Methods for securing fruit productivity in pepper

Capsicum annuum pepper plants with QTL1 and QTL2 genetic regions enhance fruit setting and yield by producing parthenocarpic and seeded fruits under varying conditions, addressing environmental stress challenges.

WO2025248527A1PCT designated stage Publication Date: 2025-12-04BREEDX LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/IL2025/050459
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-02
Filing Date
2025-05-28
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Pepper plants face challenges in fruit set and yield due to environmental stressors such as extreme temperatures, humidity fluctuations, and unpredictable weather patterns, leading to reduced fruit production and seed formation.

Method used

Development of Capsicum annuum pepper plants with genetic regions QTL1 (09.0-13.5 Mbp on chromosome 1 and QTL2 (199-218 Mbp on chromosome 10) that enhance fruit setting by producing parthenocarpic, seedless fruits under suboptimal conditions and fruits with seeds under optimal conditions, utilizing molecular markers and genes associated with these QTLs.

Benefits of technology

The pepper plants exhibit increased fruit yield, with a higher percentage of parthenocarpic and seedless fruits under suboptimal conditions, and maintain fruit setting with seeds under normal conditions, improving resilience to environmental stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IL2025050459_04122025_PF_FP_ABST
    Figure IL2025050459_04122025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention discloses a cultivated fertile pepper plant or seed comprising a genetic region that confers high yield fruit setting. The invention specifically provides fertile pepper plants and seeds comprising a genetic region comprising QTL1 located at 9.0-13.5 Mbp on chromosome 1 and / or QTL2 located at 199-218 Mbp on chromosome 10, wherein said genetic region enables the production of parthenocarpic fruit, seedless fruit, and / or fruit with seeds. The invention further provides methods for producing such pepper plants, as well as methods for cultivating said plants to obtain high-yield fruit production. Additionally, the invention encompasses the use of such plants and seeds and genetic regions for commercial pepper production, and the development of pepper varieties with improved fruit set characteristics.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS FOR SECURING FRUIT PRODUCTIVITY IN PEPPERFIELD OF THE INVENTION

[0001] The present invention relates to pepper plants or seeds setting high yield properties of fruits under different environmental conditions, methods of producing said plants and seeds and their use thereof.BACKGROUND OF THE INVENTION

[0002] In the regular course of fruit development, the initiation of fruit set relies on the successful completion of pollination and fertilization, processes that are notably influenced by environmental conditions. The normal production of pollen and ensuing fertilization are confined to specific environmental parameters, ensuring the necessary steps of pollen shedding and fertilization take place, culminating in the formation of fruits containing numerous seeds. Failing to achieve fruit set is a common occurrence under environmental, abiotic stress, including factors such as extreme temperatures, humidity fluctuations, intense or inadequate light, or drought. These stressors detrimentally impact both fruit set and growth, resulting in plants that producing less fruits with significantly diminished fruit setting and / or a reduced number of seeds during the developmental phase.

[0003] For example, sweet pepper set fruit in a narrow range of temperatures of 20° to 25°C. When the temperature falls below 15°C or exceeds 32°C, the yield decreases. (Saha et al., 2010). A decrease in fruit- set in pepper as temperatures were raised from 18 / 13° to 23 / 18° and 33 / 28°C, was also observed by Song et al., (Song et al., 1976.). Low night temperatures (<18°C) (Pressman et al., 1998) and high day temperature (>32°C) affect pepper reproduction by decreasing the total number of pollen grains formed and by reducing their viability and germination capacity. Such changes hamper pollination, thereby promoting the formation of fruits, with only a few or no seeds.

[0004] Thus, numerous crops exhibit optimal fruit setting within specific temperature ranges and under environmental conditions. However, as shown above, a persistent rise in temperatures in cultivation areas, coupled with unpredictable weather patterns, poses a significant threat to crops. Such adverse conditions not only jeopardize the profitability of growers but also contribute to shortages of fresh produce in the markets. To address these challenges, various methods have been developed to enhance crop yields.

[0005] US20020166147 discloses for a composition, a solution or dry flowable powder peptide-polysaccharide complex, to be used as a plant, soil, seed, or seed piece treatment for commercial crops to enhance germination, emergence, root mass development, plant growth crop maturity and ultimately increase crop yield. Methods of preparation and methods of use of the peptide-polysaccharide complex are provided.

[0006] US6052941 discloses a planting arrangement and method to improve crop yields in open fields in which there is a solar light corridor between crop rows and in some situations a plurality of sub-rows between the solar corridors and / or a secondary crop planted in the solar corridor. Orientation of the rows for greater crop yield is also disclosed.

[0007] AU2012357243 discloses compositions and methods for increasing plant growth and yield. The compositions comprise the high yield gene TEL (Terminal earl- Like (TEL) gene), promoters and enhancers to increase the expression of a TEL gene in a plant of interest. By enhancing the expression of at least one TEL gene in a plant, an improvement in plant growth and yield is achieved, resulting in an increase in crop yield in a field planted with such plants. A plant of interest may be transformed with a DNA construct comprising a promoter that is capable of driving expression in the plant operably linked to a coding sequence for a TEL gene. Optionally, the DNA construct may comprise at least one enhancer that acts to increase expression of the TEL coding sequence.

[0008] US10155955 provides a method for the production of Solarium lycopersicum (tomato) plants having an average sympodial index of 2 and producing red-colored fruits comprising crossing a plant of S. lycopersicum capable of producing red-colored fruits, with a plant of a Solatium spp. having an average sympodial index of 2, collecting the seeds resulting from the cross, regenerating the seeds into plants, providing one or more backcross generations, selfing the backcross plants, growing the selfed seed into plants, and identifying and selecting plants having an average sympodial index of 2 and producing red-colored fruits.

[0009] Environmental stress conditions, encompassing extremes in temperature, humidity, light intensity, heavy rainfall, drought, and strong winds, exert a detrimental impact on both fruit set and growth. Additionally, these conditions can trigger facultative parthenocarpy, which is the growth of the ovary into a seedless fruit in theabsence of pollination and / or fertilization, leading to the development of fruits that are either seedless or possess significantly fewer seeds (Dhatt & Chahal, 2016).

[0010] Parthenocarpic fruit development refers to the process by which fruits develop without the need for fertilization. In this phenomenon, fruit formation occurs in the absence of pollination and fertilization, resulting in the production of seedless or partially seeded fruits. This natural occurrence can be induced by certain environmental conditions, hormonal treatments, or genetic factors. Parthenocarpic fruits are often desirable in agriculture for their consistent quality and market appeal, especially in the absence of viable pollination.

[0011] Parthenocarpy can be induced artificially or through genetic modifications. Genetic parthenocarpy can be facultative (seedless only under adverse conditions or when flowers are emasculated) or obligatory (always seedless). Historically, it was achieved through alterations of ploidy or gene mutations, but more recently, it's been achieved via transgenesis as well. Data from both open fields and protected cultivation show that genetic parthenocarpy can improve fruit production and quality. Parthenocarpy has two main advantages: it makes fruit set and production less affected by environmental factors adverse for pollination and fertilization. (Pandolfini et al., 2009).

[0012] WO1999021411 discloses tomatoes which are substantially seedless. The tomatoes are made by crossing a tomato plant containing at least one parthenocarpic gene as the male parent with a male sterile tomato plant containing at least one parthenocarpic gene as the female parent. The tomatoes resulting from this cross are substantially seedless.

[0013] WO2017125931 discloses for a Solanaceous plant, selected from the group consisting of tomato, pepper and eggplant, exhibiting a facultative parthenocarpy. The inventors demonstrated that (various) mutated alleles of the MADS box gene Agamous like 6 (S AGL6) confer strong though facultative parthenocarpy in tomato, and that without any visible pleotropic effects, thus rendering it a new useful source for parthenocarpy in tomato. The plant comprises a loss-of-function mutation in a SI AGL6 gene and alternatively or additionally characterized by an average fruit weight / plant at least about the same as that of a non-parthenocarpic tomato of the same genetic background under fertilization permissive conditions of the non-parthenocarpic tomato.Also disclosed are methods of producing such plants and processed products produced from same.

[0014] With the ongoing climatic changes, phenomena typically associated with the summer growing season, are now observable during the winter season in recent years. Rising global temperatures, along with increasing instability in climate conditions, climate change, and the combination of the continuous increase in the population and the need to double the amount of food produced from a unit of area, require the development of genetics and varieties characterized by the ability to set fruit in changing climate conditions.SUMMARY OF THE INVENTION

[0015] It is a principal object of the present invention to provide new Capsicum annuum fertile pepper plants or seeds capable of producing high yield properties of fruits under different or varying environmental conditions. The high yield property of fruit setting results from an increase in the number of parthenocarpic or seedless fruits produced under suboptimal conditions, in addition to setting fruits with seeds under optimal conditions.

[0016] It is an object of the present invention to provide a cultivated fertile pepper plant or seed comprising a genetic region that confers high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and wherein said genetic region comprises QTL1 located at 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located at 199-218 Mbp on chromosome 10.

[0017] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined above, wherein said fruit setting comprises setting parthenocarpic, seedless and / or fruits with seeds, under varying environmental conditions.

[0018] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein said pepper plant produces increased fruit yield comprising an elevated percentage of parthenocarpic and / or seedless fruits under suboptimal growth conditions and sets fruit with seeds under normal or optimal growth conditions.

[0019] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein said suboptimal conditionsare selected from abiotic stresses such as high or low temperatures, high or low humidity, salinity, drought and radiation conditions.

[0020] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein (a) QTL1 is located 09.0- 11 Mbp as indicated in pepper genome Capsicum annuum cv CM334 v.1.55 or at position 12.0-13.5 Mbp as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI on chromosome 1, and (b) QTL2 is located 204-218 Mbp as indicated in pepper genome Capsicum annuum cv CM334 v.1.55 or at position 199- 214 Mbp as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI on chromosome 10.

[0021] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein QTL1 located on chromosome 1 is associated with increased fruit number and / or elevated fruit weight compared to a control pepper plant lacking QTL1.

[0022] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein QTL2 located on chromosome 10 is associated with early fruit setting and / or production of parthenocarpic, seedless and / or fruit with seeds, under varying environmental conditions compared to a control pepper plant lacking QTL2.

[0023] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein the genome of said plant comprises at least one molecular marker and / or gene associated with the at least one QTL, the at least one molecular marker and / or gene is selected from the group consisting of: (a) a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof, associated with QTL1 on chromosome 1; (b) a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (v) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (vi) any combination thereof, associated with QTL2 on chromosome 10; and (c) any combination thereof.

[0024] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein the genome of said plant comprises at least one molecular marker selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570,115 as indicated in Capsicum annuum cv CM334 vl.55genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

[0025] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein the pepper plant or seed is homozygous for the at least one molecular marker.

[0026] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein the high yield properties of fruit setting comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0027] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein the high yield propertiesof fruit setting comprise (a) increased average fruit number of at least 5%, such as in the range of 5%-50%, particularly an increase in the range of 10- 40% as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence, and / or (b) increased percentage of parthenocarpic and / or seedless fruits setting, out of the total fruit set, of at least 10%, such as in the range of 10%-50%, particularly in the range of 15%-40%, as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0028] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein said plant produces a fruit type selected from: bell pepper, pointed pepper, half long pepper, Como di Toro pepper, sweet pepper including a dolce-type pepper, a big rectangular pepper, a conical pepper, a long conical pepper and a blocky-type pepper.

[0029] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein the mature fruit of the plant is green, yellow, orange, red, ivory, brown, or purple.

[0030] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein the pepper plant or seed is an inbred, a hybrid, a doubled haploid (DH), or a polyploid of any ploidy level.

[0031] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein said pepper plant or seed is a genome edited plant, such as a plant or seed produced using the CRISPR / Cas system.

[0032] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein said pepper plant or seed genotype is formed using doubled haploid (DH) combined with gene editing technology techniques.

[0033] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, or a progeny thereof, wherein said QTL1 and / or QTL2 is as found in seeds of Capsicum annum CM- 192-539, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA,Scotland, UK under accession number NCIMB 44203 on 04 / 08 / 2023, and / or in seeds of CD222-401.7, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44400 on 21 / 06 / 2024.

[0034] It is another object of the present invention to provide the cultivated fertile pepper plant or seed as defined in any of the above, wherein said plant further comprising within its genome at least one additional trait selected from the group consisting of, taste, nutritional value, insect resistance, resistance to bacterial, fungal or viral disease, and resistance to a non-biotic stress, wherein the additional trait is introduced by a method selected from the group consisting of breeding, genome editing, genetic determinant introgression and transformation.

[0035] It is another object of the present invention to provide a plant part comprising a regenerable cell, pollen, ovule, fruit or seed of the cultivated fertile pepper plant or seed as defined in any of the above.

[0036] It is another object of the present invention to provide a plant part of a cultivated fertile pepper plant or seed as defined in any of the above, wherein said plant part is defined as a leaf, a bud, a meristem, an embryo, a root, a root tip, a stem, a flower, a fruit, seed or a cell.

[0037] It is another object of the present invention to provide a pepper seed obtained from a crossing in which at least one of the parental plants is the cultivated fertile pepper plant or seed as defined in any of the above, or which produces the cultivated fertile pepper plant or seed as defined in any of the above.

[0038] It is another object of the present invention to provide a tissue culture of regenerable cells, protoplasts or callus obtained from the cultivated fertile pepper plant or seed as defined in any of the above.

[0039] It is another object of the present invention to provide pepper fruit or processed pepper fruit derived from a cultivated fertile pepper plant or seed as defined in any of the above.

[0040] It is another object of the present invention to provide a method for producing a fertile pepper plant or seed capable of high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, comprising: (a) identifying a first pepper plant as a donor male parent, comprising a genetic region that confers high yield fruit setting, wherein said genetic region comprises QTL1located 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located 199-218 Mbp on chromosome 10; (b) crossing said first pepper plant with a second pepper plant as a female parent, to produce Fl hybrid pepper plant, wherein the second pepper plant is a commercially acceptable pepper line; (c) selecting at least one progeny plant by: genotyping to confirm the presence of QTL1 and / or QTL2, and phenotyping to confirm expression of high yield fruit setting; and (d) optionally, backcrossing said at least one selected progeny plant with said male parent plant and / or repeating steps c-d to introgress said genetic region into a desired genetic background.

[0041] It is another object of the present invention to provide the method as defined in any of the above, wherein said fruit setting is setting a parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions.

[0042] It is another object of the present invention to provide the method as defined in any of the above, wherein the method produces a pepper plant that produces increased fruit yield comprising an elevated percentage of parthenocarpic, and / or seedless fruits under suboptimal growth conditions and sets fruit with seeds under normal or optimal growth conditions.

[0043] It is another object of the present invention to provide the method as defined in any of the above, wherein said suboptimal conditions are selected from abiotic stresses such as high or low temperatures, high or low humidity, salinity, drought, or radiation conditions.

[0044] It is another object of the present invention to provide the method as defined in any of the above, wherein: (a) QTL1 is located at 09.0-11 Mbp according to Capsicum annuum cv CM334 v.1.55 genome, or at 12.0-13.5 Mbp according to Capsicum annuum cv Maor genome ASM2707369vl NCBI on chromosome 1; and (b) QTL2 is located at 204-218 Mbp according to Capsicum annuum cv CM334 v.1.55 genome, or at 199-214 Mbp according to Capsicum annuum cv Maor genome ASM2707369vl NCBI coordinates on chromosome 10.

[0045] It is another object of the present invention to provide the method as defined in any of the above, wherein QTL1 located on chromosome 1 is associated with increased fruit number and / or increased fruit weight compared to a control pepper plant lacking QTL1.

[0046] It is another object of the present invention to provide the method as defined in any of the above, wherein QTL2 located on chromosome 10 is associated with earlier fruit setting and / or production of parthenocarpic, seedless and / or fruit with seeds under varying environmental conditions compared to a control pepper plant lacking QTL2.

[0047] It is another object of the present invention to provide the method as defined in any of the above, wherein said step of identifying the donor male parent comprises screening F2 seeds of various pepper genetic sources for having an Excellent Parthenocarpy (EP) level of at least 5 on a scale of 1-10.

[0048] It is another object of the present invention to provide the method as defined in any of the above, wherein said screening comprises producing a doubled haploid (DH) genotype plants from haploid and / or diploid cells derived from various pepper genetic sources.

[0049] It is another object of the present invention to provide the method as defined in any of the above, wherein said steps of identifying and selecting comprises inbreeding a pepper plant characterized by said EP level until the genetic composition of the progeny becomes substantially stable.

[0050] It is another object of the present invention to provide the method as defined in any of the above, wherein the genome of the donor pepper plant comprising a molecular marker and / or a gene associated with the at least one QTL, said molecular marker and / or gene is selected from the group consisting of: (a) a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof, associated with QTL1 on chromosome 1; (b) a molecular marker selected from (i) SEQ ID NO: 291- 323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 on chromosome 10; and (c) any combination thereof.

[0051] It is another object of the present invention to provide the method as defined in any of the above, wherein the genome of said plant comprises at least one molecular marker selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570, 115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

[0052] It is another object of the present invention to provide the method as defined in any of the above, wherein the step of selecting by genotyping comprising screening by PCR amplification using primer pairs having a sequence selected from: SEQ ID NO: 336 and 337 for SEQ ID NO: 324, SEQ ID NO: 338 and 339 for SEQ ID NO: 325, SEQ ID NO: 340 and 341 for SEQ ID NO: 326 and SEQ ID NO: 342 and 343 or 344 for SEQ ID NO: 327, and optionally analyzing the amplicons using restriction analysis.

[0053] It is another object of the present invention to provide the method as defined in any of the above, wherein the high yield properties comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0054] It is another object of the present invention to provide the method as defined in any of the above, wherein the high yield properties comprise (a) increased average fruit number of at least 5%, such as in the range of 5%-50%, particularly an increase in the range of 10- 40% as compared to a pepper plant having the same genetic backgroundand lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence, and / or (b) increased percentage of parthenocarpic and / or seedless fruits setting, out of the total fruit set, of at least 10%, such as in the range of 10%-50%, particularly in the range of 15%-40%, as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0055] It is another object of the present invention to provide the method as defined in any of the above, wherein the pepper plant or seed is an inbred, a hybrid, a doubled haploid (DH) or a polyploid of any ploidy level.

[0056] It is another object of the present invention to provide the method as defined in any of the above, wherein said pepper plant or seed is a genome edited plant, such as a plant or seed produced using the CRISPR / Cas system or is produced using doubled haploid (DH) technology combined with gene editing techniques.

[0057] It is another object of the present invention to provide a method for producing a pepper plant or seed exhibiting high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and wherein said method comprises steps of introducing at least one QTL as defined in any of the above, into a Capsicum annuum plant.

[0058] It is another object of the present invention to provide the method as defined in any of the above, wherein said at least one QTL is as found in seeds of Capsicum annum CM- 192-539, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44203 on 04 / 08 / 2023, and / or in seeds of CD222-401.7, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44400 on 21 / 06 / 2024.

[0059] It is another object of the present invention to provide a pepper plant obtained by the method as defined in any of the above.

[0060] It is another object of the present invention to provide pepper seed or fruit produced by the method as defined in any of the above.

[0061] It is another object of the present invention to provide a method for detecting or selecting for a pepper plant or seed as defined in any of the above, comprising a genetic region that confers high yield fruit setting, wherein said fruit setting comprisesproduction of parthenocarpic, seedless and / or fruits with seeds, comprising detecting at least one of the following: (a) a molecular marker selected from (i) SEQ ID NO: 281- 290 or any combination thereof, (ii) allele A at position 9,570, 115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof, associated with QTL1 located 9-13.5 million bp on chromosome 1; (b) a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 located on chromosome 10; and (c) any combination thereof.

[0062] It is another object of the present invention to provide the method as defined in any of the above, wherein the method comprises detecting at least one molecular marker selected from: (a) SEQ ID NO: 324 comprising SNP at position 9,570, 115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

[0063] It is another object of the present invention to provide the method as defined in any of the above, wherein the step of detecting or selecting comprises (a) performing PCR amplification using primer pairs selected from: SEQ ID NO: 336 and 337 for SEQ ID NO: 324, SEQ ID NO: 338 and 339 for SEQ ID NO: 325, SEQ ID NO: 340 and 341for SEQ ID NO: 326 and SEQ ID NO: 342 and 343 or 344 for SEQ ID NO: 327, and (b) optionally analyzing the amplicons using restriction analysis.

[0064] It is another object of the present invention to provide the method as defined in any of the above, wherein said fruit setting is setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions.

[0065] It is another object of the present invention to provide the method as defined in any of the above, wherein the method detects or selects for a pepper plant that producing increased fruit yield comprising an elevated percentage of parthenocarpic and / or seedless fruits under suboptimal growth conditions and sets fruit with seeds under normal or optimal growth conditions.

[0066] It is another object of the present invention to provide the method as defined in any of the above, wherein said suboptimal conditions are selected from abiotic stresses such as high or low temperatures, high or low humidity, salinity, drought and radiation conditions.

[0067] It is another object of the present invention to provide an isolated genetic element from Capsicum annuum associated with conferring high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and wherein said genetic element is selected from the group consisting of: (a) a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) or any combination thereof, associated with QTL1 located 09.0-13.5 Mbp on chromosome 1; (b) a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 located 199-218 Mbp on chromosome 10; and (c) any combination thereof, wherein the genetic element confers high yield fruit setting as compared to a pepper plant having the same genetic background but lacking said genetic element.

[0068] It is another object of the present invention to provide the isolated genetic element as defined in any of the above, wherein the molecular marker is selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570, 115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 1 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

[0069] It is another object of the present invention to provide an isolated genetic element having at least 90% sequence identity with the genetic element as defined in any of the above, wherein said genetic element is associated with conferring high yield fruit setting as compared to a pepper plant having the same genetic background but lacking said genetic element.

[0070] It is another object of the present invention to provide the isolated genetic element as defined in any of the above, wherein the genetic element is detectable by PCR amplification using primer pairs selected from: SEQ ID NO: 336 and 337 for SEQ ID NO: 324, SEQ ID NO: 338 and 339 for SEQ ID NO: 325, SEQ ID NO: 340 and 341 for SEQ ID NO: 326 and SEQ ID NO: 342 and 343 or 344 for SEQ ID NO: 327, and optionally the amplicons are analyzed using restriction analysis.

[0071] It is another object of the present invention to provide the isolated genetic element as defined in any of the above, wherein said fruit setting comprises setting parthenocarpic, seedless and / or fruits with seeds, under varying environmental conditions.

[0072] It is another object of the present invention to provide the isolated genetic element as defined in any of the above, wherein said pepper plant produces increased fruit yield comprising an elevated percentage of parthenocarpic and / or seedless fruits under suboptimal growth conditions and sets fruits with seeds under normal or optimal growth conditions.

[0073] It is another object of the present invention to provide the isolated genetic element as defined in any of the above, wherein said suboptimal conditions are selected from abiotic stresses such as high or low temperatures, high or low humidity, salinity, drought and radiation conditions.

[0074] It is another object of the present invention to provide the isolated genetic element as defined in any of the above, wherein the high yield properties comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0075] It is another object of the present invention to provide a method for producing a pepper plant (Capsicum annuum) or a seed thereof capable of high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, by using a doubled haploid generation techniques on plant material comprising the QTL as defined in any of the above, to generate a doubled haploid line comprising said high yield properties of fruits and the QTL as defined in any of the above.

[0076] It is another object of the present invention to provide the method as defined in any of the above, wherein the high yield properties of fruit setting comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0077] It is another object of the present invention to provide the method as defined in any of the above, wherein the high yield properties comprise (a) increased average fruitnumber of at least 5%, such as in the range of 5%-50%, particularly an increase in the range of 10- 40% as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence, and / or (b) increased percentage of parthenocarpic and / or seedless fruits setting out of the total fruit set of at least 10%, such as in the range of 10%-50%, particularly in the range of 15%-40%, as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0078] It is another object of the present invention to provide the method as defined in any of the above, wherein the genotype of the pepper plant is produced using doubled haploid (DH) technology combined with gene editing techniques.

[0079] It is another object of the present invention to provide a use of the genetic element or sequences having at least 90% sequence identity with the genetic element as defined in any of the above, to identify or produce a pepper plant or seed with a genetic region conferring high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, particularly commercially acceptable fruits, under different environmental conditions.

[0080] It is another object of the present invention to provide a use of a molecular marker selected from the group consisting of: (a) a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof associated with QTL1 located 09.0- 13.5 Mbp on chromosome 1; (b) a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 located 199-218 Mbp on chromosome 10; and (c) any combination thereof; to identify or develop pepper plants with a genetic region conferring high yield fruit setting, particularly commercially acceptable fruits, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, under different environmental conditions, as defined in any of the above, and / or identify the at least one QTL, and / or to develop additional markers linked to the at least one QTL.

[0081] It is another object of the present invention to provide the use as defined in any of the above, wherein the high yield properties of fruit setting comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0082] It is another object of the present invention to provide pepper genetic markers, sequences or elements, plants, seeds, fruits as described in any of the above and plant products thereof for the use in multiple geographical- and / or weather-related environments and growth conditions.

[0083] It is another object of the present invention to provide use of a seed deposited of CM-192-539 under NCIMB accession number 44203, with NCIMB Aberdeen AB21 9YA, Scotland on 04 / 08 / 2023, and / or of seeds of CD222-401.7, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44400 on 21 / 06 / 2024, for the production of the pepper plant as defined in any of the above.

[0084] It is another object of the present invention to provide use of a pepper plant as a commercial crop, wherein said pepper plant: (a) carries at least one QTL as defined in any of the above, wherein said QTL is selected from QTL1 located at 09.0-13.5 Mbp on chromosome 1 and QTL2 located at 199-218 Mbp on chromosome 10; and / or (b) contains a genetic determinant as defined in any of the above, conferring high yieldfruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and wherein said QTL or genetic determinant is derived from Capsicum annuum pepper plants represented by seeds deposited under NCIMB accession number 44203 on 04 / 08 / 2023 and / or seeds deposited under NCIMB accession number 44400 on 21 / 06 / 2024.

[0085] It is another object of the present invention to provide a method for increasing pepper fruit yield in multiple geographical regions and / or under varying weather or environmental or growth conditions, comprising: growing pepper plants or cultivating seeds as defined in any of the above, in said geographical regions or under said weather or environmental or growth conditions, wherein said plants or seeds produce commercially relevant increased fruit yields compared to control pepper plants lacking the QTL defined in any of the above.

[0086] It is another object of the present invention to provide a genome modified pepper plant or seed comprising a genetic region that confers high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and said plant comprises genome modifications conferring high yield properties, said modifications selected from: (a) at least one genome modification on chromosome 1 selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, (iii) any combination thereof; (b) at least one genome modification on chromosome 10 selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, (iii) any combination thereof; and © any combination thereof.

[0087] It is another object of the present invention to provide the genome modified pepper plant or seed as defined in any of the above, wherein the genome of said plantcomprises at least one molecular marker selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570,115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

[0088] It is another object of the present invention to provide the genome modified pepper plant or seed as defined in any of the above, wherein the pepper plant or seed is homozygous for at least one molecular marker.

[0089] It is another object of the present invention to provide the genome modified pepper plant or seed as defined in any of the above, wherein said fruit setting is setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions.

[0090] It is another object of the present invention to provide the genome modified pepper plant or seed as defined in any of the above, wherein the plant is produced using targeted genome editing technique, such the CRISPR / Cas9 systems, using doubled haploid (DH) technique and / or a combination thereof.

[0091] It is another object of the present invention to provide a method for enhancing fruit yield of a pepper plant and / or securing high fruit yield setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, comprising introducing or generating via genome modification, such as using gene editing, at least one genetic element selected from: (a) a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof associated with QTL1 located 09- 13.5 Mbp on chromosome 1; (b) a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 located 199-218 Mbp on chromosome 10; and (c) any combination thereof.

[0092] It is another object of the present invention to provide the method as defined in any of the above, wherein the molecular marker is selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570,115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

[0093] It is another object of the present invention to provide the method as defined in any of the above, wherein the genome modification is performed using CRISPR / Cas gene editing technology, doubled haploid (DH) techniques or by CRISPR / Cas gene editing technology in combination with doubled haploid (DH) techniques.BRIEF DESCRIPTION OF THE DRAWINGS

[0094] Fig. 1 presents schemes for generating F2 populations derived from a cross between each of the two parental lines CM202-2258, CD222-401.7, with MAOR;

[0095] Fig. 2 presents yield analysis in average number of fruits for each treatment: (A) MM CM202-2258 haplotype type, (B) MM MAOR haplotype type, (E) MM CD222- 401.7 haplotype type and (F) MM MAOR haplotype type;

[0096] Fig. 3 presents yield analysis in average fruit number for each treatment, (A) MM CM202-2258 haplotype type, and (E) MM CD222-401.7 haplotype type; and

[0097] Fig. 4 presents the percentage of parthenocarpic fruits for each pepper line: CD222-401.7, CM202-2258 and MAOR.DETAILED DESCRIPTION OF THE INVENTION

[0098] The present invention is now described more fully hereinafter with reference to the accompanying examples and drawings, in which embodiments of the invention are shown. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather these embodiments are provided so that this disclosure will be thorough and complete and will fully convey the scope of the invention to those skilled in the art.

[0099] It is a principal object of the present invention to provide new Capsicum annuum fertile pepper plants or seeds capable of producing high yield properties of fruits under different or varying environmental conditions. The high yield property of fruit setting comprises or results from an increase in the number (or percentage) of parthenocarpic or seedless fruits produced under suboptimal conditions, in addition to setting fruit with seeds under optimal conditions.

[0100] The present invention relates to a "high yield insurance" paradigm in pepper plants. High Excellent Parthenocarpy (EP) trait in pepper plants (defined below), based on the herein identified sequences, leads to increased yield and / or fruit number per plant. This yield enhancement occurs through the setting of seedless fruits under suboptimal conditions and the setting of fruits with seeds under optimal conditions. This dual capability provides a form of biological insurance for maintaining high productivity across varying environmental conditions (where fruits with seeds are not or almost not produced), thereby stabilizing yield potential regardless of growing conditions.

[0101] It was revealed that, in a fertile genetic background, the EP trait (linked to the herein described QTLs and genetic markers) confers enhanced yield properties by enabling the setting of parthenocarpic (seedless) fruits and / or fruits with seeds under different environmental conditions, as compared to a pepper plant having the same genetic background but lacking the EP trait.

[0102] Thus it is within the scope of the present invention to provide a cultivated fertile pepper plant or seed comprising a genetic region that confers high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedlessand / or fruits with seeds, and wherein said genetic region comprises QTL1 located at 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located at 199-218 Mbp on chromosome 10.

[0103] According to one embodiment, the invention provides a cultivated fertile pepper plant or seed comprising a genetic region that confers high yield fruit setting under different or varying environmental conditions, wherein said genetic region comprises QTL1 located at 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located at 199-218 Mbp on chromosome 10.

[0104] According to a further embodiment, the fruit setting comprises setting parthenocarpic, seedless and / or fruits with seeds, under varying environmental conditions.

[0105] According to a further embodiment, the fertile pepper plant produces increased fruit yield comprising an elevated percentage of parthenocarpic and / or seedless fruits under suboptimal growth conditions and sets fruit with seeds under normal or optimal growth conditions.

[0106] It is further within the scope that the pepper plant produces parthenocarpic, seedless, and / or fruits with seeds, under suboptimal conditions.

[0107] According to aspects of the present invention, the suboptimal conditions are selected from a wide range of abiotic stresses such as high or low temperatures (e.g. temperatures below 18°C or above 32°C), high or low humidity, salinity, drought and radiation conditions.

[0108] The present invention provides a cultivated fertile pepper plant or seed capable of producing high yield properties of fruit setting, wherein the high yield properties of fruit setting results in seedless fruit production under suboptimal conditions, and / or in fruit production with seeds under optimal conditions, wherein said cultivated plant or seed carries a genetic region conferring the high yield properties of fruits, said genetic region comprises QTL1 located 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located 199-218 Mbp on chromosome 10.

[0109] According to a further embodiment of the present invention, the cultivated pepper plant or seed is a fertile pepper plant or seed that carries a genetic region as described herein, conferring the ability to produce high percentage of parthenocarpic or seedless fruits under suboptimal or abnormal growth conditions and thus secures highyield production to a commercial extent under varying environmental conditions (such as high or low temperature etc.).

[0110] According to a further embodiment of the present invention, the fruits of the herein disclosed pepper plant may comprise parthenocarpic or seedless fruits and / or fruit with seeds. It is further within the scope that the fruit setting comprises setting a parthenocarpic or seedless fruit and / or fruit with seeds under different environmental conditions, such as suboptimal or optimal conditions.

[0111] According to a further embodiment of the present invention, different environmental conditions include but are not limited to, variations in temperature, humidity, light intensity, water availability, soil salinity, and nutrient content. Suboptimal conditions may encompass any combination of these factors that deviate from the ideal (or normal) range required for successful pollination and fertilization, for example, suboptimal conditions may be selected from abiotic stresses such as high or low temperatures, high or low humidity, salinity, drought and radiation conditions. While optimal (normal) conditions are those that support the full reproductive potential of the pepper plant, for example, resulting in the highest possible yield of fruits with seeds.

[0112] According to a further embodiment of the present invention, the high yield property of fruit setting results from an increase in the number of parthenocarpic or seedless fruits in addition to the production of fruits with seeds.

[0113] It is further within the scope of the present invention that QTL1 is located 09.0- 11 Mbp as indicated in pepper genome Capsicum annuum cv CM334 v.1.55 or at position 12.0-13.5 Mbp as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, on chromosome 1.

[0114] It is also within the scope of the present invention that QTL2 is located 204- 218 Mbp as indicated in pepper genome Capsicum annuum cv CM334 v.1.55 or at position 199-214 Mbp as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, on chromosome 10.

[0115] According to a further embodiment of the present invention, the high yield properties of fruits comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic fruits, wherein said propertiesare as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0116] According to a further embodiment of the present invention, QTL1 located on chromosome 1 is associated with the property of elevated fruit number and / or elevated fruit weight.

[0117] According to a further embodiment of the present invention, QTL2 located on chromosome 10 is associated with the property of early fruit setting and / or setting parthenocarpic or seedless fruit and / or fruit with seeds under different environmental conditions.

[0118] Thus, the method and the herein identified unique genetic regions and molecular markers and genes of the present invention enable to increase and secure fruit yield for pepper lines (e.g. a pepper line with commercially acceptable characteristics) in extreme or stressed climate environments and / or conditions such elevated temperatures.

[0119] It is within the scope of the present invention that the cultivated pepper plant or seed as defined above, comprises at least one allele, haplotype, molecular marker, single nucleotide polymorphism (SNP), gene and / or genetic determinant associated with the at least one QTL (molecular markers and / or genes identified by the present invention, to be associated with the high yield properties of fruits).

[0120] Thus, the present invention provides molecular markers / SNPs associated with QTL1 and QTL2 as herein defined conferring the high yield properties of fruit setting as specified in Tables 1 and 3-6.

[0121] The above genetic regions / QTLs are shown to lead to:

[0122] a. Yield increase (fruit number and / or weight), for which unique genes / DNA sequences associated with the trait were identified on QTL1 of chromosome 1 (see Tables 1, 3, 4 and 6); and

[0123] b. Early fruit setting / setting parthenocarpic or seedless fruit and / or fruit with seeds under different environmental conditions, and increased percentage of parthenocarpic fruits, for which unique genes / DNA sequences associated with the trait were identified on QTL2 of Chromosome 10 (see Tables 1, 3, 5 and 6).

[0124] Thus, it is within the scope of this invention that a molecular marker (see Tables 1, 4 and 6) associated with the fruit yield increase that was identified on QTL1 of chromosome 1 is located on gene Ca01g05320. The amino acid sequence encoded by CA01g05320 is as set forth in SEQ ID NO: 27. It is herein acknowledged that CA01g05320 belongs to a gene family called “Agamous like MADS box protein” (AGL62-like). This family belongs to a large gene family that is called transcription factor (TF) proteins (Chen et al., 2019). According to NCBI, CA01g05320 is a homolog of agamous-like MADS-box protein AGL29 [Capsicum annuum] (LOC124890154, LOC107863471), MADS-box transcription factor 27 -like (Solarium lycopersicum) and to AT2G24840, AGAMOUS-LIKE 61, AGL61, DIA, DIANA in Arabidopsis. “Agamous like” proteins are reported to be involved in parthenocarpy.

[0125] It was herein identified that the above molecular marker associated with chromosome 1 is an SNP molecular marker located on the CA01g05320 gene. The CA01g05320 SNP (Adenine instead of Guanine) is located on Chr 1 positioned 9,570,115 bp as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 bp as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI. The CA01g05320 genomic sequence with the SNP is as set forth in SEQ ID NO: 324. The SNP causes a change of amino acid in the protein sequence from Glycine to Serine. This change could influence the transcript level and the functionality of the protein and explain the involvement of this gene in parthenocarpy level in the tested pepper lines population.

[0126] It is further within the scope of the present invention that the molecular markers associated with the early fruit setting / setting parthenocarpic or seedless fruit and / or fruit with seeds under different environmental conditions, and increased percentage of parthenocarpic fruits, were identified on QTL2 of Chromosome 10 are located on the following three genes / positions:

[0127] 1. Gene CA10gl4270. The amino acid sequence encoded by CA10gl4270 is as set forth in SEQ ID NO: 113. The corresponding molecular marker is an allele C at position 204,079,966 as indicated in reference genome Capsicum annuum cv CM334 vl.55. The CA10gl4270 genomic sequence with the SNP is as set forth in SEQ ID NO: 325.

[0128] It is acknowledged that the CA10gl4270 gene is found to be annotated as “Glutathione S-transferase (GST)”. In pepper, CA10gl4270 is up regulated related to Phytophthora capsici resistance (Shi et al, 2024). Expression of most of the CaGST transcripts as well as the total pepper GST activity was found to be significantly upregulated in response to various abiotic stress cold, heat, drought, salinity, and osmotic stress conditions. (Shiful Islam, 2019). GSTs are exploited in the development of transgenic plants with increased resistance to biotic and abiotic stresses. (Ingrid Hernandez Estevez, 2020).

[0129] 2. Gene CA10gl4820. The amino acid sequence encoded by this gene (CA10gl4820) is as set forth in SEQ ID NO: 168. The corresponding molecular marker is an allele T at position 210,564,909 as indicated in reference genome Capsicum annuum cv CM334 vl.55. No annotation is found for the gene CA10gl4820. The CA10gl4820 genomic sequence with the SNP is as set forth in SEQ ID NO: 326.

[0130] 3. Gene CA10gl5940, annotated as Capsicum annuum (Red Pepper) PHD transcriptional regulator. The amino acid sequence encoded by this gene (CA10gl5940) is as set forth in SEQ ID NO: 280. The corresponding molecular marker is an allele T at position 217,950,632 as indicated in reference genome Capsicum annuum cv CM334 vl.55. The CA0gl5940 genomic sequence with the SNP is as set forth in SEQ ID NO: 327.

[0131] Without wishing to be bound by theory, the PHD finger is a common structural motif found in all eukaryotic genomes. It is a Zn(2+) -binding domain and its closest structural relative is the RING domain (Bienz, 2006).

[0132] 4. Position 215,997,819 in reference genome Capsicum annuum cv CM334 vl.55. The corresponding molecular marker of an allele G (at position 215,997,819 in reference genome Capsicum annuum cv CM334 vl.55) and the flanking regions upstream and downstream the SNP is as set forth in SEQ ID NO: 346.

[0133] It is further within the scope that the pepper plants or seeds of the present invention are produced using targeted genome editing, e.g. using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas (such as Cas9) technology or system, or any other genetic modification method known in the relevant art to generate the herein described lines / variants / sequences / molecular markers / SNPs.

[0134] Thus, the cultivated pepper plant or seed of the present invention, may be a genome edited plant or seed, such as a plant or seed produced by the CRISPR / Cas system.

[0135] In further aspects, the genotype of the cultivated pepper plant or seed of the present invention, is formed using doubled haploid (DH) combined with gene editing technology techniques.

[0136] It is further within the scope of the present invention that the pepper plant or seed of the present invention (e.g. cultivated pepper plant) is an inbred, a dihaploid, a hybrid, a doubled haploid (DH), or a polyploid of any ploidy level.

[0137] According to further aspects, the present invention provides a pepper plant or seed capable of producing high yield properties of fruits. The plant comprises the herein identified genetic regions conferring elevated yield of commercially acceptable fruits, as compared to a pepper plant having the same genetic background and lacking said genetic regions.

[0138] In the context of the embodiments of the invention, the term “plant” is meant to be understood as whole plant, grafted plant, ancestors and progeny of the plants, or any parts or derivatives thereof. According to the present invention, a non-liming list of plant part includes plant cells, plant protoplasts, plant tissue, plant cell, plant organ, suspension cultures, plant cell or tissue culture from which pepper plants can be regenerated, plant callus or calli, meristematic regions, meristematic cells, gametophytes, sporophyte, microspores, embryos, immature embryos, pollen, ovules, egg cells, zygotes, anthers, fruit (e.g. harvested pepper fruit), flowers, flower parts, scion, leaves, cotyledons, pistil, stem, anther, seeds, seed coat, cutting, seed coat, roots, root tips, rootstock, shoot, bud, meristem, and the like. As used herein, the term “plant part” is interchangeable with “plant material”.

[0139] In the context of the embodiments of the invention, the term “plant cell” refers, without limitation, to a structural and physiological unit of a plant, comprising a protoplast and a cell wall. The plant cell may be in the form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, plant tissue, a plant organ, or a whole plant.

[0140] In the context of the embodiments of the invention, the term “plant cell culture” refers, without limitation, to cultures of plant units such as, for example, protoplasts,regenerable cells, cell culture, cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development, leaves, roots, root tips, anthers, meristematic cells, microspores, flowers, cotyledons, pistil, fruit, seeds, seed coat or any combination thereof.

[0141] In the context of the embodiments of the invention, the term “plant organ” refers, without limitation, to a distinct and visibly structured and differentiated part of a plant such as a root, stem, leaf, flower, flower bud, embryo, and the like.

[0142] In the context of the embodiments of the invention, the term “plant tissue” refers, without limitation, to a group of plant cells organized into a structural and functional unit. Any tissue of a plant in planta or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue culture, protoplasts, meristematic cells, calli and any group of plant cells organized into structural and / or functional units. The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as listed above or otherwise embraced by this definition is not intended to be exclusive of any other type of plant tissue.

[0143] In the context of the embodiments of the invention, the term “parthenocarpic” refers, without limitation, to seedless fruits, i.e., fruits that have been developed without pollination and / or fertilization. Usually, fruits generated through parthenocarpy are seedless. Parthenocarpy may be genetically determined and / or by cultivation environments. The parthenocarpy referred to as in the present invention is the genetically associated. Plants having a genetically determined parthenocarpic trait are preferred for the case of edible cultivation plants, because they offer high reliability and reproducibility as well as enabling the reduction of the labor for managing the cultivation environment. In further aspects, parthenocarpic fruit refers to fruits that develop without fertilization of ovules. The fruits produced are without seeds since no fertilization occurs. Parthenocarpy may be a natural phenomenon or an artificially induced process where fruits develop without fertilization, resulting in seedless fruits. "Seedless" fruits refer to fruits that lack seeds, which can happen through parthenocarpy or other mechanisms like seed abortion (e.g. stenospermocarpy) or developmental issues. Thus, seedlessness can result from parthenocarpy or other reasons (such as genetic, artificial or environmental reasons or seed abortion). Therefore, some seedless fruits are parthenocarpic, while others are not.

[0144] As used herein, the term “parthenocarpic” is interchangeable with “parthenocarpic fruit”, “parthenocarpy”, “seedless fruits”, or “parthenocarpic seedless fruits”.

[0145] In the context of the embodiments of the invention, the term “pepper” refers, without limitation, to the common name given to many plants, their fruits and to the spices obtained from their fruits, usually with a spicy flavor (resulting from the capsaicin). The pepper plants can include plants from the genus Capsicum, Pipper and Pimenta. Capsicum is a genus of flowering plants (angiosperms) comprised of the nightshade family Solanaceae. It is generally accepted that the Capsicum genus originated in Bolivia and consists of 25-30 species. In the context of the embodiments of the invention, the pepper plant refers, without limitation, to the cultivated species Capsicum annuum, Capsicum chinense, Capsicum baccatum, Capsicum frutescens and Capsicum pubescens, and to the wild species. Capsicum annuum comprises both non- pungent and pungent (chili) peppers. Furthermore, the term “pepper” also includes, without limitations, plants called by names other than “pepper”, e.g., horticultural crops called “piment”, “paprika”, and “sweet pepper”. In the context of the embodiments of the invention, the pepper plant is preferably Capsicum annuum. In the context of the embodiments, the Capsicum annuum is selected from a fruit type including, but not limited to, bell pepper, pointed pepper, half long pepper, Como di Toro pepper, sweet pepper including a dolce-type pepper, a big rectangular pepper, a conical pepper, a long conical pepper and a blocky-type pepper.

[0146] In the context of the embodiments of the invention, the term “introgressed” refers to incorporation (usually via hybridization and backcrossing) of alleles from one species into the gene pool of a second, divergent species. The introgression is made by means of repeated backcrosses between and hybrid and the first plant generation. As used herein, the term “introgression” is interchangeable with “introgression”, “introgressing” or “introgressive hybridization”. An introgression may also be described as a heterologous genetic material stably integrated in the genome of a recipient plant.

[0147] In the context of the embodiments of the invention, the term “backcrossing” refers, without limitation, to the repeatedly crossing of a hybrid with one of its parents, or an adult genetically identical to the parent, to achieve offspring with a genetic identity closer to parents. In some embodiments, the backcrossing process refers to therepeated crossing of a hybrid progeny back to one of the parental pepper plants. The parental pepper plant, which contributes the gene for the desired characteristic, is termed the nonrecurrent or donor parent. This terminology refers to the fact that the nonrecurrent parent is used one time in the backcross protocol and therefore does not recur. The parental pepper plant to which the gene or genes from the nonrecurrent parent are transferred is known as the recurrent parent as it is used for several rounds in the backcrossing protocol. In a typical backcross protocol, a plant from the original varieties of interest (recurrent parent) is crossed to a plant selected from second varieties (nonrecurrent parent) that carries the single gene of interest to be transferred. The resulting progeny from this cross are then crossed again to the recurrent parent and the process is repeated until a pepper plant is obtained wherein essentially all of the desired morphological and physiological characteristics of the recurrent parent are recovered in the converted plant, in addition to the single transferred gene from the nonrecurrent parent. Backcrossing methods can be used with the present invention to improve or introduce a characteristic into the parent lines.

[0148] In the context of the embodiments of the invention, the term “trait” refers, without limitation, to the appearance of other detectable characteristic or phenotype of an individual, resulting from the interaction of its genome, proteome and / or metabolome with the environment. A trait may be inherited in a dominant or recessive manner, or in a partial or incomplete- dominant manner. A trait may be monogenic (i.e. determined by a single locus) or polygenic (i.e. determined by more than one locus) or may also result from the interaction of one or more genes with the environment. A dominant trait results in a complete phenotypic manifestation at heterozygous or homozygous state; conventionally, a recessive trait manifests itself only when present at homozygous state. For example, in the context of the present invention, the genetic regions identified by the present invention, associated with the high fruit yield properties trait confers the production of elevated yield of commercially acceptable fruits on the pepper plants or seeds as described herein.

[0149] The high fruit yield properties trait is shown to lead to:

[0150] a. Yield increase (fruit number and / or weight), for which unique genes / DNA sequences associated with the trait were identified on QTL1 of chromosome 1 (SEQ ID NO: 1-93, SEQ ID NO: 281-290, and Tables 1, 3, 4 and 6); and

[0151] b. Early fruit setting / setting parthenocarpic or seedless fruit and / or fruit with seeds under different environmental conditions and increased percentage of parthenocarpic fruits, for which unique genes / DNA sequences associated with the trait were identified on QTL2 of Chromosome 10 (SEQ ID NO: 94-280, SEQ ID NO: 291- 323 and 346, and Tables 1, 3, 5 and 6).

[0152] According to a further embodiment, the cultivated pepper plant or seed of the present invention produces fruits (comprising parthenocarpic, seedless and / or fruit with seeds) which are commercially acceptable or marketable as defined by different market, segment and fruit type.

[0153] In the context of the embodiments of the invention, the term “phenotype” refers, without limitation, to distinguishable characteristics from a genetically controlled trait.

[0154] In the context of the embodiments of the invention, the term "homozygous" refers, without limitation, to a genetic condition or configuration existing when two identical or like alleles reside at a specific locus but are positioned individually on corresponding pairs of homologous chromosomes in the cell of a diploid organism. Conversely, as used herein, the term “heterozygous” means a genetic condition or configuration existing when two different or unlike alleles reside at a specific locus but are positioned individually on corresponding pairs of homologous chromosomes in the cell of a diploid organism. In specific embodiments, the hybrid pepper plants of the present invention comprise heterozygous configuration of the genetic markers associated with the high fruit yield characteristics.

[0155] An important way to measure parthenocarpy traits is through Parthenocarpy degree. The currently available commercial seedless pepper variety has an Excellent Parthenocarpy (EP) level, as measured by the applicant internal scale, is about 3, such as between 2.9 and 3.1.

[0156] In the context of the embodiments of the invention, the term “Excellent Parthenocarpy (EP) trait” refers, without limitation, to pepper fruit yield from selected lines that have an Excellent Parthenocarpy (EP) phenotype of level of at least 5, such as in the range of 5-10, preferably 7 or above, and more preferably 8 or above, considerably higher than the known or commercially available lines, with an EP phenotype level around or about 3.

[0157] It is emphasized that the lines produced and provided by the present invention comprising the genetic region as described herein conferring EP between 5-10 are capable of producing increased yield of both parthenocarpic or seedless fruits and fruits with seeds under different or varying environmental conditions.

[0158] It is within the scope that Excellent Parthenocarpy (EP) evaluation is a qualitative trait, measured visually. It is an internal grade or scale (a value between 1- 10) given to each of the tested lines for evaluating their fruit yield. In certain embodiments, the EP grade or level or value herein means a grade given to each plot by visually evaluating the fruit yield in the particular plot. EP grade is a relative evaluation, where the relative point used is a commercial seedless pepper variety that has EP in the range of 2.9-3.1. The EP grade represents the ability of the plant to set parthenocarpic or seedless fruit under different environmental conditions. Thus, the EP level of pepper plants within the scope of the present invention is in the range of 3-10.

[0159] According to some embodiments, a “female parent” refers to a pepper plant that is the recipient of pollen from a male donor line, which pollen successfully pollinates an egg. A female parent can be any pepper plant that is the recipient of pollen. Such female parents can be male sterile, for example, because of genetic male sterility, cytoplasmic male sterility, or because they have been subject to manual emasculation of the stamens. Genetic or cytoplasmic male sterility can be manifested in different manners, such as sterile pollen, malformed or stamenless flowers, positional sterility, and functional sterility.

[0160] It is further within the scope of the present invention that “male parent plant” refers to a parent plant that provides pollen to (i.e. is a pollinator for) a female line. They may be useful for breeding of progeny pepper plants.

[0161] According to some embodiments of the above pepper or plant seed, the male sterility is preferably a cytoplasmic male- sterile (CMS) trait.

[0162] According to some embodiments of the above pepper or plant seed, the plant comprises at least one allele, haplotype, genetic marker, gene encoding sequence or genetic determinant associated with the high fruit yield trait.

[0163] In the context of the embodiments of the invention, the term “allele” refers, without limitation, to one or more variant forms of DNA sequence (a single base or a segment of bases) at a given genomic location (gene locus) and relates to a trait orcharacteristic of an individual. Diploid cells or organisms inherit two alleles, one from each parent, for any given genomic location (locus, or loci in plural), on a pair of homologous chromosomes, where such variation exists. One allele is present on each chromosome of the pair of homologous chromosomes. If the two alleles are the same, the individual is homozygous for that allele. If the alleles are different, the individual is heterozygous. A diploid plant species may comprise a large number of different alleles at a particular locus. Such alternative or variant forms of alleles may be the result of single nucleotide polymorphisms, insertions, inversions, translocations or deletions, or the consequence of gene regulation caused by, for example, by chemical or structural modification, transcription regulation or post-translational modification / regulation. An allele associated with a qualitative trait may comprise alternative or variant forms of various genetic units including those that are identical or associated with a single gene or multiple genes or their products or even a gene disrupting or controlled by a genetic factor contributing to the phenotype represented by the locus.

[0164] In the context of the embodiments of the invention, the term “locus” (loci plural) refers, without limitation, to a specific place or places or genetic region or a site on a chromosome where for example a gene or genetic marker element or factor is found. In specific embodiments, such a genetic element is contributing to a trait.

[0165] In the context of the embodiments of the invention, the term “haplotype” refers, without limitation, to a physical grouping of alleles (DNA sequences) from adjacent loci (locations) or genetic region on a chromosome that tend to be inherited together. A haplotype also referred to as genotype of fingerprint, may be one locus, several loci, or an entire chromosome depending on the number of recombination events that have occurred between a given set of loci. A specific haplotype typically reflects a unique combination of variants that reside near each other on a chromosome. “Haplotype” further refers to a set of single-nucleotide polymorphisms (SNPs) on a single chromosome or a genetic region within a chromosome of a chromosome pair that are associated statistically.

[0166] In the context of the embodiments of the invention, the term “genetic marker” or "molecular marker" or "marker" refers, without limitation, to a DNA sequence with a known physical location or genetic region on a chromosome, and indicates the presence of at least one genotype, polymorphism or phenotype. According to the present invention, a non-liming list of genetic markers includes single nucleotidepolymorphisms (SNPs), cleavable amplified polymorphic sequences (CAPS), amplified fragment length polymorphisms (AFLPs), restriction fragment length polymorphisms (RFLPs), simple sequence repeats (SSRs), insertion(s) / deletion(s) (“INDEL”(s)), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) sequences. Preferably, the genetic marker is a SNP. Genetic markers are used to track the inheritance of a nearby gene that has not yet been identified, but whose approximate location is known. The genetic marker itself may be a part of a gene or may have no known function. As used herein, the term “genetic marker” is interchangeable with “molecular marker” or “DNA marker” or “biomarker” and can also refer to a polynucleotide sequence complementary or corresponding to a genomic sequence, such as a sequence of a nucleic acid used as a probe or primer. A genetic marker can be physically located in a position on a chromosome that is within or outside of the genetic locus with which it is associated (i.e., is intragenic or extragenic, respectively). In some embodiments of the present invention, the one or more genetic markers comprise a combination of two or more genetic markers. It is also within the scope of the present invention that different combinations of genetic markers are used to identify different traits or phenotypic characteristics as disclosed inter alia.

[0167] It is further within the context of the present invention that a “marker” is an indicator for the presence of at least one phenotype, genotype, trait or polymorphism. Markers include, but are not limited to, single nucleotide polymorphisms (SNPs), cleavable amplified polymorphic sequences (CAPS), amplified fragment length polymorphisms (AFLPs), restriction fragment length polymorphisms (RFLPs), simple sequence repeats (SSRs), insertion(s) / deletion(s) (“INDEL”(s)), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) sequences. A marker is preferably inherited in codominant fashion (both alleles at a locus in a diploid heterozygote are readily detectable), with no environmental variance component. A “nucleic acid marker” as used herein means a nucleic acid molecule that is capable of being a marker for detecting a polymorphism, phenotype, or both associated with a trait of interest. A “marker assay” generally means a method for detecting a polymorphism at a particular locus using a particular method, e.g. measurement of at least one phenotype (such as a visually detectable trait, e.g. fruit yield and / or excellent parthenocarpy), restriction fragment length polymorphism (RFLP), single base extension, electrophoresis, sequence alignment, allelic specific oligonucleotidehybridization (ASO), random amplified polymorphic DNA (RAPD), microarray-based technologies, PCR-based technologies, and nucleic acid sequencing technologies, etc.

[0168] In the context of the embodiments of the invention, the term "polymorphism" refers, without limitation, to the presence in a population of two or more different forms of a gene, genetic marker, or inherited trait or a gene product obtainable, for example, through alternative splicing, DNA methylation, etc.

[0169] In the context of the embodiments of the invention, the term “gene encoding sequence” refers, without limitation, to the information encoded in a gene that is used to either make RNA molecules that code for proteins or to make non-coding RNA molecules that serve other functions.

[0170] In the context of the embodiments of the invention, the term “genetic determinant” or "genetic region" refers, without limitation, to genetic patterns or sequences that can be associated to a given trait, or QTL or genetic region such as the high fruit yield properties trait of this invention.

[0171] According to some embodiments of the above pepper or plant seed, the genome of said plant comprises a genetic marker and / or a gene encoding sequence associated with said high fruit yield properties trait, said genetic marker and / or gene sequence is selected from the group consisting of: a. a genetic marker sequence selected from SEQ ID NO: 281-290 or any combination thereof, allele A at position 9570115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI (Tables 1, 3, 4 and 6), and / or a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof and / or any combination thereof, associated with QTL1 on chromosome 1; b. a genetic marker sequence selected from SEQ ID NO: 291-323 and 346, or any combination thereof, an allele selected from Tables 1, 3, 5 and 6 or any combination thereof, and / or a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, associated with QTL2 on chromosome 10; and c. any combination thereof.

[0172] According to some embodiments of the above pepper or plant seed, the high yield properties of fruits comprise at least one of: early fruit setting, settingparthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0173] According to some embodiments of the above pepper or plant or seed, the high fruit yield properties comprise (a) increased average fruit number of at least 5%, such as in the range of 5%-50%, particularly an increase in the range of 10- 40% as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence, and / or (b) increased percentage of parthenocarpic fruits setting out of the total fruit set of at least 10%, such as in the range of 10%-50%, particularly in the range of 15%-40%, as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0174] In one embodiment, the increased fruit number is of at least about 5%, of at least 10%, of at least 15%, of at least 20%, of at least 25%. In one embodiment, the increased fruit weight per plant of at least about 15%, of at least 20%, of at least 25%, of at least 30%, of at least 35%, of at least 40%, of at least 45% or of at least 50%.

[0175] According to some embodiments of the above pepper or plant seed, the property of early fruit setting and / or setting parthenocarpic or seedless fruit and / or fruit with seeds and increased percentage of parthenocarpic fruits under different environmental conditions is associated with genes or DNA sequences located on Chromosome 10 and selected from at least one gene encoding a sequence selected from SEQ ID NO: 94-280 and / or at least one sequence selected from SEQ ID NO: 291-323 and 346, and / or an allele selected from Tables 1, 3, 5 and 6 or any combination thereof. In the context of the embodiments of the invention, the term “chromosome” refers, without limitation, to structures made of protein and a single molecule of DNA that serve to carry the genomic information from cell to cell.

[0176] It is within the scope that the cultivated pepper plant or seed of the present invention comprising the at least one molecular marker and / or gene associated with QTL2, have an average EP value of at least 5, particularly in the range of 5-8 or 5-10.

[0177] According to some aspects, the cultivated pepper plant or seed of the present invention comprising the at least one molecular marker and / or gene associated with QTL2 exhibits an increase in EP value of about 20-40% compared to a plant lacking said at least one QTL2 associated molecular marker and / or gene.

[0178] According to some embodiments of the above pepper or plant seed, the property of elevated fruit number per plant and / or elevated fruit weight per plant is associated with genes or DNA sequences located on Chromosome 1 and selected from at least one gene encoding a sequence selected from SEQ ID NO: 1-93 and / or at least one sequence selected from SEQ ID NO: 281-290 and / or allele A at position 9570115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI (Tables 1, 3, 4 and 6).

[0179] The cultivated pepper plant or seed comprising the at least one molecular marker and / or gene associated with QTL1 have 15-20% more fruits compared to a plant lacking said at least one QTL1 associated molecular marker and / or gene.

[0180] According to some embodiments of the above pepper or plant seed, the plant is capable of forming fruits from at least about 90% of the flowers on said plant.

[0181] In the context of the embodiments of the invention, the term “high fruit yield” or “high yield properties of fruit setting” refers, without limitation, to genetically enhanced cultivars of crops, such as pepper, that have an increased crop production or increased percentage of usable plant parts, preferably fruits. The fruit yield produced by a plant may be affected by parameters such as timing of fruit setting, Abiotic stress of setting fruit, number of fruits per plant and weight fruit per plant. According to some non-limiting embodiments, the “high fruit yield” properties or "high yield properties of fruits" or "high yield fruit setting" refers to an increase of fruit (parthenocarpic, seedless and / or fruit with seeds) number, or fruit number per plant, e.g. of at least about 5%, such as 10-50%, as compared to a pepper plant having the same genetic background and lacking said associated QTL, genetic marker and / or gene sequence.

[0182] In the context of the present invention, the high yield properties comprise (a) increased average fruit number of at least 5%, such as in the range of 5% -50%, particularly an increase in the range of 10- 40% as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the atleast one molecular marker and / or gene sequence, and / or (b) increased percentage of parthenocarpic fruits setting out of the total fruit set of at least 10%, such as in the range of 10%-50%, particularly in the range of 15%-40%, as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

[0183] In the context of the embodiments of the invention, the term “earliness” refers, without limitation, to the rate of fruit development and more specifically to the time elapsing between planting of the seed and the subsequent harvesting. More preferably, it relates to the days from transplanting to first red fruit. Thus, in plants earliness is evaluated by measuring how rapid a state of ripeness is attained. Earliness has economic significance. The cultivation of early ripening plant species and varieties results in a more productive use of land, since the same field may yield more than one harvest per season. An enhanced or increased earliness implies a shorter duration of the growth phase of the plant, which leads to flowering and a ripening of the fruits to be harvested, which occur, further ahead in time than is normally the case. It is further disclosed that in cultivated pepper, early flowering is generally associated with higher yield of ripe fruits.

[0184] In the context of the embodiments of the invention, the term “different environmental conditions” refers, without limitations, to extreme temperatures, humidity fluctuations, intense or inadequate light, daylight hours, drought, salinity, osmotic stress conditions, heavy metals, nutrient deficiencies, and mineral toxicity.

[0185] According to some embodiments of the above pepper or plant seed, the plant produces a fruit type selected from the group consisting of: bell pepper, pointed pepper, half long pepper, Como di Toro pepper, sweet pepper including a dolce-type pepper, a big rectangular pepper, a conical pepper, a long conical pepper and a blocky -type pepper.

[0186] According to some embodiments of the above pepper or plant seed, the mature fruit of the plant is green, yellow, orange, red, ivory, brown, or purple.

[0187] According to some embodiments of the above pepper or plant seed, the pepper plant is an inbred, a dihaploid or a hybrid.

[0188] In the context of the embodiments of the invention, the term “inbreed” refers, without limitation, to the process of mating among closely related individuals or even self-fertilization in plants.

[0189] In the context of the embodiments of the invention, the term “dihaploid” refers, without limitation, to haploid plants that undergone a spontaneous or induced chromosome doubling in haploid cells during embryogenesis, thus resulting in a homozygous individual, with two identical homologs. As used herein, the term “dihaploid” is interchangeable with “doubled haploid (DH)”.

[0190] In the context of the embodiments of the invention, the term “diploid individual” (diploid organism) refers, without limitation, to an individual that has two sets of chromosomes, typically one from each of its two parents. However, it is understood that in some embodiments a diploid individual can receive its “maternal” and “paternal” chromosomes from the same single organism, such as when a plant is selfed to produce a subsequent generation of plants.

[0191] In the context of the embodiments of the invention, the term “polyploidy” or "polyploid" or "polyploid level" refers, without limitation, to a condition in which the cells of an organism have more than one pair of (homologous) chromosomes. Polyploid plants possess three or more sets of homologous chromosomes. As used herein the term “ploidy” refers to the number of chromosome sets in a cell.

[0192] It is further within the context of the present invention that a doubled haploid (DH) is a genotype formed when haploid cells undergo chromosome doubling. It is herein acknowledged that artificial production of doubled haploids is important in plant breeding. It is further acknowledged that haploid cells are produced from pollen or egg cells or from other cells of the gametophyte, then by induced or spontaneous chromosome doubling, a doubled haploid cell is produced, which can be grown into a doubled haploid plant. If the original plant was diploid, the haploid cells are monoploid, and the term doubled monoploid may be used for the doubled haploids. Haploid organisms derived from tetrapioids or hexapioids are also called dihaploids (and the doubled dihaploids are, respectively, tetrapioid or hexapioid).

[0193] Conventional inbreeding procedures take about six generations to achieve approximately complete homozygosity, whereas doubled haploidy achieves it in onegeneration. Dihaploid plants derived from tetrapioid crop plants may be important for breeding programs that involve diploid wild relatives of the crops.

[0194] In the context of the embodiments of the invention, the term “hybrid” refers, without limitation, to a plant resulting directly or indirectly from crosses between different species, varieties or genotypes (e.g., a genetically heterozygous or mostly heterozygous individual). In the context of the embodiments of the invention, hybrid plant is a plant resulted from crosses between populations, breeds or cultivars within the genus Capsicum. According to some embodiments, the hybrid plant is preferably resulted from Capsicum annuum. The term “hybrid” is related to “hybrid plant” and “hybrid progeny”.

[0195] In the context of the embodiments of the invention, the term “population” refers, without limitation, to a genetically heterogeneous collection of plants sharing a common genetic derivation.

[0196] According to some embodiments of the above pepper or plant seed, the herein identified genetic regions / QTLs are as found in seeds of Capsicum annum CM- 192- 539, representative seeds of which were deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44203 on 04 / 08 / 2023.

[0197] According to some embodiments of the above pepper or plant seed, the herein identified genetic regions / QTLs are as found in seeds of Capsicum annum CD-222- 401.7, representative seeds of which were deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44400 on 21 / 06 / 2024.

[0198] According to some embodiments of the above pepper or plant seed, the plant further comprising within its genome at least one additional trait selected from the group consisting of, taste, nutritional value, insect resistance, resistance to bacterial, fungal or viral disease, and resistance to a non-biotic stress, wherein the additional trait is introduced by a method selected from the group consisting of breeding, genome editing, genetic determinant introgression and transformation.

[0199] In the context of the embodiments of the invention, the term “breeding” refers, without limitation, to any process that generates a progeny individual, such as selection, via combination, of genetic desirable traits in a single variety (hybrid), thus generating an improved new plant variety (progeny individual). In one embodiment, the nonlimiting list of types of breeding includes crossing, selfing, introgressing, backcrossing,doubled haploid derivative generation, genome editing, a genotype formed using doubled haploid (DH) combined with gene editing technology techniques and combinations thereof. In addition, it refers to producing a doubled haploid (DH) genotype plants from haploid and / or diploid cells derived from various pepper genetic sources.

[0200] In the context of the embodiments of the invention, the term “variety” or “cultivar” used herein means a group of similar plants that by structural features and performance can be identified from other varieties within the same species.

[0201] In the context of the embodiments of the invention, the term “genome editing” or gene editing refers, without limitation, to the addition, removal, or alteration of a genetic material at a particular desired location in the genome with or without doubled haploid derivative generation. A non-limiting list of techniques for genome editing are restriction enzymes, zinc finger nucleases, prime editing, and Programmable Addition via Site-specific Targeting Elements (PASTE).

[0202] In the context of the embodiments of the invention, the term “genetic determinant introgression” or "genetic region introgression" refers, without limitation, to the incorporation of new genetic determinants, regions or elements such as genes, alleles, QTLs (quantitative trait loci) or traits, into a line wherein essentially all of the desired morphological and physiological characteristics of the line are recovered, in addition to the genetically introgressed determinant or region. In genetic determinant or region introgression, one or a few genetic determinants or regions are transferred to a desired genetic background, preferably by using backcrossing or hybridization.

[0203] In the context of the embodiments of the invention, the term “transformation” refers, without limitation, to a way to insert DNA from another organism (usually another plant), into the genome of a plant of interest. This includes both integration of the exogenous DNA into the host genome, and / or introduction of plasmid DNA containing the exogenous DNA into the plant cell. Such a transformation process results in the uptake, incorporation and expression of exogenous genetic material (exogenous DNA). Plant transformation may refer to the introduction of exogenous genes into plant cells, tissues or organs employing direct or indirect means developed by molecular and cellular biology. A non-limiting list of techniques for the transformation of plants that are well known to those of skill in the art and applicable to many crop species include,but are not limited to, electroporation, microprojectile bombardment, Agrobacterium- mediated transformation and direct DNA uptake by protoplasts.

[0204] According to some embodiments, the invention provides a plant part comprising at least one regenerable cell, pollen, ovule, fruit or seed.

[0205] In the context of the embodiments of the invention, the term “regenerable” refers, without limitation, to a plant part wherein 100% of the population produces a pepper plant.

[0206] According to some embodiments of the above plant, the plant is further defined as a leaf, a bud, a meristem, an embryo, a root, a root tip, a stem, a flower, a fruit, or a cell.

[0207] According to some embodiments, the invention provides a pepper seed obtained from a crossing in which at least one of the parents is the pepper plant according to the invention, or which produces the pepper plant according to the invention.

[0208] According to some embodiments, the invention provides a tissue culture of regenerable cells, protoplasts or callus obtained from the pepper plant according to the invention.

[0209] According to some embodiments, the invention provides a pepper fruit or processed pepper fruit of a plant according to the invention.

[0210] According to some embodiments, the invention provides A cultivated pepper plant or seed capable of producing high fruit yield properties, wherein said plant or seed carries a genetic region conferring the high yield properties of fruits, said genetic region comprises QTL1 located 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located 199- 218 Mbp on chromosome 10. The aforementioned QTLs are associated with a genetic marker and / or gene sequence is selected from the group consisting of: a. a genetic marker sequence selected from SEQ ID NO: 281-290 or any combination thereof, allele A at position 9570115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI (Tables 1, 3, 4 and 6), and / or a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, or any combination thereof, associated with QTL1 on chromosome 1;b. a genetic marker sequence selected from SEQ ID NO: 291-323 and 346, or any combination thereof, an allele selected from Tables 1, 3, 5 and 6 or any combination thereof, and / or a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, or any combination thereof, associated with QTL2 on chromosome 10; and c. any combination thereof.

[0211] According to some embodiments of the above pepper plant, the plant produces elevated yield of fruits (e.g. commercially acceptable parthenocarpic, seedless and / or fruit with seeds) independent of exogenous abiotic stress conditions such as elevated temperature or other parthenocarpy-inducing factors.

[0212] Exogenous parthenocarpy-inducing factors may induce hormones, auxins, gibberellins, and cytokinins, especially the first two, are well known to induce parthenocarpy and abiotic stress environmental conditions such as the extreme temperatures, humidity fluctuations, intense or inadequate light, and the daylight hours.

[0213] According to some embodiments, the invention provides a method for producing a pepper plant exhibiting high yield properties of fruit setting, the method comprising steps of: a. producing and selecting a first pepper plant as a donor male parent, carrying a genetic region conferring the high yield properties of fruits, said genetic region comprises QTL1 located 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located 199-218 Mbp on chromosome 10; b. crossing said first pepper plant with a second pepper plant as a female parent, such as a commercially acceptable pepper line or a pepper plant with commercially acceptable characteristics, such as MAOR line, to produce progeny hybrid pepper plant, and optionally self-crossing said hybrid pepper plant to produce F2 generation progeny plants; c. selecting by genotyping and / or phenotyping at least one progeny plant showing high yield properties of fruits, associated with the QTL1 and / or QTL2 genetic region; andd. optionally, backcrossing said at least one selected progeny plant with said male parent plant and / or repeating steps c-d.

[0214] In the context of the embodiments of the invention, the term “donor parent” refers, without limitation, to the line containing the gene or trait (e.g. high fruit yield properties) of interest and the recipient parent or recurrent parent refers to the pepper line that is used as the normal or regular branched parent line, which is preferably an elite or breeding plant line that is improved by adding the gene or trait of interest.

[0215] In the context of the embodiments of the invention, the terms “male parent” and “female parent” refer, without limitation, to a plant that pollinates (provides pollen) and to a plant that received the pollen, respectively. A female parent can be any pepper plant that is the recipient of pollen. According to some embodiments, the male parent is a parthenocarpic line and the female parent is a fertile pepper plant, preferably a pepper line with commercially acceptable characteristics.

[0216] Thus, the method and the herein identified unique genetic regions and molecular markers and genes of the present invention enable to increase and secure of fruit yield for pepper lines (e.g. a pepper line with commercially acceptable characteristics) in extreme or stressed climate environments and / or conditions (such elevated temperatures).

[0217] In the context of the embodiments of the invention, the term “progeny” refers, without limitation, to all descendants / offspring plants of the crossing between male and female parents. According to some non-limiting embodiments, the progeny is obtained from breeding of two plants or from self-fertilization (selfing). In the context of the embodiments of the invention, the term “selfing” refers, without limitation, to the production of seed by self-fertilization or self-pollination; i.e., pollen and ovule are from the same plant. The first progeny is the Fl generation; the second progeny is the F2 generation, and so on. In some embodiments, the progeny carries the high fruit yield properties trait developed in this invention. According to some non-limiting embodiments, the progeny is a hybrid pepper plant.

[0218] In the context of the embodiments of the invention, the term “recurrent” refers, without limitation, to any parent plant which is used recurrently in subsequent crossings, i.e., the same parent plant line is used in repeated crossings of resulting progenies. In some embodiments, the recurrent parent is a recurrent female parent. Inthe context of the embodiments of the invention, the term “genetic sources” refers, without limitation, to male parent lines used for generating new progenies (hybrid plants). According to some non-limiting embodiments of this invention, the male parental lines are CM202-2258 and CM-192-539 / CD222-401.7.

[0219] According to some embodiments of the above method, the step of screening comprises steps of producing a doubled haploid (DH) genotype plants from haploid and / or diploid cells derived from various pepper genetic sources.

[0220] According to some embodiments of the above method, the method comprises steps of inbreeding a pepper plant which is characterized by the EP trait (high fruit yield properties) until the genetic composition of the progeny of such inbreeding becomes substantially stable.

[0221] According to some embodiments of the above method, the genome of the donor pepper plant comprising the high fruit yield properties trait, is associated with a genetic marker and / or a gene encoding sequence selected from the group consisting of: a. a genetic marker sequence selected from SEQ ID NO: 281-290 or any combination thereof, allele A at position 9570115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI (Tables 1, 3, 4 and 6), and / or a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, or any combination thereof, associated with QTL1 on chromosome 1; b. a genetic marker sequence selected from SEQ ID NO: 291-323 and 346, or any combination thereof, an allele selected from Tables 1, 3, 5 and 6 or any combination thereof, and / or a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, or any combination thereof, associated with QTL2 on chromosome 10; and c. any combination thereof.

[0222] According to some embodiments of the above method, the high yield properties of fruits comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking saidat least one QTL associated with the at least one molecular marker and / or gene sequence.

[0223] According to some embodiments of the above method, the property of early fruit setting and / or setting parthenocarpic or seedless fruit and / or fruit with seeds and increased percentage of parthenocarpic fruits under different environmental conditions, is associated with genes or DNA sequences located on Chromosome 10 and selected from at least one gene encoding a sequence selected from SEQ ID NO: 94-280, an allele selected from Tables 1, 3, 5 and 6 or any combination thereof, and / or at least one genetic marker sequence selected from SEQ ID NO: 291-323 and 346.

[0224] According to some embodiments of the above method, the property of elevated fruit number per plant and / or elevated fruit weight per plant is associated with genes or DNA sequences located on Chromosome 1 and selected from at least one gene encoding a sequence selected from SEQ ID NO: 1-93, allele A at position 9570115 as indicated in pepper genome Capsicum aimuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI (Tables 1, 3, 4 and 6), and / or at least one genetic marker sequence selected from SEQ ID NO: 281- 290.

[0225] According to some embodiments of the above method, the property of elevated fruit number per plant and / or elevated fruit weight per plant is associated with genes or DNA sequences located on Chromosome 1 and selected from at least one gene encoding a sequence selected from SEQ ID NO: 1-93, allele A at position 9570115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI (Tables 1, 3, 4 and 6), and / or at least one genetic marker sequence selected from SEQ ID NO: 281- 290;- genes or DNA sequences located on Chromosome 10 and selected from at least one gene encoding a sequence selected from SEQ ID NO: 94-280, an allele selected from Tables 1, 3, 5 and 6 or any combination thereof, and / or at least one genetic marker sequence selected from SEQ ID NO: 291-323 and 346; and / or- interaction between one or more of the above genes and / or DNA sequences located on chromosomes 1 and 10. Such an interaction may lead to a synergistic effect with respect to the high fruit yield properties.

[0226] According to some embodiments, the invention provides a pepper seed or fruit produced by the method according to the invention.

[0227] According to some embodiments, the invention provides a pepper plant produced by the method according to the invention.

[0228] According to some embodiments, the invention provides an allele, haplotype, genetic marker or gene being inherited to progeny plant, and this allele, haplotype, genetic marker or gene is associated with the trait capable of conferring production of elevated yield of commercially acceptable fruits as compared to a pepper plant having the same genetic background and lacking said genetic marker and / or gene sequence is selected from the group consisting of: a. a genetic marker sequence selected from SEQ ID NO: 281-290 or any combination thereof, allele A at position 9570115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI (Tables 1, 3, 4 and 6), and / or a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, located on Chromosome 1; b. a genetic marker sequence selected from SEQ ID NO: 291-323 and 346, or any combination thereof, an allele selected from Tables 1, 3, 5 and 6 or any combination thereof, and / or a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, located on chromosome 10; and c. any combination thereof.

[0229] According to some embodiments of the above allele, haplotype, genetic marker or gene, the allele, haplotype, genetic marker or gene having at least 90% sequence identity, and the allele, haplotype, genetic marker or gene is associated with the trait capable of conferring production of elevated yield of commercially acceptable fruits as compared to a pepper plant having the same genetic background and lacking said trait.

[0230] In the context of the embodiments of the invention, the term “sequence identity” refers, without limitation, to the occurrence of exactly the same or having a specified percentage of nucleotide or amino acid in the same position in aligned sequences. According to the present invention, the percent of identity or homology between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, whichneeds to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of identity percent between two sequences can be accomplished using a mathematical algorithm as known in the relevant art. As used herein, the term “sequence identity” is interchangeable with “sequence homology”.

[0231] According to some embodiments, the invention provides isolated nucleotide sequences annealing with or comprising sequences selected from: a. at least one of SEQ ID NO: 281-290, allele A at position 9570115 as indicated in pepper genome Capsicum aimuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI (Tables 1, 3, 4 and 6), or any combination thereof; b. at least one of SEQ ID NO: 291-323 and 346, or any combination thereof, an allele selected from Tables 1, 3, 5 and 6 or any combination thereof; and c. any combination thereof; the nucleotide sequence is suitable for the detection and / or production of a pepper plant pepper plant or seed capable of producing high fruit yield properties, wherein said plant or seed carries a genetic region conferring the high yield properties of fruits, said genetic region comprises QTL1 located 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located 199-218 Mbp on chromosome 10.

[0232] According to some embodiments, the invention provides isolated gene sequences encoding sequences selected from: a. at least one of SEQ ID NO: 1-93 or any combination thereof; b. at least one of SEQ ID NO: 94-280 or any combination thereof; and c. any combination thereof; the gene sequence is suitable for the detection and / or production of a pepper plant pepper plant or seed capable of producing high fruit yield properties, wherein said plant or seed carries a genetic region conferring the high yield properties of fruits, said genetic region comprises QTL1 located 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located 199-218 Mbp on chromosome 10.

[0233] According to the above sequences some embodiments, the invention provides the use isolated sequences, or sequences having at least 90% sequence identity with thesequences of the invention, for detection and / or production of a pepper plant or seed capable of producing high fruit yield properties, wherein said plant or seed carries a genetic region conferring the high yield properties of fruits, said genetic region comprises QTL1 located 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located 199- 218 Mbp on chromosome 10.

[0234] According to some embodiments, the invention provides pepper genetic markers, sequences or elements, plants, seeds, fruits and plant products, as disclosed in the invention, for the use in multiple geographical- and / or weather-related environments and growth conditions.

[0235] In the context of the embodiments of the invention, the term “elements” refers, without limitation, to allele, haplotype, genetic marker or gene.

[0236] According to some embodiments, the invention provides the use of a seed deposited under NCIMB accession number 44203 on 04 / 08 / 2023 for the production of the pepper plant according to this invention.

[0237] According to some embodiments, the invention provides the use of a seed deposited under NCIMB accession number 44400 on 21 / 06 / 2024 for the production of the pepper plant according to this invention.

[0238] According to some embodiments, the invention provides a method for increasing pepper fruit yield production to a commercially relevant extent in multiple geographical- and / or whether-related environments or areas or growth conditions comprising growing in said geographical area pepper plant according to this invention.

[0239] Deposits:

[0240] The seed samples of Capsicum annuum CM- 192-539 were deposited under NCIMB accession number 44203, with NCIMB, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, Scotland, UK on 04 / 08 / 2023 under the provisions of the Budapest Treaty in the name of Breedx Ltd.

[0241] The seed samples of Capsicum annuum CD-222-401.7 were deposited under NCIMB accession number 44400, with NCIMB, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, Scotland, UK on 21 / 06 / 2024 under the provisions of the Budapest Treaty in the name of Breedx Ltd.

[0242] The following examples are presented in order to more fully illustrate certain embodiments of the invention. They should in no way, however, be construed as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the spirit and scope of the invention.EXAMPLES

[0243] In order to understand the invention and to see how it may be implemented in practice, a plurality of preferred embodiments will now be described, by way of nonlimiting example only, with reference to the following examples.EXAMPLE 1: F2 TAIL ANALYSIS UTILIZING MOLECULAR MARKER GENOTYPING

[0244] This example describes an experiment designed to compare the pepper fruit yield among different genetic lines. Specifically, two lines, CM202-2258 and CD222- 401.7 (see Table 1), which are characterized by an Excellent Parthenocarpy (EP) phenotype level of 5 and 8, respectively, correlated with the defined QTL1 and QTL2 regions and their associated molecular markers and / or genes, were evaluated against the MAOR line, which serves as a control and is defined as having an EP phenotype level of 1.

[0245] In this experiment, a yield comparison was performed on F2 populations.

[0246] The two parental lines, CM202-2258 and CD222-401.7 (see Table 1), exhibiting different EP levels, as described above, are each crossed with MAOR line, to generate two different Fl hybrid lines. It is also noted that line CD222-401.7 is a homozygous progeny of line CM192-539.Table 1: Pepper lines, corresponding EP levels, and QTL1, QTL2 associated molecular markers genotype, as indicated in Capsicum annum cv 'CM 334' genome (release 1.55) reference genome

[0247] Following the cross, Fl plants are grown, F2 seeds are collected from the Fl plants to produce F2 generation progeny plants.

[0248] Fig. 1 presents schemes for generating F2 populations derived from the two parental lines CM202-2258 and CD222-401.7, and MAOR.

[0249] F2 population plants were grown, and molecular markers on chromosome 1 (see Tables 1, 2, 3 and 5) and chromosome 10 (see Tables 1, 2, 4 and 5) are genotyped.Chromosome 1 (see Tables 1, 2, 3 and 5):

[0250] Gene CA01g05320. Position 9570115 in reference genome Capsicum annuum cv CM334 vl.55, or at position 12239886 in reference genome Capsicum annuum cv Maor ASM2707369vl NCBI.

[0251] Following a PCR amplification using the forward primer as indicated by SEQ ID No: 336 and reverse primer as indicated by SEQ ID No:337, an enzymatic restriction procedure is conducted to distinguish the three genomes as follows:

[0252] BpuEI restriction site in CD222-401.7

[0253] Genotyping:

[0254] CD222-401.7: two bends (~940bp, ~480bp)

[0255] MAOR: one bend (~1500bp)

[0256] Heterozygote: three bends (~1500bp, ~940bp, ~480bp)Chromosome 10 (see Tables 1, 2, 4 and 5):

[0257] 1. Gene CA10gl4270. Position 204079966 reference genome Capsicum annuum cv CM334 vl.55.

[0258] Following a PCR amplification using a forward primer as indicated by SEQ ID No: 338 and reverse primer as indicated by SEQ ID No:339, an enzymatic restriction procedure is conducted to distinguish the three genomes as follows:

[0259] Restriction site: Earl

[0260] Genotyping:

[0261] CD222-401.7: one bend (825bp)

[0262] Maor: two bends (484bp, 347bp)

[0263] 2. Gene CA10gl4820. Position 210564909 reference genome Capsicum annuum cv CM334 vl.55.

[0264] Following a PCR amplification using a forward primer as indicated by SEQ ID No: 340 and reverse primer as indicated by SEQ ID No:341, an enzymatic restriction procedure is conducted to distinguish the three genomes as follows:

[0265] Restriction Site: Alwl

[0266] Genotyping:

[0267] CD222-401.7: two bends (3O8bp, 533bp)

[0268] MAOR: one bend (841bp)

[0269] 3. Gene CA10gl5940. Position 217950632 reference genome Capsicum annuum cv CM334 vl.55.

[0270] Following a PCR amplification using a forward primer as indicated by SEQ ID No: 342 and reverse primer as indicated by SEQ ID No:343 and / or SEQ ID No:344, an enzymatic restriction procedure is conducted to distinguish the three genomes as follows:

[0271] Restriction site: HphI

[0272] Genotyping:

[0273] CD222-401.7: one bend (~450bp)

[0274] Maor: two bends (~250bp, ~200bp)

[0275] Heterozygote: three bends (~450bp, ~250bp, ~200bp)

[0276] 4. Position 215997819 in reference genome Capsicum annuum cv CM334 vl.55. The following sequences and SEQ ID NOs include the 'Flanking Sequence Upstream the molecular marker' + ‘unique molecular marker sequence' + 'Flanking Sequence Downstream the molecular marker', in each of the genomes:

[0277] SEQ ID NO: 345, in the Capsicum annuum cv CM334 releasel.55 reference genome, sequence ID name 10_215997819_CM334 vl.55:TGGTTAACATCATTTTTAATTAATTACAAATATTCTGATATCTTTTTTCCTT TTTTAACCAAAATTTACTAACGTGAACTAAAAAATAATAAATGATAATC.

[0278] SEQ ID NO: 346, in the Capsicum annuum CD222-401.7 genome, ID name 10_215997819_CD222-401.7:TGGTTAACATCATTTTTAATTAATTACAAATATTCTAATATCTTTTTTCCGT TTTTAACCAAAATTTACTAACGTGAACTAAAAAATAATAAATGATAATC

[0279] SEQ ID NO: 347, in the Capsicum annuum CM202-2258 genome, ID name 10_215997819_CM202-2258:TGGTTAACATCATTTTTAATTAATTACAAATATTCTAATATCTTTTTTCCCT TTTTAACCAAAATTTACTAACGTGAACTAAAAAATAATAAATGATAATC

[0280] SEQ ID NO: 348, in the Capsicum annuum Maor ASM2707369vl genome, ID name 10_215997819_Maor genome ASM2707369vl NCBI:TGGTTAACATCATTTTTAATTAATTACAAATATTCTGATATCTTTTTTCCTT TTTTAACCAAAATTTACTAACGTGAACTAAAAAATAATAAATGATAATC

[0281] The above five molecular markers (one on chromosome 1 and four on chromosome 10) were analyzed for every plant in each F2 population. Briefly, for each molecular marker analysis, the following steps were performed:Step 1: PCR amplification for each molecular marker (MM) amplicon (e.g. with corresponding primers).Step 2: validating the PCR amplicon product (e.g. by gel separation).Step 3: subjecting the validated PCR amplicon product to a restriction enzyme reaction.Step 4: performing molecular marker analysis by analyzing restriction enzyme products (e.g. by gel separation).F2 Tail analysis and genotyping:

[0282] Each of the two F2 population plants (see Fig.l) are grown and analyzed for molecular marker (MM) genotyping as follows:

[0283] At least 1500 F2 plants from each F2 population are genotyped for the detailed above molecular markers in chromosomes 1 and 10 (e.g. Table 1).

[0284] The plants were grown simultaneously, each group in a sperate four experimental 4 plots, and the yield was compared between the different F2 groups, 4 groups in total. The 4 groups (plots) are as follows:1. F2 derived from MAOR x CD222-401.7 with CD222-401.7 MM's fingerprint / haplotype / genotype.2. F2 that derived from MAOR x CD222-401.7 with MAOR MM’s fingerprint / haplotype / genotype.3. F2 that derived from MAOR x CD202-2258 with CD202-2258 MM’s fingerprint / haplotype / genotype.4. F2 that derived from MAOR x CD202-2258 with MAOR MM’s fingerprint / haplotype / genotype.

[0285] In addition, the following was analyzed:MAOR as a controlCD202-2258 as a controlCD222-401.7 as a control

[0286] For each group 10 plants were transplanted for measuring and phenotyping, 40 plants minimum in total. Yield parameters include weight and number of fruits, each plot or group (7 plants) is measured separately, and the analysis is done for each of the groups.EXAMPLE 2: IDENTIFYING UNIQUE HAPLOTYPES FOR HIGH FRUIT YIELD

[0287] A genetic analysis for identifying unique haplotypes associated with the disclosed high yield properties was performed. The analysis was made by Genotype by Sequencing (GBS) technique on DNA samples derived from F2 population.

[0288] In this section, F2 population was produced to identify DNA region / s in the genome of line CM 192-539 (derived progeny CD222-401.7) linked to the unique QTLs found by the inventors.

[0289] The male parental lines CM202-2258 and CM- 192-539 were used as genetic resources. These lines were previously described in International Application No. PCT / IL2023 / 051209, incorporated herein in its entirety.

[0290] The inbred pepper line 'Maor' (bell-type, Capsicum annuum), as well as Capsicum annuum cv. CM334, were used as control lines (reference genomes), e.g. versus lines CM202-2258 and CM-192-539.

[0291] Objective:

[0292] The genetic analysis was aimed to identify genomic regions where all three samples (CM202-2258, CM-192-539 / CD222-401.7, 'MaorV CM334) have different haplotypes.

[0293] General Workflow:

[0294] 1. Produce sequencing data for each of the two CM202-2258 and CM-192-539 samples.

[0295] 2. Mapping of the sequencing data to “Maor’7 CM334 pepper variety genome assembly.

[0296] 3. Variant calling for each sample.

[0297] 4. Recalling variants for each sample.

[0298] 5. Comparative analysis to identify unique regions across the genome.

[0299] Workflow Description:

[0300] 1. The genomic DNA (gDNA) samples of pepper lines CM202-2258 and CM- 192-539 were sequenced.

[0301] 2. The reads were aligned to the "Maor'7 CM334 pepper variety, which is relatively similar to the two tested varieties. Alignment of the sequencing data of the two samples (CM202-2258, and CM-192-539) to “Maor’7 CM334 reference genome was done.

[0302] 3. Variants discovery and recalling was performed. Briefly, reads were aligned to the Maor / CM334 reference genome and variants were called for each variety. The recalling step is important when comparing between different samples since it provides another layer of validation from an additional dataset. In addition, it is used to homogenize the analysis between the different samples.

[0303] It is herein disclosed that the high yield properties confer the following characteristics:

[0304] - Early fruit setting / setting fruit at high temperature.

[0305] - Increased percentage of parthenocarpic fruits.

[0306] - Yield increase, a result of increasing number of fruits (including parthenocarpic fruits) as well as total fruit weight (kg) per plant.

[0307] Towards this end, the following lines were used:

[0308] 1. CM 192-539 line - exhibiting high EP phenotype.

[0309] 2. MAOR (a reference line / genome) - exhibiting very low EP

[0310] A cross between the above lines was performed in the spring season (March) to produce Fl generation plants.

[0311] In the fall, the Fl plants were grown to produce F2 generation progeny plants. The F2 plants were grown for sampling every plant in the population for DNA extraction, used for genotyping purposes.

[0312] DNA treatments:

[0313] DNA extraction, measuring, and shipping:

[0314] DNA extractions were done with ISOLATE II Plant DNA Kit protocol.

[0315] DNA measuring was done with Qubit dsDNA BR Assay Kit protocol.

[0316] DNA was dried in 96 well plates and subjected to genotyping.

[0317] A total of 188 F2 individuals participated in the genotyping analysis process.

[0318] Genotyping:

[0319] Genotyping by sequencing was carried out. The libraries of the 188 individual plants were sequenced on a Novaseq platform in a paired-end with 150 bp read length. The raw-data was demultiplexed using the axe-demux tool (according to Murray and Borevitz, 2018) into the separated libraries. In the next steps, adapters were trimmed, and low-quality reads were removed with Trimommatic (according to Bolger et al., 2014). Finally, the GATK pipeline (according to McKenna et al., 2010) was used to detect polymorphic sites across the population. Briefly, BWA-MEM (Li, 2013) was used to align the reads to the Capsicum annuum cv. CM334 reference genome (https: / / www.nature.com / articles / ng.2877), and the HaplotypeCaller (Poplin et al., 2018) with default parameters was used to generate polymorphic positions summarized in a VCF file for association mapping.

[0320] Genotyping results:

[0321] GBS for F2 population experiment:

[0322] Genotypic analysis done by the VCF file, was processed in Tassel 5 (Glaubitz et al., 2014). Sites with minor allele frequency < 0.05 were filtered out from downstream analyses. Association mapping was performed with Tassel 5 using the generalized linear model (GLM) algorithm with 1000 permutations.

[0323] Also in this experiment, the number of fruits per plant was used for the analysis, due to the reason that the fruit weight parameter was not accurate (the fruits were on the plant for long period and lost their weight by shrinking due to water loss).

[0324] After analyzing the genotype and the phenotype, the results were combined to identify phenotype / genotype linkage in association with a QTL. It was chosen to use the results that have high LOD score (above 8).

[0325] The inventors successfully found two clear genome areas (two QTLs) that match the defined criteria for high yield properties.

[0326] The first genomic region, identified according to "number of fruits per plant" parameter, is located on QTL1 of chromosome 1 (Chr 1) and has the size of 4.5Mbp (9- 13.5 million bp on Chr 1). In this region, 93 sequences of candidate genes (see sequencing data SEQ ID NO: 1-93) and 11 molecular markers (see SEQ ID NO: 281- 290, Tables 1, 2 and 3) were identified.

[0327] The second genomic area, identified according to EP evaluation / gradc / lcvcl (e.g. the visual or qualitative measuring of EP in hot conditions / early fruit setting and increased percentage of parthenocarpic fruits), is located on QTL2 of chromosome 10 and has the size of 19Mbp (199-218 million bp on Chr 10). In this region, 187 sequences of candidate genes (see sequence data SEQ ID NO: 94-280 below) and 131 molecular markers (see SEQ ID NO: 291-323 and 346, Tables 1, 2 and 4) were identified.

[0328] From genetic data of CM192-539 sequence (a full genome sequencing was performed and compared to “MAOR'7 CM334 genomic sequence), 11 unique molecular markers are located on Chr 1, and 131 molecular markers on Chr 10 of the tested F2 population (see Tables 1, 2, 3 and 4).

[0329] In Table 2, the sequence (seq) of each of the SEQ ID NOs includes the 'Flanking Sequence Upstream the molecular marker' + 'CM- 192-539' unique molecular marker sequence' + 'Flanking Sequence Downstream the molecular marker'. The position indicated is relative to Maor ASM2707369vl NCBI / Capsicum annuum cv. CM334 releasel.55 reference genome.Table 2: Unique molecular markers located on Chr 1 and Chr 10

[0330] The findings disclosed herein support the inventor's hypothesis that CM 192- 539 line, has unique genes / DNA sequences that are in linkage to or associated with high fruit yield properties of setting parthenocarpic and / or seedless and / or fruits with seeds.

[0331] It is emphasized that the above results show genomic regions with distinct haplotypes, namely, where samples of CM202-2258, CM- 192-539 and 'MaorV CM334 have unique haplotypes.

[0332] The genetic and phenotypic analysis results show that the CM- 192-539 / CD222-401.7 source lines have a unique haplotype that is linked to the high fruit yield properties of high yield phenotype (e.g. increased fruit number and weight) and early fruit setting / setting fruit at high temperature and / or setting parthenocarpic fruit at high temperature, of the present invention. This haplotype is absent in the CM202-2258 control line which has significantly lower EP level and in the 'Maor' / CM334 lines used as the reference lines.EXAMPLE 3: IDENTIFYING MOLECULAR MARKERS UNIQUE FOR HIGH-YIELD PROPERTIESGenomic analysis of QTL1 on chromosome 1 (Chr 1) in F2 population

[0333] A variance between the parental lines CM-192-539 and MAOR / CM334 was found within QTL1, located on gene Ca01g05320. The amino acid sequence encoded by this gene (Ca01g05320) is as set forth in SEQ ID NO: 27.

[0334] The herein found variance in Ca01g05320 gene, was further analyzed on the F2 population. This analysis resulted in the identification of one SNP molecular marker located on the Ca01g05320 gene. The Ca01g05320 SNP (A instead of G) is located on Chr 1 positioned 9,570,115 bp as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maorgenome ASM2707369vl NCBI. The SNP causes a change of amino acid in the protein sequence from GLICYNE to SERINE. This change could influence the transcript level and the functionality of the protein and explain the involvement of this gene in parthenocarpy level in the tested F2 population.

[0335] This SNP was used for molecular marker -assisted analysis of the F2 population. The findings support that individuals that contain the allelic variation of Ca01g05320 A instead of G have 15-20% more fruits compared to individuals containing the WT allele (G) (see Table 3).

[0336] It is noted that this molecular variant or marker could explain 18-20% of the high-yield properties. In QTL terms it is considered as an important QTL for this trait.Table 3: Unique SNPs within Ca01g05320 gene on QTL1 of Chr 1

[0337] Tables 1, 2 and 3 show unique molecular markers for QTL1 located on chromosome 1 (i) between positions 09.0-11.0 Mbp relative to Capsicum annuum cv. CM334 reference genome, and (ii) between position 12.0-13.5 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, associated with increased fruit number and / or fruit weight of the high-yield properties.Genomic analysis of QTL2 on chromosome 10 (Chr 10) in F2 population

[0338] QTL2 on Chr 10 (high yield properties in hot conditions / early fruit setting traits and increased percentage of parthenocarpic fruits) was further analyzed in F2 population.

[0339] A total of 399 molecular markers were identified and from that list, molecular markers that segregate in mendelian proportion were filtered. From the filtered list, all the molecular markers with “R-Square” above 0.1 were selected. That yielded a list of 97 molecular markers with linkage to the high-yield properties. All these molecular markers are flanking and scattered on QTL2 (see Table 4).

[0340] The findings support that the allelic variations are associated with an increase of about 20-40% in the high-yield properties (see Table 4, for example marker 146357 at position 210564909).

[0341] This QTL has R-square of 0.4 (the QTL Peak) meaning that QTL2 could explain 40% of the high-yield properties (e.g. marker 146357 at position 210564909 where a change from A to T was found).

[0342] Tables 1, 2 and 4 show unique molecular markers for QTL2 located on chromosome 10 (i) between positions 204-218 Mbp relative to Capsicum annuum cv. CM334 reference genome, and (ii) between positions 199-214 Mbp relative to Maor genome reference #ASM 2707369vl NCBI, associated with the high-yield properties expressed by or having early fruit setting / setting fruit at high temperature and / or setting elevated percentage of parthenocarpic fruits characteristics.

[0343] By combining the yield results and the genetic data derived from the experiments above, it is strongly evidenced that CM 192-539 / CD222-401.7 line is a source of the unique high-yield properties which led to:

[0344] a. Yield increase (fruit number and / or weight), for which unique genes / DNA sequences associated with the molecular markers identified on QTL1 of chromosome 1 (SEQ ID NO: 1-93, SEQ ID NO: 281-290, Tables 1, 2, 3 and 5); and

[0345] b. Early fruit setting / setting fruit at high temperature and / or setting elevated percentage of parthenocarpic fruits, for which unique genes / DNA sequences were identified on QTL2 of Chromosome 10 (SEQ ID NO: 94-280, SEQ ID NO: 291-323 and 346, Tables 1, 2, 4 and 5).Table 4: Unique SNPs on QTL2 of Chromosome 10Allele aTable 5: Summary of SNPs identified in CA01g05320, CA10gl4270, CA10gl4820 and CA10gl5940 genes in each of the examined genomes, and corresponding primers and SNP positionsEXAMPLE 4: YIELD ENHANCEMENT UTILIZING F2 TAIL ANALYSIS WITH MOLECULAR MARKER GENOTYPINGMaterials & Methods

[0346] This example is divided into two sections.

[0347] Section 1: F2 tail analysis utilizing molecular marker genotyping- yield experiment.

[0348] Section 2: Percentage of seedless fruit from total fruit - EP level experiment.

[0349] Section 1: F2 tail analysis utilizing molecular marker genotyping -yield experiment

[0350] For this experiment, the isogenic fertile lines (B lines) were used to generate two populations for F2 tail analysis.

[0351] 1. CM202-2258 line

[0352] 2. CD222-401.7 line

[0353] 3. MAOR (an academic open line).

[0354] For each line, a cross was performed with MAOR to generate the Fl plants. The Fl plants were grown and F2 seeds were collected from the Fl plants to produce F2 generation progeny (see Fig. 1).

[0355] Fig. 1 presents schemes for generating F2 populations derived from a cross between each of the two parental lines CM202-2258, CD222-401.7, with MAOR.

[0356] As shown in Tables 1 and 6, the molecular marker (MM) patterns (haplotypes) are distinct amongst the tested lines CM202-2258, CD222-401.7 and MAOR. Thus, three different molecular marker patterns (haplotypes) are analyzed in the experiments: CM202-2258, CD222-401.7 and MAOR. haplotypes.Table 6: Molecular marker position on the QTLs of Chrl and Chr 10

[0357] Each population was scanned and analyzed (-1500 plants per group) for these 5 molecular markers (MM). For each population, two groups were established based on the molecular marker profiles identified:

[0358] Group 1: MM pattern corresponding to MAOR (WT) haplotype

[0359] Group 2: MM pattern corresponding to parental lines CM202-2258 and CD222-401.7 haplotype (EP trait)

[0360] After the molecular markers selection, plants were planted in the greenhouse located in "Neot Hakikar" south district Israel.

[0361] Planting date: January 31st:

[0362] Each group contained 40 plants, 4 repeats of 10 plants, 80 plants per F2 population, 160 plants in total.

[0363] Experimental type: random blocks

[0364] Treatments for F2 plants for each of the groups from each of the two crosses were as follows:

[0365] (A) MM CM202-2258 haplotype type

[0366] (B) MM MAOR haplotype type

[0367] (E) MM CD222-401.7 haplotype type

[0368] (F) MM MAOR haplotype type

[0369] An illustrative experimental map is presented in Table 7 below.Table 7: Plot experimental map

[0370] Harvesting: 10 plants of each repeat were taken for yield measurements.

[0371] Harvesting dates:

[0372] The harvests were conducted on May 6th and May 20th.

[0373] Each replica per treatment was measured for weight and number of fruits separately. Thus 4 measurements were performed for each harvesting date per treatment. This provided a total of 8 measurements per treatment across both harvest dates, and 32 measurements for all treatments in the experiment.

[0374] The data collected was analyzed, and statistical analyses (number of fruits) was performed for each treatment. Based on these analyses, the total yield was calculated.

[0375] Results

[0376] After the data collection from the experiment was completed, the data was analyzed using R-Studio and Excel. The yield was assessed by counting all ripe fruits(defined as a fruit exhibiting at least 75% red color) that were collected from plants meeting the criteria for marketable fruit size.

[0377] The results indicate that, in the F2 population obtained from the cross between CM202-2258 and MAOR, a marginally significant difference in fruit number was observed between the two haplotypes (A vs. B), with a T-test p-value of 0.09 (see Tables 8 and 9, Fig. 2). In contrast, in the F2 population derived from the cross between CD222-401.7 and MAOR, a highly significant difference in fruit number was detected between haplotypes E and F, with a T-test p-value of 0.0003 (see Tables 8 and 9, Fig. 2).

[0378] Reference is made to Table 8 and Fig. 2, in which the yield analysis is depicted as the average number of fruits produced for each treatment group, specifically (A), (B), (E), and (F).Table 8: Average yield per treatmentReference is made to Table 9 presenting comparative yield assessments among the different haplotype groups derived from the F2 populations. Specifically, the table details the statistical significance of differences in fruit number between the respective haplotypes, as determined by T-test analysis. The data demonstrates the extent to which the presence of specific molecular marker patterns (haplotypes) is associated with variations in fruit yield, thereby supporting the identification of the genetic elements as described above (e.g. in Table 1) contributing to the herein described high-yield phenotypes under different or varying environmental conditions in pepper plants.Table 9: Statistical analysis for each treatment

[0379] The foregoing results support the hypothesis that a correlation exists between the Excellent Parthenocarpy (EP) level associated with the QTLs located on chromosome 1 (between 9-13.5 Mbp) and on chromosome 10 (between 199-218 Mbp), and the high-yielding phenotype as described herein. It is further observed that the molecular marker pattern corresponding to the CD222-401.7 B-line haplotype, contributes to the increased fruit number under the tested conditions. Moreover, the data demonstrate that the EP trait influences fruit setting in both cytoplasmic male sterility (CMS) and fertile genetic backgrounds, thereby contributing to yield improvement across various environmental conditions and genetic backgrounds.

[0380] Additionally, a comparison was made between the two haplotypes, A (CM202- 2258 haplotype) and E (CD222-401.7 haplotype), to analyze the additive effect of the EP allelic variation on fruit number. The analysis revealed that the CD222-401.7 haplotype (EP 8) reflects an approximate 10% increase in yield relative to CM202-2258 haplotype (EP 5), as reflected by an increase from 71 to 78 fruits (see Table 8). Statistical analysis demonstrated that the difference in fruit number between these haplotypes is significant, with a T-test p-value of 0.05 (see Fig. 3 and Table 10).

[0381] Reference is made to Table 10 presenting statistical significance of differences in fruit number between the respective haplotypes, as determined by T-test analysis.Table 10: Statistical analysis of yield assessment between CM202-2258 haplotype and CD222-401.7 haplotype derived from the F2 populationsSection 2: Percentage of seedless fruits from total fruits -EP level experiment

[0382] Based on the ability of the plant to set a high number of seedless fruits, an internal definition of "EP" (Excellent Parthenocarpy) scale was developed, wherein MAOR is defined as EP = 1, CM202-2258 is defined as EP = 5, and CD222-401.7 is defined as EP = 8.

[0383] It was hypothesized that on a fertile background, the EP trait confers the setting of elevated yield properties of parthenocarpic or seedless fruits and / or fruits with seeds,under different environmental conditions, compared to a pepper plant having the same genetic background and lacking the EP trait.

[0384] To examine this hypothesis, B lines of CM202-2258 and CD222-401.7 were used under fertile background.

[0385] This experiment analyzed the total number of fruits and percentage of parthenocarpic (seedless) fruits from lines CM202-2258 and CD222-401.7 in comparison to MAOR.

[0386] The fruits were collected on two dates: May 6thand May 20th.

[0387] On May 6thonly ripped fruits were collected (as defined above).

[0388] On May 20th, all fruits remaining on the plants were collected (10 plants per line), resulting in a collection of between 58 and 230 fruits per line across the entire experiment.

[0389] The fruits were counted and weighed. Subsequently, the fruits were opened for analysis and separated into three groups:1) 100% parthenocarpic (seedless) fruit2) 1-10 seeds per fruit3) More than 10 seeds per fruit

[0390] Results:

[0391] The results show that CD222-401.7 line (EP=8) exhibits the highest percentage of parthenocarpic fruits compared to MAOR (EP=1) and CM202-2258 line (EP=5) (see Fig. 4 and Table 11).

[0392] Reference is now made to Fig. 4, presenting the percentage of parthenocarpic fruits for each pepper line: CD222-401.7, CM202-2258 and MAOR. Reference is now made to Table 11, which indicates the percentage of parthenocarpic (seedless) fruits from total fruits.Table 11: Percentage of parthenocarpic (seedless) fruits from total fruits| CD222-401.7 | 230 | 8 | 40 |

[0393] These findings support the hypothesis that of a correlation between the EP level conferred by the QTL located on chromosome 1 (between 9-13.511 Mbp) and QTL located on chromosome 10 (between 199-218 Mbp), and the high yielding phenotype as described herein. This correlation exists, not only under CMS background (male sterility background) but also under fertile genetic background and supports the ability of the plant to secure fruit setting under a wide range of environmental conditions via setting of seedless (parthenocarpic) fruit under suboptimal conditions.

[0394] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms "a," "an" and "the" are intended to include plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" or "comprising," when used in this specification, specify the presence of stated features, integers, steps, operations, elements components and / or groups or combinations thereof, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or groups or combinations thereof. As used herein the terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to". The term “consisting of’ means “including and limited to”.

[0395] As used herein, the term "and / or" includes any and all possible combinations or one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0396] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the specification and claims and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein. Well-known functions or constructions may not be described in detail for brevity and / or clarity.

[0397] It will be understood that, although the terms first, second, etc., may be used herein to describe various elements, components, regions, layers and / or sections, these elements, components, regions, layers and / or sections should not be limited by these terms. Rather, these terms are only used to distinguish one element, component, region, layer and / or section, from another element, component, region, layer and / or section.

[0398] Certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0399] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0400] As used herein the term "average" refers to the mean value as obtained by measuring a predetermined parameter in each plant of a certain plant population and calculating the mean value according to the number of plants in said population.

[0401] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging / ranges between” a first indicate number and a second indicate number and “ranging / ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

[0402] Whenever the term “about” is used, it is meant to refer to a measurable value such as an amount, a temporal duration, and the like, and is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0403] All publications, patent applications, patents, and other references mentioned in the disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains. In case of conflict, the patent specification, including definitions, will prevail. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Throughout this application various publications, published patent applications and published patents are referenced.

[0404] It will be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove. Rather the scope of the present invention is defined by the appended claims and includes both combinations and sub-combinations of the various features described hereinabove as well as variations and modifications thereof, which would occur to persons skilled in the art upon reading the foregoing description. While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents may occur to those skilled in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention. Various embodiments have been presented. Each of these embodiments may of course include features from other embodiments presented, and embodiments not specifically described may include various features described herein.References:K.D. Murray, J.O. Borevitz, Axe: rapid, competitive sequence read demultiplexing using a trie, Bioinformatics 34 (2018) 3924-3925.A. McKenna, M. Hanna, E. Banks, A. Sivachenko, K. Cibulskis, A. Kernytsky, K. Garimella, D. Altshuler, S. Gabriel, M. Daly, M.A. DePristo, The genome analysis toolkit: a mapreduce framework for analyzing. Genome Res, (2010), 1297-303.Poplin, V. Ruano-Rubio, M.A. DePristo, T.J. Fennell, M.O. Cameiro, G.A. Van der Auwera, D.E. Kling, L.D. Gauthier, A. Levy-Moonshine, D. Roazen, K. Shakir, J. Thibault, S. Chandran, C. Whelan, M. Lek, S. Gabriel, M.J. Daly, B. Neale, D. G. MacArthur, E. Banks, Scaling accurate genetic variant discovery to tens of thousands of samples, bioRxiv (2018), 201178.R.J. Elshire, J.C. Glaubitz, Q. Sun, J.A. Poland, K. Kawamoto, E.S. Buckler, S.E. Mitchell, A. Robust, Simple genotyping-by-sequencing (GBS) approach for high diversity species, PLoS One 6 (2011), el9379.A Tiwari, A. Vivian-Smith, R.E. Voorrips, M. E. Habets, L. B. Xue, R. Offringa, E. P. Heuvelink. Parthenocarpic potential in Capsicum annuumL. is enhanced by carpelloid structures and controlled by a single recessive gene. BMC Plant Biology 11.1 (2011): 1-15.I. Honda, H. Matsunaga, H., Kikuchi, K., Matsuo, S., & Fukuda, M. Identification of pepper (Capsicum annuum L.) accessions with large or small fruit that have a high degree of parthenocarpy. Scientia horticulturae 135 (2012): 68-70.Shi, F., Zhang, X., Wang, Z. et al. Unveiling molecular mechanisms of pepper resistance to Phytophthora capsici through grafting using iTRAQ-based proteomic analysis. Sci Rep 14, 4789 (2024).Saha, S., Hossain, M., Rahman, M., Kuo, C., & Abdullah, S. (2010). Effect of high temperature stress on the performance of twelve sweet pepper genotypes. Bangladesh Journal of Agricultural Research, 35(3), 525-534.Song, K.W., S.K. Park and C.K. Kim., (1976), Studies on the flower abscission of hot pepper. Res. Rept. Office Rural Dev. 18: 9-32.E. Pressman, H. Moshkovitch, K. Rosenfeld, R. Shaked, B. Gamliel, B. Aloni, (1998), Influence of low night temperatures on sweet pepper flower quality and the effect of repeated pollinations, with viable pollen, on fruit setting, The Journal of Horticultural Science and Biotechnology, 73: 1, 131-136.Dhatt A. & Chahal G. K. (2016). Parthenocarpy: A potential trait to exploit in vegetable crops: A review. Agricultural Reviews. 37Pandolfini T., Molesini B., and Spena A., (2009), Parthenocarpy in crop plants. Annual Plant Reviews, 38, 326-345.Chen R, Ma J, Luo D, Hou X, Ma F, Zhang Y, Meng Y, Zhang H, Guo W. CaMADS, a MADS-box transcription factor from pepper, plays an important role in the response to cold, salt, and osmotic stress. Plant Sci. 2019 Mar;280: 164-174.Islam S, Sajib SD, Jui ZS, Arabia S, Islam T, Ghosh A. Genome-wide identification of glutathione S-transferase gene family in pepper, its classification, and expression profiling under different anatomical and environmental conditions. Sci Rep. 2019 Jun 24;9(l):9101.Estevez I. H., Hernandez M. R., Plant Glutathione S -transferases: An overview, Plant Gene, 23, (2020), 100233, ISSN 2352-4073.Bienz M (2006) The PHD finger, a nuclear protein-interaction domain. Trends Biochem Sci 31: 35-40.

Claims

1. Claims1. A cultivated fertile pepper plant or seed comprising a genetic region that confers high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and wherein said genetic region comprises QTL1 located at 09.0- 13.5 Mbp on chromosome 1, and / or QTL2 located at 199-218 Mbp on chromosome 10.

2. The cultivated fertile pepper plant or seed according to claim 1, wherein said fruit setting comprises setting parthenocarpic, seedless and / or fruits with seeds, under varying environmental conditions.

3. The cultivated fertile pepper plant or seed according to any one of claims 1 and 2, wherein said pepper plant produces increased fruit yield comprising an elevated percentage of parthenocarpic and / or seedless fruits under suboptimal growth conditions and sets fruit with seeds under normal or optimal growth conditions.

4. The cultivated fertile pepper plant or seed according to claim 3, wherein said suboptimal conditions are selected from abiotic stresses such as high or low temperatures, high or low humidity, salinity, drought and radiation conditions.

5. The cultivated fertile pepper plant or seed according to any one of claims 1-4, wherein (a)QTL1 is located 09.0-11 Mbp as indicated in pepper genome Capsicum annuum cv CM334 v.1.55 or at position 12.0-13.5 Mbp as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI on chromosome 1, and (b) QTL2 is located 204-218 Mbp as indicated in pepper genome Capsicum annuum cv CM334 v.1.55 or at position 199-214 Mbp as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI on chromosome 10.

6. The cultivated fertile pepper plant or seed according to any one of claims 1-5, wherein QTL1 located on chromosome 1 is associated with increased fruit number and / or elevated fruit weight compared to a control pepper plant lacking QTL1.

7. The cultivated fertile pepper plant or seed according to any one of claims 1-5, wherein QTL2 located on chromosome 10 is associated with early fruit setting and / or production of parthenocarpic, seedless and / or fruit with seeds, under varying environmental conditions compared to a control pepper plant lacking QTL2.

8. The cultivated fertile pepper plant or seed according to any one of claims 1-7, wherein the genome of said plant comprises at least one molecular marker and / or geneassociated with the at least one QTL, the at least one molecular marker and / or gene is selected from the group consisting of: a. a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof, associated with QTL1 on chromosome 1; b. a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (v) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (vi) any combination thereof, associated with QTL2 on chromosome 10; and c. any combination thereof.

9. The cultivated fertile pepper plant or seed according to any one of claims 1-8, wherein the genome of said plant comprises at least one molecular marker selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570,115 as indicated in Capsicum annuum cv CM334 vl.55genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

10. The cultivated fertile pepper plant or seed according to any one of claims 8 and 9, wherein the pepper plant or seed is homozygous for the at least one molecular marker.

11. The cultivated fertile pepper plant or seed according to any one of claims 1-10, wherein the high yield properties of fruit setting comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

12. The cultivated fertile pepper plant or seed according to any one of claims 1-11, wherein the high yield properties of fruit setting comprise a. increased average fruit number of at least 5%, such as in the range of 5%-50%, particularly an increase in the range of 10- 40% as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence, and / or b. increased percentage of parthenocarpic and / or seedless fruits setting, out of the total fruit set, of at least 10%, such as in the range of 10%-50%, particularly in the range of 15%-40%, as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

13. The cultivated fertile pepper plant or seed according to any one of claims 1-12, wherein said plant produces a fruit type selected from: bell pepper, pointed pepper, half long pepper, Como di Toro pepper, sweet pepper including a dolce-type pepper, a big rectangular pepper, a conical pepper, a long conical pepper and a blocky-type pepper.

14. The cultivated fertile pepper plant or seed according to any one of claims 1-13, wherein the mature fruit of the plant is green, yellow, orange, red, ivory, brown, or purple.

15. The cultivated fertile pepper plant or seed according to any one of claims 1-14, wherein the pepper plant or seed is an inbred, a hybrid, a doubled haploid (DH), or a polyploid of any ploidy level.

16. The cultivated fertile pepper plant or seed according to any one of claims 1-15, wherein said pepper plant or seed is a genome edited plant, such as a plant or seed produced using the CRISPR / Cas system.

17. The cultivated fertile pepper plant or seed according to any one of claims 1-16, wherein said pepper plant or seed genotype is formed using doubled haploid (DH) combined with gene editing technology techniques.

18. The cultivated fertile pepper plant or seed according to any one of claims 1 - 17 or a progeny thereof, wherein said QTL1 and / or QTL2 is as found in seeds of Capsicum annum CM- 192-539, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44203 on 04 / 08 / 2023, and / or in seeds of CD222-401.7, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44400 on 21 / 06 / 2024.

19. The cultivated fertile pepper plant or seed according to any one of claims 1-18, wherein said plant further comprising within its genome at least one additional trait selected from the group consisting of, taste, nutritional value, insect resistance, resistance to bacterial, fungal or viral disease, and resistance to a non-biotic stress, wherein the additional trait is introduced by a method selected from the group consisting of breeding, genome editing, genetic determinant introgression and transformation.

20. A plant part comprising a regenerable cell, pollen, ovule, fruit or seed of the cultivated fertile pepper plant or seed according to any one of claims 1-19.

21. A plant part of a cultivated fertile pepper plant or seed according to any one of claims 1- 19, wherein said plant part is defined as a leaf, a bud, a meristem, an embryo, a root, a root tip, a stem, a flower, a fruit, seed or a cell.

22. A pepper seed obtained from a crossing in which at least one of the parental plants is the cultivated fertile pepper plant or seed according to any one of claims 1-19, or which produces the cultivated fertile pepper plant or seed according to any one of claims 1- 19.

23. A tissue culture of regenerable cells, protoplasts or callus obtained from the cultivated fertile pepper plant or seed according to any one of claims 1-19.

24. Pepper fruit or processed pepper fruit derived from a cultivated fertile pepper plant or seed according to any one of claims 1-19.

25. A method for producing a fertile pepper plant or seed capable of high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, comprising:a. identifying a first pepper plant as a donor male parent, comprising a genetic region that confers high yield fruit setting, wherein said genetic region comprises QTL1 located 09.0-13.5 Mbp on chromosome 1, and / or QTL2 located 199-218 Mbp on chromosome 10; b. crossing said first pepper plant with a second pepper plant as a female parent, to produce Fl hybrid pepper plant, wherein the second pepper plant is a commercially acceptable pepper line; c. selecting at least one progeny plant by: genotyping to confirm the presence of QTL1 and / or QTL2, and phenotyping to confirm expression of high yield fruit setting; and d. optionally, backcrossing said at least one selected progeny plant with said male parent plant and / or repeating steps c-d to introgress said genetic region into a desired genetic background.

26. The method according to claim 25, wherein said fruit setting is setting a parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions.

27. The method according to claim 25 or claim 26, wherein the method produces a pepper plant that produces increased fruit yield comprising an elevated percentage of parthenocarpic, and / or seedless fruits under suboptimal growth conditions and sets fruit with seeds under normal or optimal growth conditions.

28. The method according to claim 27, wherein said suboptimal conditions are selected from abiotic stresses such as 1 high or low temperatures, high or low humidity, salinity, drought, or radiation conditions.

29. The method according to any one of claims 25-28, wherein:(a) QTL1 is located at 09.0-11 Mbp according to Capsicum annuum cv CM334 v.1.55 genome, or at 12.0-13.5 Mbp according to Capsicum annuum cv Maor genome ASM2707369vl NCBI on chromosome 1; and(b) QTL2 is located at 204-218 Mbp according to Capsicum annuum cv CM334 v.1.55 genome, or at 199-214 Mbp according to Capsicum annuum cv Maor genome ASM2707369vl NCBI coordinates on chromosome 10.

30. The method according to any one of claims 25-29, wherein QTL1 located on chromosome 1 is associated with increased fruit number and / or increased fruit weight compared to a control pepper plant lacking QTL1.

31. The method according to any one of claims 25-29, wherein QTL2 located on chromosome 10 is associated with earlier fruit setting and / or production of parthenocarpic, seedless and / or fruit with seeds under varying environmental conditions compared to a control pepper plant lacking QTL2.

32. The method according to claim 25, wherein said step of identifying the donor male parent comprises screening F2 seeds of various pepper genetic sources for having an Excellent Parthenocarpy (EP) level of at least 5 on a scale of 1-10.

33. The method according to claim 32, wherein said screening comprises producing a doubled haploid (DH) genotype plants from haploid and / or diploid cells derived from various pepper genetic sources.

34. The method according to any one of claims 32 and 33, wherein said steps of identifying and selecting comprises inbreeding a pepper plant characterized by said EP level until the genetic composition of the progeny becomes substantially stable.

35. The method according to any one of claims 25-34, wherein the genome of the donor pepper plant comprising a molecular marker and / or a gene associated with the at least one QTL, said molecular marker and / or gene is selected from the group consisting of: a. a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A allele A at position 9,570, 115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof, associated with QTL1 on chromosome 1; b. a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 on chromosome 10; and c. any combination thereof.

36. The method according to any one of claims 25-35, wherein the genome of said plant comprises at least one molecular marker selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570,115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

37. The method according to any one of claims 25-36, wherein the step of selecting by genotyping comprising screening by PCR amplification using primer pairs having a sequence selected from: SEQ ID NO: 336 and 337 for SEQ ID NO: 324, SEQ ID NO: 338 and 339 for SEQ ID NO: 325, SEQ ID NO: 340 and 341 for SEQ ID NO: 326 and SEQ ID NO: 342 and 343 or 344 for SEQ ID NO: 327, and optionally analyzing the amplicons using restriction analysis.

38. The method according to any one of claims 25-37, wherein the high yield properties comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

39. The method according to any one of claims 26-38, wherein the high yield properties comprise a. increased average fruit number of at least 5%, such as in the range of 5%-50%, particularly an increase in the range of 10- 40% as compared to a pepper planthaving the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence, and / or b. increased percentage of parthenocarpic and / or seedless fruits setting, out of the total fruit set, of at least 10%, such as in the range of 10%-50%, particularly in the range of 15%-40%, as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

40. The method according to any one of claims 25-39, wherein the pepper plant or seed is an inbred, a hybrid, a doubled haploid (DH) or a polyploid of any ploidy level.

41. The method according to any one of claims 25-40, wherein said pepper plant or seed is a genome edited plant, such as a plant or seed produced using the CRISPR / Cas system or is produced using doubled haploid (DH) technology combined with gene editing techniques.

42. A method for producing a pepper plant or seed exhibiting high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and wherein said method comprises steps of introducing at least one QTL as defined in any one of claims 1-19, into a Capsicum annuum plant.

43. The method according to any one of claims 25-42, wherein said at least one QTL is as found in seeds of Capsicum annum CM- 192-539, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44203 on 04 / 08 / 2023, and / or in seeds of CD222-401.7, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44400 on 21 / 06 / 2024.

44. A pepper plant obtained by the method according to any one of claims 25-43.

45. Pepper seed or fruit produced by the method according to any one of claims 25-44.

46. A method for detecting or selecting for a pepper plant or seed according to any one of claims 1-19, comprising a genetic region that confers high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, comprising detecting at least one of the following: a. a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genomeCapsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof, associated with QTL1 located 9-13.5 million bp on chromosome 1; b. a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 located on chromosome 10; and c. any combination thereof.

47. The method according to claim 46, wherein the method comprises detecting at least one molecular marker selected from: (a) SEQ ID NO: 324 comprising SNP at position 9,570,115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

48. The method according to any one of claims 46 and 47, wherein the step of detecting or selecting comprises (a) performing PCR amplification using primer pairs selected from: SEQ ID NO: 336 and 337 for SEQ ID NO: 324, SEQ ID NO: 338 and 339 for SEQ ID NO: 325, SEQ ID NO: 340 and 341 for SEQ ID NO: 326 and SEQ ID NO: 342 and 343 or 344 for SEQ ID NO: 327, and (b) optionally analyzing the amplicons using restriction analysis.

49. The method according to any one of claims 46-48, wherein said fruit setting is setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions.

50. The method according to any one of claims 46-49, wherein the method detects or selects for a pepper plant that producing increased fruit yield comprising an elevated percentage of parthenocarpic and / or seedless fruits under suboptimal growth conditions and sets fruit with seeds under normal or optimal growth conditions.

51. The method according to claim 50, wherein said suboptimal conditions are selected from abiotic stresses such as high or low temperatures, high or low humidity, salinity, drought and radiation conditions.

52. An isolated genetic element from Capsicum annuum associated with conferring high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and wherein said genetic element is selected from the group consisting of: a. a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) or any combination thereof, associated with QTL1 located 09.0- 13.5 Mbp on chromosome 1; b. a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 located 199-218 Mbp on chromosome 10; andc. any combination thereof, wherein the genetic element confers high yield fruit setting as compared to a pepper plant having the same genetic background but lacking said genetic element.

53. The isolated genetic element according to claim 52, wherein the molecular marker is selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570,115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

54. An isolated genetic element having at least 90% sequence identity with the genetic element of any one of claims 52 and 53, wherein said genetic element is associated with conferring high yield fruit setting as compared to a pepper plant having the same genetic background but lacking said genetic element.

55. The isolated genetic element according to any one of claims 52-54, wherein the genetic element is detectable by PCR amplification using primer pairs selected from: SEQ ID NO: 336 and 337 for SEQ ID NO: 324, SEQ ID NO: 338 and 339 for SEQ ID NO: 325, SEQ ID NO: 340 and 341 for SEQ ID NO: 326 and SEQ ID NO: 342 and 343 or 344 for SEQ ID NO: 327, and optionally the amplicons are analyzed using restriction analysis.

56. The isolated genetic element according to any one of claims 52-55, wherein said fruit setting comprises setting parthenocarpic, seedless and / or fruits with seeds, under varying environmental conditions.

57. The isolated genetic element according to any one of claims 52-56, wherein said pepper plant produces increased fruit yield comprising an elevated percentage of parthenocarpic and / or seedless fruits under suboptimal growth conditions and sets fruits with seeds under normal or optimal growth conditions.

58. The isolated genetic element according to claim 57, wherein said suboptimal conditions are selected from abiotic stresses such as high or low temperatures, high or low humidity, salinity, drought and radiation conditions.

59. The isolated genetic element according to any one of claims 52-58, wherein the high yield properties comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

60. A method for producing a pepper plant Capsicum annuum) or a seed thereof capable of high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, by using a doubled haploid generation techniques on plant material comprising the QTL as defined in any one of claims 52- 59 to generate a doubled haploid line comprising said high yield properties of fruits and the QTL as defined in any one of claims 52-59.

61. The method according to claim 60, wherein the high yield properties of fruit setting comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

62. The method according to any one of claims 60-61, wherein the high yield properties comprise a. increased average fruit number of at least 5%, such as in the range of 5%-50%, particularly an increase in the range of 10- 40% as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence, and / or b. increased percentage of parthenocarpic and / or seedless fruits setting out of the total fruit set of at least 10%, such as in the range of 10%-50%, particularly in the range of 15%-40%, as compared to a pepper plant having the same geneticbackground and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

63. The method according to any one of claims 60-62, wherein the genotype of the pepper plant is produced using doubled haploid (DH) technology combined with gene editing techniques.

64. Use of the genetic element or sequences having at least 90% sequence identity with the genetic element according to any one of claims 52-59 to identify or produce a pepper plant or seed with a genetic region conferring high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, particularly commercially acceptable fruits, under different environmental conditions.

65. Use of a molecular marker selected from the group consisting of: a. a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof associated with QTL1 located 09.0-13.5 Mbp on chromosome 1; b. a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:Illor any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 located 199-218 Mbp on chromosome 10; and c. any combination thereof; to identify or develop pepper plants with a genetic region conferring high yield fruit setting, particularly commercially acceptable fruits, wherein said fruitsetting comprises production of parthenocarpic, seedless and / or fruits with seeds, under different environmental conditions, as defined in any one of claims 1-19, and / or identify the at least one QTL, and / or to develop additional markers linked to the at least one QTL.

66. The use according to any one of claims 64-65, wherein the high yield properties of fruit setting comprise at least one of: early fruit setting, setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions, increased fruit number, and increased percentage of parthenocarpic and / or seedless fruits, wherein said properties are as compared to a pepper plant having the same genetic background and lacking said at least one QTL associated with the at least one molecular marker and / or gene sequence.

67. Pepper genetic markers, sequences or elements, plants, seeds, fruits as described in any one of claims 1-19 and plant products thereof for the use in multiple geographical- and / or weather-related environments and growth conditions.

68. Use of a seed deposited of CM-192-539 under NCIMB accession number 44203, with NCIMB Aberdeen AB21 9YA, Scotland on 04 / 08 / 2023, and / or of seeds of CD222- 401.7, representative seeds of which was deposited with NCIMB Aberdeen AB21 9YA, Scotland, UK under accession number NCIMB 44400 on 21 / 06 / 2024, for the production of the pepper plant according to any one of claims 1-19.

69. Use of a pepper plant as a commercial crop, wherein said pepper plant:(a) carries at least one QTL as defined in any one of claims 1-19, wherein said QTL is selected from QTL1 located at 09.0-13.5 Mbp on chromosome 1 and QTL2 located at 199-218 Mbp on chromosome 10; and / or(b) contains a genetic determinant as defined in any one of claims 52-59 conferring high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and wherein said QTL or genetic determinant is derived from Capsicum annuum pepper plants represented by seeds deposited under NCIMB accession number 44203 on 04 / 08 / 2023 and / or seeds deposited under NCIMB accession number 44400 on 21 / 06 / 2024.

70. A method for increasing pepper fruit yield in multiple geographical regions and / or under varying weather or environmental or growth conditions, comprising: growing pepper plantsor cultivating seeds according to any one of claims 1-19 in said geographical regions or under said weather or environmental or growth conditions, wherein said plants or seeds produce commercially relevant increased fruit yields compared to control pepper plants lacking the QTL defined in claim 1.

71. A genome modified pepper plant or seed comprising a genetic region that confers high yield fruit setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, and said plant comprises genome modifications conferring high yield properties, said modifications selected from: a. at least one genome modification on chromosome 1 selected from (i) SEQ IDNO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, (iii) any combination thereof; b. at least one genome modification on chromosome 10 selected from (i) SEQ IDNO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, (iii) any combination thereof; and c. any combination thereof.

72. The genome modified pepper plant or seed according claim 71, wherein the genome of said plant comprises at least one molecular marker selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570, 115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

73. The genome modified pepper plant or seed according to any one of claims 71 and 72, wherein the pepper plant or seed is homozygous for at least one molecular marker.

74. The genome modified pepper plant or seed according to any one of claims 71-73, wherein said fruit setting is setting parthenocarpic, seedless and / or fruits with seeds under varying environmental conditions.

75. The genome modified pepper plant or seed according to any one of claims 71-74, wherein the plant is produced using targeted genome editing technique, such the CRISPR / Cas9 systems, using doubled haploid (DH) technique and / or a combination thereof.

76. A method for enhancing fruit yield of a pepper plant and / or securing high fruit yield setting, wherein said fruit setting comprises production of parthenocarpic, seedless and / or fruits with seeds, comprising introducing or generating via genome modification, such as using gene editing, at least one genetic element selected from: a. a molecular marker selected from (i) SEQ ID NO: 281-290 or any combination thereof, (ii) allele A at position 9,570,115 as indicated in pepper genome Capsicum annuum cv CM334 vl.55 or at position 12,239,886 as indicated in Capsicum annuum cv Maor genome ASM2707369vl NCBI, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 1-93 or any combination thereof, (iv) any combination thereof associated with QTL1 located 09-13.5 Mbp on chromosome 1; b. a molecular marker selected from (i) SEQ ID NO: 291-323 and 346, or any combination thereof, (ii) an allele selected from the group consisting of:or any combination thereof, and / or (iii) a gene encoding a sequence selected from SEQ ID NO: 94-280 or any combination thereof, (iv) any combination thereof, associated with QTL2 located 199-218 Mbp on chromosome 10; and c. any combination thereof.

77. The method according to claim 76, wherein the molecular marker is selected from (a) SEQ ID NO: 324 comprising SNP at position 9,570, 115as indicated in Capsicum annuum cv CM334 vl.55 genome, (b) SEQ ID NO: 325 comprising SNP at position 204,079,966 as indicated in Capsicum annuum cv CM334 vl.55 genome, (c) SEQ ID NO: 326 comprising SNP at position 210,564,909 as indicated in Capsicum annuum cv CM334 vl.55 genome, (d) SEQ ID NO: 327 comprising SNP at position 217,950,632 as indicated in Capsicum annuum cv CM334 vl.55 genome, and (e) SEQ ID NO: 346 comprising SNP at position 215,997,819 as indicated in Capsicum annuum cv CM334 vl.55 genome.

78. The method according to any one of claims 76 and 77, wherein the genome modification is performed using CRISPR / Cas gene editing technology, doubled haploid (DH) techniques or by CRISPR / Cas gene editing technology in combination with doubled haploid (DH) techniques.

Citation Information

Patent Citations

  • Capsicum annuum plant named 'SLP2B365'

    US20160165783P1

  • Parthenocarpic plants and methods of producing same

    US20210037779A1