Modulation of cell activity

Abstract

The invention relates to medicine, biology, veterinary, pharmacology diagnostics, agriculture, ecology, meterology, seismology, construction biotechnology, biomanufacturing and provided herein are products and methods for managing cells behavior, memory of cells and erasure of cell memory. The present invention describes products and methods that, unlike the known ones, make it possible by treating them with an RNase, a DNase, an antibody that binds to an RNA and / or DNA and / or a molecule with nuclease activity to control the properties of cells and organisms without the use of mutagens and / or the special introduction of genes and / or use of specific gene tools and / or changing its environmental conditions.

Description

MODULATION OF CELL ACTIVITYFIELD OF THE INVENTION

[0001] The invention relates to medicine, biology, veterinary, pharmacology diagnostics, agriculture, ecology, meteorology, seismology, construction, biotechnology, biomanufacturing and provided herein are products and methods for managing cells behavior, memory of cells and erasure of cell memory.BACKGROUND OF THE INVENTION

[0002] There are a limited number of methods that are available to modulate and affect the fundamental properties and function of a cell, including the cell’s specific and non-specific activity and function. Currently, a method of stimulate and affect the fundamental properties of a cell including stimulation with one or more growth factors or cytokines.

[0003] Herein is described a new method of affecting a cell’s function and properties using a nuclease, an antibody that binds a DNA or an RNA or a molecule with nuclease activities. Through this process, a cell can be affected or stimulated to produce bioproducts, enhance an immune response, reduce or resolve a cancer or other function of a cells. The present invention for the first time describes treated cells that provide for new products and methods that, unlike those currently known, can activate and regulate cellularactivity through the interaction with extracellular membrane-like structures produced by these cells following the treatment with one or more nucleases or molecules with nuclease activity.SUMMARY OF THE INVENTION

[0004] In an aspect, the invention is for a method of treating a patient suffering from an autoimmune disease, wherein cells taken from the patient are treated with one or more rounds of one or more of a DNase, an RNase, an anti-DNA antibody and an anti-RNA antibody and reintroduced into the patient, wherein the autoimmune disease is diabetes and the diabetes is type 1 diabetes or type 2 diabetes.

[0005] In another aspect, the method is for a treatment of diabetes that comprises administering to the patient treated cells selected from one or more of a Mesenchymal stem cell (MST), an induced pluripotent stem cell (iPSC), and a primary fibroblasts (FB) and wherein the treated cells are injected into the patient at a dose of about 106- 107treated cells / injection, once a week for up to 3 months and the the treated cells activate the NLRP3 infammasome.

[0006] In a further aspect, the method is for a treatment of a cell to reduce or prevent the progression of the autoimmune disease wherein the treated cell is treated with with multiple rounds of one or more of a DNase, an RNase, an anti-DNA antibody and an anti-RNA antibody and reintroduced into the patient erases autoimmune memory.

[0007] In an aspect, the method comprises treating a cell with eight cycles with one or more of a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity that are reintroduced into the patient and further wherein the treatment of the autoimmune disease clears a misfolded, prionogenic protein.

[0008] In a further aspect of the invention, the method is for a treatment that results in a reduced level of autoantibodies as compared to the level prior to the treatment.

[0009] In an aspect, the method comprises treated cells that are autologous treated cells, and further wherein, the treated cells are allogeneic treated cells.

[0010] In an aspect of the invention, the method of claim is to treat an autoimmune disease, including a gastrointestinal disease, a disease of the skin, a neurodegenerative disease, multiple sclerosis, systemic lupus erythematosus, amyotrophic lateral sclerosis, inflammatory bowel disease, focal segmental glomerulosclerosis, ANCA-associated vasculitis (AAV), immune-mediated inflammatory diseases (IMIDs),ankylosing spondylitis, gout, epilepsy, diabetes, psoriasis and autoimmune disorder affecting the thyroid gland.

[0011] In an aspect, the method comprises administering one or both of methotrexate and a corticosteroid.

[0012] In a further aspect, the method comprises administering to a patient a physical therapy in conjunction with the treatment with the treated cells, and further wherein, the cells are selected from fibroblasts, platelets, hematopoietic stem cells, red blood cells, white blood cells, leucocytes, lymphocytes, CD34+ cells, neurons, and cells of a microglia, and further wherein the lymphocyte is one or more of a T-cells, a B-cell, an NK cell, a neutrophil, an eosinophil, a monocyte, a basophil, a macrophage or a plasma cell.

[0013] In an aspect, the method is for the treatment of a cell that is treated prior to, during or after treatment with one or more rounds of one or more of a DNase, an RNase, an anti-DNA antibody and an anti-RNA antibody and reintroduced into the patient, with a microbial cell, a virus or components of a microbial cell or virus, a eukaryotic cell, a tumor cell, a tissue or a mitogen.

[0014] In an aspect of the invention, the method reduces a symptom of an autoimmune disease by about 10% to 80%.

[0015] In an aspect, a vaccine is comprised of a nucleic acid associated with a cell surface membrane, wherein, the nucleic acid is comprised of a non-coding genetic segment or genetic segments that are derived from a cell that is treated with an RNase, DNase or both.

[0016] In an aspect, the genetic segment is a nucleic acid.

[0017] In an aspect, the genetic segment or genetic segments have prion like activity.

[0018] In another aspect, the nucleic acid is prepared from a bacterial DNA or RNA.

[0019] In an aspect, the bacterial DNA or RNA is capable of triggering prionogenic aggregation of proteins.

[0020] In an aspect, the vaccine is prepared from DNA or RNA gram-negative bacteria.

[0021] In an aspect, the gram-negative bacteria is selected from the genera Pseudomonas.

[0022] In an aspect, the genetic segment or genetic segments are prepared from a fungal DNA or RNA.

[0023] In an aspect, the vaccine extends the lifetime of the organism to which the vaccine is administered.

[0024] In an aspect, the genetic segment or genetic segments consist of extracellular DNA or RNA.

[0025] In an aspect, the extracellular DNA or RNA does not penetrate the cell and acts as an antigen.

[0026] In an aspect, the genetic segment or genetic segments comprise microbial DNA or RNA.

[0027] In an aspect, the genetic segment or genetic segments comprise fungal DNA or RNA.

[0028] In a further aspect, the vaccine further comprises an adjuvant.

[0029] In an aspect, the vaccine is capable of being administered to a patient one or more times.

[0030] In an aspect, the non-coding sequences comprise extracellular DNA or RNA.

[0031] In another aspect, the vaccine further comprises cells that have been previously treated with an RNase, a DNase or both.

[0032] In an aspect, the cells comprise treated bacterial or fungal cells.

[0033] In an aspect, vaccine further comprises one or more of SL-4C, FB-C, SL4T and FB-T.

[0034] In an aspect, the bacterial DNA or RNA is derived from one or more of Staphyloccous aureus, Staphylococcus aureus MRSA, Bacillus pumilus, Enterococcus faecalis, Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Candida albicans, Aspergillus niger, Salmonella, Lactococcocaea, Clostridiaceae, or Mycobacterium smegmatis.

[0035] In another aspect, the fungal DNA or RNA is derived from Aspergillus.

[0036] In a further aspect, a method comprises stimulating production of a biomolecule by a cell following treatment of the cell with with one or more rounds of one or more of a DNase, an RNase, an anti-DNA antibody and an anti-RNA antibody, and wherein the cell is a prokaryotic cell, a yeast cell, a protozoa, a reptilian cell, a multicellular organism, an insect cell or a mammalian cell and wherein the cell is cultured in vitro.

[0037] In an aspect, the cells are treated with one more or more rounds of one or more rounds of one or more of a DNase, an RNase, an anti-DNA antibody and an anti-RNA antibody.

[0038] In another aspect, the method following treatment of a cell, the cell produces more of a biomolecule.

[0039] In a further aspect, the cell is used to manufacture a biomolecule for the food industry.

[0040] In a further aspect, the biomolecule is selected from chymosin, a biomolecule therapeutic, an antibiotic, an enzyme, a vitamin, a peptide or an amino acid and further wherein, the biomolecule is selected from an antibody, a cytokine, a growth factor, a viral vector, an antigen, a vaccine, a complex engineered antibody, a trivalent T-cell engager, a checkpoint modulator or inhibitor, a naive protein, a recombinant protein, a vitamin, a hormone, an antibody cytokine fusion, a biopharmaceuticals, a fusion protein; a clotting and coagulation factor; a TNF inhibitor; an Interferon, a recombinant antibody; an adeno associated virus, a virus, a receptor or a hormone.

[0041] In an aspect, the cell is a Chinese Hamster Ovary (CHO) cell, a human embryonic kidney (HEK) cell, S cerevisiae, Penicillum, or a hybridoma cell.

[0042] In another aspect, the treated cells are able to grow in one or more different concentrations comprising one or more of O2, CO2.

[0043] In an aspect, the treated cells are able to resist variations of one or more of temperature, UV environment or proteases.

[0044] In another aspect the treated cells are used to manufacture food for livestock, and further wherein, the livestock comprise one or more of a cow, a sheep, a goat, a llama, an alpaca, a horse or a pig

[0045] In a further aspect, the treated cells are used in a fermentation process to produce a food or a beverage and further wherein, the food or beverage is a cheese, a yogurt, a wine or a beer.

[0046] In an aspect, the treated cells are used to manufacture a material for the building industry, including a wood.

[0047] In an aspect, the treated cells produce a honey, a vegetable, a grain, a fruit, a mushroom or an herb.

[0048] In another aspect, treatment of a cell enhances production of a biomolecule.SUMMARY OF THE FIGURES

[0048] Figure 1 , titled Effect of treated cells and their Supernatant on solid tumors

[0049] Figure 2, titled Effect of treated cells and their Supernatant on solid tumors that shows the dynamics of tumor size growth after SL4-C / SL4-T and P-SL4-C / P-SL4-T treatment based.

[0050] Figure 3 SHOWS SL4-T i.v. allogeneic and autologous, weekly or daily, intermittent course, from 10A6 to 10A9 per injection.

[0051] Figure 4 shows SL4-T i.v. allogeneic and autologous, weekly or daily, intermittent course, from 10A6 to 10A9 per injection.

[0052] Figure 5. Comparison of pre- and post-therapy radiographic evaluation scans of the patient with lung adenocarcinoma during the therapeutic course of SL4-T. (A) Computed tomography (CT) scan of the patient before SL4-T therapy showing the tumor lesions in S6 (18.3 x 16.7 mm and 11 .9 x 8.2 mm) and S3 (6.5 x 5.1 mm) of the right lung. (B) CT scan after 24 days of SL4-T treatment showing reduction in S6 (18.1 x 16.7 mm and 11 .2 x 7.8 mm) and S3 (4.3 x 2.3 mm) lesions. (C) CT scan after 50 days of SL4-T showing partial response; one lesion in S6 disappeared, and the second lesion stabilized (11.1 x 7.1 mm), with further reduction in S3 (4 mm). (D) After 146 days of the therapy, tumor lesions in S6 and S3 disappeared, as confirmed using CT.

[0053] Figure 6 shows hematoxylin and eosin staining of samples at different disease stages. (A) Circulating tumor cells in pleural fluid at diagnosis showing the classic cytological pattern, including very large, polygonal cells with abundant granular cytoplasm and prominent nucleoli in large nuclei (magnification x200). (B) Tumor biopsy at the diagnosis showing typical gland-like formation and solid nests, characteristic of lung adenocarcinoma (magnification x200). (C) After three intrapleural injections of SL4-T, pleural fluid microscopy revealed the presence of red blood cells, neutrophils, and mucus, with no signs of tumor cells (magnification x200). (D) Biopsy of the right lung at 146 days of SL4- T therapy revealed mild fibrotic and scar-like changes, with alveolar septal thickening and post- therapeutic scarring

[0054] Figure 7 showed the decrease of the largest diameter is 34.0% with no new lesions, refers to Partial Response (PR) according to RECIST 1.1.

[0055] Figure 8 shows SL4-T i.v. allogeneic and autologous, Intravenous - Every 3 days from 10A6 to 10A9 per injection.

[0056] Figure 9 shows SL4-T i.v. allogeneic and autologous, Intravenous - Every 3 days; from 10A6 to 10A9 per injection.

[0057] Figure 10 shows a comparison of pre- and post-therapy MRI scans demonstrating liver metastases from pancreatic cancer. (A, B) Baseline MRI shows multiple hepatic lesions (A) in the liver parenchema (3.3 cm, 2.7 cm, and 1 .3 cm), and (B) in segments S4 and S7 (1 .9 x 2.2 cm and 2.0 x 2.4 cm). (C, D) MRI after 74 days of SL4-T therapy shows (C) disappearance of two lesions in the liver parenchema, the reduction of the remaining lesion (from 3.3 to 1 .3 cm) and (D) and significant reduction in remaining lesions in S4 / 7 (1.3 x 1 .1 cm; 2.0 x 1 .1 cm).

[0058] Figure 11 shows an in vitro virucidal activity of SL4-T (Figure below)

[0059] Figure 12 shows the effect of cell treatment on Qp.

[0060] Figure 13 shows the formation of Guttation Droplets with antibiotic on the Surface of Fungal Colonies.

[0061] Figure 14 shows the effect of cell treatment on the production of proteins.

[0062] Figure 15 shows mice that were either left untreated or treated (controi #1) with SL4-C (Mockcontrol #2) or SL4-T (experimental group). SL4-T cells were obtained as previously described. SL4-T and SL4-C were administered to the mice once a week at concentrations ranging from 10A3 to 10A7 cells per mouse, either intravenously (SL4-Civ; SL4-Tiv) or as a rectal instillation (SL4-Crec; SL4-Trec).

[0063] Figure 16 shows the effect of treated cells on PASI score and representative skin images of patients before and after treatment with treated cells from group C and representative skin images of patients before and after treatment with treated cells from group C.

[0064] Figure 17 shows Mice groups were: untreated control (C), mesenchymal stem cells control (MST- C) and treated (MST-T), IPSC control (IPSC-C) and treated (IPSC-T), and fibroblasts control (FB-C) and treated (FB-T), all injected with 1 x 10Λ6 cells in 300 pL of DMEM or RPMI 1640 into the hepatic portal vein. Blood glucose was monitored every five days.

[0065] Figure 18 shows a reduction in the size of osteochondral defect areas.

[0066] Figure 19 shows the effect of treatment RBC on Rh antigen.

[0067] Figure 20 shows a booster vaccine for bacteria which was given 6 and 12 month after the initial vaccination

[0068] Figure 21 (a) - (c) shows the results of the differentially expressed genes profiles of SL4-T compared to SL4-C.

[0069] Figure 22 shows the characteristics of the plants grown from the treated cells.

[0070] Figure 23 shows a Bray-Curtis similarity between pairs of inoculum and donors samples.DETAILED DESCRIPTION

[0069] In an embodiment, a treated cell is a cell that has been treated with one or more of a DNase, an RNase, an antibody that binds to a DNA and an antibody that binds to an RNA. In an embodiment, a treated cell is first treated with a DNase and then an RNase or an RNase and then a DNase. In a further embodiment, a treated cell is first treated with a DNase and then an antibody that binds to an RNase or an antibody that binds to an RNase and then a DNase. In another embodiment, a treated cell is first treated with an RNase and then an antibody that binds to a DNA or an antibody that binds to a DNA and then an RNase. For any of the above treatments, a treated cell can be treated with one or more of a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA two or more times and the treatment can be any combination of the one or more of a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA.

[0070] Treatment of the cells results in an improvement of one or more characteristics of the treated cells. For instance, for a treated cell used to manufacture a bioproduct, like a protein (including a monoclonal antibody, a bivalent or trivalent protein, insulin or other protein used to supplement a protein deficiency), the treated cell is capable of producing greater quantities of the protein. In another example, the treated cell is a B-cell, wherein, following treatment the B-cell either is able to produce a greater quantity of antibodies, or the B-cell is made naive again and ready to respond to a new antigenic challenge. For a treated cell used to make a plant that constitutes a source of food (including, a grain, a wheat, a fruit, a tomato, a peach, an orange, an apricot, a grape, a hybrid fruit, an apple, a nut, a pecan, a walnut, an almond, a pistachio, a peanut, a coffee bean, a tea, a soybean, a corn, a pea, a carrot, broccoli, squash, cauliflower, a mushroom, a bean, a legume, a barley, a sorgum, a legume or other plant food source), the plant produces grows larger, faster, produces more edible or usable product and / or provides the food with another favorable characeteristic.

[0071] In another embodiment, a treated cell is a bacteria, a fungi or other cellular organism that is capable of producing a protein, including an antibiotic. In this embodiment, the treated cell is capable of producing greater quantities of an antibiotic or produce an antibiotic that is more efficacious in killing bacteria.

[0072] In other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA for 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes,24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 24 hours, 48 hours, 72 hours, or more hours. In other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 4 minutes, at least 5 minutes, at least 6 minutes, at least 7 minutes, at least 8 minutes, at least 9 minutes, at least 10 minutes, at least 11 minutes, at least 12 minutes, at least 13 minutes, at least 14 minutes, at least 15 minutes, at least 16 minutes, at least 17 minutes, at least 18 minutes, at least 19 minutes, at least 20 minutes, at least 21 minutes, at least 22 minutes, at least 23 minutes, at least 24 minutes, at least 25minutes, at least 26 minutes, at least 27 minutes, at least 28 minutes, at least 29 minutes, at least 30 minutes, 3 at least 5 minutes, at least 40 minutes, at least 45 minutes, at least 50 minutes, at least 55 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours, 24 hours, 48 hours, 72 hours, or more hours. In other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA for no more than 1 minute, no more than 2 minutes, no more than 3 minutes, no more than 4 minutes, no more than 5 minutes, no more than 6 minutes, no more than 7 minutes, no more than 8 minutes, no more than 9 minutes, no more than 10 minutes, no more than 11 minutes, no more than 12 minutes, no more than 13 minutes, no more than 14 minutes, no more than 15 minutes, no more than 16 minutes, no more than 17 minutes, no more than 18 minutes, no more than 19 minutes, no more than 20 minutes, no more than 21 minutes, no more than 22 minutes, no more than 23 minutes, no more than 24 minutes, no more than 25 minutes, no more than 26 minutes, no more than 27 minutes, no more than 28 minutes, no more than 29 minutes, no more than 30 minutes, 3 no more than 5 minutes, no more than 40 minutes, no more than 45 minutes, no more than 50 minutes, no more than 55 minutes, no more than 1 hour, no more than 2 hours, no more than 3 hours, no more than 4 hours, no more than 5 hours, no more than 6 hours, no more than 7 hours, no more than 8 hours, no more than 9 hours, no more than 10 hours, no more than 11 hours, no more than 12 hours,24 hours, 48 hours, 72 hours, or more hours. In other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA for about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes, about 11 minutes, about 12 minutes, about 13 minutes, about 14 minutes, about 15 minutes, about 16 minutes, about 17 minutes, about 18 minutes, about 19 minutes, about 20 minutes, about 21 minutes, about 22 minutes, about 23 minutes, about 24 minutes, about25 minutes, about 26 minutes, about 27 minutes, about 28 minutes, about 29 minutes, about 30 minutes, 3 about 5 minutes, about 40 minutes, about 45 minutes, about 50 minutes, about 55 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, 24 hours, 48 hours, 72 hours, or more hours.

[0073] In other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA are treated 1 time, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 21 times, 22 times, 23 times, 24 times, 25 times, 26 times, 27 times, 28 times, 29 times, 30 times, 35 times, 40 times, 45 times, 50 times, 55 times, 100 times or more times with the nuclease(s) and / or antibody(ies).

[0074] In other aspects of this embodiment, time between multiple rounds of cell treatment with a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA is 1 minute, 5 minutes, 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 24 hours, 48 hours, 72 hours, or more hours with the nuclease(s) and / or antibody(ies).

[0075] In aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or a cell that binds to an RNA, is treated with no more than 1 pg, no more than 100 pg, no more than 5 ng, no more than 50 ng, no more than 500 ng, no more than 1 mcg, no more than 10 mcg, no more than 40 mcg, no more than 100 ng, no more than 250 mcg, no more than 500 mcg, no more than 1 mg, no more than 5 mg, no more than 10 mg, no more than 100 mg of the nuclease or antibody per ml. In other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or a cell that binds to an RNA, is treated with at least 5 ng, at least 50 ng, at least 500 ng, at least 1 mcg, at least 10 mcg, at least 40 mcg, at least 100 ng, at least 250 mcg, at least 500 mcg, at least 1 mg, at least 5 mg, atleast 10 mg, at least 100 mg of the nuclease or antibody per ml. In yet other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or a cell that binds to an RNA, is treated with about 5 ng, about 50 ng, about 500 ng, about 1 mcg, about 10 mcg, about 40 mcg, about 100 ng, about 250 mcg, about 500 mcg, about 1 mg, about 5 mg, about 10 mg, about 100 mg per ml of the nuclease or antibody. In still other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or a cell that binds to an RNA, is treated with about 10 ng to about 1 mcg, about 10 ng to about 10 mcg, about 10 ng to about 50 mcg, about 10 ng to about 100 mg, about 10 ng to about 200 mg, about 50 ng to about 250 mcg, about 50 ng to about 500 mcg, about 50 ng to about 1 mg per ml of the nuclease or antibody.

[0076] A treated cell that is to be administered to an individual is administered in a solvent, an emulsion or other diluent in an amount sufficient to maintain the stability of the treated cell prior to and as necessary, following administration. In other aspects of this embodiment, a treated cell that is to be administered to an individual is administered in a solvent, an emulsion or other diluent in an amount sufficient to maintain the stability of the treated cell prior to and as necessary, following administration of an amount of, e.g., less than about 90% (v / v), less than about 80% (v / v), less than about 70% (v / v), less than about 65% (v / v), less than about 60% (v / v), less than about 55% (v / v), less than about 50% (v / v), less than about 45% (v / v), less than about 40% (v / v), less than about 35% (v / v), less than about 30% (v / v), less than about 25% (v / v), less than about 20% (v / v), less than about 15% (v / v), less than about 10% (v / v), less than about 5% (v / v), or less than about 1 % (v / v). In other aspects of this embodiment, a pharmaceutical composition disclosed herein may comprise a solvent, emulsion or other diluent in an amount in a range of, e.g., about 1% (v / v) to 90% (v / v), about 1 % (v / v) to 70% (v / v), about 1% (v / v) to 60% (v / v), about 1 % (v / v) to 50% (v / v), about 1 % (v / v) to 40% (v / v), about 1 % (v / v) to 30% (v / v), about 1 % (v / v) to 20% (v / v), about 1 % (v / v) to 10% (v / v), about 2% (v / v) to 50% (v / v), about 2% (v / v) to 40% (v / v), about 2% (v / v) to 30% (v / v), about 2% (v / v) to 20% (v / v), about 2% (v / v) to 10% (v / v), about 4% (v / v) to 50% (v / v), about 4% (v / v) to 40% (v / v), about 4% (v / v) to 30% (v / v), about 4% (v / v) to 20% (v / v), about 4% (v / v) to 10% (v / v), about 6% (v / v) to 50% (v / v), about 6% (v / v) to 40% (v / v), about 6% (v / v) to 30% (v / v), about 6% (v / v) to 20% (v / v), about 6% (v / v) to 10% (v / v), about 8% (v / v) to 50% (v / v), about 8% (v / v) to 40% (v / v), about 8% (v / v) to 30% (v / v), about 8% (v / v) to 20% (v / v), about 8% (v / v) to 15% (v / v), or about 8% (v / v) to 12% (v / v).

[0077] In an aspect of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or a cell that binds to an RNA, is treated with is at least 0.00001 mg / mL, at least 0.0001 mg / mL, at least 0.001 mg / mL, at least 0.01 mg / mL, at least 0.1 mg / mL, at least 1 mg / mL, at least 10 mg / mL, at least 25 mg / mL, at least 50 mg / mL, at least 100 mg / mL, at least 200 mg / mL, at least 500 mg / mL, at least 700 mg / mL, at least 1 ,000 mg / mL, or at least 1 ,200 mg / mL. In other aspects of this embodiment, the concentration of a pharmaceutical composition disclosed herein in the solution may be, e.g., at most 1 ,000 mg / mL, at most 1 ,100 mg / mL, at most 1 ,200 mg / mL, at most 1 ,300 mg / mL, at most 1 ,400 mg / mL, at most 1 ,500 mg / mL, at most 2,000 mg / mL, at most 2,000 mg / mL, or at most 3,000 mg / mL of a nuclease or an antibody. In other aspects of this embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA or a cell that binds to an RNA, is treated with is about 0.00001 mg / mL to about 3,000 mg / mL, about 0.0001 mg / mL to about 3,000 mg / mL, about 0.01 mg / mL to about 3,000 mg / mL, about 0.1 mg / mL to about 3,000 mg / mL, about 1 mg / mL to about 3,000 mg / mL, about 250 mg / mL to about 3,000 mg / mL, about 500 mg / mL to about 3,000 mg / mL, about 750 mg / mL to about 3,000 mg / mL, about 1 ,000 mg / mL to about 3,000 mg / mL, about 100 mg / mL to about 2,000 mg / mL, about 250 mg / mL to about 2,000 mg / mL, about 500 mg / mL to about 2,000 mg / mL, about 750 mg / mL to about 2,000 mg / mL, about 1 ,000 mg / mL to about 2,000 mg / mL, about 100 mg / mL to about 1 ,500 mg / mL, about 250 mg / mL to about 1 ,500 mg / mL, about 500 mg / mL to about 1 ,500 mg / mL, about 750 mg / mL to about 1 ,500 mg / mL, about 1 ,000 mg / mL to about 1 ,500 mg / mL, about 100 mg / mL to about 1 ,200 mg / mL, about 250 mg / mL to about 1 ,200 mg / mL, about 500 mg / mL to about 1 ,200 mg / mL, about 750 mg / mL to about 1 ,200 mg / mL, about 1 ,000 mg / mL to about1 ,200 mg / mL, about 100 mg / mL to about 1 ,000 mg / mL, about 250 mg / mL to about 1 ,000 mg / mL, about 500 mg / mL to about 1 ,000 mg / mL, about 750 mg / mL to about 1 ,000 mg / mL, about 100 mg / mL to about 750 mg / mL, about 250 mg / mL to about 750 mg / mL, about 500 mg / mL to about 750 mg / mL, about 100 mg / mL to about 500 mg / mL, about 250 mg / mL to about 500 mg / mL, about 0.00001 mg / mL to about 0.0001 mg / mL, about 0.00001 mg / mL to about 0.001 mg / mL, about 0.00001 mg / mL to about 0.01 mg / mL, about 0.00001 mg / mL to about 0.1 mg / mL, about 0.00001 mg / mL to about 1 mg / mL, about 0.001 mg / mL to about 0.01 mg / mL, about 0.001 mg / mL to about 0.1 mg / mL, about 0.001 mg / mL to about 1 mg / mL, about 0.001 mg / mL to about 10 mg / mL, or about 0.001 mg / mL to about 100 mg / mL of an antibody or nuclease.

[0078] Aspects of the present specification disclose, in part, treating an individual suffering from a clinical syndrome or disease. As used herein, the term "treating," to the extent it does not refer to treating a cell with a nuclease or an antibody refers to reducing or eliminating in an individual a clinical syndrome or disease; or delaying or preventing in an individual the onset of a clinical syndrome or disease. For example, the term "treating" can mean reducing a symptom of a condition characterized by a syndrome or disease, including a reduction or elimination of pain or expediting the growth of new tissue, by, e.g., at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% at least 95%, or at least 100%. The actual symptoms associated with the disclosed syndromes and diseases are well known and can be determined by a person of ordinary skill in the art by taking into account factors, including, without limitation, the location of the syndrome or disease in the body, including pain, the location of the pain and the genesis of the pain. Those of skill in the art will know the appropriate symptoms or indicators associated with a specific type of syndrome or diseases, including pain and will know how to determine if an individual is a candidate for treatment as disclosed herein.

[0079] In aspects of this embodiment, a therapeutically effective amount of a treated cell reduces a symptom associated with a disease (including a cancer, an autoimmune disease, a hormonal disease, an infectious disease (including bacterial, fungal, viral and or parasitic), autoimmune disorders, neurodegenerative diseases, a rare disease (including hemophilia) a gastric disease, liver disease, kidney disease, a cardiovascular disease, a nerve disorder or a urinary disease) by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. In other aspects of this embodiment, a therapeutically effective amount of a treated cell reduces a symptom associated with a disease (including a cancer, an autoimmune disease, a hormonal disease, an infectious disease (including bacterial, viral and or parasitic), diabetes, neurodegenerative diseases, a rare disease (including hemophilia) a gastric disease, liver disease, kidney disease, a cardiovascular disease, a nerve disorder or a urinary disease) by, e.g., at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, at most 35%, at most 40%, at most 45%, at most 50%, at most 55%, at most 60%, at most 65%, at most 70%, at most 75%, at most 80%, at most 85%, at most 90%, at most 95% or at most 100%. In yet other aspects of this embodiment, a therapeutically effective amount of a treated cell reduces a symptom associated with a disease (including a cancer, an autoimmune disease, a hormonal disease, an infectious disease (including bacterial, viral and or parasitic), diabetes, neurodegenerative diseases, a rare disease (including hemophilia) a gastric disease, liver disease, kidney disease, a cardiovascular disease, a nerve disorder or a urinary disease) by, e.g., about 10% to about 100%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 20% to about 100%, about 20% to about 90%, about 20% to about 80%, about 20% to about 20%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 30% to about 100%, about 30% to about 90%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, or about 30% to about 50%.

[0080] In aspects of this embodiment, a treated cell reduces the number of a bacteria, a virus, a biofilm, a fungus or a parasite by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. In other aspects of this embodiment, a treated cell reduces the number of a bacteria, a virus, a biofilm, a fungus or a parasite by, e.g., at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, at most 35%, at most 40%, at most 45%, at most 50%, at most 55%, at most 60%, at most 65%, at most 70%, at most 75%, at most 80%, at most 85%, at most 90%, at most 95% or at most 100%. In yet other aspects of this embodiment, a treated cell reduces the number of a bacteria, a virus, a biofilm, a fungus or a parasite by, e.g., about 10% to about 100%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 20% to about 100%, about 20% to about 90%, about 20% to about 80%, about 20% to about 20%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 30% to about 100%, about 30% to about 90%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, or about 30% to about 50%.

[0081] In aspects of this embodiment, a treated cell that produces a bioproduct (an antibiotic, an anti-viral, an anti-fungal, anticancer, or anti-biofilm bioproduct) reduces the number of a bacteria, a virus, a biofilm, a fungus, cancer cell or a parasite by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. In other aspects of this embodiment, a treated cell that produces a bioproduct (an antibiotic, an anti-viral, an antifungal anticancer, or anti-biofilm bioproduct) reduces the number of a bacteria, a virus, a biofilm, a fungus, cancer cell or a parasite by, e.g., at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, at most 35%, at most 40%, at most 45%, at most 50%, at most 55%, at most 60%, at most 65%, at most 70%, at most 75%, at most 80%, at most 85%, at most 90%, at most 95% or at most 100%. In yet other aspects of this embodiment, a treated cell that produces a bioproduct (an antibiotic, an anti-viral, an anti-fungal anticancer, or anti-biofilm bioproduct) reduces the number of a bacteria, a virus, a biofilm, a fungus, cancer cell or a parasite by, e.g., about 10% to about 100%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 20% to about 100%, about 20% to about 90%, about 20% to about 80%, about 20% to about 20%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 30% to about 100%, about 30% to about 90%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, or about 30% to about 50%.

[0082] In aspects of this embodiment, a plant cell for a plant used to generate food that is treated with an RNA, a DNA, an RNA binding antibody and / or a DNA binding antibody is capable of producing a plant that produces at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100% more plant bioproduct (seed, fruit, grain, bean, legume and / or root) than a plant cell that is not treated with an RNA, a DNA, an RNA binding antibody and / or a DNA binding antibody. In other aspects of this embodiment, a plant cell for a plant used to generate food that is treated with an RNA, a DNA, an RNA binding antibody and / or a DNA binding antibody is capable of producing a plant that produces at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, at most 35%, at most 40%, at most 45%, at most 50%, at most 55%, at most 60%, at most 65%, at most 70%, at most 75%, at most 80%, at most 85%, at most 90%, at most 95% or at most 100%% more plant bioproduct (seed, fruit, grain, bean, legume and / or root) than a plant cell that is not treated with an RNA, a DNA, an RNA binding antibody and / or a DNA binding antibody. In yet other aspects of this embodiment, a plant cell for a plant used to generate food that is treated with an RNA, a DNA, an RNA binding antibody and / or a DNA binding antibody is capable of producing a plant that produces about 10% to about 100%,about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 20% to about 100%, about 20% to about 90%, about 20% to about 80%, about 20% to about 20%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 30% to about 100%, about 30% to about 90%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, or about 30% to about 50%% more plant bioproduct (seed, fruit, grain, bean, legume and / or root) than a plant cell that is not treated with an RNA, a DNA, an RNA binding antibody and / or a DNA binding antibody.

[0083] In aspects of this embodiment, following treatment of a cell with an RNase, a DNase, an antibody that binds to an RNA or an antibody that binds to a DNA, the treated cell produces at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100% more bioproduct (including a protein or a peptide) than the same cell if not treated with an RNase, a DNase, an antibody that binds to an RNA or an antibody that binds to a DNA. In other aspects of this embodiment, following treatment of a cell with an RNase, a DNase, an antibody that binds to an RNA or an antibody that binds to a DNA, the treated cell produces at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, at most 35%, at most 40%, at most 45%, at most 50%, at most 55%, at most 60%, at most 65%, at most 70%, at most 75%, at most 80%, at most 85%, at most 90%, at most 95% or at most 100% more bioproduct (including a protein or a peptide) than the same cell if not treated with an RNase, a DNase, an antibody that binds to an RNA or an antibody that binds to a DNA. In yet other aspects of this embodiment, following treatment of a cell with an RNase, a DNase, an antibody that binds to an RNA or an antibody that binds to a DNA, the treated cell produces about 10% to about 100%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 20% to about 100%, about 20% to about 90%, about 20% to about 80%, about 20% to about 20%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 30% to about 100%, about 30% to about 90%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, or about 30% to about 50% more bioproduct (including a protein or a peptide) than the same cell if not treated with an RNase, a DNase, an antibody that binds to an RNA or an antibody that binds to a DNA.

[0084] In yet other aspects of this embodiment, an RNase, a DNase, an antibody that binds to an RNA and / or an antibody that binds to a DNA is administered to a patient in an amount of about 0.001 mg / kg / day to about 100 mg / kg / day. In aspects of this embodiment, an RNase, a DNase, an antibody that binds to an RNA and / or an antibody that binds to a DNA is administered to a patient in an amount of at least 0.001 mg / kg / day, at least 0.01 mg / kg / day, at least 0.1 mg / kg / day, at least 1 .0 mg / kg / day, at least 5.0 mg / kg / day, at least 10 mg / kg / day, at least 15 mg / kg / day, at least 20 mg / kg / day, at least 25 mg / kg / day, at least 30 mg / kg / day, at least 35 mg / kg / day, at least 40 mg / kg / day, at least 45 mg / kg / day, or at least 50 mg / kg / day. In other aspects of this embodiment, an RNase, a DNase, an antibody that binds to an RNA and / or an antibody that binds to a DNA is administered to a patient in an amount of about 0.001 mg / kg / day to about 10 mg / kg / day, about 0.001 mg / kg / day to about 15 mg / kg / day, about 0.001 mg / kg / day to about 20 will mg / kg / day, about 0.001 mg / kg / day to about 25 mg / kg / day, about 0.001 mg / kg / day to about 30 mg / kg / day, about 0.001 mg / kg / day to about 35 mg / kg / day, about 0.001 mg / kg / day to about 40 mg / kg / day, about 0.001 mg / kg / day to about 45 mg / kg / day, about 0.001 mg / kg / day to about 50 mg / kg / day, about 0.001 mg / kg / day to about 75 mg / kg / day, or about 0.001 mg / kg / day to about 100 mg / kg / day. In yet other aspects of this embodiment, an RNase, a DNase, an antibody that binds to an RNA and / or an antibody that binds to a DNA is administered to a patient in an amount of about 0.01 mg / kg / day to about 10 mg / kg / day, about 0.01 mg / kg / day to about 15 mg / kg / day, about 0.01 mg / kg / day to about 20 mg / kg / day, about 0.01 mg / kg / day to about 25 mg / kg / day, about 0.01 mg / kg / day to about 30 mg / kg / day, about 0.01 mg / kg / day to about 35 mg / kg / day, about 0.01 mg / kg / day to about 40 mg / kg / day, about 0.01 mg / kg / day to about 45 mg / kg / day,about 0.01 mg / kg / day to about 50 mg / kg / day, about 0.01 mg / kg / day to about 75 mg / kg / day, or about 0.01 mg / kg / day to about 100 mg / kg / day. In still other aspects of this embodiment, an effective amount of a pharmaceutical composition disclosed herein may be in the ramge of, e.g., about 0.1 mg / kg / day to about 10 mg / kg / day, about 0.1 mg / kg / day to about 15 mg / kg / day, about 0.1 mg / kg / day to about 20 mg / kg / day, about 0.1 mg / kg / day to about 25 mg / kg / day, about 0.1 mg / kg / day to about 30 mg / kg / day, about 0.1 mg / kg / day to about 35 mg / kg / day, about 0.1 mg / kg / day to about 40 mg / kg / day, about 0.1 mg / kg / day to about 45 mg / kg / day, about 0.1 mg / kg / day to about 50 mg / kg / day, about 0.1 mg / kg / day to about 75 mg / kg / day, or about 0.1 mg / kg / day to about 100 mg / kg / day.

[0085] In one embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) disclosed herein is capable of reducing the number of cancer cells or tumor size in an individual suffering from a cancer by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% as compared to a patient not receiving the same treatment. In other aspects of this embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) is capable of reducing the number of cancer cells or tumor size in an individual suffering from a cancer by, e.g., about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70% as compared to a patient not receiving the same treatment.

[0086] Dosing of a treated cell to an individual can be through a single dosage or cumulative (serial dosing), and can be readily determined by one skilled in the art. For instance, treatment of a cancer may comprise a one-time administration of an effective number of treated cells (the dose) as disclosed herein. Alternatively, treatment of a cancer may comprise multiple administrations of an effective number of cells of a treated cells (the dose) carried out over a range of time periods, such as, e.g., once daily, twice daily, trice daily, once every few days, or once weekly. The timing of administration can vary from individual to individual, depending upon such factors as the severity of an individual's symptoms or a requirement for a specific amount of bioproduct by a treated cell. For example, an effective dose of a treated cell disclosed herein can be administered to an individual once daily for an indefinite period of time, or until the individual no longer requires therapy. A person of ordinary skill in the art will recognize that the condition of the individual can be monitored throughout the course of treatment and that the effective amount of a treated cell disclosed herein that is administered can be adjusted accordingly.

[0087] In a further embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) have half-lives of 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, one month, two months, three months, four months or more.

[0088] In an embodiment, the period of administration of a treated cell (including a B cell, a T cell, a CAR- T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In a further embodiment, a period of during which administration is stopped is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more.

[0089] In aspects of this embodiment, a therapeutically effective amount of a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) disclosed herein reduces or maintains a cancer cell population and / or tumor cell size in an individual by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. In other aspects of this embodiment, a therapeutically effective amount of a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) disclosed herein reduces or maintains a cancer cell population and / or tumor cell size in an individual by, e.g., at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, at most 35%, at most 40%, at most 45%, at most 50%, at most 55%, at most 60%, at most 65%, at most 70%, at most 75%, at most 80%, at most 85%, at most 90%, at most 95% or at most 100%. In yet other aspects of this embodiment, a therapeutically effective amount of a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) disclosed herein reduces or maintains a cancer cell population and / or tumor cell size in an individual by, e.g., about 10% to about 100%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 20% to about 100%, about 20% to about 90%, about 20% to about 80%, about 20% to about 20%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 30% to about 100%, about 30% to about 90%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, or about 30% to about 50%.

[0090] A treated cell is administered to an individual. An individual is typically a human being, but can be an animal, including, but not limited to, dogs, cats, birds, cattle, horses, sheep, goats, reptiles and other animals, whether domesticated or not. Typically, any individual who is a candidate for treatment is a candidate with some form of a disease or syndrome, including a cancer, an autoimmune disease, a hormonal disease, an infectious disease (including bacterial, viral and or parasitic), diabetes, a rare disease (including hemophilia) a gastric disease, liver disease, kidney disease, a cardiovascular disease, a nerve disorder or a urinary disease. If the disease or syndrome is a cancer, the cancer is either a benign or malignant cancer. The cancer is a tumor, solid or otherwise, a cancer cell not located in a tumor or some other form of cancer. Among the most common types of cancer include, but are not limited to, bladder cancer, breast cancer, colon and rectal cancer, endometrial cancer, kidney cancer, renal cancer, leukemia, lung cancer, melanoma, non-Hodgkins lymphoma, pancreatic cancer, prostate cancer, stomach cancer and thyroid cancer. Pre-operative evaluation typically includes routine history and physical examination in addition to thorough informed consent disclosing all relevant risks and benefits of the procedure.

[0091] Immune cells means any cells involved in the immune response. Immune cells include, but are not limited to, B-cells, T-cells, dendritic cells, macrophages, natural killer cells, neutrophils, monocytes, leucocytes, eosinophils, monocytes, basophils, plasma cells, CD34+ cells, cells of microglia and mast cells.

[0092] Treated cells means any cells treated with one or more of a DNase, an RNase, an anti-DNA antibody or an anti-RNA antibody, wherein the cells are treated one or more times. Treated cells can be treated in vitro

[0093] In an embodiment, immune cells are treated with a DNase or an RNase in vitro, after which the treated immune cells are administered to an individual suffering from a cancer. The cancer can be a cancerthat comprises a solid tumor or circulating cancer cells. In another embodiment, the immune cells are treated with one or more of a DNase or RNase one or more times in vitro prior to administration to an individual suffering from a cancer. The treated cells are administered to an individual to prevent and treat a metastasis.

[0094] In an embodiment, immune cells are treated with an anti-DNA antibody or an anti-RNA antibody in vitro, after which the treated immune cells are administered to an individual suffering from a cancer. The cancer can be a cancer that comprises a solid tumor or circulating cancer cells. In another embodiment, the immune cells are treated with an anti-DNA antibody or an anti-RNA antibody one or more times in vitro prior to administration to an individual suffering from a cancer. The treated cells are administered to an individual to treat a metastasis.

[0095] The cells treated with one or more of a DNase, an RNase, an anti-RNA antibody and / or anti-DNA antibody in vitro are administered to a patient suffering from one or more of the following cancers: carcinoma, Sarcoma, Leukemia, Myeloma, Lymphoma, Central Nervous System Cancers, Germ Cell Tumors, lung cancer, pancreatic cancer, bladder cancer, stomach cancer, colon cancer, brain cancer, glioblastoma, acute myeloid leukemia, acute lymphoblastic leukemia, bone cancer, breast cancer, Burkitt lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative neoplasms, colorectal cancer, cutaneous T-cell lymphoma, endometrial cancer, esophageal cancer, Ewing sarcoma, retinoblastoma, gallbladder cancer, testicular cancer, ovarian germ cell tumors, hairy cell leukemia, head and neck cancer, liver cancer, Hodgkin’s lymphoma, kidney cancer, Kaposi sarcoma, melanoma, mesothelioma, metastatic cancer, mouth cancer, neuroblastoma, neuroendocrine tumors, non-Hodgkin’s lymphoma, non-small cell lung cancer, oral cancer, ovarian cancer, osteosarcoma, parathyroid cancer, penile cancer, pituitary tumor, plasma cell neoplasm, multiple myeloma, primary central nervous system lymphoma, prostate cancer, primary peritoneal cancer, rectal cancer, recurrent cancer, salivary gland cancer, sarcoma, skin cancer, small cell lung cancer, small intestine cancer, soft tissue carcinoma, sguamous cell carcinoma, T-cell lymphoma, testicular cancer, throat cancer, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vascular tumors and vulvar cancer.

[0096] The cells treated with one or more of a DNase, an RNase, an anti-RNA antibody and / or anti-DNA antibody in vitro are administered by autologous and / or allogeneic administration.

[0097] The cells treated with one or more of a DNase, an RNase, an anti-RNA antibody and / or anti-DNA antibody in vitro are_administered by autologous and / or allogeneic administration, and can originate from different organisms including mammalians or cold-bloodied organisms.

[0098] The cells treated with one or more of a DNase, an RNase, an anti-RNA antibody and / or anti-DNA antibody in vitro can be additionally treated with microbial cells or viruses or their components (e.g., LPS,), eukaryotic cells, tumor cells / tissues, mitogens like ConA, or PMA / ionomycin that have been previously treated with one or more of a DNase, an RNase, an anti-RNA antibody and / or anti-DNA antibody.

[0099] The cells treated with one or more of a DNase, an RNase, an anti-RNA antibody and / or anti-DNA antibody in vitro are administered to a patient together with, prior to, or after chemotherapy, immunotherapy or surgical therapy of cancer.[000100] Chemotherapeutic agents can include, but are not limited to, those found in Table 1 .[000101]Types of immunotherapy can include, but are not limited to, the administration of antibodies that target and bind to specific antigens, including antigens of cancer cells, immunotherapy can also comprise the administration of one or more of a cancer vaccine, adoptive cell transfer, tumor-infecting viruses, checkpoint inhibitors, cytokines, and adjuvants to a patient suffering from a cancer.[000102] Types of surgical therapy to treat a cancer can include, but are not limited to, cryosurgery, electrosurgery, laser surgery, Moh’s surgery, laparascopic surgery, robotic surgery and natural orifice surgery.[000103] The cells treated with one or more of a DNase, an RNase, an anti-RNA antibody and / or anti-DNA antibody in vitro are administered systemically or locally at the site of a tumor to treat the tumor. Other forms of administration of the treated cells include intrapleural, intraabdominal, injection into the wound site that occurs either prior to, during or after the tumor is removed from the patient. By administering the treated cells to a patient suffering from a tumor, the treated cells reduce the size of the tumor or eliminate the tumor from the patient.[000104] In an embodiment, the cells that are treated with one or more of a DNase, an RNase, an anti-RNA antibody and / or anti-DNA antibody in vitro are then administered to a patient in a controlled release formulation. In another embodiment, the controlled release formulation comprise a tablet, a liquid, a powder, a nanoparticle, a controlled release device, subcutaneous autoinjectors. Following administration of the treated cells in a controlled release formulation, the treated cells are released in a controlled release manner.[000105] In an embodiment, cells are treated in vitro with one or more rounds of DNase and RNase or anti- DNA and anti-RNA antibody and the treated cells are used for the treatment or prevention of a bacterial, a fungal, a protozoan and / or a viral infection. In an embodiment, the infection can be a chronic infection, a temporary infection, a repeated infection and / or an acute infection.[000106] In an embodiment, cells are treated in vitro with one or more rounds of DNase and RNase or anti-DNA and anti-RNA antibody and the treated cells are used for the treatment of microbial, including bacterial and viral persisters, a microbial biofilm, including those caused by drug-resistant bacterial strains. A biofilm is a single biofilm or a mixed biofilm.[000107] In a further embodiment, cells are treated in vitro with one or more rounds of DNase and RNase or anti-DNA and anti-RNA antibody and the treated cells are used to treat a bacteria, a virus and / or a parasite that causes an infection. In an embodiment an infection results in an ulcer, sepsis, malaria, a mycobacteriosis, pneumonia, or other disease resulting from a bacterial, viral or parasitic infection.[000108] In another embodiment, the treated cells are selected from a White blood cell, a fibroblast, a platelet, a hematopoietic stem cell, a red blood cell and / or a stem cell. A stem cell can be a haematopoeitc stem cells, a mesenchymal stem cell, a skeletal stem cell, embryonic stem cells, adult stem cells, mesenchymal stem cells, pluripotent stem cells. A white blood cell is selected from a leucocyte, a lymphocyte (including a T-cell, a B-cells, an NK cell), a neutrophil, an eosinophil, a monocyte, a basophil, a macrophage and / or a plasma cells, a CD34+ cell and / or a cell of microglia.[000109] In an embodiment, treated cells are used for autologous and allogeneic administration. In a further embodiment, treated cells are obtained from different organisms. An organism can be a prokaryotic or a eukaryotic organism. An organism can be a mammal, a reptile, a bacteria, a parasite, yeast, a bird, a cold blooded organism.[000110] The therapeutic activity of treated cells can be increased if the treated cells prior to, during or after treatment with a DNase or an RNase or an anti-RNA or anti-DNA antibody were additionally further treated with a microbial cell, a virus, a eukaryotic cell, a tumor cell, a tissue or pieces or derivatives of their components (including cell membranes, organelles, LPS, nucleic acids, proteins, cellular extracts), a mitogen (including ConA, PMA or ionomycin).[000111] In an embodiment, administration of a treated cell is by inhalation, intrapleural, intraabdominal, inhalation, intravaginal, intra recto rally, intramuscular, subcutaneous, intraperitoneal, intraocular, orally, intraventricular, local, and / or intraspinal.[000112] In an embodiment, a cell is treated in vitro with one or more rounds of a DNase and an RNase and / or an anti-DNA and an anti-RNA antibody, wherein the treated cells are used for the treatment, prevention or reduction of the progression of an idiopathic and / or an autoimmune disease.[000113] An idiopathic and / or autoimmune disease is selected from one of diabetes, an autoimmune disease (including those with gastrointestinal involvement and those with skin involvement), a neurodegenerative disease, multiple sclerosis, SLE, ALS, IBD, focal segmental glomerulosclerosis, ankylosing spondylitis, gout, epilepsy, diabetes, psoriasis and / or an autoimmune disorder effecting the thyroid gland. Additional diseases include, those associated with the accumulation of misfolded proteins, idiopathic / cryptogenic diseases, diseases associated with inflammasome activation, Common variable immunodeficiency chronic fatigue syndrome, rheumatoid arthritis, lupus, migraines, multiple sclerosis and autism, ANCA-associated vasculitis (AAV), and / or immune-mediated inflammatory diseases (IMIDs).[000114] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA, resulting in treated cells that more effectively treat a microorganism (a bacteria, a fungi, a protozoa, a virus, a cancer cell, a pre-cancer cell, a cell infected with a bacteria, a fungi, a protozoa, and / or a virus.[000115] In an embodiment, treated cells treated with one or more rounds of a DNase, an RNase, an anti-DNA and / or an anti-RNA antibody are administered to a patient that receives a transplant of an organ, bone marrow, blood, muscle, skin, lymphoid tissue or other tissue. In an embodiment, the treated cells improve the efficiency, acceptance and survivability following a patient receiving a transplant of an organ, bone marrow, blood, muscle, skin, lymphoid tissue or other tissue.[000116] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA, resulting in treated cells that more effectively treat a microorganism (a bacteria, a fungi, a protozoa, a virus, a cancer cell, a pre-cancer cell, a cell infected with a bacteria, a fungi, a protozoa, and / or a virus, wherein the treated cells are treated prior to, during or after a further treatment with a microbial cell a virus, a cellular component (including a cell membrane, organelles, lipids, proteins, cholesterol and / or LPS,), a eukaryotic cell, a tumor cell, a cancerous tissue, a mitogens (including ConA, PMA and / or ionomycin). These treated cells can be used for the treatment of chronic and acute bacterial, fungal, protozoan, viral infections, a microbial biofilm, a cancer (including a liquid and / or a solid cancer), an autoimmune disease.[000117] In another embodiment, cells which were treated with multiple rounds of a DNase, an RNase, an anti-DNA and / or an anti-RNA antibody were used to manufacture biologic molecules. In an embodiment, the biologic molecules are a protein. In a further embodiment, the protein is an antibody, a peptide, an antibody fragment (including, an sfv, tv and / or Fab), an antibiotic, an anti-fungal an anti-viral, a food supplement and / or a biotherapeutic.[000118] In another embodiment, cells which were treated with multiple rounds of a DNase, an RNase, an anti-DNA and / or an anti-RNA antibody were used to manufacture a biomolecule to be used in the food industry. The treated cells can be used for Precision Fermentation or PF to harness the power of the treated cells to optimize and efficiently generate proteins for use in the food industry. A protein that can be manufactured in the treated cells is chymosin, an enzyme (including amylase, a protease a lipase), a vitamin (including vitamin C and vitamin B12), amino acids (including those used as flavor enhancers, sweeteners, nutritional supplements and / or food additives). The treated cells can also be used to produce a pharmaceutical, a textile, a food ingredient, a fuel enzyme and / or cosmeceutical. In another embodiment,the treated cells can be used to manufacture cellulose, silk, chitin and alginate, each an alternative to a plastic.[000119] In an embodiment, a treated cells is able to produce a biomolecule, including a protein or a peptide in a larger quantities, at a faster rate than a cell that is not treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody. In an embodiment, a treated cells is able to grow at a faster rate than a cell that is not treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody.[000120] In another embodiment, a treated cells is able to produce a non-natural biomolecule (one not found naturally in nature), including a non-natural protein or a non-natural peptide at a faster rate than a cell that is not treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody.[000121] Cells that can be treated with a DNase, an RNase, an anti-DNA antibody and / or an anti- RNA antibody include Chinese Hamster Ovary (CHO) cells, human embryonic kidney (HEK) cells, S.cerevisiae, Penicillum spp, and hybridoma cells.[000122] In a further embodiment, following treatment of cells with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody, the treated cells are able to grow in different O2, CO2, temperature, UV environment. In an embodiment, following treatment of cells with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody, the treated cells are able to grow at higher density and increase the amount of biomolecules produced. Other biomolecules that can be manufactured by cells treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody include an antibody, an antibiotic, a cytokine a growth factor, a viral vector, an antigen, a viral vector (including an adeno-associated virus or AAV), a vaccine (including a protein vaccine and / or an mRNA and / or circular RNA vaccine), complex bivalent and trivalent biotherapeutics, a trivalent T-cell engager, a checkpoint modulator, a naive proteins, a recombinant protein, a vitamin, a hormone, a vaccine, and an antibody cytokine fusion biomolecule, a clotting and / or a coagulation factor, a TNF inhibitor, an Interferon, a monoclonal antibody, a receptor, a hormone (including a cortisol, estrogen, testosterone, thyroid hormone, growth hormone, insulin and melatonin).[000123] In another embodiment, cells treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody are able to metabolize and destroy xenobiotics, including those associated with pollutants in the water or earth (in dirt or soil) and heavy metals. Treated cells include a procaryotic treated cell that is used to improve the characteristics of a plant following administration of the treated cells to a soil or growth medium used for a plant nutrition. Treated cells are used in as part of a fermentation process (including, food and beverage fermentation to manufacture a cheese, a yogurt, a wine, and / or a beer).[000124] In another embodiment, cells treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody are used to manufacture materials used in the building industry, including a wood.[000125] In an embodiment, cells treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody are used to manufacture a honey. In an embodiment the treated cells are obtained from an insect, including a honey producing bee.[000126] In a further embodiment, cells treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody are used to manufacture food (feed) for animals, including livestock. Livestock include cows, sheep, goats, llamas, alpacas, horses and / or pigs. In a further embodiment, cells treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody are used in aquaculture to manufacture biomolecules derived from plants. Treated cells can produce unique varieties of meat, milk,and fish. Currently unknown flowers on the planet, derived from cells as described above. Unique bouquets and landscapes, derived from plants as described above.[000127] In an embodiment, treated cells, treated one or more times with an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA have higher resistance to variations of temperature and / or proteases. The variation of temperature can be an increase of one degree, two degrees, three degrees, four degrees, five degrees, six degrees, seven degrees, eight degrees, nine degrees, ten degrees, eleven degrees, twelve degrees, thirteen degrees, fourteen degrees, fifteen degrees, sixteen degrees, seventeen degrees, eighteen degrees, nineteen degrees, twenty degrees, twenty-one degrees, twenty-two degrees, twenty-three degrees, twenty-four degrees, twenty-five degrees, thirty degrees, thirty-five degrees, forty degrees, forty-five degrees, fifty degrees, fifty-five degrees, sixty degrees or more and each degrees in centigrade.[000128] In an embodiment, cells treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody are administered allogeneically or autogolously. In a further embodiment, treated cells have an altered expression of MHC, HLA, CD antigens. In another embodiment the treatment of the treated cells with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody results in an altered interaction between the treated cells and anti-CD and anti-HLA antibodies. Such treated cells can be used to treat non-HLA matched transplant recipients.[000129] In an embodiment, cells treated with a DNase, an RNase, an anti-DNA antibody and / or an anti-RNA antibody are administered to a patient as part of a vaccine preparation that also includes at least one of a nucleic acid derived from a bacteria (including, a nucleic acid of gram-negative bacteria, wherein, in an embodiment, the gram-negative bacteria is genera Pseudomonas.), and / or a nucleic acid derived from a fungi. In another embodiment, the treated cells that are part of a vaccine also comprise an adjuvant. In another embodiment, the treated cells that are part of a vaccine are administered to a patient one or more times.[000130] In an embodiment, the treated cells are part of a vaccine that further comprises a nucleic acid associated with a cell surface membrane. The nucleic acid is comprised of a non-coding genetic segment and / or genetic segments that have prion like activity. In a further embodiment, the vaccine is prepared from a bacterial DNA or RNA. In a further embodiment, the vaccine is prepared from a bacterial nucleic acids associated with DNA or RNA associated with a cell surface membrane. In a further embodiment, the vaccine is prepared from a bacterial nucleic acids associated with DNA or RNA capable of triggering prionogenic aggregation of proteins. In another embodiment, the vaccine is prepared from a DNA or RNA gram-negative bacteria, wherein, in an embodiment, the bacteria genera Pseudomonas. In an embodiment, the vaccine is prepared from a fungal DNA or RNA.[000131] In an embodiment, the treated cells that are part of a vaccine, wherein the vaccine is used for lifetime prolongation, the treatment age associated diseases, as a prophylactic to treat age associated diseases, as a prophylactic to treat an oncologic diseases, as a prophylactic to treat neurodegenerative diseases, and / or as a prophylactic to treat Alzheimer diseases.[000132] In an embodiment, stem cells are treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, wherein the treated cells are administered to a patient as part of a bone marrow transplantation. In a further embodiment, the treated cells used for auto transplantation or allogeneic transplantation, are administered to a patient and the treated cells have greater survivability, lower immunogenicity, improved responsiveness and / or improved longevity of the transplant when compared to cells that are not treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA,[000133] In an embodiment, a cell is treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, and the treated cells are used for regrowth or repair of nervous tissue and nerve cells that have suffered damage. In an embodiment, cells are treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, are used to treat a patient that has suffered or suffers from a burn, an ulcer, a wound, physical damage and / or trauma. In an embodiment, cells treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, are used to regenerate cartilage, regenerate an organ or tissue and / or engineer an organ.[000134] In an embodiment, cells treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, are used to generate improved red blood cells, white blood cells, platelets that are then administered to a patient. The improvement comprises one or more of a cell that lives longer after administration to the patient. For treated red blood cells, the improvement further comprises an increased ability to carry more oxygen than a non-treated red blood cell. For treated white blood cells, the improvement further comprises an increased ability to remove, block, kill, adhere to a foreign antigen that resides in the patient.[000135] In an embodiment, cells treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, are white blood cells, dendritic cells, natural killer cells that following treatment no longer are specific to the antigen to which such cell had been responsive to. As a result, a B cell following treatment no longer produces an antibody for the specific antigen that the antibody produced by the B cell bound. Similarly, a T cell following treatment no longer produces a T cell receptor for the specific antigen that the T cell receptor produced by the T cell bound.[000136] In an embodiment, a cell treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, are used Cell is from a connective tissue, an epithelial tissue, a muscle tissue and / or a nervous tissue. In an embodiment, cells treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, produce greater amounts of collagen and / or hyaluronic acid.[000137] In an embodiment cells treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, a cell is obtained from an embryonal cell, mesoderm, endoderm, ectoderm (including, stem cells, pluripotent stem cells), a red blood cell, an immune cell, a white blood cell, a leucocyte, a lymphocyte (T-cells, B-cells, NK cells, neutrophils, eosinophils, monocytes, basophils, macrophages), a CAR-T cell, a Platelet, a Nerve cell (e.g., neurons, glial cells, oligodendrocytes, astrocytes, microglial cells), an epithelial cell, a sensory epithelium, a fibroblast, a goblet cell, a Muscle cell, a Cartilage cell, a Bone cell, a Skin cell, an Endothelial cell, an Epithelial cell, a Fat cell, a muscle cell, a sensor cell, a pigment cell, a kidney cell, a placenta cell, a sex cell, a sperm, an egg, an ovary cell, a pre- malignant cell, a tumor cell, a cancer-associated cell (e.g. cancer associated fibroblasts), a fat cell, a circulating tumor cell, a neuroendocrine cell, an endocrine cell, a bone cell, a fat cells, a skin cell, an endothelial cell, a pancreatic cell, a plant cell, a seed coat, a Monocot cell, a dicot cell, a parenchyma cell a hematopoietic stem cell, an immune cell, a renal cell, a cancer , a sarcoma cell, a tissue and / or organ of an multicellular organism, a group of cells, an organ, organisms as well as a microorganism (including bacteria, fungi, and protists, microbiota, and / or viruses of all types, including bacteriophages), multicellular organs such as plant embryo, a terminally differentiated cholangiocyte or hepatocyte. In an embodiment, cells treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, are used for reprogramming and genome editing[000138] In an embodiment, cells treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, treated cells used for transplantation result in fewer adverse events and / or fewer complications following transplantation. In an embodiment, cells treated with a DNase,an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, result in fewer graft rejections and higher engraftment and / or higher efficacy of transplantation.[000139] In an embodiment, white blood cells, fibroblasts, platelets, hematopoietic stem cells, red blood cells are treated with one or more rounds with one or more of a nuclease (including a DNase or an RNase) or an antibody that binds to a DNA and an antibody that binds to an RNA for the treatment or prevention of any solid tumor or liquid tumor.[000140] In a further embodiment, white blood cells, fibroblasts, platelets, hematopoietic stem cells, red blood cells are treated with one or more rounds with one or more of a nuclease (including a DNase or an RNase) or an antibody that binds to a DNA and an antibody that binds to an RNA. The treated cells are then further treated with a microbial cell or the components of a microbial cell (including, LPS, particularly from Klebsiella), components of eukaryotic cells, tumor cells and / or organs and / or tissues or components of tumor cells and / or tissues and or organs.[000141] In another embodiment, white blood cells, fibroblasts, platelets, hematopoietic stem cells, red blood cells are treated with one or more rounds with one or more of a nuclease (including a DNase or an RNase) or an antibody that binds to a DNA and an antibody that binds to an RNA. The treated cells are further treated with cells derived from an individual who is undergoing treatment for a cancer.[000142] White blood cells treated with one or more rounds with one or more of a nuclease (including a DNase or an RNase) or an antibody that binds to a DNA and an antibody that binds to an RNA as part of the method for the creation and propagation of CAR-T cells. In an embodiment, the treated CAR-T cells are used to treat a metastasis, including a solid tumor or a liquid tumor.[000143] In an embodiment, the treated cells are administered to an individual by either systemic or local administration. Such administration includes injection into the interior of a tumor, intrapleural, intraabdominal, administration into the wound site during / before / or after the removal of a tumor, and / or in a controlled release manner.[000144] White blood cells, fibroblasts, platelets, hematopoietic stem cells, red blood cells, are from a mammal or a non-mammal, including cold-bloodied organisms.[000145] In an embodiment, a white blood cell comprises a leucocyte, a lymphocyte (T-cells, a B- cell, an NK cell, a neutrophil, an eosinophil, a monocyte, a basophil, or a macrophage).[000146] In an embodiment a treated cell is one that is used in biomanufacturing and / or the food industry.[000147] In an embodiment, a treated cell is a eukaryotic cell (fungal, plant, mammalian, etc), an organoid, a tissue, an embryo, an organ, a single-cellular organism or is derived or obtained from a multicellular organism.[000148] In an embodiment, RBC Rh positive cells treated with a DNase, an RNase, an antibody that binds to a DNA and / or an antibody that binds to an RNA, lose their ability to interact and / or trigger the formation of anti-Rh antibodies. In a further embodiment, the RBC Rh positive treated cells can be used as part of a transplant and / or transfusion from an Rh-positive donor to an Rh-negative recipient without triggering an Rh-positive reaction.[000149] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA are used to inhibit cancer and tumor growth.[000150] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA are used to stop cancer and tumor growth.[000151] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA are used to delay cancer and tumor growth.[000152] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA result in cancer regression.[000153] In a further embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA are characterized by a higher product yield, higher expansion[000154] In a further embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA have improved efficiency of transplantation and proliferation activity.[000155] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA is a eukaryotic cell, a prokaryotic cells, single cell, a cell culture, an organoid, a 3D culture, a tissue, an embryo, an organ, a single-cellular organism, a microbiota[000156] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA are used to treat skin defects such as burns, ulcers, wounds.[000157] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA are used for cartilage regeneration, organ regeneration, engineering organs.[000158] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA are used for the transfusion to the individual[000159] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA are used to be transferred to non-relative organisms,[000160] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA have erased autoimmune memory.[000161] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA produce compounds including peptides proteins, antibiotics, with higher activity against microorganisms (bacteria, fungi, protozoa, viruses, microbial biofilms), cancer cells, pre-cancer cells, cells infected with bacteria, fungi, protozoa, and viruses.[000162] In an embodiment, the products produced by cells treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an antibody that binds an RNA used for the treatment of chronic and acute bacterial-fungal-protozoan-viral infections, microbial biofilms, cancers (liquid and solid), autoimmune diseases.[000163] In an embodiment, cells and their products obtained without the use of mutagenesis or genome editing to change genome, and having properties that are currently absent in nature in similar and related organisms. In another embodiment, cells, organisms, Seeds, grains, animals, plants, and microorganisms and their products without changes to the genome and having properties currently absent in nature in similar and related organisms. In another embodiment, modern organisms exhibiting properties of their ancient ancestors with ability "dive back in time" millions of years ago. In another embodiment, cells or organisms obtained without changes to the genome and having properties of ancient ancestors, currently absent in nature in similar and related organisms. In another embodiment, products produced by organisms exhibiting properties of their ancient ancestors. In some embodiments these organisms are the source of plants including wood, flowers, fruits, vegetables, food products, medicinal herbs; vitamins; chemicals; pigments, dyes, medical drugs, psychoactive compounds, enzymes.[000164] In some embodiments, the vaccine consists of extracellular DNA or RNA, including noncoding sequences, which does not penetrate cells and itself acts as an antigen, against which antibodies are produced. These antibodies then bind to the extracellular DNA and RNA in the body, preventing their interaction with extracellular proteins that lead to diseases and aging. In some embodiments, the vaccine consists of microbial DNA or RNA.[000165] In an embodiment, an extracellular vesicle (EV) is created following treatment of a cell with an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or another molecule (biological, small chemical molecule) with nuclease activity. An EV can be classified into three main types: exosomes, microvesicles, and apoptotic bodies.[000166] In an embodiment, an EV has a size range in diameter from around 20-30 nanometers to 10 microns or more. In another embodiment, an EV is smaller than 200 nm. The composition of EVs varies depending on their parent cells, encompassing proteins (e.g., adhesion molecules, cytoskeletons, cytokines, ribosomal proteins, growth factors, and metabolic enzymes), lipids (including cholesterol, lipid rafts, and ceramides), nucleic acids (such as DNA, mRNA, and miRNA), metabolites, and even organelles. An EV include creation from archaeal, bacterial, fungal, and plant cells that are surrounded by cell walls. A wide variety of EV subtypes have been proposed, defined variously by size, biogenesis pathway, cargo, cellular source, and function, leading to a historically heterogenous nomenclature including terms like exosomes and ectosomes. Extracellular vesicles and particles (EVPs) are released by cells in different shapes and sizes. Diverse EV subtypes have been proposed, with names such as ectosomes, microvesicles, microparticles, exosomes, oncosomes, apoptotic bodies, and more.[000167] The terms "ectosome," "microvesicle" (MV), and "microparticle" (MP) refer to particles released from the surface of cells. Technically, the platelets of certain vertebrates (which bud from megakaryocytes), as well as red blood cells (e.g., of adult humans) also fulfill the consensus definition of an EV. In addition to the very large EVs released during apoptosis, micron-sized EVs may be produced by cancer cells, neurons, and other cells. When produced by cancer cells following treatment with a nuclease of the present invention, these particles are termed "large oncosomes" and may reach 20 microns or more in diameter. Large oncosomes can attain sizes comparable to individual cells, but they do not contain full nuclei. Cellular internalization of large oncosomes can reprogram non-neoplastic brain cells to divide and migrate in primary tissue culture, and higher numbers of large oncosomes isolated from blood samples from glioblastoma patients were correlated with more advanced disease progression.[000168] Exophers are a class of large EV, approximately four microns in diameter, observed in model organisms ranging from Caenorhabditis elegans to mice following treatment with a nuclease asdisclosed herein. Exophers can remain connected to the cell body by a thin, membranous filament resembling a tunneling nanotube.[000169] The EV’s of the present invention that are created following treatment of a cell with a nuclease, including an RNA, a DNA, an antibody that binds an RNA, an antibody that binds to a DNA or a molecule with nuclease activity can have one or more of the following biological functions ; trash disposal; eliminating unwanted materials; transfer of functional proteins; Transfer of functional DNA and RNA; molecular recycling or "nutrition;" signaling to the recipient cell via cell-surface or endosomal receptors; creation of a metastatic niche for cancer’ pathfinding through the environment; quorum sensing; mediating host-commensal or parasite / pathogen interaction.[000170] In another embodiment, a cell treated with a nuclease according to the present invention produces exosomes, which can also be referred to as an intraluminal vesicle (ILV). An ILV is enclosed within a single outer membrane and can be secreted by all cell types following treatment with a nuclease. ILV’s have been found in plasma, urine, semen, saliva, bronchial fluid, cerebral spinal fluid (CSF), breast milk, serum, amniotic fluid, synovial fluid, tears, lymph, bile, and gastric acid. Exosomes are formed by an endosomal route and are typically 30-150 nm in diameter. Exosomes of the present invention can be involved in intercellular communication, transferring proteins, lipids, and nucleic acids (like mRNA and miRNA) between cells, influencing various physiological and pathological processes.[000171] In another embodiment, treatment of a cell with a nuclease results in the formation of a microvesicle, with a size range of 100 to 1 ,000 nm in diameter. The microvesicles of the present invention can play a role in cell communication or movement of biomolecules (e.g. proteins and lipids).[000172] In a further embodiment of the invention, treatment of a cell with a nuclease as described herein results in the creation of an apoptotic body, that can range in size from 50 nm up to 5000 nm in diameter. An apoptotic body can be involved in the clearance of dying cells and can also influence immune responses by presenting antigens to immune cells. Apoptotic bodies can contain intact organelles, chromatin, and small amounts of glycosylated proteins. Apoptotic bodies can also facilitate the transfer of signals and molecules between cells, influence responses and interactions or serve as a biomarker for various diseases, including a cancer.[000173] In an embodiment, a membrane vesicle has been treated one or more times with a compound that that is capable of destroying or inactivating a DNA or RNA. In another embodiment, an extracellular vesicles has been treated one or more times with a compound that that destroy or inactivate DNA or RNA. In an embodiment, an apoptotic body has been treated one or more times with compounds that that destroy or inactivate DNA or RNA. In an embodiment, the compound is an RNase, a DNase, an antibody that binds an RNA, an antibody that binds a DNA or a molecule that has nuclease activity.[000174] In an embodiment, a membrane vesicle is created following the treatment of a eukaryotic cell (including.g., a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte, a macrophage, a eosinophils, a monocytes, a basophils, a plasma cell, a CD34+ cells, a microglia cell, a pluripotent cell, a fibroblast, a neuron, skin cells, muscle cells, fungal cells) or a prokaryotic cell with a molecule that destroys or inactivates a DNA or an RNA. In a further embodiment, an extracellular vesicle is created following the treatment of a eukaryotic cell (e.g., a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte, a macrophage, a eosinophils, a monocytes, a basophils, a plasma cell, a CD34+ cells, a microglia cell, a pluripotent cell, a fibroblast, a neuron, skin cells, muscle cells, fungal cells) or a prokaryotic cell with a molecule that destroys or inactivates a DNA or an RNA. In another embodiment, an apoptotic body is created following the treatment of a eukaryotic cell (e.g., a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte, a macrophage, a eosinophils, a monocytes, a basophils, a plasma cell, a CD34+cells, a microglia cell, a pluripotent cell, a fibroblast, a neuron, skin cells, muscle cells, fungal cells) or a prokaryotic cell with a molecule that destroys or inactivates a DNA or an RNA. In another embodiment,[000175] In an embodiment, a membrane vesicle, an extracellular vesicle, or an apoptotic body originates following the treatment of at least two types of mammalian cells. These cells include: immune cells, a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte, a macrophage, an eosinophil, a monocyte, a basophil, a plasma cell, a CD34+ cell, a microglia cell, a pluripotent cell, a fibroblast, a neuron.[000176] In an embodiment, a membrane vesicle, an extracellular vesicle, or am apoptotic body originates and / or is dervived from at least three types of mammalian cells. In an embodiment, a membrane vesicle, an extracellular vesicle, or an apoptotic body originates from at least four types of mammalian cells. In an embodiment, a membrane vesicle, an extracellular vesicle, or an apoptotic body originate from at least five types of mammalian cells. In an embodiment, a membrane vesicle, an extracellular vesicle, or an apoptotic body originate and / or derived from at least six types of mammalian cells. The mammalian cells can be selected from an immune cell, a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte, a macrophage, a megakaryocyte, an eosinophil, a monocyte, a basophil, a plasma cell, a CD34+ cell, a microglia cell, a pluripotent cell, a fibroblast or a neuron.[000177] In an embodiment, a cell is treated once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, eleven times, twelve times, thirteen times, fourteen times, fifteen times, sixteen times, seventeen times, eighteen times, nineteen times, twenty times, twenty one times, twenty two times, twenty three times, twenty four times, twenty five times, twenty six times, twenty seven times, twenty eight times, twenty nine times, thirty times or more with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an RNA and a molecule with nuclease activity.[000178] In another embodiment a cell is treated 2 - 30 times, 5 - 25 times, 8 - 18 times, 10 - 15 times, 5 - 18 times, 5 - 15 times, 10 - 20 times, 10 - 25 times, 10 - 30 times, 8 - 25 times or 8 - 16 times with one or more of an RNase, a DNase, an antibody that binds a DNA and / or an RNA and a molecule with nuclease activity.[000179] In another embodiment, a therapeutically effective ratio of treated cells and membrane vesicles is 0.00001 to 1 ; 0.0001 to 1 ; 0.001 to 1 ; 0.01 to 1 ; 0.1 .1 to 1 ; 1 to 1 ; 1 to 0.1 , 1 to 0.01 ; 1 to 0.01 ;1 to 0.001 ; 1 to 0.0001 ; 1 to 0.00001 ; 1 to 1 .000001 treated cells to membrane vesicles, wherein, in a further embodiment, the membrane vesicle is an exosome, microvesicle, and / or apoptotic body.[000180] In other aspects of this embodiment, a composition comprising a cell with one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body that have been treated with a compound, including a nuclease or an antibody that binds to an RNA or a DNA have improved characteristics as compared to a cell treated with a compound, including a nuclease or an antibody that binds to an RNA or a DNA, but that is not associated with a membrane vesicle, an extracellular vesicle, or an apoptotic body. An improved characteristic includes improved biomanufacturing, improved response to an immune challenge, improved ability to reduce or resolve a cancer, improve a adverse neurological condition or other disease or syndrome.[000181] In an embodiment, a cell together with a membrane vesicle, an extracellular vesicle, and / or an apoptotic body that are treated with a DNase, an RNase, an antibody that binds to a DNA or an antibodythat binds to an RNA, is / are treated with no more than 1 pg, no more than 100 pg, no more than 5 ng, no more than 50 ng, no more than 500 ng, no more than 1 mcg, no more than 10 mcg, no more than 40 mcg, no more than 100 ng, no more than 250 mcg, no more than 500 mcg, no more than 1 mg, no more than 5 mg, no more than 10 mg, no more than 100 mg of the nuclease and / or antibody per ml ofsolution. In a further embodiment, a cell together with a membrane vesicle, an extracellular vesicle, or an apoptotic body is treated with a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 4 minutes, at least 5 minutes, at least 6 minutes, at least 7 minutes, at least 8 minutes, at least 9 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 25 minutes, at least 30 minutes, at least 40 minutes, at least 50 minutes, at least 60 minutes, at least 70 minutes, at least 80 minutes, at least 90 minutes, at least 100 minutes, at least 110 minutes, at least 120 minutes, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, at least 24 hours, at least 48 hours, at least 72 hours or at least 96 hours.[000182] In other aspects of this embodiment, a composition comprising a cell and one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body is treated with a DNase, an RNase, an antibody that binds to a DNA or an antibody that binds to an RNA for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 4 minutes, at least 5 minutes, at least 6 minutes, at least 7 minutes, at least 8 minutes, at least 9 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 25 minutes, at least 30 minutes, at least 40 minutes, at least 50 minutes, at least 60 minutes, at least 70 minutes, at least 80 minutes, at least 90 minutes, at least 100 minutes, at least 110 minutes, at least 120 minutes, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, at least 24 hours, at least 48 hours, at least 72 hours or at least 96 hours.[000183] A patient is administered a treated cell and one or more of a membrane vesicle, an extracellular vesicle, or anapoptotic body.[000184] In an embodiment, a treated cell together and one or more of a membrane vesicle has a size of at least 1 to 20,000 nanometers, an extracellular vesicle has a size of 0.1 nm to 50 micrometers and anapoptotic body has a size of 1 to 20,000 nanometers are administered to an individual.[000185] In one embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) and a membrane vesicle disclosed herein is capable of reducing the number of cancer cells or tumor size in an individual suffering from a cancer by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% as compared to a patient not receiving the same treatment. In other aspects of this embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) is / are capable of reducing the number of cancer cells or tumor size in an individual suffering from a cancer by, e.g., about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70% as compared to a patient not receiving the same treatment.[000186] In one embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) and an extracellular vesicles disclosed herein is capable of reducing the number of cancer cells or tumor size in an individual suffering from a cancer by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% as compared to a patient not receiving the same treatment. In other aspects of this embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) is / are capable of reducing the number of cancer cells or tumor size in an individual suffering from a cancer by, e.g., about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70% as compared to a patient not receiving the same treatment.[000187] In one embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) and apoptotic bodies disclosed herein is capable of reducing the number of cancer cells or tumor size in an individual suffering from a cancer by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% as compared to a patient not receiving the same treatment. In other aspects of this embodiment, a treated cell (including a B cell, a T cell, a CAR-T cell, a dendritic cell, a neutrophil, a natural killer cell, a leukocyte and / or a macrophage) is / are capable of reducing the number of cancer cells or tumor size in an individual suffering from a cancer by, e.g. , about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70% as compared to a patient not receiving the same treatment.[000188] A composition comprising a treated cell and one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body (or a platelet) is administered to an individual. The administration can be a single dose, two doses, three doses, four doses, five doses, six doses, seven doses, eight doses, nine doses, ten doses or more. The amount and number of doses can be readily determined by one skilled in the art. For instance, treatment of a cancer may comprise a one-time administration of an effective number of treated cells (the dose) as disclosed herein. Alternatively, treatment of a cancer may comprise multiple administrations of an effective number of treated cells and one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body (or a platelet) (the dose) carried out over a range of time periods, such as, e.g., once daily, twice daily, trice daily, once every few days, or once weekly. The timing of administration can vary from individual to individual, depending upon such factors as the severity of an individual's symptoms or a requirement for a specific amount of a bioproduct by a treated cell. For example, an effective dose of a treated cell disclosed herein can be administered to an individual once daily or for an indefinite period of time, or until the individual nolonger requires therapy. A person of ordinary skill in the art will recognize that the condition of the individual can be monitored throughout the course of treatment and that the effective amount of a treated cell disclosed herein that is administered can be adjusted accordingly.[000189] In an embodiment, a composition comprising a treated cell and a membrane vesicle that produces a bioproduct (an antibiotic, an anti-viral, an anti-fungal, anticancer, or anti-biofilm bioproduct) reduces the number of a bacteria, a virus, a biofilm, a fungus, a cancer cell or a parasite by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%.[000190] In another embodiment, a composition comprising a treated cell and an extracellular vesicle that produces a bioproduct (an antibiotic, an anti-viral, an anti-fungal, anticancer, or anti-biofilm bioproduct) reduces the number of a bacteria, a virus, a biofilm, a fungus, cancer cell or a parasite by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%.[000191] In aspects of this embodiment, a composition comprising a treated cell and an apoptotic vesicle that produces a bioproduct (an antibiotic, an anti-viral, an anti-fungal, anticancer, or anti-biofilm bioproduct) reduces the number of a bacteria, a virus, a biofilm, a fungus, cancer cell or a parasite by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%.[000192] A composition comprising a treated cell together with one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic bodies (or platelets) to an individual can be through a single dosage, two doses, three doses, four doses, five doses, six doses, seven doses, eight doses, nine doses, ten doses or more including serial dosing, and can be readily determined by one skilled in the art. For instance, treatment of an infection (bacterial, fungal, viral) may comprise a one-time administration of an effective number of treated cells (the dose) as disclosed herein. Alternatively, treatment of an infection may comprise multiple administrations of an effective number of treated cells of a treated cell together with one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body (or platelets) (the dose) carried out over a range of time periods, such as, e.g., once daily, twice daily, trice daily, once every few days, or once weekly. The timing of administration can vary from individual to individual, depending upon such factors as the severity of an individual's symptoms or a requirement for a specific amount of bioproduct by a treated cell. For example, an effective dose of a treated cell together with membrane vesicles, or extracellular vesicles, or apoptotic bodies, or platelets disclosed herein can be administered to an individual once daily for an indefinite period of time, or until the individual no longer requires therapy. A person of ordinary skill in the art will recognize that the condition of the individual can be monitored throughout the course of treatment and that the effective amount of a treated cell disclosed herein that is administered can be adjusted accordingly.[000193] In an embodiment, following treatment of a cell with an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity, and a membrane vesicle produce at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, or at least 1000% more bioproduct (including a protein or a peptide) than the same cell if not treated with enzymes having RNase,a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity.[000194] In another embodiment, a composition comprising a treated cell with an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity, and an extracellular vesicle produce at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% at least 100%, or at least 1000% more bioproduct (including a protein or a peptide) than the same cell if not treated with enzymes having RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity.[000195] In aspects of this embodiment, following treatment of a cell with enzymes having RNase-, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity, and an apoptotic bodyes produce at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%, or at least 1000% more bioproduct (including a protein or a peptide) than the same cell if not treated with RNase-, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity.[000196] In an embodiment, a treated cell and one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body, are able to produce a biomolecule, including a protein or a peptide in a larger quantities and / or at a faster rate than a cell that is / are not treated with a RNase-, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity. In an embodiment, a treated cell is able to grow at a faster rate than a cell that is not treated with a RNase-, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity.[000197] In an embodiment, the products produced by cells treated together with one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body, with one or more additional rounds with one or more of an RNase-, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA or a molecule that has nuclease activity used for the treatment of chronic and acute bacterial-fungal- protozoan-viral infections, microbial biofilms, cancers (liquid and solid), autoimmune diseases.[000198] In an embodiment, the treated cells and one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body, are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA an antibody that binds an RNA and / or a molecule with nuclease activity are used to treat skin defects such as burns, ulcers, wounds.[000199] In an embodiment, the treated cells and one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA an antibody that binds an RNA or a molecule with nuclease activity are used for cartilage regeneration, organ regeneration, engineering organs.[000200] In another embodiment, cells at different stages of differentiation derived from the same individual’s stem cells, and one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body — are treated with one or more additional rounds of one or more of the following: an RNase, a DNase, an antibody that binds to DNA, an antibody that binds to RNA and / or a molecule with nuclease activity, and are then injected locally or systemically into the same individual.[000201] In an embodiment, cells — together with one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic bodyes — are treated with one or more additional rounds of one or more of thefollowing: an RNase, a DNase, an antibody that binds to DNA, an antibody that binds to RNA andor a molecule with nuclease activity. When injected locally or systemically into an individual, this treatment positively affects skin and stromal conditions, including increased skin turgor, reduced wrinkles, and diminished age-related skin pigmentation.[000202] In an embodiment, the treated cells at different stages of differentiation from hemopoietic stem cells, are treated with one or more additional rounds with one or more of an enzymes with RNase or DNase activity, an antibody that binds a DNA, an antibody that binds an RNA and / or a molecule with nuclease activity are used for the preparation of the artificial blood.[000203] In an embodiment, the cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA an antibody and / or a molecule with nuclease activity wherein the cells are not fully differentiated blood cell types from hemopoietic stem cells.[000204] In an embodiment, the treated cells and one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body, are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA, an antibody that binds an RNA and / or a molecule with nuclease activity wherein the treated cells are not fully differentiated blood cell types from hemopoietic stem cells.[000205] In an embodiment, the treated cells are treated with one or more additional rounds with one or more of an RNase, a DNase, an antibody that binds a DNA, an antibody that binds an RNA and / or a molecule with nuclease activity, wherein the treatment occurs during the expansion, differential steps or other steps from the progenitor cells.[000206] In another embodiment, the treated cells are at different stages of differentiation from hemopoietic stem cells and are further treated with a nuclease, an antibody that binds a DNA, an antibody that binds an RNA and / or a molecule with nuclease activity, and combined with one or more of a membrane vesicle, an extracellular vesicle, or an apoptotic body that originates or is derived from these or other cell types.[000207] In an embodiment, cells treated with two or more rounds of a DNase, an RNase, an anti- DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are administered to a patient within 1 year prior to, 1 month prior to, 1 week prior to, 2 days prior to, 1 day prior to, from 24 to 12 hour prior to, from 12h to 1 h prior to, at the onset, from the onset to 12 hours-after, from 12 h to 24h after, from 24 to 72h after, from 3 days to 1 week, from 1 week to 1 month, from 1 month to 1 year, from 1 year to 10 years after a patient suffers a heart attack or heart failure.[000208] In an embodiment, cells treated with two or more rounds of a DNase, an RNase, an anti- DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are administered to a patient within 1 year prior to, 1 month prior to, 1 week prior to, 2 days prior to, 1 day prior to, from 24 to 12 hour prior to, from 12h to 1 h prior to, at the onset, from the onset to 12 hours-after, from 12 h to 24h after, from 24 to 72h after, from 3 days to 1 week, from 1 week to 1 month, from 1 month to 1 year, from 1 year to 10 years after a patient suffers from a stroke.[000209] In an embodiment, a patient is administered treated cells and one or more of a membrane vesicle, an extracellular vesicles, or an apoptotic body, wherein the treated cells and / or the one or more of a membrane vesicle, an extracellular vesicles, or an apoptotic body are treated with two or more rounds of a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are administered to a patient following an injury of the patient’s brain or spinal cord neurons.[000210] In an embodiment, cells treated with two or more rounds of a DNase, an RNase, an anti- DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are administered to a patient suffering from a heart arrythmia or a condition that affects the patient’s heart electrical system.[000211] In an embodiment, cells treated with two or more rounds of a DNase, an RNase, an anti- DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are administered to a patient suffering from an artery disease (coronary artery disease, peripheral artery disease, atherosclerosis, congenital heart disorders, autoimmune heart disorders, altered blood pressure).[000212] In an embodiment, patients treated with cells treated two or more rounds of a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are administered to a patient to improve exercise tolerance or increased functional capacity.[000213] In an embodiment, a treated cell or organism originating from such treated cells, that were treated with an RNase, a DNase, an antibody that binds to RNA, an antibody that binds to DNA and / or a molecule with nuclease activity, exhibit characteristics of their progenitor cells that were not displayed by the treated cells prior to the treatment.[000214] Plants derived from cells treated with an RNase, a DNase, an antibody that binds to RNA or DNase and / or a molecule with nuclease activity, which cells can be used for ornamental landscaping, forest and garden planting, wood production, pharmaceuticals and food production, waste biodegradation, and biofuel generation. These treated cells possess new and novel properties that are not found in existing plants. These treated cells also possess characteristics that differ from those of the cells prior to treatment with the aforementioned nucleases and / or antibodies.[000215] Following treatment with an RNase, a DNase, an antibody that binds to RNA or DNase and / or a molecule with nuclease activity. A fungi (lower or higher), can be used as ornamental or as an edible product, as producer of a pharmaceutical, a food product, a product for waste biodegradation, or for biofuel production. These fungi exhibit properties that are not identified in untreated fungal species, as well as exhibiting properties and characteristics that differ from those of the original untreated cells.[000216] Following treatment with an RNase, a DNase, an antibody that binds to RNA, an antibody that binds to DNA and / or a molecule with nuclease activity, a prokaryote (bacteria) is used to produce food or a pharmaceutical. The prokaryote possess previously unknown properties not found in existing prokaryotes and can be used as ornamental or edible products, for the production of a pharmaceutical, a food product, a waste biodegradation product, or for biofuel production. The treated prokaryote has properties not observed in known microorganisms and different from those of the original untreated cells.[000217] In an embodiment, a treated cell is a distiller’s yeast cell . The treated distiller’s yeast cell imparts to the beverage characteristics and taste that differ from those produced by untreated distiller’s yeast.[000218] In an embodiment, animals originating from cells treated with compounds having RNase or DNase activity, or with antibodies that bind to RNA or DNA, and / or a molecule with nuclease activity differ from those originating from untreated cells in their ability to survive under different conditions, including variations in tolerable temperature, nutritional requirements, habitat depth, responses to temperature and gas content, as well as in appearance and taste.[000219] In an embodiment, fish originating from or derived from cells treated with a compound having RNase or DNase activity, or with antibodies that bind to RNA or DNA and / or with a molecule with nuclease activity, differ from those originating from untreated cells in their ability to survive under different conditions, including variations in tolerable temperature, nutritional requirements, habitat depth, responses to temperature and gas content, as well as in appearance and taste.[000220] In an embodiment, farm animals or insects such as bees originating from or derived from cells treated with compounds having RNase or DNase activity, or with antibodies that bind to RNA or DNA and / or a molecule with nuclease acitivity, differ in their ability to live under different conditions; produceeggs, meat, milk, honey that are different from those farm animals or insects originating from untreated cells.[000221] In an embodiment, a treated cell is a cell that has been treated with a compound that destroys or inactivates a DNA or an RNA[000222] In an embodiment, a treated cell is a cell that has been treated two or more times with Benzonase.[000223] In aspects of this embodiment, following treatment of a cell with an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity, the treated cell an extracellular vesicle produces at least from 10% to 100,000% more bioproduct (including a protein or a peptide) than the same cell if not treated with an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.[000224] In an embodiment, a cell together with an extracellular vesicle that is treated with two or more rounds of a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are administered to a patient with skin disorders including eczema.[000225] In an embodiment, cells treated with two or more rounds of a DNase, an RNase, an anti- DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are used for the production of alcoholic beverages (including whiskey, bourbon, scotch, tequila, vodka and / or cognac).[000226] In an embodiment, plant cells treated with two or more rounds of a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are used for the production of nicotine-containing and producing plants or nicotine producing cells.[000227] In an embodiment, cells treated with two or more rounds of a DNase, an RNase, an anti- DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity are used for the production of psychoactive-containing and producing compounds (including cannabinoids, caffeine, psilocybin, mescaline, salvinorin).EXAMPLESExample 1. Effect of treatment of immune cells on different components of their anticancer and antimicrobial activity[000228] We evaluated the modulation of phagocytic activity of immune cells alone, after the treatment with nucleases or in complex together with the extracellular vesicles produced by these cells following the treatment with nucleases. Granulocyte and agranulocyte immune cells were isolated by gradient centrifugation from the blood products of healthy volunteers and treated with multiple rounds of RNase and DNase for varying durations, ranging from 1 to 120 minutes. Following nuclease incubation, the cells were centrifuged at different speeds — either at low speed to remove extracellular vesicles (including exosomes, membrane vesicles, microvesicles, and apoptotic bodies formed during nuclease treatment), or at high speed to sediment the extracellular vesicles. The mixture of the immune cells activated with nucleases in the presence of secreted and released extracellular vesicles (EV) were designated as SL4-T. The cells activated with nucleases after removal of extracellular vesicles were designated as SL4-Tr. Untreated control cells were designated as SL4-C.[000229] Quantification of theextracellular vesicles was performed via microscopic examination, and the ratio of extracellular vesicles to cells was calculated.[000230] Using FITC-stained E. coll, adjusted to a specific concentration after cultivation and labeling. Macrophages or neutrophils, isolated by gradient centrifugation, were seeded in multi-well plates and incubated with these bacteria to assess phagocytosis. Post-incubation, undigested bacteria werewashed off, and bacterial uptake was quantified via fluorescence. Phagocytosis efficiency was analyzed by comparing fluorescence in treated samples to controls.[000231] Additionally, we studied phagocytic responses in granulocytes and agranulocytes, by measuring Myeloperoxidase (MPO), Neutrophil Acid Phosphatase (NACP), and Neutrophil Alkaline Phosphatase (NAP) activities:[000232] MPO Activity: Measured by the color change of o-dianisidine dihydrochloride in the presence of hydrogen peroxide, and quantified spectrophotometrically at 460 nm.[000233] NACP Activity: Assessed by hydrolysis of para-nitrophenyl phosphate to paranitrophenol, monitored spectrophotometrically at 405 nm.[000234] NAP Activity: Determined by fluorescence of 4-methylumbelliferyl phosphate at 365 / 445 nm excitation / emission.[000235] These methods provided insights into the phagocytic functions and enzymatic activities of different immune cell groups under various conditions.Table 1 . Phagocytosis activity*p<0.05[000236] The data show that the treated cells possess significantly higher phagocytosis activity.Table 2*p<0.05 compared to SL4-C#p<0.05 compared to SL4-Tr[000237] As shown in Table 2, the enzymatic activities of MPO, NACP, and NAP are elevated in treated cells were not separated from the extracellular vesicles when compared to an untreated control or to the treated cells with washed out extracellular vesicles.Example 2. Effect of treated cells on cancer cell lines[000238] We investigated the anticancer effects of treated SL4-T cells (with EV, cell:EV ratio from 0.1 :1 to 1 :1 ,000) and SL4-Tr cells without EV on tumor cells. SL4-C and SL4-T, SL-Tr cells, derived from whole blood, buffy coats, leukapheresis, Filgrastim or Plerixafor, Activation of WBCs utilized a different DNase, RNase .including S1 and Micrococcal nuclease to target G-quadruplexes and Z-DNA. We cocultured SL4 cells with the NCL-H1299 lung carcinoma and T98G glioblastoma cell lines in RPMI 1640. [000239] Cultivation involved growing H1299 cells in 96-well plates and T98G cells in 25 cm2flasks, both in respective media supplemented with 10% FBS. Cell viability was measured after exposing cancer cells to SL4-based treatments for 10 minutes to 48 hours, comparing absorbance with control wells to determine effectiveness.[000240] Results showed SL4-T cells, significantly enhanced anticancer activity against tumor cells, with efficacy data presented in Table 1 .Table 3. Anticancer activity of treated cells.*p<0.05 compared to “C”#p<0.05 compared to “Tr”@p<0.05 compared to the same probe without plateletsExample 3. Effect of treated cells or their products in mouse models of solid tumors[000241] Spontaneous breast cancer modelThe SL4-T were obtained as previously described[000242] Animal models: aged SWISS mice, specifically females within a defined weight and age range, are employed in the experiments, housed, and cared for under specific conditions as per standardized guidelines.[000243] Tumor Detection and Measurement: Spontaneous mammary tumors were detected via palpation and monitored through caliper measurements taken weekly.[000244] Mice were treated with SL4-C (10A4 cells / injection), SL4-Tr (10A4 cells / injection) and SL4-T (10A4 cells / injection) weekly, by i.v. injection.Table 4. Spontaneous mammary tumors size reduction percentage relative to day -1 (one day before injection) after SL4-C, SL4-Tr, and SL4-T treatment*p<0.05 compared to SL4-C#p<0.05 compared to SL4-Tr[000245] The cytokines were measured by ELISA kits. The plasma tumor necrosis factor alpha (TNF-a) level was measured using eBioscience® ELISA kits (Affimetrix, Santa Clara, USA).Table 5*p<0.05[000246] The disparate cytokine profiles post and SL4-T treatment underscore potential immunomodulatory properties, where SL4-T particularly emerges as a potent immunostimulant. Elevated cytokines pivotal for antitumor responses (like IFNy and IL-12) post-SL4-T treatment flag its prospective utility in harnessing and enhancing immune responses against tumors. The ability to significantly modulate cytokine profiles indicates potential applications in contexts requiring immunomodulation, such as cancer, infections, or immune disorders.[000247] Additionally, MRC fibroblasts were treated using multiple rounds of nuclease treatment, as described earlier. These cells were administered in various combinations and dosages to different mouse groups with spontaneous breast cancer.[000248] We next studied different routs of SL4-T administration as set forth in the Table below.Table 6*p<0.05 compared to control#p<0.05 compared to SL4-TrTn - granulocytes, agaranulocytes and platelets treated with nucleasesTa - granulocytes, agaranulocytes and platelets treated with antinucleic acid antibodies The data received show that SL4-T cells were more active compared wot SL-Tr celldPancreatic cancer model[000249] We investigated the efficacy of various types of treated cells and their supernatants / products in treating advanced pancreatic cancer. The SL4-T cells were procured as previously outlined with a cell:EV ratio ranging from 1 :1 to 1 :100. The supernatants / products derived from these cells, referred to as P-SL, were obtained following the procedure described subsequently. To prepare P-SL 1 ml of white blood cells were combined with 1 ml of LPS at a final concentration of 5 ng / ml and incubated for 60 minutes at 37°C. Subsequently, the suspension was centrifuged at 3000 rpm, the supernatant was collected and passed through a 0.22 pm filter.[000250] After activation, we obtained the P-SL by filtration, then to eliminate the possibility of LPS remaining in the obtained filtrate (directly in the P-SL4), polymyxin B was added to a series of samples at a final concentration of 1 pg / ml. The supernatant was incubated for 60 minutes at 37°C, 5% CO2.PANC-1 Cell Cultivation and Transplantation Summary:[000251] Cultivation: PANC-1 cells were grown in 25 cm2flasks for adherent cultures, subcultured every 3 days using trypsin-EDTA, and maintained at 37°C in 5% CO2. Viability was assessed by MTT, requiring at least 90% viability.Medium: Cultured in DMEM with 10% FBS. For transplantation, cells from passages 5-10 were used.Preparation: Cells in exponential growth were trypsinized, centrifuged, counted, and resuspended in serum-free DMEM at 5x10A7 cells / ml for transplantation.Transplantation: For subcutaneous injections into mice we used an insulin syringe with a 27G needle, inserting intradermally at the withers. Cell suspension (5x10A6 cells in 100 pl DMEM) is injected slowly to form a papule, ensuring no leakage.Animal Model: Female C57BL / 6 mice received 3x10A6 PANC-01 cells in Matrigel flank injections. Treatment began when tumors reached ~100 mm3.[000252] This concise method outlines the cultivation, preparation, and transplantation techniques for PANC-1 cells into mice for cancer research.Table 7. Treatment groups[000253] Data received are presented in Figure 2, titled Effect of treated cells and their Supernatant on solid tumors that shows the dynamics of tumor size growth after SL4-C / SL4-T and P- SL4-C / P-SL4-T treatment based.[000254] As seen in Figure 2, compared to SL4-C, the SL4-T revealed a reduction in the tumor size. Similarly, while P-SL4-C displayed an increase in tumor size. P-SL4-T demonstrated a notable reduction in tumor size, similar to that of the performance of SL4-T against solid tumors.Example 4. The use of treated cells for the treatment of solid tumors.Ethical Consideration and Compliance[000255] Patient data has been anonymized and / or utilized with explicit patient consent for research and publication. Adherence to relevant ethical guidelines and regulatory compliance.Patient #1[000256] Male, 74 y.o. Lung Cancer, Stage 11 IB. T4N2M0. G3. Large-cell carcinoma. Previously treated with chemotherapy (Etoposide + Cisplatin), 3 cycles, without effect, tumor growth persisted. The decrease of the largest diameter is 17% with no new lesions, refers to Stable Disease (SD) according to RECIST 1.1.Patient #2[000257] Male, 85 y.o Squamous Cell Carcinoma of the oral cavity floor, T4N0M0, G2-G3.[000258] Figure 4 shows SL4-T i.v. allogeneic and autologous, weekly or daily, intermittent course, from 10A6 to 10A9 per injection. The decrease of the largest diameter is 16.2% with no new lesions, refers to Stable Disease (SD) according to RECIST 1.1.Patient #3[000259] An 82-year-old male presented with shortness of breath on minimal physical exertion and chest pain on the right side on deep inspiration. Chest computed tomography (CT) suggested a tumor in the right lower hilum with lesions measuring 18.3 x 16.7 mm and 11 .9 x 8.2 mm, as well as a 6.5 x 5.1 mm lesion in the S3 segment of the right lung, and mediastinal lymphadenopathy and pleural effusion, from which 2,700 mL of fluid was aspirated (Figure 1). Hydrothorax and right lung atelectasis complicated CT diagnostics. Cytological analysis of the pleural fluid confirmed lung adenocarcinoma, and tumor cells were positive for thyroid transcription factor-1 and Napsin A and negative for D2-40, as confirmed through biopsy (Figure 2 B). Routine blood biochemistry and pulmonary function tests showed no significant abnormalities.[000260] Surgical treatment was not feasible due to tumor spread and the patient's condition. The patient received two cycles of chemotherapy (etoposide 100 mg / m2, days 1-3, intravenously). A chest CT after two cycles showed no tumor response, with a large pleural effusion exceeding 2,000 mL.[000261] Given the lack of response and progressive decline of the overall condition, experimental SL4-T therapy was initiated.[000262] SL4-T allogeneic and autologous, Intravenous - Every 3 days; Intrapleural - Weekly for three times, from 10A6 to 10A9 per injection.[000263] The SL4-T treatment was initiated. SL4-T was cryopreserved prior to administration, and administered to the patient immediately after thawing at a dose of 1 x 107 to 4 x 108 cells per injectiononce or twice daily, five times a week. For the intrapleural administration, SL4-T was administered at the dose of 1 x 10A6 to 1 x 10A8.[000264] SL4-T therapy was well tolerated by the patient, without any immunological adverse effects, typically associated with other cell-based therapies, including graft-versus-host disease, cytokine release syndrome, or immune effector cell-associated neurotoxicity syndrome.[000265] Following the first 3 weeks of therapy, CT was performed to assess the efficacy of SL4-T therapy. A stable disease response, according to RECIST 1.1 criteria, was observed, with no tumor growth in S6 and an 80% reduction in S3 (from 6.5 x 5 mm to 4 x 2 mm) (Figure 1). Furthermore, the pleural fluid progressively decreased throughout treatment. The patient reported improved breathing function, reduced pain, and less fatigue. Repeated pleural fluid cytology revealed the disappearance of the tumor cells, along with a reduction in pleural effusion volume (Figure 2C).[000266] The SL4-T therapy was continued. A CT scan on week 8 revealed positive dynamics with partial response according to RECIST 1.1 criteria (Figure 1). Specifically, one lesion in S6 totally disappeared, whereas the second lesion showed only a marginal decrease from 12 x 8 mm at baseline to 11 x 7 mm. The lesion in S3 completely resolved.[000267] The volume of pleural fluid continuously decreased to 50-100 ml_. SL4-T therapy was continued for another 14 weeks, and a CT scan was performed. By week 22 of treatment, no new nodules were observed, all lesions in S6 had disappeared, and the remaining tumor mass in S3 was no longer visible. Due to lung atelectasis, a fine-needle biopsy was performed in the areas corresponding to the initial tumor lesions in S6. Histology revealed no cancer cells, only fibrotic tissues. These findings, along with the CT results, were considered a complete response according to RECIST 1.1 criteria (Figure 2). The patient was monitored for another 6 months following the completion of SL4-T therapy, with no evidence of disease. Figure 5 shows SL4-T i.v. allogeneic and autologous, Intravenous - Every 3 days; Intrapleural - Weekly for three times, from 10A6 to 10A9 per injection.[000268] Figure 5. Comparison of pre- and post-therapy radiographic evaluation scans of the patient with lung adenocarcinoma during the therapeutic course of SL4-T. (A) Computed tomography (CT) scan of the patient before SL4-T therapy showing the tumor lesions in S6 (18.3 x 16.7 mm and 11.9 x 8.2 mm) and S3 (6.5 x 5.1 mm) of the right lung. (B) CT scan after 24 days of SL4-T treatment showing reduction in S6 (18.1 x 16.7 mm and 11.2 x 7.8 mm) and S3 (4.3 x 2.3 mm) lesions. (C) CT scan after 50 days of SL4-T showing partial response; one lesion in S6 disappeared, and the second lesion stabilized (11.1 x 7.1 mm), with further reduction in S3 (4 mm). (D) After 146 days of the therapy, tumor lesions in S6 and S3 disappeared, as confirmed using CT.[000269] Figure 6. Hematoxylin and eosin staining of samples at different disease stages. (A) Circulating tumor cells in pleural fluid at diagnosis showing the classic cytological pattern, including very large, polygonal cells with abundant granular cytoplasm and prominent nucleoli in large nuclei (magnification x200). (B) Tumor biopsy at the diagnosis showing typical gland-like formation and solid nests, characteristic of lung adenocarcinoma (magnification x200). (C) After three intrapleural injections of SL4-T, pleural fluid microscopy revealed the presence of red blood cells, neutrophils, and mucus, with no signs of tumor cells (magnification x200). (D) Biopsy of the right lung at 146 days of SL4-T therapy revealed mild fibrotic and scar-like changes, with alveolar septal thickening and post-therapeutic scarring.Patient #4[000270] Female, 56 y.o. Adenoid cystic carcinoma (ACC) of the right parotid gland. The patient underwent chemo- and proton beam radiation therapy.[000271] SL4-T i.v. allogeneic and autologous, Intravenous - Every 3 days; from 10A6 to 10A9 per injection.[000272] Figure 7 showed the decrease of the largest diameter is 34.0% with no new lesions, refers to Partial Response (PR) according to RECIST 1 .1 .Patient #5[000273] Female, 40 y.o. Krukenberg tumor (Post-gastrectomy due to gastric adenocarcinoma) with ascites and canceromatosis.[000274] Figure 8 shows SL4-T i.v. allogeneic and autologous, Intravenous - Every 3 daysfrom 10A6 to 10A9 per injection.[000275] The decrease of the largest diameter is 7.0%* with no new lesions, refers to Stable Disease (SD) according to RECIST 1 .1 . Dynamics of patient’s weight is shown in Table 8Table 8Patient #6[000276] Pediatric Adrenal Neuroblastoma, Malignant neoplasm of retroperitoneum (C48.0).[000277] Stage 4. Chemo- and immunotherapy failed.[000278] Figure 9 shows SL4-T i.v. allogeneic and autologous, Intravenous - Every 3 days; from 10A6 to 10A9 per injection.Table 9. Summary of biochemical response to SL4-T therapy.[000279] The decrease of the largest diameter is 7.0% with no new lesions, refers to Stable Disease (SD) according to RECIST 1 .1 .[000280] During the treatment course, the patient reported a gradual alleviation in weakness and an enhancement in overall vitality. Notable decrease in the frequency and intensity of chest pain and improvement in breathing capacity during activities. Appetite incrementally improved, and weight stabilized, suggesting a possible reversal in cachexia. Reduction in the incidence of night sweats and no further episodes of fever were reported.[000281] Results: CT scans demonstrated a shrinkage of tumor size with no evident progression or new metastatic formations.[000282] Symptomatic Changes: Remarkable improvement in quality of life, reduced symptom burden, and augmented daily functional capacity.[000283] The symptom alleviation and stabilization suggests clinical utility of allogeneic and autologous SL4-T in the management of cancers including those unresponsive to available therapies.Patient #7 Rare cancers[000284] A 79-year-old female patient presented with metastatic liver disease unresponsive to chemotherapy. She had been diagnosed with pancreatic adenocarcinoma (pT3N0M0) in 2023 and underwent corporocaudal resection with splenectomy. Later multiple liver metastases were identified. Due to her poor performance and nutritional status, she was not considered a candidate for surgical resection. [000285] The patient received capecitabine (1000 mg / m2, BID), followed by seven cycles of chemotherapy with capecitabine plus oxaliplatin (XELOX). Subsequently, capecitabine therapy (1000 mg / m2, BID) was resumed. The patient tolerated capecitabine poorly, experiencing significant nausea, and due to lack of therapeutic response, chemotherapy was discontinued, and supportive therapy with tramadol was initiated.[000286] Given the lack of response to existing therapies, experimental SL4-T therapy was recommended. Administration of SL4-T was approved by the Institutional Review Board, and the study was conducted according to the approved protocol.[000287] At baseline examination in November 2024, laboratory results revealed elevated CA 19-9 (8420 U / mL), D-Dimer (1200 ng / mL FEU), ferritin (950 ng / mL), lactate dehydrogenase (LDH; 510 U / L), total bilirubin (2.63 mg / dL), alanine aminotransferase (ALT; 85 U / L), and aspartate aminotransferase (AST; 92 U / L) (Table 1). The serum albumin level was decreased to 2.8 g / dL.[000288] Further diagnostic evaluation via magnetic resonance imaging (MRI) (Fig. 1 A, B) revealed multiple hepatic lesions of 3.3 cm, 2.7 cm, and 1.3 cm in size, along with additional metastatic lesions in segments S4 (1 .9 x 2.2 cm) and S7 (2.0 x 2.4 cm). SL4-T therapy was initiated in November 2024 at doses ranging from 1 x 10Λ7 to 1 x 10Λ8 cells per injection, administered once or twice daily, two to seven times weekly. Cryopreserved infusions were administered to the patient over two weeks. SL4-T therapy was well tolerated, with no signs of cytokine release syndrome, graft-versus-host disease, or immune effector cell- associated neurotoxicity syndrome. Mild fever (maximum 37.7 °C) occurred episodically within three hours post-injection, resolving within four hours with symptomatic management.[000289] After the first 30 days of treatment, blood markers indirectly reflecting tumor progression showed improvement (Table 1). CA 19-9 decreased to 4256 U / mL, D-Dimer to 874 ng / mL FEU, ferritin to 740 ng / mL, and LDH to 312 U / L. Total bilirubin (2.05 mg / dL) and AST (65 U / L), although still elevated, showed a downward trend, while ALT slightly increased to 91 U / L. Albumin levels increased to 3.6 g / dL, returning within normal range. Given these positive trends, therapy continued. By day 70, laboratory markers further improved (Table 1): CA 19-9 decreased to 1547 U / mL, D-Dimer to 790 ng / mL FEU, ferritin to 487 ng / mL, and LDH to 278 U / L. Total bilirubin was 2.11 mg / dL, ALT 52 U / L, AST 56 U / L, and albumin increased slightly to 3.8 g / dL.[000290] MRI evaluation on day 74 post-initiation of SL4-T therapy demonstrated significant improvement (Fig. 1 B). Two liver lesions completely disappeared, and the largest lesion shrank from 3.3 cm to 1 .3 cm. Lesions in S4 and S7 also notably reduced to 1 .3 x 1 .1 cm (from 1 .9 x 2.2 cm) and 2.0 x 1 .1 cm (from 2.0 x 2.4 cm), respectively. The patient continues SL4-T therapy.Table 10EXAMPLE 5: Effect of treatment on generating autologous cells with enhanced anticancer activity.[000291] Female NOD SCID mice were implanted with Raji cells and treated with human CD19 CAR T cells. For that we T-cells which were treated from 3 to 12 cycles of DNase and RNase at 40 ug / mL either with leaving them together with the EV or with EV being removed (washed out) were further used for the production of CD19 CAR-T as previously described (Wang X, Riviere I. Clinical manufacturing of CAR T cells: foundation of a promising therapy. Molecular Therapy-Oncolytics. 2016 Jan 1 ;3). After that the resulted cells were used to treat female NOD SCID (CB17-Prkdcscid / NcrCrl) mice on day 8 after subcutaneously implantation of 7.0 Iog10 Raji cells (Table 2).Table 11 : The utilization of treated cells in the generation of CAR-T cells.*p<0.05 compared to CAR-T control# p<0.05 compared to CAR-T made from treated WBC (when T-cells were treated with the nucleases with the EV being removed)[000292] These data surprisingly demonstrate that the use of treated cells for the production of CAR-T cells results in the formation of cells with a high level of anticancer activity. Additionally, we investigated the potential of treated tumor-infiltrating lymphocytes (TILs) from pancreatic adenocarcinoma. TILs were expanded and either left untreated (TIL-C) or treated with DNase and RNase at 1 pg / mL (TIL-T1 , TIL-T2), stimulated with anti-CD3, and co-cultured with irradiated PBMCs. The efficacy of TILs was assessed by IFN-y levels after co-cultivation with a pancreatic cancer cell line.This study evaluates the impact of nuclease treatment on CAR-T cells and TILs against cancer, with findings suggesting enhanced anticancer activity (Table 3).Table 12: Effect of Cell Treatment on Their Anticancer Responses. The data clearly show that treatment of immune cells resulted in a significantly higher anticancer response.*p<0.05Example 6. The Use of Tuned Cells for Cancer Prophylaxis and Post-Surgical Treatment[000293] A 58-year-old patient was diagnosed with a single colorectal polyp, accompanied by an elevation of her carcinoembryonic antigen (CEA) levels to 22.1 ng / mL, significantly higher than the normal CEA values (< 4.3 ng / mL). Following laparoscopic removal of the polyp, the patient underwent therapy involving daily intravenous injections of SL4-T cells for 7 days. After the therapy concluded, the CEA level decreased to 2.5 ng / mL. The patient's CEA levels were monitored every six months through blood tests. Twelve months post-therapy, the CEA levels remained within the normal range. The data received indicate that the use of tuned SL4-T cells can be effective for the prophylaxis of cancer as well as in managing patients post-surgically after the removal of neoplasms.Example 7. The use of treated cells in combination with other anticancer therapies.[000294] A n11 -year-old child with neuroblastoma. Stage IV, that showed poor response to standard chemotherapy regimens (Temozolomid, per os and Irinotecan i / v).[000295] SL4-T could potentiate the effects of chemotherapy and mitigate its side effects.Administered at a dose of 10A6 cells / ml daily i / v for the first four weeks, SL4-T was closely monitored for its impact on the child's health and ameliorating the severity of chemotherapy.[000296] Over the course of 2 months, remarkable improvements were observed. The size of the neuroblastoma tumor reduced by 60%, a significant reduction that was corroborated by MRI scans. Furthermore, the levels of tumor markers in the blood decreased by 150% from their baseline levels, indicating a substantial decline in the presence of cancerous cells (Table 1).[000297] The side effects profile before and after the introduction of SL4-T illustrated a dramatic change in the child's experience of chemotherapy. Nausea and vomiting, previously reported at a frequency of 90%, dropped to 30%. Other severe side effects such as neutropenia, skin lesions, and fatigue saw similar declines in frequency, making the chemotherapy process considerably more tolerable for the young patient. Notably, even the more common side effects like hair loss, mucositis, and anemia were significantly reduced, further evidence of the positive impact of SL4-T on mitigating the negative aspects of cancer treatment (Table 2).Title 13: Neuroblastoma size and tumor markers levels reduction.Table 14. Side effects during chemotherapy + SL4-T.Scoring system: O-None; 1-Mild; 2-Moderate; 3-Severe; 4- Very severeExample 8. The effect of antimicrobial and anticancer products produced by treated cells[000298] We analyzed the activity of products and supernatants from SL4-C, SL4-Tr and SL4-T, which are referred to as P_4C, P_4Tr, and P_4T, respectively. Also, some cells were treated with anti- DNA and anti-RNA antibodies SL4-Ta. Supernatants from SL4-C and SL4-T were collected, and protein levels were equalized between the samples. This was done by first determining the protein amount using the Bradford assay, followed by quantification with Coomassie brilliant blue dye binding.Title 15. Antibacterial activity of products obtained from SL4-C, SL4-Tr and SL-T against bacteria.na - not active *p<0.05 to control #p<0.05 to Tr[000299] Across all microbial strains, P_4T / Ta consistently demonstrated superior inhibitory effects compared to P_4C or to P_4Tr.Activity of Products Secreted by Cells of Various Organisms[000300] We analyzed the products secreted by white blood cells against microorganisms using multidrug resistant strain of Pseudomonas aeruginosa MR45. Prestimulation was done by adding bacterial LPS to WBC for 45 min.Table 16. Antimicrobial effect of products against P. aeruginosa. (Table below)[000301] Data received demonstrate that the treated cells of different organisms following the activation produce highly active Products.[000302] Production of Products Using Different subsets of cells[000303] The study presented showcases the production and efficacy of Products, utilizing different activators across various cellular fractions. The main aim was to identify the optimal combinations that offer the highest antimicrobial efficacy, using the test strain Aspergillus niger. Granulocyte and agranulocyte fractions were obtained from buffy coats using gradient centrifugation at densities of 1 .077 and 1 .119. SL-4C / SL-4T - the whole subset of all WBC and plateletsTable 16. Antimicrobial effect of products against Aspergillus spp[000304] We next analyzed the effect of bacterial stimulators on SL-4C and SL-4T, where we showed that the pretreating of the SL-4T with Klesiella spp significantly increased their antimicrobial activity. We marked prestimulated cells as “ps”Table 17. Inhibition of biomass S. aureus biofilms (24h and 48h- old)[000305] Data received in the Table 17 above highlights that the antimicrobial activity of Products can be increased in treated cells following their prestimulation.[000306] Efficacy of products from treated cells on cancer cell viability[000307] The study aimed to evaluate the effect of various Products post stimulation (psP) on the viability of the H1299 and T98G cancer cell linesTable 18.*p<0.05 to control#p<0.05 to Tr[000308] Effect of Products produced by treated cell for the treatment of infections[000309] The provided data illustrated the effect of treated cells on sepsis by tracking body temperature variations in murine subjects following sepsis induction. These variations were measured at two distinct time intervals: 40 hours and 48 hours.[000310] A mouse model of sepsis using fecal suspension intraperitoneal injection was used as described by Tsuchida et al ( see, Tsuchida, T., Wada, T., Mizugaki, A., Oda, Y., Kayano, K., Yamakawa, K., & Tanaka, S. (2022). Protocol for a Sepsis Model Utilizing Fecal Suspension in Mice: Fecal Suspension Intraperitoneal Injection Model. Frontiers in Medicine, 9.)[000311] In a disclosed system utilizing murine models’ post-sepsis induction, bacteremia levels were quantitatively evaluated by measuring blood culture concentrations, presented in log Colony Forming Units per milliliter (CFU / ml). The resultant data, recorded 20 hours post-sepsis induction, is articulated in the Table below:Table 19*p<0.05 to control#p<0.05 to Tr[000312] This quantification suggests enhanced efficacy of the antimicrobial and anticancer products (AMPs) produced by the SL4-T formulation, compared to AMP_4C (derived from untreated white blood cells), AMP_4Tr (produced by cells treated with nucleases but with extracellular vesicles removed and washed out during and after treatment), and the saline control, in mitigating bacteremia following sepsis induction.[000313] Physical properties of Products produced by SL-4T cellsTable 20: Assessment of the antibacterial activity of P following heat exposure for 30 minutes.RTRoom temperature; na not activeTable 21 . Antibacterial activity of Products against bacteria after trypsin exposure.S. aure usVT55na not activeExample 9. Effect of different activators on treated cells to produce more products.[000314] We treated SL4-T cells with various activators to generate biologically active products, using SL4-C products as a control. Both SL4-C and SL4-T, prepared as previously described with DNase, RNase, or antibody treatments, were subjected to activators, altering their secretions' properties. We evaluated the anticancer and antimicrobial effects of these products on various cancer cell lines and microbial isolates. Cancer cells were cultured in RPMI 1640 with 10% FBS to full confluency for 48-72 hours at 37°C and 5% CO2. MICs were determined using the broth microdilution method, following CLSI guidelines with modifications. Bacterial and fungal inoculums were standardized for testing, with outcomes detailed in Table 1.Table 22. Concentration of products produced by different cells resulting in reducing viability of 50% cells.n / a not active; *p<0.05[000315] Data received indicate that immune cells following treatment and subsequent activation started to produce more potent products active against different pathogenic gram-positive, gram negative bacteria and fungi.Example 10. In vitro antimicrobial susceptibility testing:[000316] The minimum inhibitory concentrations (MICs) for the tested cells were determined using the broth microdilution method, following the Clinical and Laboratory Standards Institute (CLSI) guidelines with minor modifications. For bacterial testing, a standard bacterial inoculum of 5 x 1 OA5 colony-forming units (CFU) / mL was employed. In fungal testing, the standard inoculum size for yeast was set at 2.5 x 10A3 CFU / mL, while for molds, it was 5 x 1OA4 CFU / mL. The minimum fungicidal concentration (MFC) was defined as the lowest concentration of the antimicrobial agent that completely inhibited visible fungal growth after 48 hours at 37°C. Microbial isolates were categorized as susceptible, intermediate, or resistant, based on susceptibility breakpoints for antifungals according to both CLSI and the European Committee on Antimicrobial Susceptibility Testing (EUCAST) criteria. Serial twofold dilutions of the antimicrobials were prepared in RPMI 1640 medium. The MIC was determined as the lowestconcentration of cells that completely inhibited visible growth of the bacteria or fungi. All experiments were conducted in triplicate.Table 23. Names of the probesResultsIn vitro antimicrobial susceptibility testing of SL4 is presented in the Table 23(b).Table 23(b)*p<0.05 to control#p<0.05 to TrIn vitro antimicrobial susceptibility testing of different tested products is presented in the Table 24.Table 24The data received indicate that treatment enhanced the antimicrobial activity of cells against a wide range of Gram-positive and Gram-negative bacteria, both aerobic and anaerobic, as well as against various fungi. Surprisingly, the activation of the cells with nucleases in the presence of EV from these cells increased the specific activity of the immune cells.Example 11 Antibiofilm activity of treated cells[000317] Treated cells efficacy was evaluated in a biofilm model using a 96-well plate with 200 pL of 5 x 1OA5 CFU / mL bacterial suspension in LB broth, incubated at 37 °C for 24 hours to form biofilms. After incubation, biofilms were washed with PBS, exposed to RPMI 1640 with tested cells for 24 hours, and then assessed by OD600 measurements, with all procedures done in triplicate.[000318] White blood cells were modified with DNase and RNase or with specific anti-DNA and anti-RNA antibodies, produced by immunizing rabbits with nucleic acids from different gram positive and negative bacteria and Freund's adjuvant. Additionally, human bone marrow CD34+ stem cells and fibroblasts, the latter isolated from juvenile foreskin and cultured through several passages, were also treated with DNase and RNase treatments for comparison. The results of biofilm’s biomass quantification after the treatment with different cells are presented in Table 1 . For P. aeruginosa biofilms we used treated cells the low dose of 10*3 cells / mL.Table 25. The effect of cells on the inhibition of the biofilm biomass.*p<0.05; C-untreated; T-treated with nucleases, Ta-treated with anti-DNA / RNA antibodiesExample 12[000319] The activity of treated immune cells against persisters was analyzed. In order to obtain persisters, E. coll ATCC 25922 was inoculated in LB broth supplemented with ampicillin (150 pg / mL), and incubated at 37 °C for 24 h. After that cells were collected and treated with SL4-C or SL-4T for 10 minutes. Subsequently, bacteria were inoculated again on LB agar and the number of viable counts was evaluated.Table 26. Effect of treated cells on persisters.*p<0.05Example 13. Antimicrobial activity using chicken embryo sepsis model and evaluation of the safety of allogeneic treated cells.[000320] Bacteria Preparation:[000321] We used Staphylococcus aureus VT-232, Klebsiella pneumonia VT-678, andPseudomonas aeruginosa VT-548 strains. The bacterial cells were cultured on 5% blood agar, then inColumbia broth to OD 0.50 at 540 nm, centrifuged, and resuspended in 0.9% NaCI.[000322] Chicken Embryo Inoculation: Used pathogen-free eggs, incubated at 37°C and 65% humidity.[000323] At 12 days, embryos were intravenously inoculated with 0.1 ml bacterial suspension.Viability checked by candling post 5 hours and daily for 4 days.[000324] Injection of Testing Cells: Administered 0.1 mL of SL4-C, SL4-T, or saline (control) 3 hours after bacterial inoculation.[000325] Bacterial Strain Distribution: Collected and homogenized samples from blood, liver, and brain to determine CFU / ml.[000326] Results: Control group showed 0% mortality, confirming non-toxicity of agents.[000327] SL4-T treatment significantly reduced mortality in embryos infected with SA, KP, and PA strains, demonstrating its protective effectiveness against bacterial infections.Table 27. The effect of treated cells on the protection from septic related mortality.*p<0.05Example 14. Effect of treated cells on mouse sepsis modelSepsis Model Utilizing Fecal Suspension[000308] A total of 8,000 mg of mouse feces were collected and resuspended in 55 ml_ of 0.9% saline solution. During the preparation phase, the feces were manually macerated using a tea strainer until thoroughly soaked in the saline. The macerated feces were then filtered through the same strainer with the aid of a grinding rod, processing the material until it reached a non-gritty consistency. For further refinement, the fecal suspension was passed through a 70 pm filter. The suspension was thoroughly mixed, and 1 mL was intraperitoneally injected using a 25-gauge needle into the mouse's intraperitoneal cavity.[000309] SL4-T cells were generated as described above. Different subsets of SL4-T products containing EVs of varying size ranges (from 10 nm to 10,000 nm) were obtained using differential centrifugation protocols, ranging from low-speed centrifugation to ultracentrifugation. The mice were treated with saline, SL4-C, or SL4-T 6 hours after the induction of sepsis.Bacterial load 40h and 46h after sepsis induction[000310] The number of colony-forming units (CFU) was evaluated by plating the blood on LB petri dishes (Table 3).Table 27. Blood culture [Iog10 CFU / ml],*p<0.05 SL4-T compared to control#p<0.05 SL4-T compared to SL4-Tr[000311] Also, the potential accumulation of DNase and RNase I nthe different components of EVs was analysed. For that, different fractinos of EVs aobtained after the last cycle of nuclease treatement of SL-T were anssayed for the residual DNase and RNase activity based on the alteration of the OD260 or OD230 when EVs were added to the control DNA or RNA molecules respectfully. The results are present in the table belowTable 28. The level of the residual DNase and RNase in the EVs of SL4-TExample 15. The Effect of Treated Cells on Enveloped and Non-Enveloped Viruses.[000312] The treated SL4-T were obtained as previously discussed following the repeated treatment with nucleases or ant-DNA or anti-RNA antibodies.[000313] In vitro log reduction virucidal assay[000314] The cell cultures were grown in tissue culture media (Eagle’s Minimum Essential Medium (MEM) supplemented with 10% fetal bovine serum (all Sigma , MO). For the log reduction virucidal assay from 106plaque-forming units per milliliter (PFU / mL) of viruses were used. 0.1 ml of each testing cells were added to 0.9 ml of each of viruses tested, thus the final concentrations were diluted in 10 times. The viral mixtures were incubated at 37C for 2h, and next 0.01 ml aliquots were taken and dissolved in 990 ml of the appropriate tissue culture. Next, the viral titers were Log10 converted and for each tray Log10 reductions compared to negative control (vehicle) were calculated. The results were plotted as Log10 at each time bin. The reduction in viral titer of 3Log10 (99.9%) were considered to be virucidal. Figure 11 . in vitro virucidal activity of SL4-T. Data received shown in Figure 11 shows antiviral activity of treated cells against enveloped and non-enveloped viruses.Example 16. Efficacy of inhaled treated immune cells for the treatment of respiratory infections[000315] To study the efficacy of treated cells, a single inhaled drug was evaluated in mouse model of pneumonia.To develop pneumonia, adult C57BL / 6 mice were used. Animals were randomized into three groups of eight, which were used to measure overall survival following thew treatment with saline, SL4-C or SL4-T. Mice were then anesthetized with 2 % isoflurane, and nasally instilled with P.aeruginosa suspension. Briefly, nares were blocked, and mice aspirated 50 pL P.aeruginosa VT57 into the lungs while being held vertically for 60 s. Mice received a total dose of 8.5 log cFU / mouse. Overall survival was assessed over 5 days.[000316] After 8h post infection, mice were placed in a chamber of 40 dm3and using a connected PARI BABY® N compressor and PARI LL Nebuliser saline, SL4-C or SL4-T were dispersed in the camera. The inhalation dose was adjusted to the length of time the animals were being placed in the experimental chamber. The period of time during which the animals were exposed to the inhalation was determined by the formula:Length of inhalation = Dose (cells / kg) / A x B, whereA - the maximum possible concentration of the tested compound in the aerosol (in the chamber), was based on the technical characteristics of the nebulizer, determining the rate of aerosol formation;B - a minute ventilation of mice - 2.67 L / kg body weight of animals;Time of inhalation of a therapeutic dose was 8.3 min. The results are shown in table 29.Table 29. Median survival following treatment with different tested therapies.*p<0.05 compared with SL4-TExample 17. The use of treated cells for the treatment of chronic infections[000317] The research aimed to assess treated cells' effectiveness in treating delayed wound healing in diabetic ulcers with polymicrobial biofilms in a mouse model. Using clinical isolates S. aureus MRSA VTR71 , P. aeruginosa VR-465, and E. faecalis VT-23, bacteria were cultured on Mueller-Hinton agar, followed by broth subcultures. MICs were determined by CLSI standards. The study involved 16 diabetic female mice (db / db; BKS.Cg-Dock7m + / + Leprdb / J), 12 weeks old, anesthetized and subjected to a full-thickness wound. A mixed biofilm inoculum (8.15log10 CFU / ml) was applied to each wound after 3 days of initial bandaging.[000318] Group 1 : White blood cells+platelets (untreated); Group 2: White blood cells+platelets+ fibroblasts (untreated) ; Group 3: White blood cells+platelets (treated, with EV); Group 4: White blood cells+platelets+ fibroblasts (treated, with EV). Group 4: White blood cells+platelets+ fibroblasts (treated, without EV).[000319] The percentage of wound closure was determined using the equation: (Ad0-Adx) / Ad0 x 100%, where AdO is the wound area on day 0 and Adx is the area of the wound on the observation day.Table 30. Effect of tested cells on polymicrobial biofilm dynamics within chronic wounds.*p<0.05 to control#p<0.05 to the cells with EV washed out during the nucleases treatmentExample 18. The Impact of Immune Cell Treatment on the Transcriptome Activity in Antimicrobial Pathways of Immune Cells.[000320] SL4-C and SL4-T were obtained as previously described. To isolate RNA from cells, the cell suspension were washed thrice in PBS, pH 7.2 (Sigma) and centrifuged each time at 4000x g for 20 min (Microfuge 20R, Beckman Coulter) followed by resuspension in PBS.[000321] RNA was purified using the RNeasy Mini Kit (Qiagen), according to the manufacturer’s protocol. The concentration and quality of RNA based on absorbance at 230, 260, and 280 nm was determined with the NanoDrop OneC spectrophotometer (Thermo Fisher Scientific).[000322] Transcriptome sequencing (RNA-Seq) libraries were prepared using an Illumina TruSeq Stranded Total RNA Library Prep kit. RNA was ribo-depleted with the Epicenter Ribo-Zero magnetic gold kit (catalog No. RZE1224), according to the manufacturer’s recommendations. The libraries were pooled equimolarly and sequenced in an Illumina NextSeq 500 (lllumona, San Diego, CA, USA) platform with paired 150-nucleotide reads (130MM reads max).[000323] Sequencing reads were mapped corresponding to the reference genome of human immune cells, and expression levels were estimated using Geneious 11.1.5. Transcripts with an adjusted p value of <0.05 and Iog2 fold change value of ±0.5 were considered for significant differential expression. PCA, volcano plots were generated using the ggplot2 package in R, and the Venn diagram was obtained using BioVenn. Differentially expressed genes (DEGs) were identified as genes with a twofold change (Iog2 fold-change > 0.5 or <-0.5) and false discovery rate < 0.05. The results are set forth in Table 31 below.Table 31.Example 19. Effect of Treated Cells on Chronic Inflammatory Diseases[000324] We investigated the effectiveness of treated cells in a model of interstitial cystitis, a disease characterized by mast cell abnormalities and alterations in the p38 / NF-KB pathway. A chemically induced rat model of interstitial cystitis was used. Adult female Wistar rats (180-230 g) were anesthetized with isoflurane. Their bladders were catheterized, the urine was removed, and 200 pl of 0.1 N HCI was instilled for 4 minutes. This process was repeated after one week. Forty-eight hours following the second HCI instillation, rats under isoflurane anesthesia received intravesical instillations of either SL4-C or SL4-T (10A6 cells in 50 pl of PBS) or SL4-C or SL4-T (10A6 cells in 10 pl of PBS), injected into both the posterior and anterior bladder walls. This procedure was repeated every 72 hours, three times in total. The levels of TNF-a and histamine in urine were analyzed using the ELISA method 7 and 14 days after the last therapy with SL4-C / SL4-T (Table 1).Table 32. Severity of Interstitial Cystitis.*p<0.05 compared to SL4-CExample 20. The effect of treated cells on intracellular parasites.[000325] We studied the effect of SL4-C and SL4-T on the malaria-related protozoan Plasmodium falciparum. Both SL4-C and SL4-T were obtained as described previously.[000326] P. falciparum was cultured in human type O blood and ATCC Medium 2196, following the manufacturer's instructions, with the goal of maintaining parasitemia at 3-5% in the red blood cell culture. The samples were incubated with various dilutions of SL4-C and SL4-T for 72 hours. Subsequently, the quantity of histidine-rich protein 2 (HRP2) produced by P. falciparum was measured using an HRP2 ELISA, according to the manufacturer's guidelines. The individual inhibitory concentrations 50% (IC50) and 90% (IC90) were calculated. The results are presented in Table 1.Table 33. Antiparasitic Activity Against Malaria of SL4-C and SL4-T Depending on Their Dilution.*p<0.05Example 21. The use of treated cells to increase productivity of mammalian cell lines.[000327] We utilized Chinese hamster ovary (CHO) cells expressing monoclonal antibodies Seq 1- 5, with treatments as follows: control (CHO-C), DNase and RNase-treated with the presence of the EV released by these cells (CHO-T), DNase and RNase-treated with the EV removed (CHO-Tr), and anti- DNA / RNA antibody-treated (CHO-Ta). Maintenance was in shake flasks before scaling to 5L bioreactors (Eppendorf), with a daily vessel volume exchange. See Figure 12 for the impact of treatment on Qp.We assessed CHO-T cell response to reduced nutrient medium volumes, examining viability and growth when daily exchange decreased from 1 vessel volume to 0.5 or 0.25. Analysis was conducted on day 10.Table 34. Viability of cells depending on volume of media used.*p<0.05 to control#p<0.05 to CHO-TrSeq ID No. 1. Siltuximab(Heavy chain)EVQLVESGGK LLKPGGSLKL SCAASGFTFS SFAMSWFRQS PEKRLEWVAE ISSGGSYTYY PDTVTGRFTI SRDNAKNTLY LEMSSLRSED TAMYYCARGL WGYYALDYWG QGTSVTVSSA STKGPSVFPL APSSKSTSGG TAALGCLVKD YFPEPVTVSW NSGALTSGVH TFPAVLQSSG LYSLSSVVTV PSSSLGTQTY ICNVNHKPSN TKVDKKVEPK SCDKTHTCPP CPAPELLGGP SVFLFPPKPK DTLMISRTPE VTCVVVDVSH EDPEVKFNWY VDGVEVHNAK TKPREEQYNS TYRWSVLTV LHQDWLNGKE YKCKVSNKAL PAPIEKTISK AKGQPREPQV YTLPPSRDEL TKNQVSLTCL VKGFYPSDIA VEWESNGQPE NNYKTTPPVL DSDGSFFLYS KLTVDKSRWQ QGNVFSCSVM HEALHNHYTQ KSLSLSPGK (Light chain)QIVLIQSPAI MSASPGEKVT MTCSASSSVS YMYWYQQKPG SSPRLLIYDT SNLASGVPVR FSGSGSGTSY SLTISRMEAE DAATYYCQQW SGYPYTFGGG TKLEIKRTVA APSVFIFPPS DEQLKSGTAS VVCLLNNFYP REAKVQWKVD NALQSGNSQE SVTEQDSKDS TYSLSSTLTL SKADYEKHKV YACEVTHQGL SSPVTKSFNR GEC(Disulfide bridge: H22-H96, H146-H202, H263-H323, H369-H427, H228-H'228, H231-H'231 , L23-L87, L133-L193, H222-L213)Seq ID No 2. Atezolizumab(Heavy chain)EVQLVESGGG LVQPGGSLRL SCAASGFTFS DSWIHWVRQA PGKGLEVWAW ISPYGGSTYY ADSVKGRFTI SADTSKNTAY LQMNSLRAED TAVYYCARRH WPGGFDYWGQ GTLVTVSSAS TKGPSVFPLA PSSKSTSGGT AALGCLVKDY FPEPVTVSWN SGALTSGVHT FPAVLQSSGL YSLSSVVTVP SSSLGTQTYI CNVNHKPSNT KVDKKVEPKS CDKTHTCPPC PAPELLGGPS VFLFPPKPKD TLMISRTPEV TCVVVDVSHE DPEVKFNWYV DGVEVHNAKT KPREEQYAST YRVVSVLTVL HQDWLNGKEY KCKVSNKALP APIEKTISKA KGQPREPQVY TLPPSREEMT KNQVSLTCLV KGFYPSDIAV EWESNGQPEN NYKTTPPVLD SDGSFFLYSK LTVDKSRWQQ GNVFSCSVMH EALHNHYTQK SLSLSPGK (Light chain)DIQMTQSPSS LSASVGDRVT ITCRASQDVS TAVAWYQQKP GKAPKLLIYS ASFLYSGVPS RFSGSGSGTD FTLTISSLQP EDFATYYCQQ YLYHPATFGQ GTKVEIKRTV AAPSVFIFPP SDEQLKSGTA SWCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC(Disulfide bridge: H22-H96, H145-H201 , H221-L214, H227-H'227, H23O-H'23O, H262-H322, H368-H426, H'22-H'96, H'145-H'2O1 , H'221-L'214, H'262-H'322, H'368-H'426, L23-L88, L134-L194, L'23-L'88, L'138- L'194)Seq ID No. 3 Erenumab (Heavy chain)QVQLVESGGG VVQPGRSLRL SCAASGFTFS SFGMHWVRQA PGKGLEWVAV ISFDGSIKYS VDSVKGRFTI SRDNSKNTLF LQMNSLRAED TAVYYCARDR LNYYDSSGYY HYKYYGMAVW GQGTTVTVSS ASTKGPSVFP LAPCSRSTSE STAALGCLVK DYFPEPVTVS WNSGALTSGV HTFPAVLQSS GLYSLSSVVT VPSSNFGTQT YTCNVDHKPS NTKVDKTVER KCCVECPPCP APPVAGPSVF LFPPKPKDTL MISRTPEVTC VVVDVSHEDP EVQFNWYVDG VEVHNAKTKP REEQFNSTFR VVSVLTVVHQ DWLNGKEYKC KVSNKGLPAP IEKTISKTKG QPREPQVYTL PPSREEMTKN QVSLTCLVKG FYPSDIAVEW ESNGQPENNY KTTPPMLDSD GSFFLYSKLT VDKSRWQQGN VFSCSVMHEA LHNHYTQKSL SLSPGK (Light chain)QSVLTQPPSV SAAPGQKVTI SCSGSSSNIG NNYVSWYQQL PGTAPKLLIY DNNKRPSGIP DRFSGSKSGT STTLGITGLQ TGDEADYYCG TWDSRLSAVV FGGGTKLTVL GQPKANPTVT LFPPSSEELQ ANKATLVCLI SDFYPGAVTV AWKADGSPVK AGVETTKPSK QSNNKYAASS YLSLTPEQWK SHRSYSCQVT HEGSTVEKTV APTECS(Disulfide bridge: H22-H96, H144-L215, H157-H213, H232-H'232, H233-H'233, H236-H'236, H239-H'239, H270-H330, H376-H434, H'22-H'96, H'144-L'215, H'157-H'213, H'27O-H'33O, H'376-H'434, L22-L89, L138-L197, L'22-L'89, L'138-L'197)Seq ID No. 4 Cemiplimab(Heavy chain)EVQLLESGGV LVQPGGSLRL SCAASGFTFS NFGMTWVRQA PGKGLEWVSG ISGGGRDTYF ADSVKGRFTI SRDNSKNTLY LQMNSLKGED TAVYYCVKWG NIYFDYWGQG TLVTVSSAST KGPSVFPLAP CSRSTSESTA ALGCLVKDYF PEPVTVSWNS GALTSGVHTF PAVLQSSGLY SLSSVVTVPS SSLGTKTYTC NVDHKPSNTK VDKRVESKYG PPCPPCPAPE FLGGPSVFLF PPKPKDTLMI SRTPEVTCW VDVSQEDPEV QFNWYVDGVE VHNAKTKPRE EQFNSTYRVV SVLTVLHQDW LNGKEYKCKV SNKGLPSSIE KTISKAKGQP REPQVYTLPP SQEEMTKNQV SLTCLVKGFY PSDIAVEWES NGQPENNYKT TPPVLDSDGS FFLYSRLTVD KSRWQEGNVF SCSVMHEALH NHYTQKSLSL SLGK (Light chain)DIQMTQSPSS LSASVGDSIT ITCRASLSIN TFLNWYQQKP GKAPNLLIYA ASSLHGGVPS RFSGSGSGTD FTLTIRTLQP EDFATYYCQQ SSNTPFTFGP GTVVDFRRTV AAPSVFIFPP SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC(Disulfide bridge: H22-H96, H131-L214, H144-H200, H223-H'223, H226-H'226, H258-H318, H364-H422, H'22-H'96, H'131-L'214, H'114-H'2OO, H'258-H'318, H'364-H'422, L23-L88, L134-L194, L'23-L'88, L'134- L'194)Seq ID No. 5 Isatuximab(A chain)QVQLVQSGAE VAKPGTSVKL SCKASGYTFT DYWMQWVKQR PGQGLEWIGT IYPGDGDTGY AQKFQGKATL TADKSSKTVY MHLSSLASED SAVYYCARGD YYGSNSLDYW GQGTSVTVSS ASTKGPSVFP LAPSSKSTSG GTAALGCLVK DYFPEPVTVS WNSGALTSGV HTFPAVLQSS GLYSLSSVVT VPSSSLGTQT YICNVNHKPS NTKVDKKVEP KSCDKTHTCP PCPAPELLGG PSVFLFPPKP KDTLMISRTP EVTCVVVDVS HEDPEVKFNW YVDGVEVHNA KTKPREEQYN STYRVVSVLT VLHQDWLNGK EYKCKVSNKA LPAPIEKTIS KAKGQPREPQ VYTLPPSRDE LTKNQVSLTC LVKGFYPSDI AVEWESNGQP ENNYKTTPPV LDSDGSFFLY SKLTVDKSRW QQGNVFSCSV MHEALHNHYT QKSLSLSPGK(B chain) QVQLVQSGAE VAKPGTSVKL SCKASGYTFT DYWMQWVKQR PGQGLEWIGT IYPGDGDTGY AQKFQGKATL TADKSSKTVY MHLSSLASED SAVYYCARGD YYGSNSLDYW GQGTSVTVSS ASTKGPSVFP LAPSSKSTSG GTAALGCLVK DYFPEPVTVS WNSGALTSGV HTFPAVLQSS GLYSLSSVVT VPSSSLGTQT YICNVNHKPS NTKVDKKVEP KSCDKTHTCP PCPAPELLGG PSVFLFPPKP KDTLMISRTP EVTCVVVDVS HEDPEVKFNW YVDGVEVHNA KTKPREEQYN STYRVVSVLT VLHQDWLNGK EYKCKVSNKA LPAPIEKTIS KAKGQPREPQ VYTLPPSRDE LTKNQVSLTC LVKGFYPSDI AVEWESNGQP ENNYKTTPPV LDSDGSFFLY SKLTVDKSRW QQGNVFSCSV MHEALHNHYT QKSLSLSPGK (C chain) DIVMTQSHLS MSTSLGDPVS ITCKASQDVS TWAWYQQKP GQSPRRLIYS ASYRYIGVPD RFTGSGAGTD FTFTISSVQA EDLAVYYCQQ HYSPPYTFGG GTKLEIKRTV AAPSVFIFPP SDEQLKSGTA SWCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC (D chain) DIVMTQSHLS MSTSLGDPVS ITCKASQDVS TWAWYQQKP GQSPRRLIYS ASYRYIGVPD RFTGSGAGTD FTFTISSVQA EDLAVYYCQQ HYSPPYTFGG GTKLEIKRTV AAPSVFIFPP SDEQLKSGTA SWCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC(Disulfide bridge: A22-A96, A147-A203, A223-C214, A229-B229, A232-B232, A264-A324, A370-A428, B22-B96, B147-B203, B223-D214, B264-B324, B370-B428, C23-C88, C134-C194, D23-D88, D134- D194)Example 22. The use of treatment cells for the AAV production and cell expansion systems.[000328] HEK 293T cells from ATCC were treated with DNase and RNase at varying concentrations for 1 min to 24h, resulting in: 293T-T1 (DNase / RNase treated, in the presence of EVs produced and released by the cells), 293T-T2 (DNase / RNase cultured), 293T-T3 (RNase cultured), and 293T-Tr (DNase / RNase treated, EVs produced were removed). Control cells (293T-C) received PBS instead. Upon reaching 70% confluency, cells in serum-free medium were transfected with pHLP-AAV5(AAP5+) and pCMV1-AAV5cmVP3 using polyethyleneimine (DNA / polyethyleneimine ratio of 1 :2) and harvested at 120 hours for viral particle recovery. The pHLP-AAV5 plasmid, a standard helper for AAV5 vector production, expresses AAV2 Rep and AAV5 proteins. Cells and medium were purified 120 hours post-transfection via cesium chloride and density gradient centrifugation.Table 34.*p<0.05 to control#p<0.05 to 293-TrExample 23. Treatment of yeast expression system for the production of recombinant proteins[000329] Insulin producing Komagataella phaffii (Pichia pastoris) was obtained by transformation of Komagataella phaffii (Pichia pastoris) SuperMan5 strain with yeast vector pPICZ-a cloned with insulin DNA (Sequence 6). Fungi from a single colony underwent treatment with cycles of DNase and RNase treatment(-T in the presence of EVs produced and released by the cells), DNase and RNase treatment (-Tr, EV were removed), RNase presence (-T2), or PBS as a control (-C). Inoculated with 25 ml_ MGYH in a 250 ml_ flask, they were grown at +30°C and 300 rpm until OD600 = 4. After centrifuging at 1 ,500g for 10 min, the cell pellet was resuspended in 100 ml_ MMH medium to OD600 of 0.9-1 .0, transferred to a 1 -liter flask, and induced with methanol. Recombinant protein levels in the supernatant are set forth in the Table 36 below. The use of treatment cells to increase production of hormones.Table 36*p<0.05 to control#p<0.05 to K.phaffii -Tr[000330] Data received indicate that the use of treatment cells increased the production of the recombinant proteins.Seq ID No. 6AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGC CCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGA ACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCExample 24: The Use of Treated Cells for the Production of Bioactive Compounds and Antibiotics[000331] Penicillium spp. was incubated for 10 days at +25-27 C on a Sabouraud medium.[000332] Fungi were treated with multiple rounds of DNase and RNase ( “-T” in the presence of EVs produced and released by the cells) or with PBS ( “-C”) as previously described or grown on agar supplemented with RNase 1 (-R) (Figure 13). The volume of exudate was analyzed after 4 days of culturing.Also, the properties of guttation product produced by treated cells was evaluated as the Minimal Inhibitory Concentration studied as the minimal dilution of guttation product capable to completely inhibit growth of bacteria and fungi. The treated cells produce more products and these products possess unique characteristics not identical to one seen on the original non-treated cells, sharing the similarity with evolutionary old ancestors.Example 25. Use of Treated Cells for Recombinant Protein Production in Bacteria[000333] An E. coll clone producing human IL-2 was used, treated with DNase and RNase for treatment ("-T") or PBS as control ("-C"), and grown in ampicillin. Recombinant protein was induced with 1 mM IPTG, cells were lysed, and centrifuged at 10,000 g for 20 minutes at +4°C to isolate IL-2 inclusion bodies. The yield from E.coli-T was 6.15 fold higher (p<0.05) compared with E.coli-C. The data received indicate that treated bacteria produce significantly higher amounts of recombinant proteinsExample 26. The use of food treated cells in food and beverage production.[000334] We studied how treated strains of Lactobacillus delbrueckii (LD), Lactobacillus plantarum (LP), Streptococcus thermophilus (ST), and Bifidobacterium breve (BB) could improve the properties of milk products, particularly yogurt. The bacterial cultures were either treated with multiple rounds of DNase and RNase , marked as “-T” (treated; in the presence of EVs produced and released by bacteria), marked as “-Tr” (treated; EVs removed during the activation), or left untreated, marked as “-C” (control). The cow milk was pasteurized, cooled to 106 F degrees, and inoculated with the bacterial starting cultures. The survival was assessed after 28 days of storage at +4°C (Table 1).Table 37. Survival of LP in Various Yogurt Compositions.*p<0.05 -T compared to -C#p<0.05 - T compared to T r[000335] T reated cells, particulary those that were treated with nucleases in the presence of EVs secreted and released by these cells were able to survive digestion under conditions of human gastric stress. In low pH (pH 3) environments LP-C dropped by 3.4 Iog10 cells / ml and LP-T by 0.2 Iog10 cells / ml (p<0.05). Subsequently, we analyzed the impact of treatment Lactobacillus rhamnosus (LR) by subjecting it to multiple treatments with benzonase, thereby generating LR-T, on cheese properties and fermentation speed. Volatile compounds in milk fermented with LR-T were identified after 120 hours at +37°C, using solid-phase extraction mass spectrometry (Agilent Technologies) (Table 4). Significant shifts were observed in some of these compounds, as detailed in Table 4.Table 38. Concentrations and Significant Shifts in Volatile Compounds Produced by LR-T compared to LR-C and LR-Tr.*p<0.05 -T compared to -C[000336] #p<0.05 - T compared to Tr**1- acetic acid; 2-2-methyl- propanoic acid; 3-butanoic acid; 4-; 2-methyl-hexanoic acid; 5- hexanoic acid; 6- octanoic acid; 7-2-octanol; 8 - 3-methyl-3-buten-1-ol; 9 -3-methyl-2-buten-1-ol; 10- octanoic acid ethyl ester; 11- decanoic acid ethyl ester; 12 - acetoin; 13-2-nonanone[000337] Also, the minimal fermentation time was reduced by 72%(p<0.05) by using treated starting culture. Evaluated brewing performance of Saccharomyces cerevisiae VT-009 (SC) as a starter culture. Growth of control (SC-C), nuclease treated (SC-T in the presence of EV), and nuclease treated (SC-Tr without presence of EV) strains was tested on YPD Medium with 0-20% ethanol, measuring optical density at OD600 (Table 38(b) below).Table 38(b)*p<0.05 -T compared to -C#p<0.05 - T compared to T r[000338] The results demonstrated that SC-T strains are ethanol- tolerant, making them suitable for high-gravity brewing and the production of alcohol products with novel properties.Example 27. The use of treated organisms in remediation, inactivation of xenobiotics including heavy metals.[000339] We assessed the bioaccumulation potential of treated cells for heavy metal remediation using Escherichia coll (EC) VT-17 and Bacillus subtilis (BS), treated with DNase and RNase, or antibodies against DNA / RNA. Treated cells with the nucleases in the presence of EV were designated as "-T1" (EC-T1), "-Ta" (EC-Ta), and "-T2" (EC-T2), while cells treated with nucleases without EV were designated as “-Tr (EC-Tr),” control cells were treated with PBS ("-C" EC-C). We tested heavy metal concentrations: Cd (up to 50 mg / L), Cr (up to 40 mg / L), Pb (up to 100 mg / L). Specifically, we evaluated treated E. coil's ability to remediate mercury by inoculating EC-C and EC-T in LB broth with varying Hg2+ concentrations, incubating for 24 hours at +37°C with shaking, then measuring bacterial growth and residual Hg2+ spectrophotometrically (Table 38(c) below).Table 38(c). Bioabsorption capacity of treated cells.*p<0.05 -T / Ta compared to -C#p<0.05 - T / Ta compared to TrExample 28. The use of treated cells in the inactivation and remediation of xenobiotics[000340] We assessed the efficacy of DNase and RNase-multiple times-treated Bacillus licheniformis (VT-260, BL-T) versus PBS-treated control (BL-C) for atrazine remediation. Cultures (1 X10A5 cells / mL) in M9 or LB broth with 50 mg / L atrazine were incubated at 30°C, shaken at 125 r / min for 96 hours, and atrazine levels were measured bi-hourly by HPLC-MS / MS (Table 1).Table 39. Degradation of Atrazine by Treated Bacteria.*p<0.05 -T compared to -C#p<0.05 - T compared to T rExample 29. Treatment of bacterial expression system of the pyocyanine product[000341] Pseudomonas aeruginosa SUS-24 isolates were cultured in GRM broth with 100 pg / mL nuclease at 37°C for 72 hours for pigment production. The pigment-rich culture was centrifuged (10000 rpm, 15 min), and the supernatant used as a crude extract. Pigment was extracted using chloroform (2:1 ratio to broth), forming a blue layer, then acidified with 0.1 N HCI (20% volume), turning pink after centrifugation. The pink layer was neutralized with Tris-Base, pH adjusted, and MIC evaluated as previously described. Results on the produced compound on microbial growth are set forth in the Table 40.Table 40.*p<0.05[000342] Data received indicate that products produced by the cells cultivated in the presence of nucleases possess higher level of biological activityExample 30. Use of treated cells in plant bioproduction[000343] To analyze the impact of treated cells on plant growth, we utilized Bacillus subtilis (BS) that had been subjected to multiple rounds of DNase and RNase treatment in the presence of EV (-“T”) or if EVs were removed and washed out (-“Tr”). These treated cells were then incorporated into the irrigation water at a concentration of 10A7 CFUs per gram of soil. The results are presented in Table below 41 .Table 41 . Growth Promotion of Solanum melongena Using Treated Bacillus subtilis Cell.*p<0.05 -T compared to -C#p<0.05 - T compared to T rExample 31. The use of treated cells to increase productivity of hybridomas.[000344] Mouse Anti-Human EGFR Hybridoma [mAb 219, lgG2a kappa] from Creative Diagnostics, developed from animals immunized with EGFR cDNA-transfected CHO cells and fused with NS-1 mouse myeloma cells, targets human EGFR and inhibits tumor cell growth. Hybridoma cells, untreated or DNase / RNase-treated (treated, along with EV produced), or DNase / RNase-treated (EV removed) were cultured at 37°C, 5% CO2, with 2-3x10A5 cells / mL. Antibody levels were measured by ELISA, with cell count / viability via Acridine Orange. Treated cells showed increased numbers, leading to recalculated antibody production per cell, with control as 100% reference. Results in the Table below.Table 42. Antibody Production by Hybridoma Cells.*p<0.05 - “hybridoma with EV” compared to control#p<0.05 - “hybridoma with EV” compared to “hybridoma washed out EV”Example 32. The use of treatment of eukaryotic multicellular organisms to increase productivity of the desired product.[000345] We used commercially purchased eggs of Bombyx mori (BM), randomized them into two groups and treated one of them with multiple rounds of DNase and RNase to obtain treated eggs (BM-T, in the presence of EVs released and secreted from these cells), or with washed-out EVs (Tr) or left untreated (BM-C). Both BM-T and BM-C were maintained under the same conditions. We analyzed the weights of cocoons on the 3rdday of their formation using a laboratory balances (Mettler Toledo). The data were statistically analyzed and presented in the Table below.Table 43. Cocoon characteristics of BM-C and BM-T.*p<0.05 - T compared to control#p<0.05 - T compared to T rExample 33: The use of cell treatment to regulate cell expansion and differentiation.[000346] PBMCs were sourced from five healthy volunteers and T cells isolated via Ficoll centrifugation. Control T cells received PBS (T4-C); experimental ones were treated with DNase andRNase (T4-T with the EVs of these cells), or if the EVs were removed (-T4-Tr). T cell activation / expansion used Miltenyi Biotec's kit with varying bead-to-cell ratios, removing beads on day 7.[000347] Experiments assessed IL-2's impact on expansion at five concentrations (20-500 lU / mL) and seeding density's effect at five densities (6 x 1OA4 to 2.5 x 1 OA6 cells / mL), both using a 1 :2 bead-to- cell ratio. Additionally, the bead-to-cell ratio's impact was tested at ratios from 1 :10 to 10:1 , all with IL-2 at 50 lU / mL. T cell treatment notably enhanced expansion across setups.Table 44. Impact of Cell Treatment on Expansion with Various IL-2 Concentrations.Table 45. Effect of Cell Treatment on Expansion Depending on Various Cell Densities.*p<0.05 - T compared to control#p<0.05 - T compared to T rTable 46. Impact of Cell Treatment on Expansion Depending on Various B:C Ratios.*p<0.05 - T compared to control#p<0.05 - T compared to T rExample 34. Use of cell treatment in baculovirus system[000348] Spodoptera frugiperda 9 cell line (ATCC CRL-1711) was cultivated according to the instructions at 27°C in Sf-900 II SFM medium in suspension. Control cells were left untreated and experimental were either treated with several rounds of DNase, RNase and their combinations in the presence of EVs produced by these cells or were cultivated in the presence of these nucleases from 1 to 30 pg / mL[000349] The neuraminidase gene of influenza A virus was subcloned into a plZA / 5 His (Invitrogen, Thermo Fisher Scientific, Inc., USA) and further transfected into Groups 1-7 of Sf9 cells using Cellfectin II (Invitrogen) according to the manufacturer instruction. The results are shown in Figure 14. Data received indicate that treatment cell culture conditions was able to increase the yield of products synthesized in insect cells, including virus-like particles produced by the baculovirus expression system.Example 35. Use of treated cells to generate products with new characteristics.[000350] To study the effects of nuclease treatment on the organoleptic properties of bread, Saccharomyces cerevisiae were pretreated either once (x1) or multiple times (Treated) with DNase I and RNase at 1 pg / mL. The cells were then washed to remove the nucleases, either with preservation of EVs produced upon treatment with nucleases (Treated group), or — in the case of the Tr group — washed to remove both nucleases and EVs before being used in bread baking.. The results are set forth in the Table 47 below.Table 47.[000351] Bread obtained from “x1” and Treated fungi are richer, more uniform golden-brown crust with a crisper texture, enhanced softness and elasticity, pillowy texture. Notably, x1 and treated bread exhibits a delicate hint of olive oil and rosemary. Additionally, an unexpected but pleasant slight sweetness is detected, reminiscent of honey. The aroma is markedly more complex and inviting. One is greeted with the rich scent of toasted almonds and a subtle hint of vanilla. This bouquet of aromas is enriched further by a slight citrus undertone.[000352] Next, we treated tomato seeds to generate new tomatoes. To study effects of nucleases use on plants tomato seeds were pretreated with DNase I and RNase A once (x1) or with multiple times (Treated), washed from nucleases (washed to remove the nucleases, either with preservation of EVs (Treated group), or — in the case of the Tr group — washed to remove both nucleases and EVs) and sown in plastic trays and were transplanted with a single seedling in three liter capacity plastic pots filled with compost. The experiment was carried out in greenhouse with the medium temperature 22°C and 34% humidity. We will assign scores to each organoleptic property of both control tomatoes (Control) and treated tomatoes (x1 and Treated), on a scale from 0 to 10, where 0 represents the lowest quality and 10 represents the highest quality.[000353] Data are shown in the Table 48below.Table 48.[000354] “x1” and Treated tomatoes exhibited a deeper and more uniform red color compared to the control group and to the treated group treated with nucleases if EX were moved. The color intensity, measured by a spectrophotometer, showed a significant increase in the x1 and Treated groups with EVs produced by the cells during the treatment with nucleases, indicating enhanced lycopene content. [000355] The texture of x1 and T reated tomatoes (with EVs produced by the cells during the treatment with nucleases) was significantly improved, with a firmer and more consistent flesh. This was quantified using a penetrometer, where x1 and Treated tomatoes required higher force to penetrate, suggesting enhanced cell structure and firmness.[000356] Sensory analysis revealed that tomatoes treated with nucleases along with EVs produced by the cells during the treatment with nucleases had a more pronounced flavor profile. The most notable achievement was the development of a unique spicy flavor profile in the tomatoes. Tasting panels reported a mild to moderate heat level, reminiscent of the sensation provided by mild chili peppers.[000357] The x1 and Treated tomatoes in particular, emitted a stronger and more appealing tomato aroma, which was confirmed through gas chromatography-mass spectrometry analysis. Volatile compounds associated with the characteristic tomato aroma were found in higher concentrations in the treated groups. The tomatoes exhibited a distinctive aromatic profile with clear notes of rosemary and thyme.[000358] X1 and tomatoes treated with nucleases along with EVs produced by the cells during the treatment with nucleases tomatoes were found to be juicier than their control counterparts. This was measured by the weight of juice extracted from an equal weight of tomatoes, with x1 and Treated tomatoes producing an average of 10-20% more juice.Example 36. The use treated cells for the treatment of inflammatory diseases.[000359] Crohn’s disease and ulcerative colitis are the major types of inflammatory bowel diseases (IBD). To model them, we used the 2,4,6-trinitrobenzene sulphonic acid (TNBS) model.[000360] Briefly, C57BL / 6J mice (both females and males) were anesthetized with xylazine and ketamine, and a TNBS solution was prepared in absolute ethanol to a final concentration of 2.5% TNBS in 50% ethanol. To induce IBD, the mice were administered 20 pl of 2.5% TNBS in 50% ethanol (5 pl / g body weight) rectaliy using a gavage needle. The disease activity index was calculated by analyzing stool consistency, rectal bleeding, and the percentage of weight loss during the observational period, [000361] Mice were either left untreated or treated (control #1) with SL4-C (Mock-control #2) or SL4-T (experimental group). SL4-T cells were obtained as previously described. SL4-T and SL4-C were administered to the mice once a week at concentrations ranging from 10A3 to 10A7 cells per mouse, either intravenously (SL4-Clv; SL4-Tiv) or as a rectal instillation (SL4-Crec; SL4-Trec) (see Figure 15).[000362] Data received demonstrated that SL4-T can be used for the treatment of inflammatory bowel diseases and are effective through different routes of administration.EXAMPLE 37: The use of treated cells for the treatment of diseases associated with protein misfolding.[000363] We investigated the clearance of misfolded, prionogenic proteins implicated in neurodegenerative and autoimmune diseases by comparing treated cells to controls. Cells were treated through treatments with DNase, RNase, or anti-DNA / RNA antibodies along with the EVs produced by the cells or with EVs washed out. Primary neuronal cultures were derived from rat embryo hippocampi. [000364] Studies involved prion-like proteins (Tau, beta-amyloid, a-synuclein, SOD1 , TDP-43, IAPP) linked to diseases like Alzheimer's and Parkinson's. Proteins, in monomeric form, were aggregated using heparin and incubated at 37°C, with aggregation tracked by Thioflavin T fluorescence and PMCA method. 10A8 of the tested cells were tested with 100 nM of aggregated proteins to assess clearance efficiency, detailed in Table 49.Table 49. Clearance of misfolded proteins with treated cells following 120 min contact time.*p<0.05 compared to untreated control#p<0.05 compared to untreated the relative group without EVs[000365] The data indicates that treated cells have a higher capacity to remove misfolded aggregates.Example 38. The use of treated cells in patients with psoriasis.[000366] We examined the impact of treated SL4-T cells on psoriasis patients with baseline PASi scores >12. Using autologous cells, each patient served as their own control due to demographic diversity.Group A: 1 x 10Λ8 cells / patient i.v. , bi-weekly; Group B: 1 x 10Λ4 cells / patient i.v,, every other day; Group C: 1 x 10Λ8 cells / patient i.v., every other day; Group D: 1 x 10Λ8 cells in 10 ml baby cream, topically every other day.[000367] Patients were monitored for up to 12 months post-therapy, during which they experienced no exacerbations or new lesions, contrasting with their history of up to 2 exacerbations annually (Table 50).Table 50. Comparison of the number of exacerbations of psoriasis during 12 months follow-up.000368] Data received indicate that the use of treated cells can be used for the successful management of psoriasis.[000369] Figure 16 shows the effect of treated cells on PASI score and representative skin images of patients before and after treatment with treated cells from group C and representative skin images of patients before and after treatment with treatedExample 39. The use of treated cells for the treatment of diabetes[000370] To study diabetes modulation, C57BL / 6 mice were fasted for 12 hours. The mice were then injected intraperitoneally with 60 mg / kg STZ in citric acid buffer (pH 4.5) for five days. Mice with fasting blood glucose over 300 mg / dL were deemed diabetic.[000371] Mesenchymal stem cells (MST), induced pluripotent stem cells (iPSC), and primary fibroblasts (FB) were treated via multiple DNase, RNase, or anti-DNA / RNA antibody treatments, following standard procedures.[000372] Mice groups were: untreated control (C), mesenchymal stem cells control (MST-C) and treated (MST-T), IPSC control (IPSC-C) and treated (IPSC-T), and fibroblasts control (FB-C) and treated(FB-T), all injected with 1 x 10Λ6 cells in 300 pL of DMEM or RPMI 1640 into the hepatic portal vein. Blood glucose was monitored every five days (Figure 17).Example 40. Effect of treated cells in patients with autoimmune diseases associated with the elevated levels of autoantibodies.[000373] A 52-year-old woman presented with Hashimoto thyroiditis with the presence of thyroid peroxidase antibodies anti-TPO. The patient was referred for the treatment with allogeneic SL4-T cells obtained as previously described. SL4-T and MSC-T cells were given as i.v. injection at concentration 10*7 cells / injection once a week. The results are shown in table 1 .Table 51 . Level of autoantibodies during the therapeutic course.*p<0.05[000374] Next, we analyzed the effect of autologous SL4-T for the treatment of diabetes (type 1 diabetes) in four patients with diabetes confirmed at least over 3 years prior to the initiation of the study.Allogeneic, treated SL4-T cells were obtained as previously described. Human mesenchymal stem cells were treated following eight cycles of treatment with DNase and RNase (MSC-T) each taken at concentration 50 mg / L. Cells at the concentration of 10*6 cells / injection were injected weekly for 3 months (Table 52 below).Table 52.*p<0.05[000375] ICA - islet cell antibodies; IA2- antibodies against islet antigen-related tyrosine phosphatase 2; GAD-glutamic acid-decarboxylase;[000376] At 3-month follow-up after treatment, all patients presented positive dynamics for the therapy with reduced levels of autoantibodies which were significantly elevated prior to the initiation of the study (p value < 0.05). Data received show the efficacy of therapy of the autoimmune diseases with autologous and allogeneic treated cells.Example 41. The Use of Treated Cells for the Treatment of Systemic Lupus Erythematosus[000377] A total of five participants with refractory systemic lupus erythematosus (SLE) were treated with treated allogeneic or autologous SL4-T cells. Disease status was assessed by evaluating anti-nuclear antibodies (ANA) using indirect immunofluorescence. SL4-T cells were administered intravenously (i.v.) in doses ranging from 10A5 to 10A8 cells per injection, once a week (see Table 53).Table 53. Dynamics of ANA in treated patients.*i.v. injected 10*5 cells / injection ; **i.v. injected 10*7 cells / injection; *** i.v. injected 10*8 cells / injectionExample 42. The effect of treated cells on multiple sclerosis.[000378] Three patients with a previous history of multiple sclerosis (MS) underwent treatment with treated SL4-T cells. In two patients, SL4-T cells were allogeneic, and in one patient, they were autologous. The administration of SL4-T cells was through intravenous (i.v.) injection, following various regimens ranging from twice a week to once a month. The therapy spanned 6 months, followed by a 6- month observation period. Expanded Disability Status Scale (EDSS) and annual number of relapses.Each patient acted as their own control, comparing data from the 12 months prior to the initiation of SL4-T therapy. The results of the therapy are presented in Table 54.Table 54. The use of SL4-T for the treatment of MS.EXAMPLE 43. The Effect of Treated Cells on Neurodegenerative Disorders[000379] When exploring the utility of a new therapeutic agent designed for treating neurodegenerative diseases, such as Alzheimer’s disease, Parkison’s disease, myotrophic lateral sclerosis, motor neuron disease, Huntington's disease, spinal muscular atrophy, and spinocerebellarataxia; or neurodevelopmental conditions such as autism spectrum disorders, it is essential to evaluate its impact on behavioral and cognitive parameters that are often compromised in such conditions. Here we studied the effects of treated SL4-T (nuclease treatment in the presence of EVs produced by these cels due to the nuclease treatment) or MRC-T (nuclease treatment in the presence of EVs produced by these cels due to the nuclease treatment) cells on various behavioral aspects in mice. Some cells were washed out from the EVs (SL4-Tr) and MRC-Tr (control).[000380] Mice were i.v. injected with various concentrations of SL4-T, SL4-Tr or SL-C or with MRC-C, MRC-T, MRC-Tr cells varying from 10*3 to 10*7 cells per mouse.[000381 ] Locomotor and Exploratory Behavior[000382] Home Cage Activity: Baseline locomotion measured by distance covered in five minutes in familiar settings, noting changes post-treatment.[000383] Open Field Test / Anxiety-Like Behavior: Assesses locomotion and exploration by tracking movements and zone occupancy in a square arena for five minutes.[000384] Elevated Zero Maze (EZM): Evaluates anxiety through exploration patterns between open and closed maze quadrants over five minutes.[000385] Open Field Test (Anxiety Context): Analyzes anxiety by measuring time spent in central versus peripheral zones.[000386] Spatial Learning and Memory[000387] Barnes Maze Test: Tests spatial memory by recording escape box search efficiency, including latency and errors, influenced by treatment.[000388] Depression-Like Behavior / Forced Swim Test (FST): Measures despair by tracking immobility duration in water, observing changes due to therapeutic intervention.[000389] Locomotor Activity (HOME CAGE CONDITION (NON-STRESSFULL) Examined across weeks, focusing on total and center distance traveled, revealing treatment impacts.The results are shown in Table 55 below.Table 55.*p<0.05 T compared to control#p<0.05 T compared to TrAnxiety-like behavior (Analyzed via open field and set forth in Table 56 below)Table 56*p<0.05Spatial learning and memory (assessed with Barnes Maze test)[000390] Through a rigorous experimental setup, the Barnes Maze test was conducted over four consecutive days in the fifth week, following the 3rdinjection, to evaluate and contrast the behavioral attributes of mice exposed to various formulations. The parameters evaluated were time spent in openarms and the number of transitions, both pivotal in portraying anxiety-like behaviors and memory functions in murine models. The results are set forth in Table 57 below.Table 57Depressive-like behaviour (assessed by Forced swim test.) - set forth in Table 58 below.Table 58*p<0.05[000391] Mice treated with SL4-T and MRC-T exhibited a remarkable rise in time spent in open arms from, indicating reduced anxiety-like behavior.Example 44. The use of treated cells for the treatment of rheumatoid arthritis[000392] Patient Details 53-old female. Diagnosis: Seronegative Rheumatoid Arthritis, ACPA- Positive (6.2), Late Stage, Erosive, Radiological Stage 3, Activity 3, Functional class 3.[000393] Pre-Treatment Status. Symptoms: Pain and stiffness in the joints, Chronic fatigue, Prolonged morning stiffness, Symmetrical joint swelling, Reduced range of motion, Development ofrheumatoid nodules, Persistent low-grade fever, Unintended weight loss, Elevated inflammatory markers. Prior Treatment: DMARDs (Disease-Modifying Antirheumatic Drugs): Methotrexate was administered to manage inflammation and modulate the autoimmune response. Corticosteroids: Prednisone was employed to manage acute flares and to potentially decelerate joint damage. Physical Therapy: Joint exercises and mobility training.[000394] Despite these comprehensive interventions, the patient demonstrated no significant improvement, thereby necessitating exploration into alternative therapeutic approaches.[000395] Treatment Plan SL4-T was administered intravenously once a week at the concentration 10*7 cells / injection Treatment Course and Outcomes (2 months)Observations showed a gradual decrease in morning joint pain and stiffness, significant reduction in swelling of smaller joints (fingers and wrists), and enhanced joint motion and function. The patient experienced better sleep, less fatigue, and increased physical ability.[000396] CT scans one-month post-treatment displayed improvements in both knees, with reduced bone marrow edema and osteochondral damage, and less synovial fluid and popliteal cyst size.[000397] Overall, the patient noted a substantial improvement in life guality, symptom relief, and functionality.The results are presented in Figure 18.Example 45: Use of SL4-T for the therapy of neurodegenerative diseases[000398] History of Present Illness:[000399] Mr. B, a 40-year-old IT specialist, began experiencing significant memory issues 18 months ago, initially attributing them to stress. His condition evolved into marked cognitive and motor impairments, including forgetfulness, difficulty focusing, and name recall challenges. He developed a shuffling gait and physical instability, reducing his mobility and independence, alongside involuntary twitching and occasional blurred vision. The patient had confusion and disorientation. Pronounced muscle weakness. Marked walking instability, needing support. Motor agitation and involuntary finger movements. Gait apraxia with a rightward lean and excessive foot dorsiflexion.[000400] Physical Examination Upon Admission:[000401] Cognitive Status: Deteriorated; showed issues in immediate and short-term memory, difficulty concentrating, and slowed problem-solving abilities.[000402] Motor Skills: Noticeable motor restlessness, impaired coordination, an unstable, shuffling gait.[000403] Neurological Findings: Subtle dysarthria, nystagmus, and a positive Romberg sign.[000404] Laboratory Tests & Imaging:[000405] Signs of atrophy in the cerebellum and changes in the basal ganglia. Normal metabolic blood panel, negative for common infectious and autoimmune markers. Normal pressure, no infectious or malignant cells.[000406] Initial Treatment Approach:[000407] Donepezil (5 mg / day), Memantine (10 mg twice daily); Levodopa / Carbidopa (Sinemet); Pramipexole (0.125 mg three times a day); Baclofen (5 mg x 3 times a day); Sertraline (50 mg / day); Quetiapine (25 mg at night, titrated cautiously). Supportive Therapy: Speech and Language Therapy; Nutritional Management[000408] Experimental Therapy Initiation:[000409] Despite ongoing treatment, the patient's symptoms worsened. Due to limited conventional therapy response, an experimental SL4-T regimen was initiated with consent, ranging from weekly to daily injections of 10A7 or 10A8 cells.[000410] Outcome Post-SL4-T Therapy:2 Months Post-Therapy:[000411] Cognitive function significantly improved; FAB score increased from 5 / 18 to 11 / 18, and MMSE score from 9 / 30 to 19 / 30, indicating better cognitive flexibility, orientation, and speech.[000412] Motor symptoms, including shuffling gait and twitching, showed marked improvement. [000413] Quality of life improved with enhanced cognitive and motor functions, leading to greater independence and social interaction.[000414] SL4-T Therapy Effects:[000415] Targeted multiple symptoms including cognitive, motor, and oculomotor disturbances by modulating affected neural networks. Exhibited neuroprotective properties to slow neurodegenerative disease progression by protecting neurons. Enhanced cognitive functions, improving memory and attention through neural circuit modulation.[000416] Improved motor functions, aiding in the stabilization and potential improvement of extrapyramidal and cerebellar symptoms.[000417] Managed oculomotor symptoms, supporting eye movement control essential for independence and quality of life.Example 46. The use of treated cells for the treatment of autoimmune reactions.Experiment 1 : Evaluating SL4-T Efficacy during Anaphylactic Shock in Mice[000418] Species: BALB / c mice, 8-10 weeks, Under Specific Pathogen Free conditions, adhering to scientific research animal care guidelines Anaphylactic Shock was induced by ovalbumin, Intraperitoneal injection, 100 pg / mouse.[000419] Experimental Groups: CN (Control Normal, control group of healthy mice); Control Group 1 (CG1): No treatment post-anaphylactic shock induction; Control Group 2 (CG2): epinephrine, 0.01 mg / kg, intraperitoneally; SL4-C Group: SL4-C administration; SL4-T Group (white blood cells, platelets, treated with multiple rounds of nucleases in the presence of EVs produced by them): SL4-T administration; SL4-Tr Group (white blood cells, platelets, treated with multiple rounds of nucleases, EVs removed): SL4-Tr administration. All treatments are administered intraperitoneally, 10 minutes postreaction onset.[000420] Symptomatic Evaluation Scale: 0: No symptoms; 1 : Erythema, urticaria; 2: Increased motor activity; 3: Trembling, distress; 4: Spasms; 5: Loss of consciousness; 6: DeathTable 59. Average Symptom Scores (mean ± SD, n=5).*p<0.05 T compared to CG1 and CG2#p<0.05 T compared to TrTable 60. Immunological Parameters (mean ± SD, n=5).*p<0.05 compared to CG1 , CG2, SL-CExperiment 2: Evaluating SL4-T Efficacy during Delayed-Type Hypersensitivity in Mice[000421 ] Delayed-Type Hypersensitivity was induced by intradermal injection of T uberculin PPD 50 pl[000422] Treatment Protocols[000423] CG1 : No treatment; CG2: Dexamethasone administration (5 mg / kg), intraperitoneally, every 24 hours; SL4-C Group: SL4-C therapy, intraperitoneally, every 24 h; SL4-T Group: SL4-T therapy, intraperitoneally, every 24 hTable 61 . Edema Tissue Thickness Changes.Table 62. Cytokine Levels (pg / ml).[000424] SL4-T administration significantly reduced edema, swelling, and inflammation in delayed- type hypersensitivity, suggesting a novel approach for treating allergic contact dermatitis.Example 47. Effect of cell treatment on inflammasome activation[000425] The effect of treated SL4-T cells and SL-T r obtained as described above on the activation of the NLRP3 inflammasome, which is a key pathological process in a number of disorders such as focal segmental glomerulosclerosis, ankylosing spondylitis, gout, rheumatoid arthritis, type 2 diabetes, atherosclerosis, psoriasis, and non-alcoholic fatty liver disease, was tested in bone marrow-derived macrophages (BMDMs). BMDMs were placed in minimal media in 96-well plates at 10A5 cells / well and were first primed with lipopolysaccharide (from E. coli). Then, SL4-T or SL4-C were added at a 1 :1000 ratio, and finally, NLRP3 was stimulated with ATP. SL4-T inhibited the release of IL-1 in BMDMs and PBMCs, while SL4-C did not. Notably, the viability of BMDMs was not affected by the addition of SL4-T / C as shown in the Table 63 below.Table 63.*p<0.05 of SL4-T compared with SL4-C#p<0.05 of SL4-T compared with SL4-TrExample 48. The use of treated cells for the transplantation to relative and non-related organisms.[000426] We analyzed how treatment of cells could increase their potential for being used for the regenerative medicine including tissue engineering and bioprinting.[000427] For that we analyzed how the treatment of cells could change their genes including the expression and interaction with the antibodies of the MHC class I proteins as well as safe administration for HLA-non-matched subjects and non-relative organisms.[000428] SL4-T has altered interaction with anti-HLA and anti-CD antibodies and altered expression of CD and HLA antigens[000429] Materials and Methods Summary:[000430] SL4-T, SL4-Tr and SL4-C cells were prepared as previously described. White blood cell counts were done using a NucleoCounter NC-202. Cells were stained with various fluorescent dyes for analysis. T- and B-cell populations were quantified using a Cytomics FC500 flow cytometer, with data analyzed via CXP Cytometer 2.2 and Kaluza software. HLA typing and antibody screening were conducted using Miseq Omixon, LABScan 100 Flow analyzer, and Illumina MiSeq, following specific sequencing protocols.[000431] Results Summary:[000432] SL4-C and SL4-T showed comparable viability (82%-85%). However, significant differences were noted in white blood cell interactions with anti-CD and anti-HLA antibodies between SL4- C and SL4-T, with a notable reduction in SL4-T's white blood cell count (p<0.05). This trend extended to T- and B-cell anti-CD antibody reactions, with marked variations in CD4+, CD45+, CD19+, CD56+, and CD8+ cell counts, demonstrating significant changes in binding capabilities.Table 63. The absolute number of T-lymphocytes capable of binding to anti-CD antibodies.****p<0.0001 compared to control and Tr[000433] Next, we analyzed the effect of treatment white blood cells on their interaction with anti- HLA antibodies, using three distinct methods. Luminex analysis revealed alterations in cellular reactivity to anti-HLA antibodies. The data obtained indicate that SL4-T cells were characterized by the loss of HLA-A, HLA-C, and HLA-DRB1 alleles (see Table 4).Table 64. HLA typing using Luminex.[000434] Finally, we assessed their interaction with HLA-DR1 using flow cytometry (refer to Figure 6). It was found that SL4-T cells exhibited a lower level of binding with anti-HLA-DR antibodies.[000435] The use of treated cells for the transplantation of bone marrow.[000436] To analyze the applicability of treatment of non-immune cells, we examined donor bone marrow to determine if we could modulate the interaction between HLA antigens and anti-HLA antibodies on stem cells. For this purpose, the bone marrow from a volunteer was treated with a combination of DNase and RNase (1 ug / mL) or with anti-DNA and anti-RNA antibodies.[000437] HLA typing of the treated bone marrow was then performed using next-generation sequencing (refer to Table 5).Table 65. Effect of tunning on bone marrow cells.[000438] We next analyzed the effect of treatment on cells derived from various tissue types, including connective, epithelial, muscle, and nervous tissues. For treatment, we either applied continuous or multiple cycles of nuclease treatment, or utilized ant-DNA and anti-RNase antibodies either removing the EVs (Group “Tr”) or in the presence of EVs produced by these cells (Group T). We focused on a total of five different HLA loci, examining two alleles at each locus. The cell cultures were sourced either from patient donors or purchased. These cells were cultivated following general recommendations for cell culture. The results of this analysis are presented in Table 6.Table 66. The effect of treatment on the interaction of HLA proteins with the antibodies.- not alteredExample 49. The use of treated cells to produce universal blood components.[000439] Blood specimens of healthy volunteers with known A, B, 0, AB and Rh positive groups were obtained. The RBCs were leukodepleted and 7.0log10 cells per ml were resuspended in PBS (pH 7.2), harvested by centrifugation 600 x g for 5 min, washed twice with PBS buffer, and resuspended in PBS buffer. For the treatment of RBCs, erythrocytes were harvested by centrifugation at 600 x g for 5 min and treated with multiple times with RNase or anti-RNA antibodies to develop treated cells. The blood group performed by Column agglutination technology (CAT) using fully automated Immunohematological Equipment Autovue Innova (Ortho Clinical Diagnostics, USA) according to the manufacturer’s instructions.[000440] We found that the treatment of RBS results in the conversion of RhD positive to RhD negative (Figure 1). This conversion was stable and was not restored up to seven days after the last treatment which was the last day, we measured it. Notably, the effect of conversion from Rh-positive to Rh- negative phenotype was observed in all four ABO blood groups following the treatment with either nucleases or ant-RNA antibodies. Figure 19 shows the effect of treatment RBC on Rh antigen. ([000441] We found that RhD positive erythrocytes treated with anti-exRNA antibodies exhibiting characteristics of RhD-negative RBCs and this effect was consistent across any of the ABO groups.Example 50. The elimination of HLA antigens from the organs and generation of universal donor organs.[000442] Next, we investigated whether the interaction between MHC I and HLA antigens with antibodies could be prevented within mammalian organs. For this, we used liver tissue specimens from excess surgical material obtained during liver transplants. The tissues were freshly frozen and processed promptly for perfusion. We employed isolated liver perfusion, a method involving the perfusion of a specific portion or slice of the liver to model the whole organ, focusing particularly on parenchymal organ perfusion. Liver slices were obtained using a Krumdieck slicer or a similar instrument, set at a speed of 30, to produce slices thinner than 400 pm. These slices were placed into six-well plates filled with 3.5 mL of culture medium supplemented with DNase and RNase at concentrations of either 10 mg / L or 75 mg / L. The slices were then incubated at +37°C in a 5% CO2 atmosphere with sufficient humidity, and the medium was replaced every 12 hours. Subsequently, the tissues were homogenized, and the interaction of HLA with relevant antibodies was analyzed. The results are presented in the Table below.Table 67. Alteration of MHC antigens and their interaction with the antibodies.not altered; altered[000443] The data received indicate that the proposed method can be utilized to remove HLA specificity, enabling the generation of universal donor organs and tissues. Additionally, this method is applicable in organ printing, organ-on-chip technology, and the creation of unique primary cell cultures.Example 51. The use of treated cells for the treatment of epithelial defects[000444] The objective of this research was to evaluate the in vivo activity of treated cells in a diabetic ulcer mouse model for delayed wound healing.[000445] To study the effect of allogeneic cells, we used human-derived fibroblasts, and for the autologous effects, we used fibroblasts derived from the same mice. To obtain autologous primaryfibroblasts, mice were anesthetized with a Ketamine / Xylazine mix. A small piece of tail was cut using sterile scissors and further divided into pieces smaller than 2 mm. These pieces were transferred into 2.0 ml tubes containing collagenase D-pronase solution. The tubes were shaken at 200 r / min for 180 minutes. Next, a 70 pm cell strainer was placed over cell culture dishes, and complete medium was added. The digested tail tissues were placed in the strainer and ground using a 10 ml syringe plunger for 10 minutes. The resulting cell suspension was then transferred to 15 ml tubes containing pre-warmed medium. T reated cells were obtained as previously described, by modifying their activity following repeated treatment with DNase and RNase.[000446] Experiments were conducted in 16 diabetic female mice (db / db; BKS.Cg-Dock7m + / + Leprdb / J) 12 weeks of age. The mice were anesthetized with ketamine (0.13 mg / g, IP) + xylazine (20mg / ml) and shaved to expose their back. A circular, full-thickness wound 0.6x0.6 cm patch of skin was then excised in a dorsal skin and bandaged with dressing for 3 days.[000447] Groups and Treatments:[000448] 5 days post-infection, mice were randomly assigned to one of the treatment groups (see,Table below)Table 68. Effect of different therapies on wound healing.*p<0.05[000449] The groups treated with treated autologous and allogeneic cells were able to accelerate wound healing, which can be used for the treatment of different epithelial defects including burns and ulcers.EXAMPLE 52: Products and method for allogeneic mesotherapy[000450] A patient experiencing hairline decline was previously unsuccessfully treated with multiple rounds of autologous PRP therapy. Following the failure of the PRP therapy to enhance hair growth, the patient underwent two cycles of PRP therapy, utilizing allogeneic SL4-T. The results, as measured by hair count per 1 cmA2, are presented in Table .Table 69. The use of allogeneic treated cells for the restoration for the hairline. (Table below)*p<0.05[000451] The data received demonstrate that the use of SL4-T significantly facilitated hair growth.Example 53. The use of treated microbial cells for microbiota transplantation.[000452] We aimed to determine whether treatment the microbial mix from the donor could enhance their potential to engraft in the recipient. Microbiota engraftment was assessed by comparing the overall similarity between the donor's inoculum and the recipients' microbiota.[000453] Male C57BL / 6J specific pathogen-free 8-week-old mice were utilized. Feces were collected from donor mice in the morning, stored in sterile containers, and then diluted (1 :20) in RPMI-1640. The samples were homogenized by vortex and treated with multiple rounds of DNase and RNase I at 20 mg / L for 5 or 16 cycles. These treated samples were used as inoculum.[000454] For fecal microbiota transplantation, recipient mice were administered broad-spectrum antibiotics (neomycin 200 mg / kg, metronidazole 200 mg / kg, ampicillin 200 mg / kg, and vancomycin 100 mg / kg) for 5 days. Colonization with microbiota was achieved through intragastric gavage with 200 pl of inoculum once a day for three consecutive days.[000455] Fecal samples were collected 28 days after the microbiota transplantation and stored at -80 °C until further processing. Bacterial DNA was extracted from the recipient's fecal samples and from the original recipients' feces using a QIAamp stool DNA mini kit following the manufacturer’s instructions. Sequencing libraries of the V3-V4 region were prepared according to the Illumina MiSeq system instructions. In brief, the V3 and V4 regions of the 16S bacterial rRNA gene were amplified using a two- step polymerase chain reaction (PCR) protocol with V3 and V4 region primers (forward: 5- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’; reverse: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3') for the first PCR and Nextera XT index primers for the second PCR. Amplicons were cleaned using AMPure XP magnetic beads. Illumina sequencing adapters and dual-index barcodes were then added to each amplicon. Libraries were assessed with the Qubit dsDNA HS assay kit and Tapestation high sensitivity D1000 ScreenTape. They were normalized and sequenced on an Illumina MiSeq instrument using a MiSeq reagent kit v2 (500 cycles). The data were analyzed using the MiSeq Reporter software Metagenomics workflow by Illumina, and the Bray-Curtis similarity between pairs of inoculum and donor samples was assessed. This analysis particularly focused on the Gammaproteobacteria, Bacillales, Enterobacterales, Bacteroidales, Lactobacillaceae, Ruminococcaceae, Alcaligenaceae, Lachnospiraceae, Coriobacteriaceae, Gastranaerophilales, Prevotellaceae families, as well as Verrucomicrobiales, Erysipelotrichales, and Clostridiales. (Figure 23).Example 54. The use of cell treatment to generate cells with the higher secretion capacity.[000456] We utilized mucus secreted by goblet cells as a reference model for modulating cell secretion function. HT29-MTX cells, derived from human colon carcinoma and known for mucin secretion, were cultivated in plastic culture flasks using RPMI-1640 medium within a 5% CO2 atmosphere in a humidified incubator. These cells were treated with multiple rounds of DNase and RNase, as describedpreviously, to produce treated cells either in the presence of EVs or following EV removal. Mucin-like glycoprotein secretion was quantified using an enzyme-linked lectin assay (ELLA) and expressed in nanograms per 10A5 cells.Table 70. Enhanced Cell Secretion Activity and Mucin A Secretion Following Cell Treatment.*p<0.05#p<0.05 Treated in the presence of EVs compared to Treated without EVs[000457] The data received indicate that treatment cells can enhance their secretion activity, having higher reprogramming potential, promoting increased mucin secretion and the production of protective mucus layers.Example 55. The use of treatment of immune cells to prevent autoimmunity[000458] We investigated whether cell treatment could be utilized to reset immunological memory and reprogram cells. Peripheral blood mononuclear cells (PBMCs) were isolated from blood samples of patients diagnosed with systemic lupus erythematosus (SLE) using Ficoll-Paque Plus density-gradient centrifugation. The lymphocyte-enriched fraction was washed with PBS (pH 7.2) and centrifuged at 500g for 20 minutes. To generate treated B-celis, a portion of the samples underwent multiple treatments with DNase and RNase (B-T), while controls were treated with PBS (B-Mock). Additionally, some untreated B- cellswere mixed with SL4-T ceils in a 10:1 proportion. The viability of cells was monitored by MTT according to manufacturer’s recommendations (Sigma).[000459] The cells, at a density of 5 x 1OA5 cells per well in 96-well plates, were cultured in RPMI 1640. Antibody production was stimulated by adding 2.5 pg / ml CpG (InvivoGen), known to promote antibody secretion in B cells through TLR9 stimulation. The identification of antinuclear antibodies was conducted on day 5 using an ELISA immunoassay using SLE ELISA KIT (Table 71).[000460] The groups were organized as follows: Group 1 : Control B-cells / plasma cells (B-C) not stimulated; Group 2: Control B-cells / plasma cells (B-Mock) stimulated with CpG; Group 3: Treated B- cells / plasma cells (B-T) stimulated with CpG; Group 4: Untreated B-cells / plasma cells + SL4-T (B+SL4-T) stimulated with CpG; Group 5: Untreated B-cells / plasma cells + SL4-Tr (B+SL4-Tr) stimulated with CpGTable 71 . Analysis of autoantibody production.[000461] The data we obtained indicate that control B-cells were involved in the production of antinuclear antibodies. In contrast, treated B-cells or the addition of SL4-T cells (but not SL4-Tr) to B-cells suppressed autoantibody production.Example 56. The use of treated cells for interspecies transplantation[000462] Methods: Blood samples were obtained from horses, cows, pigs, and humans, using heparin-containing vacutainers ('green' tops) as an anticoagulant. These samples were stored at +4°C until use. For each sample, 10 mL of blood was centrifuged at 1500xg for 5 minutes, and the plasma fraction was separated from the samples. The sediment was washed with the same volume of 0.9% NaCI, mixed, and the tubes were inverted. This centrifugation and washing process was repeated five times.After the final wash, 5 mL of PBS was added, and the resulting samples were diluted to a concentration of approximately ~5X10A8 red blood cells / mL.1% Triton-X100 and PBS were used as positive and negative controls, respectively.[000463] After adding the samples to wells, the plate was gently shaken for 20 seconds and incubated at room temperature for 30 minutes (sufficient for agglutination due to both antigens and immune reactions attacking foreign red blood cells). The contents of the wells were then centrifuged at 1500xg for 5 minutes. The supernatant was collected, transferred to a plate, and the optical density of each well was measured at 405 nm.[000464] C-control cells; T-treated cells with multiple rounds of DNase and RNase treatment[000465] Table Title: Hemolytic activity and transplantability of treated cells between different unrelated organisms. (Table 72below)Table 72Example 57. Use of cell treatment to produce programable protein-producing cells from stem cells.[000466] Human iPSCs derived from fibroblasts were cultured in low oxygen conditions using RPMI 1640 or Essential 8 medium. They were divided into groups: untreated controls, DNase-treated, RNase-treated, and those treated with both DNase and RNase. After differentiation into insulin-producing cells, a subset of controls was also treated with DNase and RNase, forming a fifth group. All the cells treated with nucleases were either treated in the presence of EVs in solution (“T”) or with EVs removed (“Tr”). Insulin levels were measured with ELISA after incubating cells in glucose-supplemented medium. Results showed the impact of nuclease treatment on insulin production.[000467] Results of the effect of treatment on insulin production are shown in the Table below.Table 73. Insulin synthesis by developed insulin producing cells.*p<0.05#p<0.05 Treated in the presence of EVs compared to Treated without EVs[000468] Insulin secretion in response to 2.5 mM glucose. Results were normalized to the total protein concentration in supernatants and presented as picograms of insulin per milligram of the total protein content in supernatant of insulin producing cells.[000469] To test in vivo insulin secretion, IPSCs were transplanted into diabetic STZ-inducedRag2- / -yc- / - mice. The fasting blood glucose levels in these mice were monitored daily. Table Title: Effect of Transplantation of Treated Celis on Glucose. (Table 73 below)Table 73.*p<0.05#p<0.05 Treated in the presence of EVs compared to Treated without EVsEXAMPLE 59: Products and method for allogeneic mesotherapy[000470] A patient experiencing hairline decline was previously unsuccessfully treated with multiple rounds of autologous PRP therapy. Following the failure of the PRP therapy to enhance hair growth, the patient underwent two cycles of PRP therapy, utilizing allogeneic SL4-T. The results, as measured by hair count per 1 cmA2, are presented in Table 74 below.Table 74. The use of allogeneic treated cells for the restoration for the hairline.*p<0.05Example 60: The Use of Cell-surface-bound for the Development of an Anti-Aging Vaccine[000471] Known DNA and RNA vaccines contain the DNA or RNA sequence that encodes the protein antigen, which is synthesized and against which an immune response is sought. In our case, antibodies are produced against the DNA or RNA itself.[000472] Female / male SWISS mice were used utilized in this study. Upon initiation of the study, these mice were aged between 3 and 80 weeks. They were accommodated in standard plastic cages designed for mice, with each cage housing 5 to 6 animals. All mice were given unrestricted access to tap water and a standard diet (Purina 5L79, Rat and Mouse 18% protein, supplied by PMI Nutrition International, Brentwood, MO, USA).[000473] Vaccination methods: Antigen (60 pg / mice) cell-surface-bound nucleic acids of bacteria (Pseudomonas aeruginosa VT20, Escherichia coli \ / 7 224 , Klebsiella spp VT17, Enterobacter spp VT98, Streptococcus spp VT5, Proteus spp. VG-8, Stenotropomonas spp VT6, Burkholderia spp VT7, Staphylococcus spp VF90) or human white blood cells (VL-5H) was diluted in 100 pl PBS and mixed equally with Complete Freund’s adjuvant (or AIOH3). Mice were injected intraperitoneally with 100 pl of this mix and subcutaneously at base of tail with 100 pl. A booster injection, consisting of 60 pg antigen, diluted in PBS, and mixed 1 :1 with Incomplete Freund’s adjuvant (or AIOH3) was administered after 3 weeks. One more booster injection was given either with 60 pg antigen in PBS 1 :1 .MAJOR SIGNS:[000474] Urinary Incontinence Test: Mice without water for 4 hours; filter papers analyzed under UV light for voids, measured with Image J. Home Cage Activity: Locomotor activity over 6 days, recording distance traveled in standard cages. Open Field Test: Anxiety assessed in a divided arena for 6 minutes, noting periphery time and immobility. Elevated Plus Maze: Exploration of open vs. closed arms over 10 minutes. Barnes Maze: Escape latency and errors in finding an escape box. Forced Swim Test: Behavioral responses in water-filled cylinders. Grip Strength Test: Maximum strength measured. Blood and Serum Analysis: CBC and serum tests for metabolic and organ function using ABX Pentra and Vitros analyzers.Mice immunized at 35 weeks / 8 months.Table 75. Major signs | Absolute data.*p<0.05, ** p<0.01 , ***p<0.001 when compared to the control mice of the same age (96 weeks)Table 76. Kaplan - Meier study.Figure 20 shows a boostervaccine for bacterial which was given 6 and 12 month after the initial vaccination.Table 76. Major signs | Absolute data.*p<0.05, ** p<0.01 , ***p<0.001 when compared to the control mice of the same age“ / ***” when compared with vaccinated animals that did not receive a boosterExample 61.Effect of cells tuning on longevity[000475] We examined the impact of cell tuning on longevity by assessing telomere length in white blood cells as an example. White blood cells (WBC) were isolated from donor blood using the quadruple bag system. Characteristics of blood donors are presented in the Table 77 below.Table 77.[000476] To generate “tuned” WBCs (SL4-T) were treated with either DNase I and RNase A (SL4- Tn) or with anti-DNA and anti-RNA antibodies (SL4-Ta), as previously described. As a control we used untreated cells.[000477] DNA from WBCs was isolated using a Qiagen DNA Midi kit. For PCR, we followed the protocols outlined by Lin J, Smith DL, Esteves K, Drury S in 'Telomere length measurement by qPCR- Summary of critical factors and recommendations for assay design' (Psychoneuroendocrinology, 2019 Jan 1 ;99:271-8) and used the following primers: telg ACACTAAGGTTTGGGTTTGGGTTTG GGTTTGGGTTAGTGT tele TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA[000478] Probes:The results of tuning cell telomere length are depicted in the Table 78 below.Table 78. The impact of cell tuning on telomere length.*p<0.05Example 62. The use of vaccine together with tuned cells for the increase of longevity.[000479] The study aimed at evaluating the effectiveness of the vaccination with extracellular DNA of (Pseudomonas aeruginosa VT20, Escherichia coli VT 224 , Klebsiella spp VT17, Enterobacter spp VT98, Streptococcus spp VT5, Proteus spp. VG-8, Stenotropomonas spp VT6, Burkholderia spp VT7, Staphylococcus spp VF90) (eDNAB) vaccination in conjunction with various adjuvants and additional agents reveals significant differences in the condition of mice, especially when compared to a control group. The primary vaccination agent, eDNAB, combined with additional agents, including SL-4C, FB-C (control fibroblasts), SL4-T, and FB-T (fibroblasts tuned following multiple treatments with anti-DNA and anti-RNA antibodies), demonstrates improvements across a range of health-related parameters.[000480] Individually, the eDNAB vaccination improved the condition compared to the control group, reducing the actual age of mice in comparison to their physiological state, reflected in the decrease of the Frailty index. This improvement was particularly noticeable in aspects related to anxiety and activity under normal and stressful conditions, depression, muscle function, and laboratory data. Theintroduction of SL-4T and FB-T, both separately and in combination, without vaccination also shows positive effects, albeit to a lesser extent than when combined with the vaccine.[000481] However, the most significant improvements were observed when the vaccination was combined with the processed forms SL4-T and FB-T. These combinations led to an improvement in bladder function, a reduction in anxiety, an improvement in activity under various conditions, a lower level of depression, and an improvement in muscle function. Laboratory data also reflected positive changes, indicating an improvement in overall health.[000482] Interestingly, the combination of vaccination with processed forms SL4-T and FB-T not only improved the condition according to individual parameters but also contributed overall to the reduction of the Frailty index, indicating a slowdown in the aging processes and an improvement in the quality of life of the mice.[000483] The eDNAPA vaccination significantly extends the lifespan of mice, and this effect can be further enhanced by combining the vaccine with additional agents such as SL4-T and FB-T. The combination of eDNAPA20 with both SL4-T and FB-T provides the most significant increase in estimated median survival as shown in the Table 79 below.Table 79.*p<0.05Example 63. Effect of treated cells on antimicrobial and anticancer activity of white blood cells[000484] Our analysis revealed differential expression of numerous genes SL4-T compared to SL4-C. Our analysis revealed a positive enrichment of genes associated with numerous pathways including Immune cell signaling, Immune cell migration, and Cellular uptake. For instance, key pathways enriched included Chemokine signaling, Cytokine signaling, and MARK signaling, transedothelial migration, extravasation, anaerobic energy pathways, energy metabolism including glyscolysis, actin cytoskeleton remodeling, endocytosis and phagocytosis pathways. The results of the differentially expressed genes profiles of SL4-T compared to SL4-C are shown in the Figure 21 (a) - (c).Example 63. Effect of treated cells on generation of evolutionary old ancestor organisms[000485] In order to get the evolutionary old organisms, we treated cells of Elodea with several rounds of nucleases. The resulted plant was able to generate the energy using evolutionary old pathways including anaerobic and to grow in darkness. The characteristics of the plants grown from the treated cells are shown in Figure 22.Example 64. The use of treated cells for the treatment of heart associated disease and metabolic syndrome.History of Present Illness:[000486] Mr. D, a 68-year-old male patient, began experiencing significant issues related to heart disease and the circulatory system, including arrhythmias, high blood pressure, poor exercise tolerance, and frequent episodes of chest pain requiring administration of nitroglycerin-containing compounds.Experimental Therapy Initiation:[000487] Despite ongoing treatment, the patient's symptoms worsened. Two experimental regimens of (I) WBC and platelets treated with multiple rounds of DNase and RNase as described above, followed by the therapy with (II) WBC in combination with platelets and membrane vesicles and apoptotic bodies, treated with multiple rounds of DNase and RNase, was initiated with consent, ranging from weekly to daily injections of 10A7 or 10A8 cells.Table 80. Outcome of Therapy[000488] Experimental therapy targeted multiple symptoms. Both experimental therapies were effective. Surprisingly, the mixture of white blood cells, platelets, and their membrane vesicles and apoptotic bodies worked even better.Example 65. The use of treated cells for the treatment of stroke.[000489] The patients were treated for the stroke. Total 6 patients were used in the study. The patients were treated with the two experimental regimens of (i) WBC and platelets treated with multiple rounds of DNase and RNase as described above, followed by the therapy with (ii) WBC in combination with platelets and membrane vesicles and apoptotic bodies, treated with multiple rounds of DNase and RNase, was initiated with consent, ranging from weekly to daily injections of 10A7 or 10A8 cells. The experimental therapy was administered at different time points after carotid thrombosis, ranging from 1 hour to 4 hours,from 6 hours to 12 hours, from 24h to 48 hours, along with tPA. The results were calculated as the average area of ischemia compared to the control group treated with tPA alone, which was taken as 100% (Table below).Table 81 . Effect of SL-T for the treatement of stroke*p<0.05 compared to Control[000490] #p<0.05 compared to Experimental therapy with WBC and platelets treated with multiple rounds of DNase and RNase[000491] The results unexpectedly show that the Experimental therapy with WBC and platelets treated with multiple rounds of DNase and RNase were effective for the treatment of stroke. Surprisingly, the efficacy of the Experimental therapy with WBC platelets, and membrane vesicles and apoptotic bodies, all treated with multiple rounds of DNase and RNase was even more effective for the management of stroke.Example 65. The use of preparation of the cells from CD34+.[000492] Two patients with advanced metastatic prostate cancer (primary tumor size: 21-28 mm in both patients) were enrolled. CD34+pluripotent stem cells were isolated from the patients’ blood using anti- CD34+antibodies.[000493] Next, CD34+cells were expanded and differentiated into lymphocyte, granulocyte, monocyte, and megakaryocyte lineages (all expansion kits from Stemcell Technologies). Upon expansion, the resulting white blood cells and platelets — either alone or in combination with platelet membrane vesicles, extracellular vesicles, and apoptotic bodies — were treated with one or more rounds of DNase and RNase, or with anti-DNA and anti-RNA antibodies.[000494] After signing informed consent forms, both patients were treated with the allogeneic experimental therapies, receiving injections ranging from 10® to 10® cells, eitherweekly or daily. The results are presented in the following table 82.Table 82. Effect of the therapy with cells produced from the stem cells.*p<0.05 compared to Control[000495] #p<0.05 compared to Experimental therapy with WBC and platelets treated with multiple rounds of DNase and RNase[000496] The results unexpectedly show that the Experimental therapy with WBC and platelets obtained from the stem cells treated with multiple rounds of DNase and RNase were effective for the treatment of cancer. Surprisingly, the efficacy of the Experimental therapy with WBC, platelets, treated with nucleases in the presence of membrane vesicles and apoptotic bodies all treated with multiple rounds of DNase and RNase was even more effective.Example 66. Bioproduction[000497] The SL4-T and SL4-Tr were obtained as previously discussed. Cells were stimulated with microbial LPS as described before. Protein identification and label-free quantification using ultra-high performance LC (UPLC) coupled with tandem MS was conduced. Briefly, two aliquots of each culture medium sample (containing 50 pg of protein) were removed for bottom-up proteomics analysis. One aliquot was subjected to standard in-solution digestion procedures, including a 1 :1 dilution (v: v) with 0.1 M ammonium bicarbonate in water (final pH of 8). Cys residues were reduced and alkylated using 5 mM DTT and 10 mM iodoacetamide for 1 .5 h at 22°C room temperature and 45 min at room temperature in the dark. Sequencing-grade modified trypsin (Promega) was added at a 1 :20 dilution (enzyme: protein), and digested proceeded for 16 h at 37 °C on a thermal mixer. Trypsin digestion was quenched with formic acid to a final pH of 2.5.[000498] The second culture medium sample was subjected to full denaturation and high- temperature digestion by adding urea (8 M final concentration). The Cys residues in the urea-denatured samples were reduced and alkylated with 5 mM DTT or 10 mM iodoacetamide at room temperature for 1 .5 h or 45 min in the dark, respectively. Endoproteinase LysC / trypsin mixture (Promega) was added to the samples at a 1 :20 (enzyme: protein) ratio for 16 h at 37 °C on a thermal mixer for LysC-specific proteolysis. On the next day, the samples were diluted to contain 1 M urea using 0.1 M ammonium bicarbonate to activate the trypsin, after which they were digested for 8 h at 50 °C. The dual-enzyme digestion reactions were cooled to room temperature and quenched using formic acid (final pH: 2.5). Digested and acidified peptides from both digestion protocols were desalted using Pierce Peptide Desalting Spin Columns, dried down, resuspended in 0.1 % formic acid in water, quantified by measuring their OD280 values using a Nanodrop spectrophotometer (Thermo Scientific), and frozen at -20 °C before analysis.[000499] Desalted peptides were subjected to UPLC-MS / MS analysis using a Dionex Ultimate 3000 RSLCnano UPLC instrument coupled to an Orbitrap Eclipse Tribrid MS instrument (Thermo Fisher Scientific). The peptides were loaded onto a nanoEase m / z Peptide BEH C18 analytical column (WatersCorporation, Milford, MA) 75 pm x 25 cm and separated using a 60 min linear reversed-phase UPLC gradient (solvent A: 0.1 % formic acid in water, solvent B: 0.1 % formic acid in acetonitrile). The peptides were gradient-eluted directly into the Orbitrap Eclipse using positive-mode electrospray ionization and analyzed using the data-dependent acquisition method for MS / MS acquisition, incorporating higher energy collisional dissociation. Both MS and MS / MS spectra were acquired at high resolution with the Orbitrap instrument.[000500] Peptide identification, protein identification, and label-free quantification were performed using MaxQuant (v2.0.2.0) and an embedded Andromeda search engine. Raw data were searched against the UniProt Homo sapiens reference proteome (identifier UP000005640, accessed 02 / 26 / 2024) using tryp / P enzyme specificity, a minimum peptide length of 5 amino acids, and variable modifications: oxidation of Met, protein N-terminal acetylation, deamidation of Asn and Gin residues, and peptide N-terminal Gin to pyroGlu conversion. Cys carbamidomethylation was set as a fixed modification. Protein and peptide spectrum match false-discovery rates were set to 1 %. The MaxQuant results were uploaded to Scaffold 5 (Proteome Software) for further data visualization and analysis.[000501] The amounts of proteins, metabolites and peptides produced by SL4-T were unique compared to untreated cells and to SL4-T4. Table below presents the products either exclusively produced by SL4-T or which amounts were significantly higher compared to SL4-Tr or SL4-C. , Predominantly they were associated with *Abiotic stress*, *CHEMOKINE*, *Hepatoprotective peptide MAP2*, *NEUROACTIVE*, *ANTIDIABETES (type2)*, *Antihyperuricemic*, *Antihypertensive*, *Antioxidative*,Table 83. List of products[000502] In closing, it is to be understood that although aspects of the present specification are highlighted by referring to specific embodiments, one skilled in the art will readily appreciate that these disclosed embodiments are only illustrative of the principles of the subject matter disclosed herein. Therefore, it should be understood that the disclosed subject matter is in no way limited to a particular compound, composition, article, apparatus, methodology, protocol, and / or reagent, etc., described herein, unless expressly stated as such. In addition, those of ordinary skill in the art will recognize that certain changes, modifications, permutations, alterations, additions, subtractions and sub-combinations thereof can be made in accordance with the teachings herein without departing from the spirit of the present specification. It is therefore intended that the following appended claims and claims hereafter introduced are interpreted to include all such changes, modifications, permutations, alterations, additions, subtractions and sub-combinations as are within their true spirit and scope.[000503] Certain embodiments of the present invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects skilled artisans to employ such variations as appropriate, and the inventors intend for the present invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described embodiments in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.[000504] Groupings of alternative embodiments, elements, or steps of the present invention are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other group members disclosed herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.[000505] Unless otherwise indicated, all numbers expressing a characteristic, item, quantity, parameter, property, term, and so forth used in the present specification and claims are to be understood as being modified in all instances by the term “about.” As used herein, the term “about” means that the characteristic, item, quantity, parameter, property, or term so qualified encompasses a range of plus or minus ten percent above and below the value of the stated characteristic, item, quantity, parameter, property, or term. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary. For instance, as mass spectrometry instruments can vary slightly in determining the mass of a given analyte, the term "about" in the context of the mass of an ion or the mass / charge ratio of an ion refers to + / -0.50 atomic mass unit. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical indication should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.[000506] Use of the terms “may” or “can” in reference to an embodiment or aspect of an embodiment also carries with it the alternative meaning of “may not” or “cannot.” As such, if the present specification discloses that an embodiment or an aspect of an embodiment may be or can be included as part of the inventive subject matter, then the negative limitation or exclusionary proviso is also explicitly meant, meaning that an embodiment or an aspect of an embodiment may not be or cannot be included as part of the inventive subject matter. In a similar manner, use of the term “optionally” in reference to an embodiment or aspect of an embodiment means that such embodiment or aspect of the embodiment may be included as part of the inventive subject matter or may not be included as part of the inventive subject matter. Whether such a negative limitation or exclusionary proviso applies will be based on whether the negative limitation or exclusionary proviso is recited in the claimed subject matter. Further, the use of the terms “include,” “includes” and “including” means include, includes and or including as well as include, includes and including, but not limited to.[000507] Notwithstanding that the numerical ranges and values setting forth the broad scope of the invention are approximations, the numerical ranges and values set forth in the specific examples are reported as precisely as possible. Any numerical range or value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Recitation of numerical ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate numerical value falling within the range. Unless otherwise indicated herein, each individual value of a numerical range is incorporated into the present specification as if it were individually recited herein.[000508] The terms “a,” “an,” “the” and similar references used in the context of describing the present invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Further, ordinal indicators - such as “first,” “second,” “third,” etc. - for identified elements are used to distinguish between the elements, and do not indicate or imply a required or limited number of such elements, and do not indicate a particular position or order of such elements unless otherwise specifically stated. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein is intended merely to better illuminate the present invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the present specification should beconstrued as indicating any non-claimed element essential to the practice of the invention.[000509] When used in the claims, whether as filed or added per amendment, the open-ended transitional term “comprising” (and equivalent open-ended transitional phrases thereof like including, containing and having) encompasses all the expressly recited elements, limitations, steps and / or features alone or in combination with unrecited subject matter; the named elements, limitations and / or features are essential, but other unnamed elements, limitations and / or features may be added and still form a construct within the scope of the claim. Specific embodiments disclosed herein may be further limited in the claims using the closed-ended transitional phrases “consisting of” or “consisting essentially of’ in lieu of or as an amended for “comprising.” When used in the claims, whether as filed or added per amendment, the closed- ended transitional phrase “consisting of” excludes any element, limitation, step, or feature not expressly recited in the claims. The closed-ended transitional phrase “consisting essentially of’ limits the scope of a claim to the expressly recited elements, limitations, steps and / or features and any other elements, limitations, steps and / or features that do not materially affect the basic and novel characteristic(s) of the claimed subject matter. Thus, the meaning of the open-ended transitional phrase “comprising” is being defined as encompassing all the specifically recited elements, limitations, steps and / or features as well as any optional, additional unspecified ones. The meaning of the closed-ended transitional phrase “consisting of” is being defined as only including those elements, limitations, steps and / or features specifically recited in the claim whereas the meaning of the closed-ended transitional phrase “consisting essentially of’ is being defined as only including those elements, limitations, steps and / or features specifically recited in the claim and those elements, limitations, steps and / or features that do not materially affect the basic and novel characteristic(s) of the claimed subject matter. Therefore, the open-ended transitional phrase “comprising” (and equivalent open-ended transitional phrases thereof) includes within its meaning, as a limiting case, claimed subject matter specified by the closed-ended transitional phrases “consisting of’ or “consisting essentially of.” As such embodiments described herein or so claimed with the phrase “comprising” are expressly or inherently unambiguously described, enabled and supported herein for the phrases “consisting essentially of’ and “consisting of.”[000510] All patents, patent publications, and other publications referenced and identified in the present specification are individually and expressly incorporated herein by reference in their entirety for the purpose of describing and disclosing, for example, the compositions and methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.[000511] Lastly, the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims. Accordingly, the present invention is not limited to that precisely as shown and described.[000512] Although embodiments of the current disclosure have been described comprehensively in considerable detail to cover the possible aspects, those skilled in the art would recognize that other versions of the disclosure are also possible.[000513] While the present invention has been described in terms of particular embodiments and applications, in both summarized and detailed forms, it is not intended that these descriptions in any way limit its scope to any such embodiments and applications, and it will be understood that many substitutions, changes and variations in the described embodiments, applications and details of the method and system illustrated herein and of their operation can be made by those skilled in the art without departing from the spirit of this invention.[000514]The present invention is also described and demonstrated by way of the following examples. However, the use of these and other examples anywhere in the specification is illustrative only and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to any particular preferred embodiments described here. Indeed, many modifications and variations of the invention may be apparent to those skilled in the art upon reading this specification, and such variations can be made without departing from the invention in spirit or in scope. The invention is therefore to be limited only by the terms of the appended claims along with the full scope of equivalents to which those claims are entitled.

Claims

What is claimed:1 . A product for treating a cancer, wherein a product is a composition comprising a cell and one or more of an extracellular vesicle and a platelet treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity;2. The treated extracellular vesicles of claim 1 , wherein the extracellular vesciles are an exosome, a membrane vesicle, a microvesicle, or an apoptotic body.

3. The treated extracellular vesicle of claim 1 , wherein the treated extracellular vesicles are derived from a cell treated with one or more of an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

4. The treated extracellular vesicle of claim 1 , wherein the treated extracellular vesicles are derived from an immune cell.

5. The immune cells of claim 4, wherein the immune cells are one or more of a B-cell, a T-cell, a dendritic cell, a macrophage, a natural killer cell, a neutrophil, a monocyte, an eosinophil, a monocyte, a basophil, a plasma cell, a CD34+ and / or a CD90+ cell, an immature immune cell, a cells of microglia and / or a mast cell.

6. The product of claim 1 wherein the treated cell is CD 34+.

7. The product of claim 1 wherein the treated cell is CD 90+.

8. The product of claim 1 wherein the treated cell is a derivative of CD 34+.

9. The product of claim 1 wherein the treated cell is a derivative of CD 90+.

10. A method for treating a cancer, wherein a. a composition comprising a cell, which is not a chimeric antigen receptor T-cell, together with an extracellular vesicle are treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA , an antibody that binds to a DNA and / or a molecule with nuclease activity; b. following treatment, a therapeutically effective amount of the composition of treated cells and extracellular vesicles are administered to a patient suffering from a cancer; and c. following administration, the composition of treated cells and extracellular vesicles reduce the symptoms of the cancer.11 . The method of claim 10, wherein the administered composition of treated cells and extracellular vesicles produce a bioproduct with anticancer activity that reduces or maintains the number of cancer cells in the patient.

12. The method of claim 10, wherein the administered mixture / complex of treated cells and extracellular vesicles produce a bioproduct with anticancer activity that reduces or maintains the size of a tumor in the patient.

13. The method of claim 10, wherein the administered composition of treated cells and extracellular vesicles maintain the size of the tumor or results in its regression.

14. The method of claim 10, wherein the administered composition of treated cells and extracellular vesicles are a combination of leukocytes and platelets.

15. The method of claim 10, wherein the cancer is a solid tumor, primary tumor, metastasis, or circulating cancer cells.

16. The method of claim 10, wherein the treated composition of treated cells and extracellular vesicles are autologous or allogeneic.

17. The method of claim 10, wherein along with the administration of the treated composition of treated cells and extracellular vesicles to the patient, the patient undergoes one or more of chemotherapy, immunotherapy, radiotherapy, targeted therapy, gene therapy, cell therapy, surgery, to treat the cancer.

18. The method of claim 17, wherein the two or more treatments increase the effectiveness of the treated cells to treat a cancer.

19. The method of claim 10, wherein the cancer is head and neck cancer, breast cancer, blood cancer, a lung cancer, a prostate cancer, gastrointestinal cancers, liver cancer, bone cancer or pancreatic cancer, precancer.

20. The method of claim 1 , wherein the treated cells are administered to a patient by intracerebral, intracerebroventricular, intraparenchymal injections, intrastriatal, intraspinal, parenteral, subcutaneous, intramuscular, intravenous, intraarterial, inhalation, intradermal, intrathecal, intracisterna magna, epidural and infusion, subarachnoid injection, enteral, oral, intramuscular, intraperitoneal, transdermal, rectal, nasal, buccal, sublingual, vaginal, intraperitoneal, topical, transdermal administration, inside the tumor or inside the surgical wound.21 . A product for treating an infection, whereinA product is a composition of cell together with extracellular vesicles treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

22. The treated extracellular vesicles of claim 21 , wherein the treated extracellular vesicles are derived from a cell treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

23. The treated extracellular vesicles of claim 21 , wherein the treated extracellular vesicles are derived from an immune cell.

24. The cells of claim 23, wherein the immune cells are selected from a B-cell, a T-cell, a dendritic cell, a macrophage, a natural killer cell, a neutrophil, a monocyte, an eosinophil, a monocyte, a basophil, a plasma cell, a CD34+ and / or a CD90+ cell, an immature immune cell, a cells of microglia and / or a mast cell.

25. The product on claim 21 wherein the treated cell is CD 34+.

26. The product on claim 21 wherein the treated cell is CD 90+.

27. The product on claim 21 wherein the treated cell is derived from a CD 34+ cell.

28. The product on claim 21 wherein the treated cell is derived from a CD 90+ cell.

29. A method for treating an infection, wherein a. a composition of cells, which is not a chimeric antigen receptor T-cell, together with extracellular vesicles and platelets is treated with one or more of an RNase, a DNase, an enzymethat has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity; b. following treatment, a therapeutically effective amount of the composition of treated cells and extracellular vesicles are administered to a patient suffering from an infection; and c. following administration, the composition of treated cells and extracellular vesicles reduce the symptoms of the infection.

30. The method of claim 21 , wherein the infection is a bacterial, viral, fungal, protozoan or parasitic infection.31 . The method of claim 21 , wherein the patient is suffering from a chronic infection, a temporary infection, a repeated infection or an acute infection.

32. The method of claim 21 , wherein the composition of treated cells and extracellular vesicles are used to treat an infection comprising two or more of a bacteria, a virus, a fungus, a protozoa or a parasite.

33. The method of claim 21 , wherein the composition of treated cells and extracellular vesicles produce one or more bioproducts that are capable of treating an infection in the patient.

34. The method of claim 21 , wherein the one or more bioproducts reduce the severity of the infection35. The method of claim 21 , wherein the one or more bioproducts produced by the treated cells increase the survival time of the patient suffering from an infection as compared to a patient that is not administered the treated cells that produce one or more bioproducts.

36. The method of claim 21 , wherein the administered treated cells are a combination of leukocytes mixture / complex of treated cells and extracellular vesicles.

37. The method of claim 21 , wherein the composition of treated cells and extracellular vesicles are autologous or allogeneic.

38. The method of claim 21 , wherein the composition of treated cells and extracellular vesicles are treated two or more times with one or more of an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA, an enzyme with DNase or RNase activity and / or a molecule with nuclease activity.

39. The method of claim 38, wherein the two or more treatments increase the effectiveness of the mixture / complex of treated cells and extracellular vesicles to treat an infection.

40. The method of claim , wherein the composition of treated cells and extracellular vesicles are administered to a patient by intracerebral, intracerebroventricular, intraparenchymal injections, intrastriatal, intraspinal, parenteral, subcutaneous, intramuscular, intravenous, intraarterial, inhalation, intradermal, intrathecal, intracisterna magna, epidural and infusion, subarachnoid injection, enteral, oral, intramuscular, intrapleural, transdermal, rectal, nasal, buccal, sublingual, vaginal, intraperitoneal, topical, transdermal administration or inside the site of an infection.41 . A composition comprising a cell, an extracellular matrix and a vesicle, which are treated with one or more rounds of one or more of a DNase, an RNase, an enzyme that has DNase, has RNase activity, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity.

42. The treated extracellular matrix and vesicles of claim 41 , wherein the treated extracellular matrix and vesicles are derived from a cell treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

43. The treated extracellular matrix and vesicles of claim 41 , wherein the treated extracellular matrix are derived from an immune cell.

44. A composition comprising a treated cell, an extracellular matrix and a vesicle, wherein the cells of the composition are derived from a prokaryotic cell, a yeast cell, a protozoa, a reptilian cell, a multicellular organism, an insect cell or a mammalian cell.

45. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the cell is a Chinese Hamster Ovary (CHO) cell, a human embryonic kidney (HEK) cell, S cerevisiae, Penicillum, or a hybridoma cell.

46. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell is able to grow in one or more different concentrations comprising one or more of O2 and CO2 as compared to an untreated cell.

47. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell is able to resist variations of one or more of temperature, UV environment or proteases as compared to an untreated cell.

48. A composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell is used to manufacture food for livestock.

49. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell is used in a fermentation process to produce a food or a beverage.

50. The composition comprising a treated cells an extracellular matrix and a vesicle of claim 49, wherein the food or beverage is a cheese, a yogurt, a wine, a whiskey or a beer.51 . The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell is used to manufacture a material for the building industry, including a wood.

52. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell produces a vegetable, a grain, a fruit, a mushroom or an herb.

53. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, for the enhanced production of a biomolecule.

54. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell produces a cosmetology product.

55. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell produces unique varieties of meat, milk, and fish.

56. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell differentiates into a cell, a bacteria and / or a fungi not found on Earth.

57. The composition comprising a treated cell, an extracellular matrix and a vesicle of claim 44, wherein the treated cell produces a product of interest with a higher yield, faster and with a higher expansion58. A composition comprising a a cell, organoid, a tissue, an embryo, an organ, a single-cellular organism, a multicellular organism, an extracellular matrix and / or a vesicle each treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity, wherein the composition increases the amount of antibodies, cytokines, growth factors, viral vectors, antigens, vaccines, complex engineered antibodies, trivalent T-cell engagers, checkpoint modulators, naive proteins, recombinant proteins, vitamins, hormones, vaccine, and antibody cytokine fusions producedwhen compared to a cell, an organoid, a tissue, an embryo, an organ, a single-cellular organism, a multicellular organism, an extracellular matrix and / or a vesicle that is not treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

59. A method of stimulating production of a biomolecule by composition comprising a cell, an extracellular matrix and a vesicle with one or more rounds of one or more of a one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

60. The method of claim 59, wherein the composition is maintained and / or cultured in vitro.61 . The method of claim 59, wherein the treated composition results in an increase in the production of the biomolecule by the composition.

62. The method of claim 59, wherein the treatment of the composition results in an expedited production of biomolecules.

63. The method of claim 59, wherein the composition is used to manufacture a biomolecule for the food industry.

64. The method of claim 63, wherein the biomolecule is an antibody, a cytokine, a growth factor, a viral vector, an antigen, a vaccine, a complex engineered antibody, a trivalent T-cell engager, a checkpoint modulator or inhibitor, a naive protein, a recombinant protein, a vitamin, a hormone, an antibody cytokine fusion, a biopharmaceuticals, a fusion protein; a clotting and coagulation factor; a TNF inhibitor; an Interferon, a recombinant antibody; an adeno associated virus, a virus, a receptor or a hormone.

65. A composition for treating an autoimmune disease, wherein the composition comprises a cell, an extracellular vesicle that is treated with one or more of an RNase, a DNase, an enzyme that has Dnase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

66. The composition of claim 65, wherein the extracellular vesicle is one or more of an exosome, a membrane vesicle, a microvesicle, an apoptotic body and a platelet.

67. The composition of claim 65, wherein the treated extracellular vesicles are derived from a cell treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

68. The composition of claim 65, wherein the treated cell is CD 34+.

69. The composition of claim 65, wherein the treated cell is CD 90+.

70. The composition of claim 65, wherein the treated cell is derivatives of CD 34+.71 . The composition of claim 65, wherein the treated cell is derivatives of CD 90+.

72. The composition of claim 65, wherein a. the composition is treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity; b. following treatment, a therapeutically effective amount of the treated composition are administered to a patient suffering from autoimmune disease; andc. following administration, the composition reduces the symptoms of the autoimmune disease.

73. The composition of claim 65, wherein the autoimmune disease is selected from diabetes, gastrointestinal disease, a disease of the skin, a neurodegenerative disease, multiple sclerosis, systemic lupus erythematosus, amyotrophic lateral sclerosis, inflammatory bowel disease, focal segmental glomerulosclerosis, ANCA-associated vasculitis (AAV), immune-mediated inflammatory diseases (IMIDs), ankylosing spondylitis, gout, epilepsy, diabetes, allergic reactions, psoriasis and autoimmune disorder affecting the thyroid gland.

74. The composition of claim 65, wherein the treatment of an autoimmune disease comprises administering to the patient treated with the composition selected from one or more of a Mesenchymal stem cell (MST), an induced pluripotent stem cell (iPSC), and a primary fibroblasts (FB).

75. The composition of claim 65, wherein the composition reduces or prevents the progression of the autoimmune disease.

76. The composition of claim 65, wherein the composition is obtained from a patient and is treated with multiple rounds of one or more of a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity, and further wherein, the treated composition is administered to the patient and wherein, the autoimmune memory is erased from the composition.

77. The composition of claim 76, wherein the multiple rounds of the treatment of composition with one or more of a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity results in the erasure of autoimmune memory of the cells.

78. The composition of claim 76, wherein the composition is treated with six to twenty rounds with one or more of a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity prior to administration into the patient.

79. The composition of claim 65, wherein the treatment of the autoimmune disease results in the removal of a misfolded, prionogenic protein.

80. The composition of claim 65, wherein the treatment results in a reduced level of autoantibodies as compared to the level of a composition not treated with a DNase, an RNase, an anti-DNA antibody, an anti-RNA antibody and / or a molecule with nuclease activity.81 . The composition of claim 65, wherein the cell is a lymphocyte.

82. The composition of claim 81 , wherein the lymphocyte is one or more of a T-cells, a B-cell, an NK cell, a neutrophil, an eosinophil, a monocyte, a basophil, a macrophage or a plasma cell.

83. The composition of claim 65, wherein treatment with the composition reduces a symptom of an autoimmune disease by about 10% to 100%.

84. A method to improve the efficiency of transplantation, wherein the method comprises administration of a composition comprising a cell and an extracellular vesicle that have been treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and a molecule with nuclease activity.

85. The method of claim 84, wherein the extracellular vesicle is one or more of an exosome, a membrane vesicle, a microvesicle, an apoptotic body and a platelet86. The method of claim 84, wherein the treated extracellular vesicle is derived from a cell treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA , an antibody that binds to a DNA and a molecule with nuclease activity.

87. The method of claim 84, wherein the treated extracellular vesicle is derived from a cell used for the transplantation.

88. The method of claim 84, wherein the treated cell is CD 34+.

89. The method of claim 84, wherein the treated cell is CD 90+.

90. The method of claim 84, wherein the treated cell is derivatives of CD 34+.91 . The method of claim 84, wherein the treated cell is derivatives of CD 90+.

92. The method of claim 84, wherein the composition is used for auto transplantation or allogeneic transplantation.

93. The method of claim 84, wherein the composition of treated cells and extracellular vesicles has improved efficacy of transplantation compared to a composition of cells and extracellular vesicles that have not been treated.

94. The method of claim 84, wherein the composition is transplanted to the same individual from whom the cells of the composition were collected.

95. The method of claim 84, wherein the composition is transplanted into an individual from whom the cells of the composition were not collected.

96. The method of claim 84, wherein the cells of the composition is from a microbiota.

97. The method of claim 84, wherein the cells of the composition has increased cell proliferation activity.

98. The method of claim 84, wherein the composition is used for the treatment of burns, ulcers, wounds.

99. The method of claim 84, wherein the cells of the composition has an altered interaction with an MHC, an HLA, a CD protein and with an antibody.

100. The method of claim 84, wherein the cells of the composition has an altered expression of an MHC, an HLA, a CD antigen or an altered interaction with anti-CD and anti-HLA antibodies.101 . The method of claim 84, wherein the cells of the composition has an altered interaction with antiCD and anti-HLA antibodies and altered CD- and HLA antigens.

102. The method of claim 84, wherein the cells of the composition has an erased autoimmune memory.

103. The method of claim 84, wherein the cells of the composition derive from a connective tissue, an epithelial tissue, a muscle tissue, a nervous tissue.

104. The method of claim 84, wherein a cell of the composition is a fibroblast.

105. The method of claim 104, wherein the fibroblast production of collagen and hyaluronic acid is increased in the treated cells of the composition.

106. The method of claim 105, wherein the composition is transplanted into a patient.

107. The method of claim 84, wherein the cells of the composition are one or more of an embryonal cell, a derivative of a mesoderm, endoderm, ectoderm such as, a stem cell, a pluripotent stem cell, a red blood cell, an immune cell, a white blood cell: a leucocyte, a lymphocyte (e.g., a T-cell, a B-cell, an NK cell, a neutrophil, an eosinophil, a monocyte, basophils, macrophages), CAR-T cells, Platelets, Nerve cells (e.g. neurons, glial cells, oligodendrocytes, astrocytes, microglial cells), epithelial cells,sensory epithelium, fibroblasts, goblet cells, Muscle cells, Cartillage cells, Bone cells, Skin cells, Endothelial cells, Epithelial cells, Fat cells, muscle cells, sensor cells, pigment cells, kidney cells, placenta cells, sex cell, pre-malignat cells, tumor cells, cancer-associated cells (e.g. cancer associated fibroblasts), fat cells, circulating tumor cells, neuroendocrine cells, endocrine cells, bone cells, fat cells, skin cells, endothelial cells, pancreatic cells, plant cells, seed coat, Monocot cells, dicot cell, parenchyma cells hematopoietic stem cell, immune cells, renal cells, cancer , sarcoma cells, tissue and organs of multicellular organisms, group of cells, organs, organisms as well as microorganisms, including bacteria, fungi, and protists, microbiota, multicellular organs such as plant embryo, and / or viruses of all types, including bacteriophages, + Stem cells mesenchymal stem cell + induced pluripotent stem cell+ Adult stem cells (ASCs) (e.g., undifferentiated lineage-committed cells), terminally differentiated cholangiocytes or hepatocytes can also become activated by appropriate liver injury, which causes them to restart the cell cycle and induce liver regenerative repair by forming ASCs.

108. The method of claim 84, wherein the cells of the composition are used to regenerate cartilage.

109. The method of claim 84, wherein the cells of the composition is a hemocytoblast used for bone marrow transplantation.

110. The method of claim 84, wherein the composition is used for non-HLA matched cell transplantation.

111. The method of claim 84, wherein the composition is used for organ regeneration.

112. The method of claim 84, wherein following administration of the composition to a patient, the patient suffers fewer complications following transplantation to the patient than a patient receiving a composition that has not been treated with an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA and a molecule with nuclease activity.

113. The method of claim 84, wherein the patient suffers fewer complications following an engraftment procedure to the patient than a patient receiving a composition that has not been treated with an RNase, a DNase, an antibody that binds to an RNA, an antibody that binds to a DNA and a molecule with nuclease activity.

114. The method of claim 84, wherein a patient administered a treated composition has a higher success rate of transplantation.

115. The method of claim 84, wherein the treated of the composition is used to reprogram the cells of the composition.

116. The method of claim 84, wherein the treated composition is used to engineer organs.

117. The method of claim 84, wherein the treated composition is used to produce a universal donor cell, tissue or organ.

118. The method of claim 117, wherein the treated composition can be transplanted to a patient that is non-HMLA matching with the cells of the treated composition.

119. The method of claim 84, wherein the treated composition is used for regenerative medicine.

120. The method of claim 119, wherein the regenerative medicine is the formation of an artificial organ, production of a universal cell, a tissue or an organ.121 . The method of claim 84, wherein the treated composition is injected into the organ of a patient in the need thereof122. A method to improved efficiency of transplantation, comprising:a. treating one or more of a compositin of cells and extracellular vesicles wherein the cell is a prokaryotic cell, a eukaryotic cell, a group of prokaryotic cells, a group of eukaryotic cells; b. wherein the treatment comprises treating the composition with an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA and an antibody that binds to a DNA and / or a molecule with nuclease activity.

123. The method of claim 122, wherein the composition is treated with two or more rounds with a DNase and an RNase.

124. The method of claim 122, wherein the cells of the composition are derived from a cell culture, an organoid, a 3D culture, a tissue, an embryo, an organ, a single-cellular organism or a microbiota.

125. A method for differentiation and expansion of a composition comprising a stem cell and an extracellular vesicle;Wherein, the composition is treated with with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

126. A product for differentiation and expansion from the stem cells, The product is complex of cells differentiated from stem cells together with extracellular vesicles treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA and an antibody that binds to a DNA;127. A product comprising a composition of a complex of blood cells and extracellular vesicles, wherein differentiated from stem cells that were previously treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule that has nuclease activity.

128. A product for treating a stroke, wherein the product comprises a composition of a cell and an extracellular vesicle that have been treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

129. A product for treating a skin disorder, wherein the product comprises a composition of a cell and an extracellular vesicle that have been treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

130. The product of claim 129, wherein the skin disorder is exzema or psoriasis.

131. A product for treating a high blood pressure, wherein the product comprises a composition of a cell and an extracellular vesicle that have been treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

132. A composition comprising a cell and an extracellular vesicle, wherein the extracellular vesicle is derived from the cell following treatment with an RNase, a DNase, or an enzyme with nuclease activity, an antibody that binds to RNA, or an antibody that binds to DNA and / or a molecule with nuclease activity; and further wherein, the cell of the composition exhibits characteristics of a progenitor cell.

133. A plant derived from a composition of a cell and an extracellular vesicle that were treated with an RNase, a DNase, enzymes with nuclease activity, an antibody that binds to RNA or DNase and / or a molecule with nuclease activity.

134. The plant of claim 133, wherein the plant is used for one or more of ornamental landscaping, forest and garden planting, wood production, a plant derived pharmaceutical, food production, waste biodegradation, and biofuel generation.

135. The plant of claim 133, wherein the plant possesses properties and characteristics that were not present in the progenitor cell that can create the plant that was not treated with an RNase, a DNase, or an enzyme with nuclease activity, an antibody that binds to RNA, or an antibody that binds to DNA.

136. The complex of cells together with extracellular vesicles originating from such cells, following treatment with an RNase, a DNase, or an enzyme with nuclease activity, an antibody that binds to RNA, or an antibody that binds to DNA, exhibit characteristics of their ancestors that were not displayed by the same cells prior to treatment.

137. Plants derived from cells following treatment of the complex of cells together with extracellular vesicles with an RNase, a DNase, enzymes with nuclease activity, or an antibody that binds to RNA or DNase, which can be used for ornamental landscaping, forest and garden planting, wood production, pharmaceuticals and food production, waste biodegradation, and biofuel generation, possess previously unknown properties not found in existing plants, as well as characteristics different from those of the original untreated cells.

138. Plants derived from cells following treatment of the complex of cells together with extracellular vesicles with an RNase, a DNase, enzymes with nuclease activity, or an antibody that binds to RNA or DNase wherein the cells are of crops, plants, planting units, or their parts, are selected from the group consisting of a tree, a herb, a bush, a grass, a vine, a fem, moss and, a green algae, a monocotyledonous plant, and a dicotyledonous plant, capable of producing higher yield, faster growth, producing higher biomass in the same conditions as the plants derived from the untreated cells.

139. An animal derived from a composition comprising a cell and an extracellular vesicle, wherein the composition is treated with an RNase, a DNase, enzymes with nuclease activity, an antibody that binds to RNA or DNase, and / or a molecule with nuclease activity.

140. The animal of claim 139, wherein the animal is used for food production.141 . The animal of claim 139, wherein the animal possesses properties and characteristics that are not found in an animal derived from a composition not treated.

142. A fungi derived from a composition comprising a cell and an extracellular vesicle, wherein the composition is treated with an RNase, a DNase, enzymes with nuclease activity, an antibody that binds to RNA or DNase, and / or a molecule with nuclease activity.

143. The fungi of claim 142, wherein the animal is used for production of a pharmaceutical or food production.

144. The fungi of claim 142, wherein the animal possesses properties and characteristics that are not found in an animal derived from a composition not treated.

145. A prokaryote or archaea, derived from a composition comprising a cell and an extracellular vesicle, wherein the composition is treated with an RNase, a DNase, enzymes with nuclease activity, an antibody that binds to RNA or DNase, and / or a molecule with nuclease activity.

146. The prokaryote or archaea of claim 145, wherein the treated cells are used for production of a pharmaceutical and / or a biologic, waste biodegradation and biofuel generation.

147. The prokaryote or archaea of claim 145, wherein the animal possesses properties and characteristics that are not found in an animal derived from a composition not treated.

148. A treated extracellular vesicle, wherein the extracellular vesicle is treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

149. A treated extracellular vesicle, wherein the extracellular vesicle is treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity and further wherein the treated extracellular vesicle is derived from a cell treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.

150. The composition of claim 1 , wherein the composition is treated from two to three or from three to 90 times with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity.151 . A composition comprising an extracellular vesicle treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA, and / or a molecule with nuclease activity that is derived from a cell treated with one or more of an RNase, a DNase, an enzyme that has DNase and / or RNase activity, an antibody that binds to an RNA, an antibody that binds to a DNA and / or a molecule with nuclease activity, further wherein the ratio of treated cells to treated extracellular vesicles has a ratio 0.00001 to 1 ; 0.0001 to 1 ; 0.001 to 1 ; 0.01 to 1 ; 0.1 .1 to 1 ; 1 to 1 ; 1 to 0.1 , 1 to 0.01 ; 1 to 0.01 ; 1 to 0.001 ; 1 to 0.0001 ; 1 to 0.00001 ; 1 to 1.000001.

152. The composition of claim 1 , wherein the composition is treated with no more than 1 pg, no more than 100 pg, no more than 5 ng, no more than 50 ng, no more than 500 ng, no more than 1 mcg, no more than 10 mcg, no more than 40 mcg, no more than 100 ng, no more than 250 mcg, no more than 500 mcg, no more than 1 mg, no more than 5 mg, no more than 10 mg and no more than 100 mg of the nuclease or antibody per ml.

153. The composition of claim 1 , wherein the composition treated for at least 1 minute, at least 10 minutes, at least 30 minutes, at least 120 minutes, at least 24 hours, at least 96 hours, at least 7 days, at least 30 days, at least 90 days of the nuclease or antibody per ml.

154. A composition comprising a cell and / or an extracellular matrix and / or an extracellular vesicle, wherein the composition is treated with an RNase, a DNase, an antibody that binds to an RNA and / or a DNA and / or a molecule with a nuclease activity.

155. The composition of claim 154, wherein the composition is used to biomanufacture bioproduct.

156. The composition of claim 154, wherein the bioproduct is a food product, livestock, a protein, a biomolecule or a biologic.

Images