist in a dormant state within a host cell without actively expressing proteins or producing new virions. Reactivation is the process by which a latent virus is activated to begin expression of proteins and new virions. The method includes providing a latency reversal agent (LRA) and administering the latency reversal agent to the cells, thereby reactivating latent HIV-1 in the cells. An example of reservoir cells harboring latent HIV-1 are T cells, particularly, but not limited to, CD4+ T cells. A latency reversal (or reversing) agent (LRA) is a substance that reactivates a latent virus within a host cell (FIG. 2). Non-limiting examples of classes of HIV- 1 latency reversing agents are PIEZO 1 agonists. PKC agonists and MAPK agonists25. A preferred, but non-limiting, example of an LRA is the PIEZO 1 agonist Yodal. In an embodiment, Yodal can be administered to any reservoir cells harboring latent HIV-1 that are positive for PIEZO 1 and / or positive for expression of PIEZO 1.

[0027] It should be understood that although the steps of the methods set forth herein can be carried out sequentially such steps are not necessarily required to be performed in the order described, and the order of the steps of such methods should be understood to be merely exemplary. Likewise, additional steps may be included in such methods, and certain steps maybe omitted or combined in methods consistent with various embodiments of the present methods and / or compositions.

[0028] In another embodiment, the invention provides a method for reactivating a reservoir of latent HIV-1 in a subject having an HIV-1 infection. A latent HIV reservoir is a group of immune system cells in the body that are infected with HIV but are not actively producing any new HIV26. Although preferably a human or human patient, the subject is not limited thereto. A “subject” refers to any human or animal that can benefit from the methods and treatments disclosed herein. The method includes providing an effective amount of a latency reversal agent (LRA) and administering the effective amount of the latency reversal agent to the subject, thereby reactivating the reservoir of latent HIV-1. This method can further include administering the latency reversal agent in combination with at least one pharmaceutically acceptable carrier.

[0029] A “pharmaceutical carrier” can be any inactive and non-toxic agent useful for preparation and / or delivery of medications. The phrase “pharmaceutically acceptable carrier” refers to an inactive and non-toxic substance used in association with an active substance, i.e. Yodal, especially for aiding in the application / delivery of the active substance. “Inactive”, in this context, refers to inactivity with regard to the activity of the active substance. Non-limiting examples of pharmaceutically acceptable excipients are diluents, fillers, binders, disintegrants, superdisintegrants. flavorings, sweeteners, lubricants, alkalizers / alkalinizing agents, and absorption enhancers / penetration enhancers / permeation enhancers. Pharmaceutically acceptable carriers can have more than one function, a non-limiting e.g. a filler can also be a disintegrant. Additionally, pharmaceutically acceptable carriers may also be referred to as non-medicinal ingredients (NMIs) or pharmaceutically acceptable excipients. The phrases “therapeutically effective dosage’’, ‘'therapeutically effective amount”, "effective amount" and "effective dose" refers to the amount of a composition required to achieve the desired function; such as, but not limited to, an amount required to reactivate latent HIV-1.

[0030] In another embodiment, the invention provides a method for treating a latent HIV-1 infection in a subject in need of such treatment. The method includes providing a therapeutically effective amount of a latency reversal agent (LRA) and administering the therapeutically effective amount of the latency reversal agent to the subject, thereby reactivating latent HIV-1 in the subject such that cells of the subject harboring the latent HIV-1 are exposed for elimination. Although Yodal is the preferred latency reversal agent, the method is not limited thereto. The phrase "exposed for elimination" refers to the "kick-and-kill" approach. Latently infected cells do not typically express viral proteins and are not detectable by the immune system and are not killed directly by viral cytopathic effects or immune effector mechanisms3. If HIV- 1 expression can be induced in the latently infected cells (kick) then these cells could become susceptible to cytopathic effects or virus-or immune mediated killing mechanisms (kill)3. Thus, the reactivation of latent HIV-1 exposes the cells for killing or elimination.

[0031] In another aspect of the treatment, the method encompasses co-treatment further including administering a therapeutically effective amount of an antiretroviral composition to the subject concurrently with or subsequent to administering the therapeutically effective amount of the latency reversal agent. A non-limiting example of a candidate for co-treatment is Biktarv ® (emtricitabine, tenofovir alafenamide, bictegravir). Biktarvy® is a prescribed drug for treatment of HIV infection.

[0032] In yet another embodiment, the invention provides a method for reducing or eliminating a need for long term antiretroviral therapy (ART) in a subject having a latent and / or chronic HIV-1 infection. The method includes providing a therapeutically effective amount of a latency reversal agent (LRA) and administering the therapeutically effective amount of the latencyreversal agent to the subject, thereby reactivating latent HIV-1 in the subject such that cells of the subject harboring the latent HIV-I are exposed for elimination. Although Yodal is the preferred latency reversal agent, the method is not limited thereto.

[0033] In another embodiment, various components of the invention can be packaged in containers and assembled in kits together with instructions for use. Non-limiting examples of such kit components are Yodal, pharmaceutically acceptable earners, and antiretroviral compositions.

[0034] Other objectives and advantages of this invention will become apparent from the following description taken in conjunction with the accompanying drawings, wherein are set forth, by way of illustration and example, certain embodiments of this invention. The drawings constitute a part of this specification and include exemplary embodiments of the present invention and illustrate various objects and features thereof.

[0035] Brief Description of the Drawings

[0036] A more complete understanding of the present invention may be obtained by reference to the accompanying drawings and to the data shown in the accompanying drawings when considered in conjunction with the subsequent detailed description. Any embodiments illustrated in the draw ings are intended only to exemplify the invention and should not be construed as limiting the invention to the illustrated embodiments.

[0037] FIG. l shows PIEZO1 as a membrane protein that functions as a mechanosensor. For example, in response to mechanical stress the PIEZO1 rearranges to form an open channel. The figure is a schematic illustration of PIEZO 1 channel function. The left side (of the figure) represents a closed channel and the right side (of the figure) represents an open channel. Mammalian PIEZO 1 proteins can be directly gated by membrane stretching which is conserved throughout evolution. The PIEZO channel is a nonselective channel that is permeable to alkali ions (K+, Na+, Cs+), divalent cations (Ba2+, Ca2+, Mg2+, Mn2+), and organic cations (tetramethyl ammonium (TMA), tetraethyl ammonium (TEA)). Yodal, Jedi 1 , and Jedi2 can function as chemical activators of the PIEZO 1 channel. Conversely, streptomycin can function to block mechanosensitive ion channels7’28.

[0038] FIG. 2 is a schematic illustration of the "shock-and-kill" approach to an HIV cure. Latent HIV contained in a reservoir cell population (for example, resting CD4+ helper T Cells) can be reactivated by a latency reversing agent (LRA) such as, but not limited to, the PIEZO 1 activator Yodal. Reactivated latent HIV could lead to reservoir clearance both by direct virus cytopathic effect and by immune response directed to expression of HIV proteins7, 28.

[0039] FIG. 3 is a schematic illustration of PIEZO 1 as found in human tissues. PIEZO 1 is ubiquitously expressed in different tissues as shown by the RNAseq data. This data was found on the website of the protein atlas.

[0040] FIGS. 4A-C show the reactivation of HIV by Yodal. Reactivation can be induced by LTR transactivation.

[0041] FIG. 4A is a graph illustrating that 10-15 pM Yodal show ed significant increase in virus infection as tested using pseudotyped lentivirus expressing two HIV membrane glycoprotein strains BG505 and ZM197M.

[0042] FIG. 4B is a graph illustrating that 10 pM Yodal increased baseline expression of luciferase in TZM.bl cells in the absence of HIV transactivation protein Tat. TZM.bl cells, a HeLa cell-derived reporter cell line, are derived from HeLa cells by introduction of a stable copy of an LTR-Luc expression cassette.

[0043] FIG. 4C is a graph illustrating the Yodal synergistic effect observed when combined with the expression of Tat and Rev proteins. Yodal induced around 100% increase in luciferase activity with respect to Tat-Rev alone (no Yodal). LTR transactivation, measured by luciferase activity, was assessed using TZM.bl cells containing a stable copy of an LTR-Luc expression cassette. Statistical differences between the group means were assessed by two-tailed Student’s T test (*=p<0.05).

[0044] FIG. 5 is a graph illustrating Yodal versus PMA (phorbol 12-myristate 13-acetate) in reactivation of HIV. PMA is an established stimulant for latent virus activation. 15 pm Yodal HIV reactivation activity in ACH-2 cells is comparable to the positive control using 5ng / ml PMA. Both compounds can increase Luc activity in TZM.bl cells treated with ACH-2 supernatant by 4-10 folds. ***=P>0.001

[0045] FIG. 6 is a graph illustrating that Yodal reactivation is inhibited by EGTA (egtazic acid, calcium chelator with high affinity for calcium cations) and streptomycin (a use-dependent PIEZO 1 inhibitor). Yodal effect is inhibited by both 0.5 mM EGTA and 200 pg / ml streptomycin. ACH-2 cells were cultured for 2-3 passages in absence of streptomycin.

[0046] FIG. 7 is a graph illustrating data resulting from an HIV reactivation assay using Yodal. 400,000 cells / ml ACH-2 cells were treated for 96 hours. TZM.bl cells were cultured for 72 hours with the ACH-2 supernatant.

[0047] FIGS. 8A-B show a dose-response of HIV reactivation by Yodal.

[0048] FIG. 8 A is a graph illustrating data from a Yodal response assay showing that ACH-2 virus activation is maximal at a concentration of Yodal around 10-20 pM (maximal reactivation). 40 pM concentration results in a virus production drop probably due to cell growth inhibition. *=p<0.05, **=p<0.01

[0049] FIG. 8B is a dose-response curve of the data shown in FIG. 8A.

[0050] FIGS. 9A-D show that Yodal reactivation of HIV induces Gag expression.

[0051] FIG. 9A is a graph illustrating data from an infection assay performed on samples used for HIV Gag quantification by RT-qPCR.

[0052] FIG. 9B is a series of photos illustrating cell culture medium degradation as observed by shading patterns (phenol red color change pattern) in the compared cultures. The change is in line with virus reactivation.

[0053] FIG. 9C are graphs illustrating that Gag expression was quantified by RT-qPCR. 5 pg / ml PMA resulted in ~ 25 increase in protein expression while Yodal had a lower effect with a Gag increase of- 5 times with respect to the control. EGTA congruently with the infection assay counteracted Yodal effect on Gag expression.

[0054] FIG. 9D are graphs illustrating that 72 hours of treatment with Yodal and PMA congruently correlated with a decrease in total cells but with minimal cell viability effect. EGTA partially reverted Yodal cell growth inhibition. *=p<0.05, **=p<0.01, ***=p<0.005

[0055] FIG. 10 are micrographs of syncytia formation occurring after Yodal treatment. Syncytia formation is confirmation of HIV infection. Syncytia result when multiple cells fuse together during a viral infection due to expression of viral fusion proteins. Formation of syncytia is possibly linked to rapid progression of viral infection, such as, but not limited to. HIV infection.

[0056] FIG. 11 shows a series of micrographs illustrating syncytia formation. Yodal induces HIV -mediated syncytium formation (shown by arrows). Syncytia formation was analyzed both by light microscopy and confocal microscopy of membrane and nuclear staining. Yodal and PMA showed a massive induction of syncytia. EGTA (calcium chelator) was able to revert this effect when co-administered with Yodal. Nuclei were stained dark (DAPI, blue) and cell membranes stained brighter (CellBrite 550, red). Bright field was co-visualized as a reference.

[0057] FIG. 12 shows micrographs illustrating that Yodal -induced HIV-mediated syncytium formation (in TZM.bl cells induced by 15pM Yodal) is inhibited by EGTA (calcium chelator). Syncytia formation detail, shown in light microscopy (20X), shows the inhibition of syncytia formation when Yodal was in the presence of EGTA at 0.5mM. Yodal showed a massive formation of the multinuclear bodies (show n circled) characteristic of syncytia that appear as a result of membrane expression of the HIV fusion protein ENV during HIV replication.

[0058] FIG. 13 shows primer sequences used for detection of Gag and glyceraldehyde-3- phosphate dehydrogenase (GAPDH). Primers were used at 400 nM final concentration.

[0059] FIG. 14 is a diagram illustrating a procedure for assessment of HIV reactivation in ACH- 2 CD4 T cells. Yodal reactivates ACH-2 cells to produce infectious HIV which is assessed by the ability of supernatants to infect TZM.bl cells (measured by luciferase activity) and form syncytia.

[0060] FIGS. 15A-D demonstrate that Yodal reactivated latent HIV in ACH-2 cells resulting in the upregulation of HIV genes. Statistical difference between the group means was assessed by two-tailed Student's T test (*=p-value<0.05, **=p-value<0.01).

[0061] FIG. 15 A is a graph showing a proteomic analysis revealing Yodal -mediated increase in HIV Gag-pol protein expression relative to a control.

[0062] FIG. 15B is a graph showing a proteomic analysis revealing Yodal -mediated increase in HIV gpl60 protein expression relative to a control. FIG. 15C is a graph showing an RT-qPCR analysis illustrating that Yodal increased Gag mRNA (5-fold) relative to a control.

[0063] FIG. 15D is a graph showing an RNAseq illustrating that Yodal increased HIV-1 BRU (K02013.1) RNA.

[0064] FIGS. 16A-D show that P1EZO1 is expressed on ACH-2 CD4 T cell clones and mediates reactivation of latent HIV by Y odal .

[0065] FIG. 16A is a graph showing two independent RT-qPCR analyses that demonstrate ACH-2 cells expressing PIEZO 1. Results indicate a consistent PIEZO 1 expression with a threshold cycle (Ct) of 25.50 compared to the positive control, Actin (ACTB) and to the negative control, PIEZO 1 primers only (no template). ACTB was quantified as internal reference.

[0066] FIG. 16B is a graph showing that Yodal (15 pm) co-administered with 200ug / ml streptomycin (Strep), a known / eslablished activation-dependent PIEZO 1 inhibitor, or ImM EGTA that specifically sequester Ca2+, inhibited latent HIV reactivation. PMA (5ng / ml) was used as a positive control. Data were analyzed by one-way ANOVA and Tukey’s post-hoc test (**=p-value<0.01) (F5,i2= 213.47, p 2.73x I O'" ).

[0067] FIG. 16C shows micrographs, obtained using confocal microscopy, demonstrating that EGTA impaired formation of syncytia, thus indicating poor virus production in response to Yodal treatment (in the presence of EGTA).

[0068] FIG. 16D is a graph showing an RT-qPCR analysis illustrating that EGTA inhibited HIV Gag upregulation by Yodal. Statistical difference between the group means was assessed by two- tailed Student's T test (**=p<0.01).

[0069] FIGS. 17A-B show that Yodal reactivated HIV in peripheral blood mononuclear cells (PBMCs) of people with HIV (PWH).

[0070] FIG. 17A is a graph showing PBMCs (2x106 cells) of PWH undergoing antiretroviral therapy (ART) with undetectable HIV that were treated with 15 pM Yodal for 72 hours. Supernatant of the Yodal -treated PWH PBMC produced viruses capable of infection of TZM.bl cells (measured by RLU). EGTA (ImM) reduced latent HIV reactivation. PMA (5ng / ml) reactivation was less than Yodal. The unstimulated control and the TZM.bl cells only control are also shown.

[0071] FIG. 17B is a graph showing that treatment with Yodal for 72 hours had no significant effect on cell viability as measured by trypan-blue cell staining. The mean of each group (in triplicates) was statistically different from each other, shown by the letters a-e (ANOVA oneway, Tukey’s post-hoc) (F4,IO=442.2, pO.OOOl). FIGS. 18A-C show data demonstrating that HIV reactivation by Yodal in ACH-2 cells involved a novel signaling pathway.

[0072] FIG. 18A is a proteomic profile of ACH-2 cells (6 replicates) treated with 15pM Yodal and 6 control replicates that were graphed using Uniform Manifold Approximation and Projection (UMAP). The samples clustered well congruently to Yodal treatment. Upregulated (upper chart, in blue) and downregulated (lower chart, in red) proteins were statistically analyzed using three alternative tests: DESeq2 Wald, edgeR, and Limma. Meta.q is the most conservative value calculated by the three tests. Downregulated and upregulated proteins in Yodal vs. control samples were grouped by False Discovery Rate (FDR) p-value range.

[0073] FIG. 18B is a volcano plot-a graphical representation of the protein differential expression between ACH-2 cells treated with 15pM Yodal versus control cells. Red (right side of graph) and blue (left side of graph) dots represent upregulated and dow nregulated proteins, respectively. Cut-off for Fold-Change (FC) was set to 1.5. Statistical significance cut-off was set to 0.05. Effect size is represented by logarithm base two of the FC while significance was plotted as the negative logarithm base ten of the Meta.q value for each protein.

[0074] FIG. 18C demonstrates that the 50 most differentially expressed proteins were clustered. The upregulated (in blue) and downregulated (in red) proteins are shown.

[0075] FIG. 19 is a proteomic analysis demonstrating that Yodal treatment increased the expression of T cell markers. Clustering and box plots of markers related to immune activation including HLA, TCR, and CD3 complexes, are shown. Upregulated genes (in orange, right side under Yodal) and downregulated genes (in blue, left side under controls) in response to Yodal treatment are shown. Box plots show key gene expression comparisons. The absolute value of each group’s average expression is indicated in purple (on far right).

[0076] FIG. 20 is a proteome demonstrating Yodal -mediated regulation of host RNA polymerase and transcription factors. The polymerase activity diagram is illustrated listing the transcription factors (TF) and the polymerase complexes. Blue (indicates downregulated genes) and red (indicates upregulated genes) highlights represent differential gene expression observed in Yodal -treated vs control groups. Polymerase 1 subunits and TF2H were dramatically downregulated in response to Y odal treatment. In contrast, polymerase 2 complex members were upregulated.

[0077] FIGS. 21 A-B show proteome data demonstrating Yodal -regulated expression of ribosome proteins and translation factors.

[0078] FIG. 21 A demonstrates an analysis of nucleolar and ribosomal protein expression in which broad downregulation is show n. Of the 249 proteins clustered, 40 were statistically less abundant in the Yodal group. Orange and blue represent, respectively, the relative up- and down- regulation in the Yodal vs control comparison. The absolute values of the group average are shown in purple scale.

[0079] FIG. 21B demonstrates that Yodal treatment decreased expression of several translation factors. A diagram of the translation process is shown with differential expression of proteins between control and Y odal treatment (blue and red denote downregulated and upregulated genes, respectively). Box plots show key elongation factor gene expression comparison.

[0080] FIGS. 22A-B show transcriptomic profiles of ACH-2 cells treated with Yodal and PMA with results demonstrating induction of distinct T cell activation pathways by Yodal.

[0081] FIG. 22 A shows the transcriptomic profile of ACH-2 cells treated with Yodal.

[0082] FIG. 22B shows the transcriptomic profile of ACH-2 cells treated with PMA.

[0083] The two profiles show different differential expression targets indicating involvement of different pathways. Yodal -induced latent HIV reactivation was characterized by high expression of TCR receptor members. HIVEP3, and other molecules characteristic of immune activation. Upregulated (in red) versus downregulated (in blue) genes are shown. The logarithm (base 2) of differential expression as fold change (x-axis) versus the negative logarithm base 10 of the meta.q value (y-axis) is shown.

[0084] FIGS. 23A-C show transcriptomic analyses of Yodal -mediated upregulation of T cell activation markers.

[0085] FIG. 23A shows that Yodal had a major effect on the overexpression of a set of TCR receptors belonging to both a and y5 T cells.

[0086] FIG. 23B shows a transcriptomic analysis of T cell co-receptor CD3 complex family members. Upregulated genes (in red) and downregulated genes (in blue) in response to Yodal treatment are shown.

[0087] FIG. 23C show-s a transcriptomic analysis of HL A family members. Upregulated genes (in red) and downregulated genes (in blue) in response to Yodal treatment are shown.

[0088] FIGS. 24A-D show transcriptomic analyses of Yodal -mediated regulation of gene transcription and translation factors.

[0089] FIG. 24 A shows a Yodal response correlated with decreased expression of RNA polymerase (POL) 2 components and a variable effect on the expression of the RNA polymerase 3.

[0090] FIG. 24B shows Yodal -affected ribosome activity by a broad downregulation of genes associated with ribosome biogenesis.36,37 ofllst 2

[0091] FIG. 24C shows Y odal decreased ribosome activity by downregulating a set of translation factors belonging to the EIF and EEF families. FIG. 24D shows that Yodal increased the expression of two members of the HIVEP family, specifically HIVEP2 and HIVEP3, that are involved in immunoglobulin expression and HIV replication. Upregulated genes (in red) and downreg dated genes (in blue) in response to Yodal treatment are shown.

[0092] FIGS. 25A-B are schematic diagrams showing a proposed model for Yodal as a latencyreversing agent (LRA) for cure of HIV.

[0093] FIG. 25A shows a representation of the Kick-and-Kill theoretical framework.

[0094] FIG. 25B shows a proposed mechanism for HIV reactivation and killing of latent cells mediated by Yodal.

[0095] Detailed Description of the Invention

[0096] As required, embodiments are disclosed herein; however, it is to be understood that the disclosed embodiments are merely examples and that the methods, compositions, and / or treatments described below can be embodied in various forms. Therefore, specific structural and functional details disclosed herein are not to be interpreted as limiting, but merely as a representative basis for teaching one skilled in the art to variously employ the present subj ect matter in virtually any appropriately detailed structure and function. Further, the terms and phrases used herein are not intended to be limiting, but rather, to provide an understandable description of the concepts.

[0097] It can be advantageous to set forth definitions of certain words and phrases used throughout this disclosure. The terms “a” or “an”, as used herein, are employed to describe elements and components described herein. This is done merely for convenience and to give a general sense of the scope of the disclosure. This description should be read to include one or at least one and the singular also includes the plural unless it is obvious that it is meant otherwise. The term plurality7, as used herein, is defined as two or more than two. The term another, as used herein, is defined as at least a second or more.

[0098] The term "communicate." as well as derivatives thereof, encompasses both direct and indirect communication. The terms "include" and "comprise," as well as derivatives thereof, mean inclusion without limitation. The term "or" is inclusive, meaning and / or. The phrase "associated with," as well as derivatives thereof, can mean to include, be included within, interconnect with, contain, be contained within, connect to or with, couple to or with, be communicable with, cooperate with, interleave, juxtapose, be proximate to, be bound to or with, have, have a property of, have a relationship to or with, or the like. The phrase "at least one of," when used with a list of items, means that different combinations of one or more of the listed items can be used, and only one item in the list can be needed. For example, "at least one of: A, B, and C" includes any of the following combinations: A, B, or C; A and B; A and C; B and C; and A, B, and C.

[0099] As used herein, the term "about" or "approximately" applies to all numeric values, whether or not explicitly indicated. These terms generally refer to a range of numbers that one of skill in the art would consider equivalent to the recited values (i.e., having the same function or result). In many instances these terms may include numbers that are rounded to the nearest significant figure. As used herein, the terms "substantial" and "substantially" means, when comparing various parts to one another, that the parts being compared are equal to or are so close enough in dimension that one skill in the art would consider the same. Substantial and substantially, as used herein, are not limited to a single dimension and specifically include a range of values for those parts being compared. The range of values, both above and below (e.g., or greater / lesser or larger / smaller), includes a variance that one skilled in the art would know to be a reasonable tolerance for the parts mentioned.

[0100] Note that not all of the activities described above in the general description, or the examples are required, that a portion of a specific activity may not be required, and that one or more further activities can be performed in addition to those described. Still further, the order in which activities are listed is not necessarily the order in which they are performed.

[0101] Reference will now be made to specific embodiments illustrated herein and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the invention is thereby intended. Any alterations and further modification in the described methods, compositions, and / or treatments along with any further application of the principles of the invention as described herein, are contemplated as would normally occur to one skilled in the art to which the invention relates.

[0102] Example One: Parts A and B

[0103] Introduction

[0104] According to a recent report by the World Health Organization (WHO), approximately 39 million individuals are currently grappling with chronic HIV infection, with a significant portion of them undergoing antiretroviral therapy (ART) as part of their treatment regimen. It is worth noting that a significant proportion of those that are infected do not receive or receive inadequate ART treatment. The demand for prolonged ART comes with its own set of challenges, encompassing a wide spectrum of side effects, the considerable cost associated with medications, and the intricate nature of adhering to the therapeutic regimen. Despite these hurdles, the pursuit of a definitive cure remains an active and determined realm of research. Central to the quest for a cure is the formidable obstacle posed by HIV's capacity to integrate itself into the host's genome. The integration process within specific cell populations gives rise to latent reservoirs that remain undetected by the immune system and are impossible to be targeted without the presentation of viral markers. Those reservoirs can trigger a renewed and productive infection shortly after the discontinuation of ART. Thus, eliminating these HIV reservoirs is a fundamental prerequisite for achieving a lasting cure.

[0105] As noted above in the "Background", several researchers have conceived an innovative strategy termed "shock-and-kill" or "kick-and-kill." This approach hinges on the development of molecules designed to rouse dormant HIV within these latent reservoirs, subsequently clearing them through targeted immune responses or the cytopathic effects stemming from productive infection. Leveraging a robust model of HIV latency, the exploration described herein has unveiled a breakthrough: the application of the PIEZO 1 activator Yodal triggers an extensive surge in HIV production, indicative of viral reactivation. Additionally, another advantage is that Yodal has shown itself to be well-tolerated in animal models in contrast to other tested molecules.

[0106] This discovery not only offers a tantalizing glimpse into the potential of Yodal treatment but also underscores the exciting prospects within the field. As research continues to illuminate the path towards a definitive cure, this newfound knowledge brings us one step closer to an HIV cure.

[0107] EXAMPLE ONE: PART A

[0108] In the experiments described herein, a well-established in vitro model based on the ACH-2 cell line was used to assess the effect of Yodal on latency reversal. ACH-2 cells are cells of lymphocytic origin containing a quiescent copy of HIV- 1 sequence LAT. The ACH-2 treated supernatant was applied to TZM.bl cells (HeLa cell-derived reporter cell line) to measure virus production. TZM-bl cells are very sensitive to infection with HIV. The HIV infection in these cells induces expression of luciferase. Luciferase activity is directly proportional to multiplicity of infection.

[0109] 15uM Y odal resulted in viral reactivation in ACH-2 cells comparable to 5ng / ml of PMA used as positive control (FIG. 7). To rule out PIEZO 1 -independent effects of Yodal, a calcium chelator (EGTA) and Streptomycin were used as PIEZO1 inhibitors (FIG. 7).

[0110] HIV infection was confirmed by examining the cell cultures for syncytia formation. Syncytia, often a hallmark of viral infection, are multinucleated cells that are formed from fusion of uninuclear cells. Micrographs of syncytia formation after Yodal treatment are shown in FIG. 10. The control culture (top micrograph) had no treatment and no syncytia formation. Cells treated with 10 ng / ml PMA (bottom left of micrograph), a known stimulator of latent virus, exhibited syncytia formation as did cells treated with 15 pM Yoda I (bottom right of micrograph).

[0111] EXAMPLE ONE:PART B

[0112] Methods and Materials

[0113] Cells

[0114] ACH-2 cells, obtained from AIDS Reagent Program, were cultured in RPMI 1640 (Gibco Waltham, MA) with 10% Fetal Bovine Serum, 10 mM HEPES. These cells were kept growing in the incubator at 37°C and 5% CO2.

[0115] TZM.bl cells, obtained from AIDS Reagent Program, were cultured in DMEM (Gibco Waltham, MA) with 2% PEN-STREP and 10% Fetal Bovine Serum. These cells were kept growing in the incubator at 37°C and 5% CO2.

[0116] Mechanical Activation

[0117] For the mechanical PIEZO1 channel activation, ACH-2 cells were subjected to various conditions, and incubated at 37°C for 96 hours and 5% CO2. The concentration of cells used was 5 x 105ACH2 cells per ml. Shaker control conditions were 2.5 x 106ACH-2 cells in 5ml and shaker conditions were 6 x 106ACH-2 cells in 12ml in baffled glass flask shaking at 95 RPM.

[0118] Following 96 hours of incubation at 37°C and 5% CO2, the cells were centrifuged at 10°C and 2550 RPM for 10 minutes. The supernatants were obtained for infection of TZM.bl cells.

[0119] Chemical Activation

[0120] For the chemical PIEZO1 channel activation, ACH-2 cells were subjected to various conditions and incubated at 37°C for 72 hours and 5% CO2. The concentration of cells used was 5 x 105ACH2 cells per ml. The cells were treated with 15mM Yodal (Sigma Aldrich, St. Louis, MO). Following 72 hours, the cells were centrifuged at 10°C and 2550 RPM for 10 minutes. The supernatants were obtained for infection of TZM.bl cells.

[0121] Cell Counting Assessment

[0122] The cells were counted by 1:1 of cells and 0.4% solution Trypan Blue (Gibco Waltham, MA). The cells were then counted using Invitrogen Countess 3 Automated Cell Count (Waltham, MA). The cell counts were carried out in triplicates and total and alive cell counts were obtained.

[0123] Infection of TZM.bl Cells

[0124] The TZM.bl cells were washed with 5ml of Gibco PBS pH 7.2 (IX) (NO Calcium Chloride or Magnesium Chloride). The TZM.bl cells were then trypsinized with 2ml Trypsin for 15 minutes. The cells were counted and 2 x 104cells in lOOul were seeded in each well of a SPL Life Science Sterile 96 Cell Culture Plates. The cells were incubated overnight at 37°C and 5% CO2, allowing the cells to adhere. The following day the infection was carried out in triplicates; lOOul of the supernatants of each condition were added to the adhered TZM.bl cells in the 96 Cell Culture Plates. These cultures were incubated for 72 hours.

[0125] Luciferase Reading

[0126] After 72 hours, the treatments with ACH-2 were read using a Synergy Hl Plate Reader (BioTek, Winooski, VT). The medium in the 96 well plate was discarded and a 1: 1 of Britelite Plus (PerkinHelmer Waltham, Massachusetts) and complete RPMI1640 was prepared. 180ul of the mix was added and resuspended thoroughly until complete lysis of the adherent TZM.bl cells. 150ul of the cell lysate was transferred into a white 96 well plate and read using Luminescence protocol.

[0127] Cell Membrane and Nuclear Fluorescent Staining

[0128] After a 72h infection, TZM.bl cells were washed with PBS and a IX Cellbrite 555 (Biotium, Fremont, CA) in PBS was applied for 15 minutes. After a PBS wash, cells were fixed using 4% PFA in PBS for 10 minutes and washed again. A solution of DAPI in PBS was added and cell visualized using a LSM540 confocal microscopy (Zeiss, Oberkochen, Germany). RT-qPCR

[0129] After treatments by centrifugation at 2500RPM for 5mins, ACH-2 cells were pelleted. Total RNA was extracted using Trizol extraction. RNA was quantified by nanodrop and 28ng was used for cDNA synthesis. cDNA was produced using Gag and GAPDH reverse primers to assure cDNA specificity. cDNA was obtained using VERSO cDNA kit (ThermoScientific) following manufacturer instruction. cDNA synthesis was carried out at 42°C for 40 minutes followed by 2 minutes at 95°C. 2ul of cDNA were used for PCR quantification using Quantabio perfecta SYBR Green superMix low ROS (Quantabio, Beverly, MA) in QuantStudio 3 PCR device (Applied Biosystems. Waltham, MA).

[0130] Primers (FIG. 13) for detection of Gag and GAPDH, used at 400nM final concentration, were as following (5’->3’):Gag For: CCACCTATCCCAGTAGGAG (SEQ ID NO: 1); Gag Rev: CTCCCTGACATGCTGTCATC (SEQ ID NO:2);GAPDH For: TCAAGGCTGAGAACGGGAAG (SEQ ID NO:3); and GAPDH Rev: CGCCCCACTTGATTTTGGAG (SEQ ID NO:4).

[0131] Results and Discussion

[0132] An HIV-1 pseudovirus in vitro model of infection was used to assess the role of PIEZO 1 activation by Yodal in the context of HIV replication and infection. It was found that Yodal increased Luciferase activity of TZM.bl cells infected with lentivirus based on pCMV dR8.2 backbone pseudotyped with two different Envelop glycoprotein (ENV) BG505 and ZM197M. In both cases, luciferase activity' increased by 100% after Yodal treatment (FIG. 4A). In addition, a similar increase in the luciferase activity of non-infected cells after Yodal treatment was observed (FIG. 4A). This data suggests that Yodal upregulates the expression of Luciferase under the control of the HIV-1 LTR.

[0133] The effect of Yodal in combination with LTR transactivation elements Tat / Rev was assessed to demonstrate the activation of LTR by PIEZO 1 activation. TZM.bl cells were transfected with a bicistronic expression plasmid containing Tat and Rev genes. Consistent with lentivirus infection data, Yodal increased luciferase expression by -100% compared to Tat / Rev alone (FIG. 4C).

[0134] Yodal was compared with PMA (a well-known HIV latency reactivator) to assess the potency of Yodal in reactivation of HIV. It was found that 15uM Yodal induced viral replication similar in magnitude to activation with 5ng / ml PMA (FIGS. 5-7). Yodal dose response curve showed a linear correlation between Yodal concentration and viral reactivation that peak at 20uM (FIG. 8B). At 40uM Y odal concentration, there was a decrease in HIV activity likely due to a cell growth inhibition by Yodal (FIG. 8A).

[0135] A measurement of HIV Gag protein on Yodal -treated ACH-2 cells was performed to further confirm virus reactivation. PCR analysis showed a significant 5-fold increase in Gag protein production after Yodal treatment (FIG. 9C). As expected, the PMA control led to increased Gag expression. Consistent with previous observations, EGTA was able inhibit the effect of Yodal through chelation of calcium (FIG. 9C).

[0136] Yodal and PMA treatment showed effects on cell growth as shown by total cell number count and cell viability’ (FIG. 9D). Whether this effect is directly related to the treatments or as consequence of HIV reactivation remains to be determined. Viral production associated with Yodal and PMA treatment was confirmed by marked induction of syncytium formation in the TZM.bl cell culture treated with ACH-2 supernatant (FIGS. 10-12). EGTA was able to abolish the formation of syncytia, demonstrating the involvement of calcium as mediator of the Yodal effect (FIGS. 10-12). Specific involvement of PIEZO1 in HIV reactivation was confirmed by using Streptomycin, which was previously shown to be an inhibitor of PIEZO127. Indeed, 200ug / ml Streptomycin abrogated the effect of Yodal in HIV reactivation (FIG. 6).

[0137] EXAMPLE TWO: Yodal reactivation of HIV

[0138] Demonstration of Yodal induction of a previously unrecognized pathway of HIV reactivation Summary' Despite the effectiveness of antiretroviral therapy (ART) in suppressing viremia in people having / living with HIV (PWH), the persistence of latent viral reservoirs remains a major barrier to curing HIV. Latency reversing agents (LRAs) are currently being explored to eliminate latent reservoirs, but those tested thus far have failed in clinical trials. In the experiments described herein, Y odal is identified as a synthetic agonist of the mechanosensitive ion channel, PIEZO1. Yodal is thus a novel and a potentially effective LRA. Yodal effectively reactivated latent HIV in vitro using the ACH-2 HIV latency cell model and in ex vivo using peripheral blood mononuclear cells (PBMCs) from an HIV patient on suppressive ART. Yodal - mediated latent HIV reactivation led to the production of infectious virus, upregulation of HIV gene expression, and HIV LTR transactivation. The observed latent HIV reactivation was dependent on PIEZO 1 activation and calcium signaling. Integrated transcriptomic and proteomic analyses revealed Yodal induction of a previously unrecognized pathway of HIV reactivation, characterized by enhanced T cell activation and upregulation of the TCR / CD3 complex and HLA genes. In addition, Yodal regulated host and viral transcription and translation machinery, favoring viral gene expression. These findings strongly suggest that PIEZO 1 is an important target for HIV cure strategies and argue for further in vivo efficacy testing of Yodal as a novel LRA and potential cure for HIV by reversing HIV latency and enhancing the immune clearance of the latent HIV reservoir.

[0139] Introduction

[0140] Over the course of its four-decade pandemic trajectory, HIV has resulted in approximately 41 million deaths. In 2023, 40 million people were living with HIV. 630,000 individuals have died from HIV-related causes, including 76,000 children under the age of 15.1HIV antiretroviral therapy (ART) stands as one of the most remarkable achievements in contemporary' medicine. Before the advent of ART, the mortality rate among individuals infected with HIV was nearly 100%.2Currently, people having / living with HIV (PWH) on ART who maintain controlled viremia can expect a life expectancy and quality of life comparable to that of the general population.2

[0141] Despite the extraordinary benefits of ART, HIV remains a chronic condition, and patients must rely on ART to sustain their health. Unfortunately, access and adherence to ART often present significant challenges, limiting the effectiveness of treatment regimens. Financial barriers and psychological factors, often exacerbated by the stigma surrounding HIV, are correlated with reduced ART success rates.3'5The United States’ contributions and response organizations like PEPFAR have saved more than 26 million lives through treatment, care, and support. Potential clinical and economic impacts of cutbacks in the President’s Emergency Plan for AIDS Relief Program globally will be catastrophic, leading to 565,000 new infections, 100,000 new deaths, and the loss of 3.71 life years in South Africa alone.6,7

[0142] The development of a vaccine, as well as a sterilizing or functional cure, remains crucial for the ultimate eradication of HIV. From the global perspective, the need for a cure becomes even more critical. There has been a dedicated research effort to develop treatment strategies to clear the virus from infected individuals and PWH on suppressive ART, but the existence of a latent population of cells harboring integrated HIV provirus has proven difficult to target. Memory CD4 T cells comprise most of the HIV reservoir, but HIV is also detected in various cell types and anatomical locations, including the lymph nodes, gastrointestinal tract, central nervous system, lungs, bone marrow, and genital tract.89In the bloodstream, myeloid cells such as monocytes, macrophages, and follicular dendritic cells also harbor HIV.10 11Compounding the difficulty of detecting and quantifying the reservoir, is the estimated only one CD4 T cell per million containing HIV DNA, much of which is non-infectious and consists of incomplete viral genomes.12-14

[0143] The HIV-infected CD4 T cell reservoir is highly diverse, harboring transcriptionally quiescent provirus that persists during ART and is sustained by homeostatic proliferation and survival.15When ART is discontinued, the virus reactivates and rebounds to re-establish a propagating infection.16Viral reservoirs exhibit persistent viral replication kinetics and are highly resistant to ART, as no current ART agents are specifically designed to target HIV gene expression and replication. Viral reservoirs play a critical role in re-establishing active infection shortly after ART cessation, even after prolonged periods of uninterrupted treatment. It is now widely accepted that the reactivation of latent HIV within the reservoir is a pivotal step towards achieving a definitive cure. Upon reactivation, infected cells can be rapidly eliminated through direct viral cytopathic effects and immune-mediated responses.

[0144] There are ongoing research efforts to develop HIV cure strategies using the “kick-and- kill” approach.17This two-pronged approach involves the reactivation of latent HIV-infected cells for the ‘‘kick”10,18using a class of drugs called Latency Reversal Agents (LRA). These are designed to reactivate latent HIV -infected cells to flush out the virus and render the virus and these cells susceptible to the “kill’' by ART and immunologic clearance. Current LRAs interfere with chromatin remodeling and gene silencing, which were shown to be involved in HIV latency. Key targets in this context include DNA methyltransferases (DNMTs), histone deacetylases (HDACs), and histone methyltransferases (HMTs).19-22Several inhibitors and agonists acting on chromatin remodeling have shown the ability to induce HIV expression in latently infected cells. Many studies have examined strategies to reverse HIV latency by inducing virus reactivation and viral antigen re-expression to restore immune detection of infected cells.20However, LRAs studied and clinically tested to date have failed due to inefficient HIV reactivation, highlighting a knowledge gap in HIV latency reversal.19-21-23Indeed, studies in PWH show that, on average, only 1.7% of intact pro viruses across all T cell subsets were induced in vitro to transcribe viral genes and release replication-competent virus after stimulation.24Hence, there is an urgent need for a better understanding of the mechanisms involved in effective latency reversal and the development of more effective and safer LRAs for HIV cure.

[0145] Akin to the previous example, in EXAMPLE TWO, the PIEZO1 agonist, Yodal, is proposed as a novel and effective latency reversing agent (LRA) in a kick-and-kill strategy7. Strong functional data supporting the ability of Yodal to reactivate latent HIV is provided herein.

[0146] MATERIALS AND METHODS

[0147] Cells

[0148] ACH-2 cells, from AIDS Reagent Program, were cultured in RPMI 1640 (Gibco. Waltham, MA) with 10% Fetal Bovine Serum, lOmM HEPES, at 37°C and 5% CO2. TZM.bl cells, from AIDS Reagent Program, were cultured in DMEM (Gibco, Waltham, MA) with 2% PEN-STREP (Gibco, Waltham, MA) and 10% Fetal Bovine Serum at 37°C and 5% CO2. PIEZO 1 activation

[0149] For chemical activation of the PIEZO 1 calcium channel, 5 x 105ACH-2 cells per ml were treated with 15pM Yodal (Sigma Aldrich, St. Louis, MO) at 37°C for 72 hours. Activated cells were centrifuged at 2500 RPM for 5 minutes and supernatant was collected. The supernatant was used to infect TZM.bl cells for assessment of viral production. Cell viability assay

[0150] The viable cells were counted in 1: 1 cell suspension and 0.4% solution Trypan Blue (Gibco, Waltham, MA) mix using Invitrogen Countess 3 Automated Cell Count (Gibco, Waltham, MA) in triplicates. TZM.bl cell infection assay

[0151] TZM.bl cells were washed with 5ml PBS pH 7.2 (without Calcium Chloride and Magnesium Chloride) (Gibco, Waltham, MA) and trypsinized with 2ml Trypsin for 15 minutes. 2 x 104cells were seeded and adhered to 96 Cell Culture Plates (SPL Life, Gyeonngi-do, South Korea) at 37°C and 5% CO2. The TZM.bl cells were then infected with lOOpl of the ACH-2 supernatant for 72 hours for assessment of viral production. LTR transactivation assay pALPS Tat-P2A-Rev plasmid (Addgene, Watertown, MA; Cat#101331) transfection was carried out following Lipofectamine 2000 standard protocol. Briefly, 6-well plate wells with 80% confluent 293T cells, culture medium was replaced with 2ml OptiMEM. 250 pl OptiMEM containing lOpl Lipofectamine 2000 and 250pl OptiMEM with 4pg plasmid were incubated at RT for 5 minutes. The solutions were mixed, incubated for 15 minutes at RT, and subsequently added to the cell culture dropwise, while swirling the plate to allow optimal dilution. On the following day, the medium was replaced with DMEM / 10% FBS. Cells were incubated 37°C and 5% CO2 overnight and then used for downstream Yodal transactivation assay.

[0152] Lentivirus production and infection assay

[0153] 5 x 106293T cells in T75 flask containing a 1 :1 mixture of optiMEM (GIBCO, Waltham, MA) and DMEM supplemented with 10% FBS (GIBCO, Waltham, MA) were transfected as follows: 14.2pg pHAGE-Luc-zGFP (BEI Resources, Manassas, VA), 16pg pCMVdR8.2 (Addgene, Watertown. MA), and alternatively 6.4pg pcDNA3.1-BG505 (kindly provided by Dr. John P. Moore, Cornell University7, Ithaca, NY) or pcDNA3. l-ZM197M.PB7 (NIH HIV reagent Program, Bethesda, MD) were dissolved in 1.8ml optiMEM. 1.8ml of optiMEM with 75pl of Lipofectamine 2000 (Invitrogen. Waltham, MA) was then added to the plasmid mixture after incubation at RT for 5 minutes. The mix was incubated at RT for another 15 minutes. The final solution was added dropwise onto the cells. The day after transfection, the medium was replaced with 15ml DMEM / 10%BSF / 2% PEN-STREP with lx non-essential amino acids (GIBCO, Waltham, MA). Supernatants were collected after 24 and 48 hours. Supernatants were filtered through a 0.45 pm PVDF Millex-GV filter (Millipore, Burlington, MA). Lenti Concentrator reagent (Origene, Rockville, MD) at 1 :5 ratio was added to the filtered medium and incubated for 2-4 hours at 4°C. The mixture was centrifuged at 4°C for 40 minutes at 4,000 RPM, and the viral pellet was resuspended in DMEM to a l / 75th of the initial volume. The virus was stored at -80°C before use. Virus infection was performed as follows: 5,000 TZM.bl cells per well in 96- well plate in complete DMEM growth medium containing 15pM Yodal were infected with lOpl virus solution for 48 hours. Infection w as assessed using a luciferase assay described below7. Luciferase assay

[0154] To assess virus infection, luciferase expression was measured using a Synergy Hl Plate Raeder (BioTek, Winooski, VT). The medium in the 96 well plate was discarded and 180pl of a solution 1 : 1 of BriteLite Plus (Perkin-Elmer, Waltham, MA) and complete RPMH 40 was added. Cells were lysed by repeated pipetting and 150 pl of the cell lysate was transferred into a white 96-well plate for luminescence measurement. Cell membrane and nuclear fluorescent staining

[0155] Infected TZM.bl cells were washed with PBS and incubated with IX Cellbrite 555 (Biotium, Fremont, CA) in PBS for 15 minutes. The cells were then washed with PBS and fixed using 4% PFA in PBS for 10 minutes and washed again. A solution of DAPI in PBS was added and cells were visualized using a LSM540 confocal microscopy (Zeiss. Oberkochen. Germany).

[0156] Gene expression analysis by RT-qPCR

[0157] Yodal -treated ACH-2 cells were pelleted by centrifugation at 2500RPM for 5 minutes. Total RNA was extracted using Qiazol Lysis reagent (Qiagene, Venlo, the Netherlands). Total RNA was quantified by nanodrop and 28-100ng were used for cDNA synthesis. cDNA for Gag quantification was produced using Gag and GAPDH reverse primers to assure cDNA specificity while for PIEZO 1 a 1 :5 mixture of random hexamers and Poly-T was used. cDNA was obtained using VERSO cDNA kit (Thermo Fisher Scientific, Waltham, MA) following manufacturer instruction. cDNA synthesis was performed at 42°C for 40 minutes followed by 2 minutes at 95°C. 2pl of cDNA was used for PCR quantification using Quantabio perfecta SYBR Green superMix low ROS (Quantabio, Beverly, MA) in QuantStudio 3 PCR device (Applied Biosystems, Waltham, MA). Primers for detection of Gag and GAPDH, used at 400nM final concentration were the following: Gag Forward: CCACCTATCCCAGTAGGAG (SEQ ID NO: 1); Gag Reverse: CTCCCTGACATGCTGTCATC (SEQ ID NO:2); GAPDH Forward: TCAAGGCTGAGAACGGGAAG (SEQ ID NO:3); and GAPDH Rev: CGCCCCACTTGATTTTGGAG (SEQ ID NO:4).

[0158] TaqMan assay to detect the expression of PIEZO1 in ACH-2 cells was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA). In brief, lOpl of master mix were added to I pl of PIEZO1 TaqMan Assay kit (Thermo Fisher Scientific, Waltham, MA; Cat# Hs00207230_ml) containing specific primers and probe and Ipl of cDNA in a 20pl final volume with milliQ water. PCR was performed in an AB QuantStudio 3 equipment (Applied Biosystems, Foster City, CA) using the built-in fast protocol as thermocycling profile. The threshold value was registered and a value less than 30 was considered positive for PIEZO1 expression.

[0159] Yodal activation of peripheral blood mononuclear cells (PBMCs) from people having / living with HIV (PWH)

[0160] De-identified peripheral blood mononuclear cells (PBMC) were isolated from a PWH patient with Nova Southeastern University' Institutional Review Board (IRB) approval. Two Histopaque 1077 (Sigma Aldrich, St. Louis, MO) PBMC separation aliquots were processed following manufacturer's protocol. Briefly, 4ml of Histopaque 1077 solution was aliquoted in two 15ml conical tubes. In each tube, 4ml blood was carefully layered and centrifuged for 30 minutes at 4000xg at RT. After centrifugation, the interphase containing the cell was isolated. The two cell aliquots were pooled and washed twice with 10ml PBS and resuspended in 6.4ml RPMI1640 / 10% FBS. The cell suspension was divided into 3 wells in a 6-well plate containing 2x106cells each well. One well was treated with 15pM Yodal and another with 5ng / ml of PMA. After 72 hours, the cells were counted and viability’ assessed by trypan blue staining. The presence of virus was determined using the TZM.bl cell infection assay as described above. Data were analyzed by one-way ANOVA and Tukey’s post-hoc test.

[0161] Proteomic analysis

[0162] Proteins were reconstituted in a buffer containing 2% (w / v) SDS, 50mM Tris pH 8.0. Subsequently, lOOpl protein extract was treated with lOpl of 250mM TCEP at 70°C for 10 minutes. This step was followed by incubation with 20pl of 400mM IAA at room temperature for 10 minutes. Purification and tryptic digestion of proteins were performed using the SP3 protocol, as outlined by the original authors.25The resulting peptides underwent purification using Stage Tips with SDB-RPS sorbent, following the protocol developed by Rappsilber et al11’ The Vanquish Neo nanoLC system, Orbitrap Eclipse mass spectrometer, FAIMS Pro Interface, and Easy Spray ESI source (Thermo Fisher Scientific, Waltham, MA), were used for LC- MS / MS data measurements. NanoLC separation was performed using a combination of an Acclaim PepMap trap column (75pm x 2cm) and an EasySpray ES802 column (75pm x 25mm, 100 A) (Thermo Fisher Scientific, Waltham, MA). 5pl peptide digest was injected, and the analytes were separated with a mobile phase comprising 0.1% (v / v) formic acid in water (solution A) and 0.1% (v / v) formic acid in 80% (v / v) acetonitrile (solution B), flow rate at 300nL / min and the column temperature at 40°C. Initial equilibration of the column with 3% solution B for 2 minutes was follow ed by a gradual linear gradient (raised to 40% solution B) for 60 minutes. Any residual peptides attached to the Cl 8 resin were eluted with 95% solvent B for 11 minutes. In positive MS mode, the ion source temperature was set at 305°C. and ionized peptides were separated from singly charged ions through the FAIMS Pro unit at -50V. Mass spectra were collected in MSI mode with a resolution of 120,000, covering the mass range of m / z 350-2000, using standard automatic gain control (AGC) settings and automatic injection time. For MS / MS fragmentation, a data-independent acquisition (DIA) mode a range of m / z 375-1200 and a 30,000 resolution was implemented. The collision energy was set at 30%, and an AGC target of 1000% was applied. MS2 spectra were measured across m / z 25 isolation windows with 0.5 m / z overlaps. Proteome data analysis was carried out utilizing the DIA-NN 1.8.1 software platform.27LC-MS data files underwent processing and analysis with the following parameters: FASTA database - Homo sapiens (UP000005640) and HIV (UP000007692); FASTA digest for library-free search / hbrary generation; Protease - Try psin / P missed cleavages - 1, N-term M excision; C carbamidomethylation; Peptide length range - 7- 30; Precursor charge range - 1-4; precursor m / z range - 300-1800; fragment ion m / z range - 200-1800; Precursor FDR (%) - 1.0; Use isotopologues; heuristic protein interference; no shared spectra; Protein interference - Genes; Neural network classifier - Single-pass mode; Quantitation strategy - Robust LC (high precision); Cross-run normalization - RT-dependents; Library' generation - Smart profiling; Speed and RAM usage - optimized for optimal results. Raw protein peak areas were utilized for statistical analysis, following the methodology' outlined by Schulte et a / .28Transcriptomic analysis

[0163] Total RNA was extracted from fresh frozen cell pellets using the Qiagen RNeasy Plus Mini kit following manufacturer's protocol (Qiagen, Hilden, Germany). RNA samples were quantified using a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad. CA). RNA integrity was evaluated using an Agilent TapeStation 4200 (Agilent Technologies, Palo Alto, CA). RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, Ipswich, MA). Briefly, enriched mRNAs using Oligo(dT) beads were fragmented for 15 minutes at 94°C. First-strand and second strand cDNA were synthesized. The cDNA fragments were end-repaired and adenylated at 3' ends, and universal adapters ligated to cDNA fragments, followed by index addition and library enrichment by PCR with limited cycles. Sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies, Palo Alto, CA) and quantified by using Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) as well as by qPCR (KAPA Biosystems, Wilmington, MA). The sequencing libraries were clustered on a flow cell ready for sequencing using Illumina NovaSeq. The samples were sequenced using a 2xl50bp Paired-End (PE) configuration, targeting 30M reads / sample. The raw sequencing data (.bcl files) were converted into fastq files and de-multiplexed using Illumina's bcl2fastq 2.20 software. One mismatch was allowed for index sequence identification. Data Analysis Sequence reads were trimmed to remove possible adapter sequences and nucleotides of poor quality’ using Trimmomatic v.0.36. The trimmed reads were mapped to the human reference genome (GRCh38) available on ENSEMBL using the STAR aligner v.2.5.2b. The STAR aligner is a splice aligner that detects splice junctions and incorporates them to help align the entire read sequences. Mapping .bam files were used to generate hit counts for genes and exons. Unique gene hit counts were calculated using feature CONFIDENTIAL Counts from the Subread package v.1.5.2. Unique reads within exon regions were counted and used in downstream analysis.

[0164] Differential gene expression, clustering, and pathways / ontology analyses Proteomic and transcriptomic read counts were analyzed using Bigomics Playground platform. Statistical significance of the differential expression was expressed as meta.q, which is the most conservative analysis that integrates three different statistical methods: DESeq2 Wald, edgeR, and Limma. Differential gene expressions were determined using the threshold optimized to best fit the distribution of each data set, but in all cases following a strict minimal standard (Fold-Chage >1.5 and meta.q<0.05). The global transcriptional and proteomic changes across samples were represented by a volcano plot to determine downregulated and upregulated genes. Bigomics Playground was also used to run gene ontology and pathways analysis to determine the gene functions significantly influenced by the Yodal induction (z.e., biological processes, molecular functions, and cellular components).

[0165] RESULTS

[0166] Yodal induced reactivation of latent HIV in ACH-2 cells leading to production of infectious HIV,

[0167] PIEZO 1 is expressed in various cell types, including CD4 T cells, mediating cell activation via calpain activation and organization of cortical actin scaffold, TGFpl and integrin- dependent chemotactic migration signaling.29'31The experiments addressed whether the PIEZO 1 agonist, Yodal, could reactivate latent HIV CD4 T cells using ACH-2 cells. The experimental design for assessing HIV reactivation by Yodal is depicted in FIG. 14. Following a 72-hour treatment with Yodal, ACH-2 cells produced infectious HIV capable of infecting TZM.bl cells, achieving maximum virus production and infection (measured by luciferase activity) at 15- 20pM (FIG. 8A). Infection of TZM.bl cells resulted in the formation of syncytia (FIG. 12). Fluorescence staining of the syncytia revealed a diffuse disruption of cell-cell adhesion, indicating a cytopathic effect due to infection (FIG. 11).

[0168] Yodal reactivated latent HIV in ACH-2 cells, leading to upregulation of HIV genes.

[0169] Reactivation of latent HIV was previously shown to result in the expression of HIV genes in latent cells.20,32Proteomics analysis revealed that Yodal markedly upregulated the expression of HIV-1 Gag-Pol proteins (FIG. 16A) and HIV-1 gpl60 (FIG. 16B). It was also found that Yodal induced the HIV-1 Gag mRNA expression (FIG. 16C), and RNAseq analysis showed that Yodal upregulated the expression of HIV BRU RNA (FIG. 16D). Together, these results demonstrate that Yodal reactivated latent HIV by inducing the expression of HIV- 1 genes.

[0170] PIEZO 1 is expressed on ACH-2 cells and mediated reactivation of latent HIV by Yodal.

[0171] The interaction of Yodal with PIEZO 1 receptor results in the activation of T cells.31,33The role of PIEZO 1 in the reactivation of latent HIV was addressed. First, it was found that PIEZ01 is expressed in ACH-2 cells (FIG. 16A). To assess the involvement of PIEZO1, EGTA and streptomycin, which are inhibitors of PIEZO 1, were used. EGTA sequesters calcium cations required for the PIEZO1 signaling cascade while streptomycin has an activation-dependent inhibi lory effect.34Both PIEZO1 inhibitors abrogated latent HIV reactivation with significant reduction of HIV-1 virus production and syncytium formation (FIGS. 16 and 16C. respectively). Additionally, EGTA prevented upregulation of HIV Gag expression after Yodal stimulation (FIG. 16D). Collectively, these results suggest that the PIEZO 1 signaling pathway plays an important role in latent HIV reactivation induced by Y odal .

[0172] Yodal reactivated latent HIV in peripheral blood mononuclear cells (PBMCs).

[0173] Most people with HIV (PWH) under antiretroviral treatment (ART) are virally suppressed but have quiescent latent HIV infection.8’18’32It was found that Yodal treatment of human PBMC from a PWH under ART and with undetectable viral load, markedly reactivated latent HIV in vitro by inducing production of infectious HIV compared to the untreated control (FIG. 17A). EGTA inhibited reactivation of latent HIV in PWH PBMC (FIG. 17A). The level of Yodal -mediated reactivation of PWH was comparable to PMA (FIG. 17A). The effects of Yodal and PIEZO 1 inhibitors were not due to compromised viability' (FIG. 17B). All these data combined suggest that Yodal can strongly reactivate latent HIV in PWH PBMC that is mediated by PIEZO 1.

[0174] Yodal reactivated HIV by inducing LTR transactivation.

[0175] Upregulation of HIV gene expression during latent HIV reactivation is mediated by LTR transactivation.35The role of LTR transactivation in latent HIV reactivation that is mediated by Yodal was assessed. Using an LTR-luciferase assay, it was found that treatment of TZM.bl cells containing an LTR-luciferase cassette with 15pM Yodal resulted in LTR transactivation (FIG. 4B). Infection of highly susceptible TZM.bl cells containing the LTR-luciferase cassette with pseudovirus expressing the envelope glycoproteins of either the primary’ isolate BG505 (Clade A) or ZM197M (Clade C) dramatically increased luciferase activity (FIG. 4A). In addition, it was found that Yodal treatment of TZM.bl cells transfected with pALPS -Tat-P2A-rev increase luciferase activity by7approximately 2-fold (FIG. 4C). Taken together, these results strongly suggest that Y odal can reactivate latent HIV by upregulating the expression HIV genes through the transactivation of the LTR.

[0176] Proteomic analysis showed that Yodal unregulated T cell and immune response markers.

[0177] Proteomic analysis to determine host factors that may be involved in latent HIV reactivation was conducted. A total of 6 independent proteomic replicates for each ACH-2 control and ACH-2 treated with 15pM Yodal were clustered by UMAP method. The replicates of each condition clustered well in the 2D space showing that latent cells treated with Yodal had a distinct proteomic profile (FIG. 18 A). The statistical significance of the differential expression was calculated employing 3 methods (Wald test, EdgeR, and Limma trend). Considering the average among the three methods and adopting an FDR of 0.2 or less, Yodal treatment of latent cells was characterized by the upregulation of a total of 411 and the downregulation of 74 proteins (FIG. 18A). In line with the differential expression analysis, the volcano plot showed a skewed distribution of upregulated proteins towards the upper-right (FIG. 18B). In FIG. 18C, the 50 most differentially expressed proteins clustered by treatment status are represented. The differential expression analysis revealed that Yodal upregulates a set of genes related to immune response and T cells. Yodal was associated with the expression of T cell receptor (TCR) components belonging both to 0. (TRA / TRAC, TRAV29DV5, TRBV3-1) and y5 (TRGV3, TRGC1) subtypes (FIG. 19). Yodal affected also the CD3 co-receptor complex as shown by the upregulation of CD3D, CD3E, CD3G and CD247 (CD3Z) (FIG. 19). Proteomic analysis also showed the markedly increased expression of the Human Leukocyte Antigen family (HLA) upon Yodal treatment. Specifically, HL A- A, HLA-C and HLA-E were upregulated (FIG. 19). These results suggest that upregulation of these HLA molecules along with induction of HIV protein expression (FIG. 15) may impact the recognition and killing of latent cells by cytotoxic T cells and NK cells through class I presentation of HIV antigens.

[0178] Proteomics analysis showed that Yodal reactivated latent HIV bv downregulation of mRNA processing and ribosome biosynthesis proteins.

[0179] It was found that Yodal regulated both host gene transcription and translation. Regarding transcription, Yodal downregulated the components of the RNA polymerase I complex: POLR1G and POLR1E; while upregulating the RNA polymerase II components: POLR1 A, POLR1B, and POLR1D (FIG. 20). RNA polymerase 1 decrease was associated with RNA polymerase 2 components increase (POLR2A / B / C / G / K / H and I). While RNA polymerase 1 oversees the production of ribosomal RNAs, RNA polymerase 2 is responsible for the production of messenger RNAs including the replication of HIV that serves as genome for the new viral particles and for the synthesis of viral proteins. Yodal also impacted gene transcription in ACH-2 cells by regulating transcription factors (FIG. 20), Specifically Yodal either upregulated or downregulated Transcription Initiation Factors (TIFs) depending on the transcriptional regulator (TFIID, B or H). With respect to gene translational regulation by Yodal. proteomic analysis revealed downregulation of a set of nucleolar and ribosome factors, that were suggested to affect ribosome function.36,3749 of 249 of these nucleolar and ribosome factors were detected in the proteomic analysis. 45 of these factors were down regulated in response to Yodal treatment with 40 showing a meta.q<0.05 (FIGS. 21A-B). Although the effects size was modest, the wide impact of Yodal treatment on ribosome related proteins suggest the Yodal results in an overall decreased ribosomal activity. Yodal also downregulated several structural and functional proteins essential to ribosome activity. Several sub-units of the Eukaryotic Initiation Factor 2b (EIF2B1, EIF2B2, EIF2B5, EIF2B3) were slightly but consistently affected by Yodal (FIGS. 21A-B)). The EEF1 complex, including EEF1A1, EEF1B2. EEF1G and EEF1D were also downregulated in response to Yodal (FIGS. 21A-B). These factors are necessary for matching aminoacyl-tRNAs with their corresponding codon on the mRNA during translation. Altogether, these results suggest that the ability of Yodal to regulate host and viral gene transcription and translation could aid in the expression of HIV genes and reactivation of latent HIV.

[0180] Transcriptomic analysis revealed the upregulation of T cell markers bv Yodal.

[0181] In comparison with the proteomics data, transcriptomic analysis also revealed some interesting results. The transcriptomic profiles of PMA and Yodal induction were profoundly different from each other with no overlap among the most up- and downregulated genes (FIGS. 22A-B). In comparison with proteomic analysis, transcriptomic analysis also revealed increased expression of T cell receptor complex genes. Among the most up-regulated genes were 5 T cell receptor alpha genes (TRAV27, TRAC, TRAV29DV5, TRAV 22 and TRAV), 7 T cell receptor gamma complex genes (TRGV2, TRGV1. TRGV4, TRG-AS1, TRGC1 and TRGC2) and the T cell receptor delta, TRDV1 gene (FIG. 23 A). Regarding CD3 and HLA expression, transcriptomic data showed no significant upregulation of these genes, in contrast to the proteomics analysis (FIGS. 23B-C). Altogether, the combined proteomics and transcriptomics data provide a possible explanation for the Yodal -mediated HIV reactivation via T cell activation mediated by the TCR / CD3 complex.

[0182] Transcriptomics revealed regulation of gene transcription and translation bv Yodal.

[0183] Similar to proteomics, transcriptomics showed the effect of Yodal on regulating genes associated with the RNA polymerases needed for gene transcription. The mRNAs of the major polymerase 2 subunits (POL2A and POL2B) were upregulated, while the other polymerase 2 subunits (POLR2E / C / E / G / H / I / J / K / L / M) were downregulated. The upregulation of these genes in the proteomic data was observed, but it lacked statistical significance (FIG. 24A). Transcriptomics, like proteomics, also showed the effects of Yodal on ribosome synthesis necessary' for protein translation. The analysis of genes relevant for the ribosome biosynthesis was performed as suggested by Jarboui et al36, as in the analysis of the proteomic data. Of the 249 genes associated with ribosome synthesis36,37, 1 17 were affected by Yodal treatment of ACH-2 cells. Consistent with proteomic analysis, it was found that the majority of the proteins (87 over 117) were downregulated in response to Yodal, with the downregulation of 36 of these proteins showing statistical significance (meta.q<0.05) (FIG. 24B). The ribosome genes RPL10A, RPL21, RPL27, RPL38, RPS5, and RPS16 were significantly downregulated in both proteomic and transcriptomic data sets. In line with the proteomic data, several elongation factors crucial for the protein translation were downregulated by Yodal with the exception for EEF2, EEF2K and EIF3A (FIG. 24C). Taken together, the transcriptome suggests the ability of Yodal to regulate both host transcnption and translation likely promotes HIV gene expression and latent HIV reactivation.

[0184] Transcriptomic analysis showed that Yodal unregulated the HIVEP transcription factors involved in T cell activation and HIV gene expression.

[0185] Transcription factors such as NF-kB play a key role in T cell activation as well as in HIV LTR transactivation and gene expression.38'40Transcriptomic analysis showed that Hivpep2 and 3 (known as Schnurri) expression was increased by Yodal (FIG. 24D). HIVEP2 and 3 are zinc finger transcription factors that bind to the recombination signal sequence (Rss) flanking the V, D, and J gene segments of the immunoglobulin gene and enhance HIV transcription via LTR transactivation.41’42Taken together, these results revealed the possible involvement of T cell activation in latent HIV reactivation and reversal of HIV latency mediated by Yodal through the regulation of transcription factors involved in T cell activation, HIV LTR transactivation and gene expression.

[0186] DISCUSSION

[0187] Despite the ability of antiretroviral therapy (ART) to suppress HIV in people having / living with HIV (PWH), there is no cure for HIV due to the remaining presence of latent viral reservoirs that are unperturbed even by the most powerful antiretroviral drugs available. The goal of kick-and-kill HIV cure strategy is to reactivate latent HIV and destroy these latent reservoirs, resulting in the complete elimination of the virus from the host. Latency reversal agents (LRAs) are being developed to reactivate latent HIV. Unfortunately, LRAs previously tested have failed in clinical trials likely due to inefficient reactivation coupled with the poor clearance of latent HIV-infected cells17>i8,2o.22,32,43,44 Therefore is paramount and a research priority to develop more effective kick-and-kill strategies including the development of new LRAs that can reactivate latent HIV more effectively to ultimately achieve HIV cure.45

[0188] The studies disclosed herein investigated Yodal, a synthetic PIEZO 1 agonist, as a novel LRA. It was demonstrated that Yodal can effectively reactivate latent HIV in the ACH-2 T cell line. The Yodal -induced latent HIV reactivation was mediated by PIEZO 1. Yodal induced the production of infectious HIV and increased HIV gene expression in ACH-2 cells. Latent HIV reactivation by Yodal was associated with T-cell activation, HLA upregulation, and the modulation of host and viral transcription and translation that favors viral gene expression. Prior studies showed that in CD4 T cells, PIEZO 1 is involved in T cell activation via calpain activation and organization of cortical actin scaffold, as well as Treg development requiring TGFP and integrin-dependent chemotactic migration.29-30Interestingly, however, the signaling pathways induced by Yodal in ACH-2 cells are novel and distinct from prior studies on LRAs and PIEZO 1 -mediated T cell activation. This could likely be due to the presence of latent HIV in ACH-2 cells as well as in the diversity of the HIV-infected CD4 T cell reservoir. Future studies include Yodal treatment of uninfected CD4 T cells in the absence of latent HIV to assess how latent HIV infection influences Yodal -mediated T cell activation.

[0189] Integrated proteomic and trans criptomic analyses revealed a novel HIV reactivation profile in latent cells treated with Yodal. Proteomic analysis identified 485 differentially expressed proteins post-Yodal treatment, with 411 upregulated and 74 downregulated proteins. Upregulated proteins were primarily involved in immune response pathways, including TCR and the co-receptor CD3 complex, as well as the HLA molecules, which play critical role in antigen presentation, T cell recognition and activation.

[0190] Notably observed from the Omics analyses, Yodal increased expression of TCR coreceptor complex components such as CD3D, CD3E, CD3G, and CD247, crucial for T cell signaling. The increases occurred upon reactivation of latent HIV in ACH-2 cells. HIV latency reversal was found to be inefficiently induced by T cell receptor (TCR) engagement, perhaps due to a TCR engagement deficit, while agents that bypass proximal TCR signaling can induce downstream signals.46Interestingly, like PMA, anti-CD3 / CD28 is also a potent LRA in vitro, better than clinically tested LRAs.47These findings suggest that Yodal may serve as an effective LRA by upregulating TCR / CD3 complex, including TCR and CD3, creating a more effective TCR engagement necessary for latent HIV reactivation or reversal of latency.

[0191] Upregulation of HIV gene expression is likely due to the Yodal -mediated LTR transactivation and T cell activation involving NF- B and HIVEP2 and 33S-40-42-4fiPreviously, the activation of T cells and HIV transcription were found to share common upstream signaling pathways, including reliance on the transcription factor NF-KB.39It is noteworthy that Yodal increased the expression of transcription factors HIVEP2 and 3, which in concert with NF-KB could not only augment T cell activation but also HIV gene expression through LTR transactivation. As an LRA, Yodal could reactivate latent HIV through T cell activation and LTR transactivation involving transcriptional regulators such as HIV EP2 and 3.

[0192] Yodal also upregulated HLA molecules including HLA- A, HLA-C, and HLA-E, enhancing antigen presentation and immune surveillance. Upregulation of HLA molecules along with HIV protein in reactivated latent cells could render these cells susceptible to CTL killing. HLA-A bound to HIV peptides could lead to the killing by Cytotoxic T cells: while HLA-C bound to HIV peptides could mediate recognition by both natural killer and T cells.10,44’49Upregulation of HLA-E could lead to the binding of NK cells and a small subset of T cells in the peripheral blood via CD94 / NKGK2A / B / C NK cell receptors. Engaging CD94 / NKG2A or CD94 / NKG2B induces an inhibitory effect on the cytotoxic activity7of the NK cell to prevent cell lysis?0Dichotomously however, binding of HLA-E to CD94 / NKG2C (KLR.C2) triggers expansion of NK cell subsets in antiviral responses?1The precise role of these HLA molecules in the elimination of latent reservoirs needs to be further investigated.

[0193] In addition to immunomodulation, Omics analyses demonstrated that Yodal impacts ribosome and nucleolar function. Proteomic analysis showed that Yodal downregulated several proteins associated with ribosome biosynthesis and nucleolar activity, including proteins involved in ribosomal RNA (rRNA) processing and structural components of the ribosome. This down regulation results in a decrease overall ribosomal activity7, which may have implications for cellular protein synthesis and viral replication. Transcriptomic analysis further confirmed that Yodal induced changes in gene expression related to ribosome function characterized by a modest but w ide downregulation of nucleolar and ribosomal components fundamental for the ribosome biogenesis.

[0194] Omics analyses also revealed that Yodal treatment impacted RNA polymerase complexes, specifically decreasing components of RNA polymerase I, which is responsible for rRNA synthesis while increasing components of RNA polymerase II, which is responsible for mRNA synthesis. This shift suggests that Yodal may promote viral replication by favoring the transcription of HIV mRNA over the synthesis of rRNA, altering the transcriptional machinery7in favor of viral gene expression. An important consequence is triggering host defense in that inducing HIV expression on latent infected cells could lead to the destruction of the reservoir. Increased expression of envelope protein on the cell surface could trigger antibody^ dependent cellular cytotoxicity ?2’53Furthermore, increased HIV protein expression could lead to enhanced CTL cell killing of latent cells via HLA presentation of HIV peptides and by the recognition of antibody -HIV envelop complex by CD 16 receptor of the NK cells.

[0195] It is worth noting that proteomic and transcriptomic data showed some overlap. There were differences between the two analyses, however. For example, proteomic but not transcriptomic analysis was able to detect statistically significant upregulation of members of the CD3 / TCR complex and HLA family. Differences between proteomic and transcriptomic analyses are commonly observed. In fact, assay detection sensitivity and specificity as well as the presence of post-translational modifications, RNA and protein stability w ere found to account for Omics analysis differences?4,55This highlights the complexity of cellular responses to Yodal and underscores the importance of multi-omics approach to fully delineate the role of Yodal in latent HIV reactivation and latency reversal.

[0196] Based on these collective findings, a model is proposed for how PIEZO1 reactivates latent HIV or reverses latency and contributes to the elimination of latent HIV reservoir (FIGS. 25A-B). Briefly. Yodal interacts with PIEZO 1. leading to cellular calcium uptake and triggering a series of transcriptional effects, including the reactivation of the latent HIV genome. The mediators of HIV reactivation are the subject of future investigation. The cascade of events initiated by Yodal results in the modulation of RNA synthesis, driven by the upregulation of RNA polymerase II and the downregulation of RNA polymerase I, which is involved in the synthesis of ribosomal RNA. The influence of Yodal on the ribosome extends to the downregulation of a set of proteins necessary for the proper function of this organelle.

[0197] FIGS. 25A-B show the proposed model for Yodal as a latency -reversing agent (LRA) for cure of HIV in more detail.

[0198] FIG. 25A shows a diagrammatic representation of the kick-and kill theoretical framework. Achieving a sterilizing cure for HIV requires the complete elimination of the HIV reservoir responsible for re-establishing infection shortly after antiretroviral therapy (ART) is discontinued. HIV in its latent state is characterized by the absence or low level of viral gene expression, enabling the virus to become undetectable to both the immune system and drug targeting. The kick-and-kill approach relies on developing Latency Reversal Agents (LRAs), which are compounds designed to reactivate viral replication. Once reactivated, the newly synthesized virus can be targeted by co-administered ART, preventing it from infecting new cells. Latent cells that transition to an active state will undergo cell death through either the host immune response (including NK and CD8 T cells) or the virus’s cytopathic effect. HIV reactivation has been associated with the expression of Death Receptors (DR), which, upon interaction with TRAIL on the NK cell surface, trigger cell death. Additionally, NK cells can recognize opsonized HIV proteins on the cell surface via CD 16 leading to the killing of infected cells.

[0199] FIG. 25B is a diagrammatic representation of a proposed mechanism of HIV reactivation and killing of latent cells mediated by Yodal. Based on preliminary data, a model was proposed on how Y odal acts as an LRA to reactivate HIV and render latent cells susceptible to immune- mediated killing. Yodal is a selective chemical agonist of the mechanosensor PIEZO 1. Upon activation by Yodal, PIEZO1 acts as a calcium channel, leading to cellular calcium uptake and triggering a series of transcriptional effects, including the reactivation of the latent HIV genome. The mediators of HIV reactivation are the subject of future investigation. The cascade of cellular events initiated by Yodal results in the modulation of RNA synthesis, driven by the upregulation of RNA polymerase II and the downregulation of RNA polymerase I, which is involved in the synthesis of ribosomal RNA. Yodal impairs the ribosome function through the dow nregulation of a set of proteins necessary7for the proper function of this organelle. Additionally. Yodal induces the overexpression of several genes related to the immunological role of T cells, including an increase in all components of the T cell receptor (TCR) and CD3. This TCR / CD3 overexpression sensitizes T cells to activation, an event associated with HIV latency reversion. Yodal also increases expression of HLA (human leukocyte antigen) proteins, such as HLA- A, HLA-C, and HLA-E proteins. In addition, Yodal induces LTR transactivation leading to the production of HIV. This increase in HIV protein production along with increased expression of HLA proteins is promising, as it may facilitate the destruction of latent cells by class I presentation of HIV peptides to activate cytotoxic T cells, NK cells and antibodydependent cellular cytotoxicity (ADCC).

[0200] Additionally, Yodal induces over expression of several genes related to the immunological role of T cells, including a significant increase in all components of the T cell receptor (TCR) and CD3. This TCR / CD3 over expression sensitizes T cells to activation, an event associated with HIV latency reversal. Several members of the HLA family, including HLA- A, HLA-C, and HLA-E are also upregulated by Yodal. Furthermore. Yodal upregulates HIV gene expression through LTR transactivation. This increased expression of HLAs as well as increase HIV protein expression facilitates the clearance of latent cells by class I presentation of HIV peptides activating the cytotoxic CD8 T cells or antibody-depending cellular cytotoxicity7.

[0201] There are possibly other host factors or mechanisms that play a role in Yodal -mediated latent HIV reactivation. Based on previous studies of the role of calcium influx in T cell activation, citrullination might be involved in HIV reactivation in that the calcium influx triggered by PIEZO 1 activation through Yodal stimulation leads to histone citrullination that is mediated by calcium-dependent Peptidyl Arginine Deaminases (PADs).56In support of this hypothesis. PAD2 activation was associated with Thl7 cell activation, and treatment with Yodal — a PIEZO1 activator — was linked to increased histone H3 citrullination.33’56These observations suggest that Yodal could be a potent LRA because it possibly activates T cells through histone citrullination mediated by PAD4.57

[0202] To deepen understanding of the effect of Yodal on T cells, performing post translational analysis to determine the phosphorylation cascade associated with the T cell markers and receptor signaling upregulation is planned.58The study of protein phosphorylation through phosphoproteomics would be a key analysis for understanding the signaling landscape in the response of latent cell reservoir to Yodal stimulation. The phosphorylation of intermediate proteins is a common feature that is integral to a variety of cell-signaling cascades mediated by the CD3 / TCR complex, NF-kB and several others.58,59

[0203] Yodal as a new LRA is innovative. Unfortunately, to date, candidate LRAs have failed to eliminate or substantially reduce the latent reservoir.18’20,32,60Yodal serves as a method for reactivating a reservoir of latent HIV-1 in PWH. Conceptually, the identification of novel pathways for HIV reactivation in T cells and other cell reservoirs by Yodal is innovative. Yodal stimulates PIEZO1 activation pathways unique from prior LRAs (FIGS. 25A-B), which can be leveraged to tweak Yodal / PIEZOl agonists and develop new LRAs and therapeutic strategies to efficiently reactivate latent HIV. Other mechanosensors (i.e. PIEZO2) may have reactivation potential in latent cells that can be easily tested.61

[0204] PIEZO1 is expressed broadly in many cell types, including macrophages, which are reservoirs for latent HIV.8,9,11,17Research indicates that non-T cells can harbor HIV, and the Yodal agonist may effectively reactivate these other latent HIV-infected non-T cells.8,11Use of Yodal or a more effective PIEZO1 agonist (Y oda2, KC 159, Jedil or Jedi262,63) in combination with other safe LRAs is a possible route to efficiently reactivate latent cells. Current LRAs activate certain pathways such as histone acetylation (Vorinostat, Panobinostat or Romidepsin) that are different or may overlap with Yodal -PIEZO 1 signaling pathways and altogether may be synergistic at reactivating HIV.19,21,44

[0205] Administering Y odal with a therapeutically effective amount of an antiretroviral composition can be an efficient treatment. It may prevent the establishment of latent HIV if administered immediately after exposure to the virus. Various "kill" strategies including enhanced killing by CTLs. NK cells and antibodies (i.e. ADCC) are being developed, and these can be combined with Yodal.49,52,64,65

[0206] Yodal has a good safety profile, and it is easily produced. Yodal has been proven to have safety and good tolerance in vitro and in mouse models. Mice continuously treated with Yodal at doses as high as 213 ug / kg for 35 days did not develop any significant health issues or notable changes in their blood biochemistry.66Yodal is readily available and manufactured for clinical testing and eventual use as an latency reversal agent (LRA)in people with HIV (PWH).

[0207] Future research should focus on validating these findings in animal models of latent HIV as well as in the clinical setting. These studies should evaluate the efficacy of Yodal in reactivation of latent cells and reducing latent reservoir in primary T cells, macrophages and other cells from a larger cohort of PWH. In vivo testing in humanized mouse and non-human primate models to assess the viability of Yodal as therapeutic candidate should be conducted. Integrating single-cell omics techniques using PWH patient samples will be needed to investigate host variability in latent reservoir responses to PIEZO 1 activation, mainly due to reservoir population heterogeneity and reservoir size differences. These studies will be crucial for understanding the complexity of latent HIV infection and reactivation, as well as the optimization of PIEZO 1 -based HIV cure strategies.

[0208] Conclusion

[0209] Collectively, these experimental results show the role of PIEZO 1 in HIV-1 reactivation and the use of Yodal as a therapeutic agent to cure HIV-1. First, it was found that Yodal through PIEZO 1 activation induced the reactivation of HIV- 1 using the in vitro ACH-2 cell model of HIV reactivation. It was found that Yoda-1 increased both HIV-1 infection and syncytium formation as well as the reactivation of HIV in the ACH-2 cell model. Furthermore, viral reactivation was confirmed by upregulation of Gag expression in ACH-2 cells after Yodal treatment. It was demonstrated that the Yodal effect occurred specifically through PIEZO 1 activation and calcium influx since EGTA and streptomycin abrogated the effects of Yodal on the reactivation of HIV. These results also revealed the possible involvement of T cell activation in latent HIV reactivation and reversal of HIV latency mediated by Yodal through the regulation of transcription factors involved in T cell activation, HIV LTR transactivation, and gene expression. In conclusion, these findings demonstrate the use of Yodal as therapeutic agent for the reactivation of HIV in patients infected with HIV and the eradication of viral reservoirs for the ultimate cure of HIV infection.

[0210] All patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication were specifically and individually indicated to be incorporated by reference. It is to be understood that while a certain form of the invention is illustrated, it is not intended to be limited to the specific form or arrangement herein described and shown. It will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification. One skilled in the art will readily appreciate that the present invention is adapted to cany' out the objectives and obtain the ends and advantages mentioned, as well as those inherent therein. The methods, compositions, and / or treatments described herein are presently representative of the preferred embodiments, are intended to be exemplary and are not intended as limitations on the scope. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention. Although the invention has been described in connection with specific, preferred embodiments, it should be understood that the invention as ultimately claimed should not be unduly limited to such specific embodiments. Indeed various modifications of the described modes for carrying out the invention, which are obvious to those skilled in the art, are intended to be within the scope of the invention.

[0211] REFERENCES-LIST ONE

[0212] 1 Busman-Sahay, K., Starke, C. E., Nekorchuk, M. D. & Estes, J. D. Eliminating HIV reservoirs for a cure: the issue is in the tissue. Current Opinion in HIV and AIDS 16 (2021).

[0213] 2 Lopes, J. R., Chiba, D. E. & Dos Santos. J. L. HIV latency reversal agents: A potential path for functional cure? Eur J Med Chem 213, 113213 (2021). https : / / doi. org: 10. 1016 / j . ej mech.2021.113213

[0214] 3 Marsden. M. D. et al. In vivo activation of latent HIV with a synthetic br ostatin analog effects both latent cell "kick" and "kill" in strategy' for virus eradication. PLOS Pathogens 13, el006575 (2017). https: / / doi.org: 10.1371 / joumal.ppat. l006575

[0215] 4 Rosas-Umbert, M. et al. In vivo Effects of Romidepsin on T-Cell Activation, Apoptosis and Function in the BCN02 HIV-1 Kick&Kill Clinical Trial. Frontiers in Immunology' 11 (2020). https: / / doi.org: 10.3389 / fimmu.2020.00418

[0216] 5 Thorlund, K., Horwitz, M. S., Fife, B. T., Lester, R. & Cameron, D. W. Landscape review of current HIV ‘kick and kill’ cure research - some kicking, not enough killing. BMC Infectious Diseases 17, 595 (2017). https: / / doi.org: 10.1186 / sl2879-017-2683-3

[0217] 6 Coste, B. et al. PIEZO 1 and PIEZO2 are essential components of distinct mechanically activated cation channels. Science 330, 55-60 (2010). https: / / doi.org: 10. 1126 / science. 1193270

[0218] 7 Qin, L. et al. Roles of mechanosensitive channel PIEZO 1 / 2 proteins in skeleton and other tissues. Bone Res 9, 44 (2021). https: / / doi.orgT0.1038 / s41413-021-00168-8

[0219] 8 Vig, M. & Kinet, J. P. Calcium signaling in immune cells. Nat Immunol 10, 21-27 (2009). https: / / doi.org: 10. 1038 / ni.f.220

[0220] 9 Huang, K. P. The mechanism of protein kinase C activation. Trends Neurosci 12, 425- 432 (1989). https: / / doi.org: 10. 1016 / 0166-2236(89)90091-x

[0221] 10 Ishiguro, K. et al. Ca2+ / calmodulin-dependent protein kinase II is a modulator of CARMA1 -mediated NF-kappaB activation. Mol Cell Biol 26, 5497-5508 (2006). https: / / doi.org: 10. 1128 / mcb.02469-05

[0222] 11 Park, Y.-J., Yoo, S.-A., Kim, M. & Kim, W.-U. The Role of Calcium-Calcineurin- NFAT Signaling Pathway in Health and Autoimmune Diseases. Frontiers in Immunology 11 (2020). https : / / doi . org: 10.3389 / fimmu.2020.00195

[0223] 12 Nash, P. D., Opas, M. & Michalak, M. Calreticulin: not just another calcium-binding protein. Molecular and Cellular Biochemistry 135, 71-78 (1994). https: / / doi.org: 10. 1007 / BF00925962

[0224] 13 Donato, R. et al. Functions of S100 proteins. Curr Mol Med 13, 24-57 (2013). 14 Romanchikova, N. et al. NF AT transcription factors control HIV-1 expression through a binding site dow nstream of TAR region. Immunobiology 208, 361-365 (2003). https : / / doi. org: 10.1078 / 0171 -2985-00283

[0225] 15 Acchioni, C. et al. Alternate NF-kappaB-lndependent Signaling Reactivation of Latent HIV-1 Provirus. J Virol 93 (2019). https: / / doi.org:10.1128 / JVI.00495-19

[0226] 16 Sheng, M., Thompson, M. A. & Greenberg, M. E. CREB: a Ca(2+)-regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science 252, 1427-1430 (1991). https : / / doi . org: 10.1126 / science. 1646483

[0227] 17 Wegner, M., Cao, Z. & Rosenfeld, M. G. Calcium-regulated phosphory lation within the leucine zipper of C / EBP beta. Science 256, 370-373 (1992). https: / / doi.org: 10. 1126 / science.256.5055.370

[0228] 18 Schwartz, C. et al. Functional interactions between C / EBP, Spl, and COUP-TF regulate human immunodeficiency virus type 1 gene transcription in human brain cells. J Virol 74, 65-73 (2000). https: / / doi.org: 10. 1128 / j vi.74.1.65-73.2000

[0229] 19 Ross, H. L. et al. HIV-1 LTR C / EBP binding site sequence configurations preferentially encountered in brain lead to enhanced C / EBP factor binding and increased LTR-specific activity. J Neurovirol 7, 235-249 (2001). https: / / doi.org: 10. 1080 / 13550280152403281

[0230] 20 Henderson, A. J., Connor, R. I. & Calame, K. L. C / EBP activators are required for HIV- 1 replication and proviral induction in monocytic cell lines. Immunity 5, 91-101 (1996). https: / / doi.org: 10. 1016 / s 1074-7613(00)80313-1

[0231] 21 Bosque, A. & Planelles, V. Induction of HIV- 1 latency and reactivation in primary memory' CD4+ T cells. Blood 113, 58-65 (2009). https: / / doi.org: 10.1182 / blood-2008-07-168393

[0232] 22 Syeda, R. et al. Chemical activation of the mechanotransduction channel PIEZO 1. eLife 4, e07369 (2015). https: / / doi.org: 10.7554 / eLife.07369

[0233] 23 Hope, J. M., Lopez-Cavestany, M., Wang, W., Reinhart-King, C. A. & King, M. R. Activation of PIEZO1 sensitizes cells to TRAIL-mediated apoptosis through mitochondrial outer membrane permeability. Cell Death Dis 10, 837 (2019). https: / / doi.org: 10. 1038 / s41419- 019-2063-6

[0234] 24 Choi, D. et al. PIEZO 1 -Regulated Mechanotransduction Controls Flow- Activated Lymphatic Expansion. Circ Res 131, e2-e21 (2022). https: / / doi.org: 10. 1161 / CIRCRESAHA.121.320565

[0235] 25 Ait-Ammar, Amina, et al. Current Status of Latency Reversing Agents Facing the Heterogeneity of HIV-1 Cellular and Tissue Reservoirs. Review-Frontiers in Microbiology’ 10:Article 3060 (2020). doi. 10.3389 / fmicb.2019.03060

[0236] 26 HIV Overview. Factsheet: What is a Latent HIV Reservoir? National Institute of Allergy7and Infectious Diseases; accessed from the internet on February 9, 2024.

[0237] 27 Bae, C. et al. The Mechanosensitive Ion Channel PIEZO 1 Is Inhibited by the Peptide GsMTx4. Biochemistry. 50 (29):6295- 6300 (2011). doi: 10.1021 / bi200770q 28 Kim, Y. et al. Getting the "Kill" into "Shock and Kill": Strategies to Eliminate Latent HIV. Cell Host & Microbe. 23: 14-26 (2018). doi: 10. 106 / j.chom.2017. 12.004

[0238] 29 Citation: Scientists discover the basics of how pressure-sensing Piezo proteins work (2019, August 21) retrieved 17 April 2024 from https: / / phys.org / news / 2019-08-scientists- basicspressure-sensing-piezo-proteins.html

[0239] 30 Parsonage, G. et al. Improved PIEZO1 agonism through 4-benzoic acid modification of Yodal. Br. J. Pharmacol. 180:2039-2063 (2023). doi: 10.1111 / bph. 15996

[0240] REFERENCES-LIST TWO FOR EXAMPLE TWO

[0241] 1 HIV data and statistics, <https: / / www.who.int / teams / global-hiv-hepatitis-and-stis- programmes / hiv / strategic-information / hiv-data-and-statistics> [consulted: 03 / 2025]

[0242] 2 Sabin, C. A. Do people with HIV infection have a normal life expectancy in the era of combination antiretroviral therapy? BMC Med 11. 251 (2013). https: / / doi.org / 10. ! 186 / 1741- 7015-11-251

[0243] 3 Do, N. T. et al. Psychosocial factors affecting medication adherence among HIV-1 infected adults receiving combination antiretroviral therapy (cART) in Botsw ana. AIDS Res Hum Retroviruses 26, 685-691 (2010). https: / / doi.org / 10.1089 / aid.2009.0222

[0244] 4 Wohl, D. A. et al. Financial Barriers and Lapses in Treatment and Care of HIV-Infected Adults in a Southern State in the United States. AIDS Patient Care STDS 31, 463-469 (2017). https: / / doi.org / ! 0. 1089 / apc.2017.0125

[0245] 5 Quinn, K. G. & Voisin, D. R. ART Adherence Among Men Who Have Sex with Men Living with HIV: Key Challenges and Opportunities. Curr HIV'AIDS Rep 17, 290-300 (2020). https : / / doi. org / 10.1007 / s 11904-020-00510-5

[0246] 6 Tram, K. H., Ratevosian, J. & Beyrer, C. By executive order: The likely deadly consequences associated with a 90-day pause in PEPFAR funding. Journal of the International AIDS Society 28, e26431 (2025). https: / / doi.Org / https: / / doi.org / 10.1002 / jia2.26431

[0247] 7 Gandhi, A. R. et al. Potential Clinical and Economic Impacts of Cutbacks in the President’s Emergency Plan for AIDS Relief Program in South Africa. Annals of Internal Medicine (2025). https: / / doi.org / 10.7326 / ANNALS-24-01104

[0248] 8 Chen, J. et al. The reservoir of latent HIV. Front Cell Infect Microbiol 12, 945956 (2022). https: / / doi.org / 10.3389 / fcimb.2022.945956

[0249] 9 Li, K., Liu, B., Ma, R. & Zhang, Q. HIV Tissue Reservoirs: Current Advances in Research. AIDS Patient Care and STDs 37, 284-296 (2023). https: / / doi.org / 10.1089 / apc.2023.0028

[0250] 10 Board, N. L., Moskovljevic, M., Wu, F., Siliciano, R. F. & Siliciano, J. D. Engaging innate immunity in HIV-1 cure strategies. Nat Rev Immunol 22. 499-512 (2022). https: / / doi.org / 10.1038 / s41577-021-00649-l

[0251] 11 Kumar, A., Abbas, W. & Herbein, G. HIV-1 latency in monocytes / macrophages. Viruses 6, 1837-1860 (2014). https: / / doi.org / 10.3390 / v6041837 12 Hosmane, N. N. et al. Proliferation of latently infected CD4(+) T cells carry ing replication-competent HIV-1: Potential role in latent reservoir dynamics. J Exp Med 214, 959- 972 (2017). https: / / doi.org / 10.1084 / jem.20170193

[0252] 13 Ho, Y. C. et al. Replication-competent noninduced proviruses in the latent reservoir increase barrier to HIV-1 cure. Cell 155, 540-551 (2013). https : / / doi. org / 10. 1016 / j . cell.2013.09.020

[0253] 14 Bruner, K. M. et al. A quantitative approach for measuring the reservoir of latent HIV-1 proviruses. Nature 566, 120-125 (2019). https: / / doi.org / 10.1038 / s41586-019-0898-8

[0254] 15 Chomont, N. et al. HIV reservoir size and persistence are driven by T cell survival and homeostatic proliferation. Nat Med 15, 893-900 (2009). https: / / doi.org / 10.1038 / nm.1972

[0255] 16 Chun, T. W., Davey, R. T., Jr., Engel, D., Lane, H. C. & Fauci, A. S. Re-emergence of HIV after stopping therapy. Nature 401. 874-875 (1999). https: / / doi.org / 10.1038 / 44755

[0256] 17 Cohn, L. B., Chomont, N. & Deeks, S. G. The Biology of the HIV-1 Latent Reservoir and Implications for Cure Strategies. Cell Host Microbe 27, 519-530 (2020). https: / / doi.Org / 10.1016 / j.chom.2020.03.014

[0257] 18 Rasmussen, T. A., Tolstrup, M. & Sogaard, O. S. Reversal of Latency as Part of a Cure for HIV-1. Trends Microbiol 24, 90-97 (2016). https: / / doi.Org / 10.1016 / j.tim.2015. l l .003

[0258] 19 Rasmussen, T. A. et al. Panobinostat, a histone deacetylase inhibitor, for latent-virus reactivation in HIV -infected patients on suppressive antiretroviral therapy: a phase 1 / 2, single group, clinical trial. Lancet HIV 1, el3-21 (2014). https: / / doi.org / 10.1016 / s2352- 3018(14)70014-1

[0259] 20 Rodari, A., Darcis, G. & Van Lint, C. M. The Current Status of Latency Reversing Agents for HIV-1 Remission. Annu Rev Virol 8, 491-514 (2021). https : / / doi. org / 10.1146 / annurev-virology-091919-103029

[0260] 21 Sogaard, O. S. et al. The Depsipeptide Romidepsin Reverses HIV-1 Latency In Vivo. PLoS Pathog 11, el005142 (2015). https: / / doi.org / 10.1371 / joumal.ppat.1005142

[0261] 22 Thorlund, K.. Horwitz. M. S., Fife, B. T., Lester, R. & Cameron, D. W. Landscape review of current HIV ‘kick and kill’ cure research - some kicking, not enough killing. BMC Infectious Diseases 17, 595 (2017). https: / / doi.org / 10.1186 / sl2879-017-2683-3

[0262] 23 Archin. N. M. et al. Administration of vorinostat disrupts HIV-1 latency in patients on antiretroviral therapy. Nature 487, 482-485 (2012). https: / / doi.org / 10.1038 / naturel l286

[0263] 24 Kwon, K. J. et al. Different human resting memory CD4(+) T cell subsets show similar low inducibility of latent HIV- 1 pro viruses. Set TranslMed 12 (2020). https: / / doi.org / 10.1126 / scitranslmed.aax6795

[0264] 25 Hughes, C. S. et al. Single-pot, solid-phase-enhanced sample preparation for proteomics experiments. Nat Protoc 14, 68-85 (2019). https: / / doi.org / 10.1038 / s41596-018-0082-x 26 Rappsilber, J., Mann, M. & Ishihama, Y. Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat Protoc 2, 1896- 1906 (2007). https: / / doi.org / 10.1038 / nprot.2007.261

[0265] 27 Demichev, V., Messner, C. B._ Vemardis, S. 1., Lilley, K. S. & Raiser, M. D1A-NN: neural networks and interference correction enable deep proteome coverage in high throughput. Nat Methods 17. 41-44 (2020). https: / / doi.org / 10.1038 / s41592-019-0638-x

[0266] 28 Schulte, F.. Hasturk, H. & Hardt, M. Mapping Relative Differences in Human Salivary Gland Secretions by Dried Saliva Spot Sampling and nanoLC-MS / MS. Proteomics 19, el900023 (2019). https: / / doi.org / 10.1002 / pmic.201900023

[0267] 29 Liu, C. S. C. et al. Cutting Edge: Piezol Mechanosensors Optimize Human T Cell Activation. J Immunol 200, 1255-1260 (2018). https: / / doi.org / 10.4049 / jimmunol.1701118

[0268] 30 Liu, C. S. C. et al. Piezol mechanosensing regulates integrin-dependent chemotactic migration in human T cells. Elife 12 (2024). https: / / doi.org / 10.7554 / eLife.91903

[0269] 31 Jairaman. A. et al. Piezol channels restrain regulatory T cells but are dispensable for effector CD4+ T cell responses. Science Advances 7, eabg5859 https: / / doi.org / 10.1126 / sciadv.abg5859

[0270] 32 Lopes, J. R., Chiba, D. E. & Dos Santos. J. L. HIV latency reversal agents: A potential path for functional cure? Eur J Med Chem 213, 113213 (2021). https: / / doi.org / 10. 1016 / j.ejmech.2021.113213

[0271] 33 Yang, Y. F. et al. Peptidylarginine deiminase 2 promotes T helper 17-like T cell activation and activated T cell-autonomous death (ACAD) through an endoplasmic reticulum stress and autophagy coupling mechanism. Cell Mol Biol Lett 27 , 19 (2022). https: / / doi.org / 10. 1186 / s 11658-022-00312-0

[0272] 34 Bae, C., Sachs, F. & Gottlieb, P. A. The mechanosensitive ion channel Piezol is inhibited by the peptide GsMTx4. Biochemistry 50, 6295-6300 (2011). https : / / doi. org / 10.1021 / bi200770q

[0273] 35 Jiang, G. et al. Reactivation of HIV latency by a newly modified Ingenol derivative via protein kinase C5-NF-KB signaling. Aids 28, 1555-1566 (2014). https : / / doi. org / 10.1097 / qad.0000000000000289

[0274] 36 Jarboui, M. A.. Wynne, K., Elia. G.. Hall, W. W. & Gautier, V. W. Proteomic profiling of the human T-cell nucleolus. Mol Immunol 49, 441-452 (2011). https : / / doi. org / 10. 1016 / j . molimm.2011.09.005

[0275] 37 Kleinman, C. L. et al. HIV-1 infection causes a down-regulation of genes involved in ribosome biogenesis. PLoS One 9, el 13908 (2014). https: / / doi.org / 10.1371 / joumal.pone.0113908

[0276] 38 Acchioni, C. et al. Alternate NF-kappaB-Independent Signaling Reactivation of Latent HIV-1 Provirus. J Virol 93 (2019). https: / / doi.org / 10.1128 / JVI.00495-19

[0277] 39 Bosque, A. & Planelles, V. Induction of HIV-1 latency and reactivation in primary memory CD4+ T cells. Blood 113, 58-65 (2009). https: / / doi.org / 10.1182 / blood-2008-07-168393 40 Pache, L. et al. Pharmacological Activation of Non-canonical NF-kappaB Signaling Activates Latent HIV-1 Reservoirs In Vivo. Cell Rep Med 1, 100037 (2020). https: / / doi.Org / 10.1016 / j.xcrm.2020.100037

[0278] 41 Allen, C. E., Mak, C.-h. & Wu, L.-C. The KB transcriptional enhancer motif and signal sequences of V(D)J recombination are targets for the zinc finger protein HIVEP3 / KRC: a site selection amplification binding study. BMC Immunology 3, 10 (2002). https : / / doi. org / 10. 1186 / 1471 -2172-3- 10

[0279] 42 Kimura, M. Y. et al. Schmirri-2 controls memory Thl and Th2 cell numbers in vivo. J Immunol 178, 4926-4936 (2007). https: / / doi.Org / 10.4049 / jimmunol.178.8.4926

[0280] 43 Marsden, M. D. et al. In vivo activation of latent HIV with a synthetic bryostatin analog effects both latent cell "kick" and "kill" in strategy for virus eradication. PLOS Pathogens 13, el006575 (2017). https: / / doi.org / 10.1371 / joumal.ppat.1006575

[0281] 44 Rosas-Umbert, M. et al. In vivo Effects of Romidepsin on T-Cell Activation, Apoptosis and Function in the BCN02 HIV-1 Kick&Kill Clinical Trial. Frontiers in Immunology 11 (2020). https : / / doi . org / 10.3389 / fimmu.2020.00418

[0282] 45 Kim, Y., Anderson, J. L. & Lewin, S. R. Getting the "Kill" into "Shock and Kill": Strategies to Eliminate Latent HIV. Cell Host Microbe 23, 14-26 (2018). https: / / doi.Org / 10.1016 / j.chom.2017.12.004

[0283] 46 Carlin, E. et al. Extensive proteomic and transcriptomic changes quench the TCR / CD3 activation signal of latently HIV-1 infected T cells. PLoS Pathog 17, el008748 (2021). https: / / doi.org / 10.1371 / joumal.ppat.1008748

[0284] 47 Rezaei, S. D. et al. The Pathway To Establishing HIV Latency Is Critical to How Latency Is Maintained and Reversed. J Virol 92 (2018). https: / / doi.org / 10.1128 / jvi.02225-17

[0285] 48 Modai, S. et al. HIV-1 infection increases microRNAs that inhibit Dicerl, HRB and HIV-EP2, thereby reducing viral replication. PLoS One 14, e02111 11 (2019). https: / / doi.org / 10.1371 / joumal.pone.0211111

[0286] 49 Pollara, J. et al. Redirection of Cord Blood T Cells and Natural Killer Cells for Elimination of Autologous HIV- 1 -Infected Target Cells Using Bispecific DART® Molecules. Front Immunol 11, 713 (2020). https: / / doi.org / 10.3389 / fimmu.2020.00713

[0287] 50 Braud, V. M. et al. HLA-E binds to natural killer cell receptors CD94 / NKG2A, B and C. Nature 391, 795-799 (1998). https: / / doi.org / 10.1038 / 35869

[0288] 51 Rolle, A. et al. IL-12-producing monocytes and HLA-E control HCMV-driven NKG2C+ NK cell expansion. J Clin Invest 124, 5305-5316 (2014). https: / / doi.org / 10.1172 / jci77440

[0289] 52 Pollara, J. et al. High-throughput quantitative analysis of HIV- 1 and SIV-specific ADCC-mediating antibody responses. Cytometry A 79, 603-612 (2011). https: / / doi.Org / 10.1002 / cyto.a.21084

[0290] 53 Forthal, D. N. & Finzi, A. Antibody-dependent cellular cytotoxicity in HIV infection.

[0291] Aids 32, 2439-2451 (2018). https: / / doi.org / 10.1097 / qad.0000000000002011 54 Haider, S. & Pal, R. Integrated analysis of transcriptomic and proteomic data. Curr Genomics 14, 91-1 10 (2013). https: / / doi.org / 10.2174 / 1389202911314020003

[0292] 55 Gunawardana, Y. & Niranjan, M. Bridging the gap between transcriptome and proteome measurements identifies post-translationally regulated genes. Bioinformatics 29, 3060-3066 (2013). https : / / doi. org / 10.1093 / bioinformatics / btt537

[0293] 56 Baratchi, S. et al. Piezol expression in neutrophils regulates shear-induced NETosis. Nat Commun 15, 7023 (2024). https: / / doi.org / 10.1038 / s41467-024-51211-l

[0294] 57 Love, L. et al. PADI4-mediated citrullination of histone H3 stimulates HIV-1 transcription. bioRxiv. 2024.2003.2017.583304 (2024). https : / / doi . org / 10. 1101 / 2024.03.17.583304

[0295] 58 Savage, S. R. & Zhang, B. Using phosphoproteomics data to understand cellular signaling: a comprehensive guide to bioinformatics resources. Clinical Proteomics 17, 27 (2020). https : / / doi . org / 10. 1186 / s 12014-020-09290-x

[0296] 59 Sancho, J., Franco, R., Chatila, T., Hall, C. & Terhorst, C. The T cell receptor associated CD3-epsilon protein is phosphorylated upon T cell activation in the two tyrosine residues of a conserved signal transduction motif. Eur J Immunol 23, 1636-1642 (1993). https: / / doi.org / 10.1002 / eji.1830230736

[0297] 60 Busman-Sahay, K., Starke. C. E., Nekorchuk, M. D. & Estes, J. D. Eliminating HIV reservoirs for a cure: the issue is in the tissue. Current Opinion in HIV and AIDS 16 (2021).

[0298] 61 Qin, L. et al. Roles of mechanosensitive channel Piezol / 2 proteins in skeleton and other tissues. Bone Research 9, 44 (2021). https: / / doi.org / 10.1038 / s41413-021-00168-8

[0299] 62 Parsonage, G. et al. Improved PIEZO 1 agonism through 4-benzoic acid modification of Yodal. Br J Pharmacol 180, 2039-2063 (2023). https: / / doi.org / 10. l l l l / bph.15996

[0300] 63 Wang, Y. et al. A lever-like transduction pathway for long-distance chemical- and mechano-gating of the mechanosensitive Piezol channel. Nature Communications 9, 1300 (2018). https : / / doi . org / 10. 1038 / s41467-018-03570-9

[0301] 64 Board, N. L. et al. Bispecific antibodies promote natural killer cell-mediated elimination of HIV-1 reservoir cells. Nat Immunol 25, 462-470 (2024). https: / / doi.org / 10.1038 / s41590-023- 01741-5

[0302] 65 Fisher, L. et al. Vaccine-Induced Antibodies Mediate Higher Antibody-Dependent Cellular Cytotoxicity After Interleukin- 15 Pretreatment of Natural Killer Effector Cells. Front Immunol 10, 2741 (2019). https: / / doi.org / 10.3389 / fimmu.2019.02741

[0303] 66 Choi. D. et al. Piezol -Regulated Mechanotransduction Controls Flow- Activated Lymphatic Expansion. Circ Res 131, e2-e21 (2022). https : / / doi. org / 10. 1161 / CIRCRES AHA. 121.320565

Claims

The ClaimsWhat is claimed is:

1. A method for activating a PIEZO protein in cells positive for expression of the PIEZO protein, the method comprising: providing an activator of the PIEZO protein: and administrating the activator of the PIEZO protein to the cells, thereby activating the PIEZO protein in the cells.

2. The method according to Claim 1, wherein the PIEZO protein is PIEZO 1 or PIEZO2.

3. The method according to Claim 1, wherein the activator of the PIEZO protein is a PIEZO agonist.

4. The method according to Claim 3, wherein the PIEZO agonist is at least one of Yodal, Yoda2, KC159, Jedil, and Jedi2.

5. A method for treating a disease in a subject in need thereof, the method comprising: providing a therapeutically effective amount of a PIEZO activator; and administering the therapeutically effective amount of the PIEZO activator to the subject, thereby treating the disease in the subject.

6. The method according to Claim 5, wherein the disease is an active HIV infection or a latent HIV infection.

7. The method according to Claim 5, wherein the therapeutically effective amount of the PIEZO activator is in combination with at least one pharmaceutically acceptable carrier.

8. The method according to Claim 5, wherein the PIEZO activator is a PIEZO agonist.

9. The method according to Claim 8, wherein the PIEZO agonist is at least one of Yodal. Yoda2, KC159, Jedil, and Jedi2.

10. A method for reactivating human immunodeficiency virus type-1 (HIV-1) in cells harboring latent HIV-1, the method comprising:providing a latency reversal agent (LRA); and administering the latency reversal agent to the cells, thereby reactivating the latent HIV-1 in the cells.

11. The method according to Claim 10, wherein the cells are positive for expression of PIEZO 1.

12. The method according to Claim 10, wherein the latency reversal agent is a PIEZO-type mechanosensitive ion channel component 1 (PIEZO 1) agonist.

13. The method according to Claim 12, wherein the PIEZO 1 agonist is Yodal.

14. A method for reactivating a reservoir of latent HIV-1 in a subject having an HIV-1 infection, the method comprising: providing an effective amount of a latency reversal agent (LRA); and administering the effective amount of the latency reversal agent to the subject, thereby reactivating the reservoir of latent HIV-1.

15. The method according to Claim 14, wherein the effective amount of a latency reversal agent is in combination with at least one pharmaceutically acceptable carrier.

16. The method according to Claim 14, wherein the latency reversal agent is a PIEZO1 agonist.

17. The method according to Claim 16, wherein the PIEZO1 agonist is Yodal.

18. A method for treating a latent HIV-1 infection in a subject in need thereof, the method comprising: providing a therapeutically effective amount of a latency reversal agent (LRA); and administering the therapeutically effective amount of the latency reversal agent to the subject, thereby reactivating latent HIV-1 in the subject such that cells of the subject harboring the latent HIV-1 are exposed for elimination.

19. The method according to Claim 18, wherein the therapeutically effective amount of a latency reversal agent is in combination with at least one pharmaceutically acceptable carrier.

20. The method according to Claim 19, wherein the latency reversal agent is a PIEZO 1 agonist.

21. The method according to Claim 20, wherein the PIEZO 1 agonist is Y odal .

22. The method according to Claim 19, further comprising administering a therapeutically effective amount of an antiretroviral composition to the subject concurrently with or subsequent to administering the therapeutically effective amount of the latency reversal agent.

23. The method according to Claim 22, wherein the antiretroviral composition is at least one of emtricitabine, tenofovir alafenamide, and bictegravir.

24. A method for reducing or eliminating a need for long term antiretroviral therapy (ART) in a subject having a latent HIV-1 infection, the method comprising: providing a therapeutically effective amount of a latency reversal agent (LRA); and administering the therapeutically effective amount of the latency reversal agent to the subject, thereby reactivating latent HIV-1 in the subject such that cells of the subject harboring the latent HIV-1 are exposed for elimination.

25. The method according to Claim 24, wherein the therapeutically effective amount of a latency reversal agent is in combination with at least one pharmaceutically acceptable carrier.

26. The method according to Claim 24, wherein the latency reversal agent is a PIEZO 1 agonist.

27. The method according to Claim 26, wherein the PIEZO I agonist is Yodal.

28. The method according to Claim 24, further comprising administering a therapeutically effective amount of an antiretroviral composition to the subject concurrently with or subsequent to administering the therapeutically effective amount of the latency reversal agent.

29. The method according to Claim 28, wherein the antiretroviral composition is at least one of emtricitabine, tenofovir alafenamide, and bictegravir.

30. A method for treating a latent HIV-1 infection in a subject in need thereof, the method comprising: providing a therapeutically effective amount ofYodal; and administering the therapeutically effective amount ofYodal to the subject, thereby reactivating latent HIV-1 in the subject such that cells of the subject harboring the latent HIV-1 are exposed for elimination.

31. The method according to Claim 30, wherein the therapeutically effective amount of Yodal is in combination with at least one pharmaceutically acceptable carrier.

32. The method according to Claim 30, further comprising administering a therapeutically effective amount of an antiretroviral composition to the subject concurrently with or subsequent to administering the therapeutically effective amount ofYodal.

33. The method according to Claim 32, wherein the antiretroviral composition is at least one of emtricitabine, tenofovir alafenamide, and bictegravir.

34. A kit comprising Yodal and at least one pharmaceutically acceptable earner.

35. The kit according to Claim 34, further comprising at least one antiretroviral composition.

36. The kit according to Claim 35. wherein the antiretroviral composition is at least one of emtricitabine, tenofovir alafenamide, and bictegravir.

37. A kit comprising Yodal, at least one pharmaceutically acceptable carrier, and at least one antiretroviral composition.

38. The kit according to Claim 37, wherein the antiretroviral composition is at least one of emtricitabine, tenofovir alafenamide, and bictegravir.

39. A method for activating a PIEZO protein in cells positive for expression of the PIEZO protein, the method comprising: providing an activator of the PIEZO protein; and administrating the activator of the PIEZO protein to the cells, thereby activating the PIEZO protein in the cells.

40. An activator of a PIEZO protein suitable for activating the PIEZO protein in cells positive for expression of the PIEZO protein.

41. The activator according to Claim 40. wherein the PIEZO protein is PIEZO 1 or P1EZO2.

42. The activator according to Claim 40, wherein the activator of the PIEZO protein is a PIEZO agonist.

43. The activator according to Claim 42, wherein the PIEZO agonist is at least one of Yodal, Yoda2, KC159, Jedil, and Jedi2.

44. A therapeutically effective amount of a PIEZO activator suitable for treating a disease in a subject in need thereof, the disease responsive to a PIEZO activator.

45. The therapeutically effective amount of the PIEZO activator according to Claim 44, wherein the disease is an active HIV infection or a latent HIV infection.

46. The therapeutically effective amount of the PIEZO activator according to Claim 44, wherein the PIEZO activator is a PIEZO agonist.

47. The therapeutically effective amount of the PIEZO activator according to Claim 46, wherein the PIEZO agonist is one at least one of Yodal, Yoda2, KC159, Jedil, and Jedi2.

48. A therapeutically effective amount of a PIEZO activator in combination w ith at least one pharmaceutically acceptable carrier suitable for treating a disease in a subject in need thereof.

49. A latency reversal agent (LRA) suitable for reactivating human immunodeficiency virus type-1 (HIV-1) in cells harboring latent HIV-1.

50. The latency reversal agent (LRA) according to Claim 49, wherein the cells are positive for expression of PIEZO 1.

51. The latency reversal agent (LRA) according to Claim 49, wherein the LRA is a PIEZO- type mechanosensitive ion channel component 1 (PIEZO 1) agonist.

52. The latency reversal agent (LRA) according to Claim 51, wherein the PIEZO 1 agonist is Yodal.

53. An effective amount of a latency reversal agent (LRA) suitable for reactivating a reservoir of latent HIV-1 in a subject having an HIV-1 infection.

54. The effective amount of the latency reversal agent (LRA) according to Claim 53, wherein the latency reversal agent is a PIEZO 1 agonist.

55. The effective amount of the latency reversal agent (LRA) according to Claim 54, wherein the PIEZO 1 agonist is Yodal.

56. An effective amount of a latency reversal agent (LRA) in combination with at least one pharmaceutically acceptable carrier suitable for reactivating a reservoir of latent HIV-1 in a subject having an HIV-1 infection.

57. A therapeutically effective amount of a latency reversal agent (LRA) suitable for reactivating latent HIV-1 in a subject such that cells of the subject harboring a latent HIV-1 are exposed for elimination.

58. The therapeutically effective amount of a latency reversal agent (LRA) according to Claim 57, wherein the latency reversal agent is a PIEZO 1 agonist.

59. The therapeutically effective amount of a latency reversal agent (LRA) according to Claim 58, wherein the PIEZO 1 agonist is Yodal.

60. A therapeutically effective amount of a latency reversal agent (LRA) in combination with at least one pharmaceutically acceptable carrier suitable for reactivating latent HIV-1 in a subject such that cells of the subject harboring a latent HIV-1 are exposed for elimination.

61. A therapeutically effective amount of a latency reversal agent (LRA) in combination with at least one pharmaceutically acceptable carrier and a therapeutically effective amount of an antiretroviral composition suitable for reactivating latent HIV-1 in a subject such that cells of the subject harboring a latent HIV-1 are exposed for elimination.

62. The therapeutically effective amount of a latency reversal agent according to Claim 61. wherein the antiretroviral composition is at least one of emtricitabine, tenofovir alafenamide, and bictegravir.

63. A therapeutically effective amount of a latency reversal agent (LRA) suitable for reducing or eliminating a need for long term antiretroviral therapy (ART) in a subject having a latent HIV-1 infection.

64. The therapeutically effective amount of the latency reversal agent (LRA) according to Claim 63, wherein the latency reversal agent is a PIEZO 1 agonist.

65. The therapeutically effective amount of the latency reversal agent (LRA) according to Claim 64, wherein the PIEZO 1 agonist is Yodal.

66. A therapeutically effective amount of a latency reversal agent (LRA) in combination with at least one pharmaceutically acceptable carrier suitable for suitable for reducing or eliminating a need for long term antiretroviral therapy (ART) in a subject having a latent HIV-1 infection.

67. A therapeutically effective amount of a latency reversal agent (LRA) in combination with at least one pharmaceutically acceptable carrier and a therapeutically effective amount of an antiretroviral composition suitable for reducing or eliminating a need for long term antiretroviral therapy (ART) in a subject having a latent HIV-1 infection.

68. The therapeutically effective amount of a latency reversal agent according to Claim 67, wherein the antiretroviral composition is at least one of emtricitabine, tenofovir alafenamide, and bictegravir.

Images