Split guide RNA compositions and methods for activating a crispr-CAS effector protein with a short nucleotide sequence
The split guide RNA system addresses the limitations of traditional CRISPR-Cas methods by enabling direct detection of short RNAs through a split guide RNA and capture nucleic acid, achieving reliable detection and quantification of miRNAs and other short RNAs.
Patent Information
- Application Number
- PCT/US2025/030627
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-27
- Filing Date
- 2025-05-22
- Publication Date
- 2026-01-29
AI Technical Summary
Current methods for detecting short RNA sequences, such as miRNAs, are limited by the need for RNA extraction, purification, and reverse transcription, leading to errors and reduced reliability, especially for sequences shorter than 21 nucleotides.
A split guide RNA system is used, where the guide RNA is split into two parts, with a capture nucleic acid providing an anchor and capture region, allowing detection of short nucleic acids like miRNAs by activating a CRISPR-Cas effector protein, such as Cas13a, without traditional RNA extraction and purification steps.
This approach extends the detectable range of RNA sequences to as short as 8 nucleotides while maintaining sensitivity and specificity, providing a reliable method for direct detection and quantification of short RNAs.
Smart Images

Figure US2025030627_29012026_PF_FP_ABST
Abstract
Description
Atty Docket No.: BERK-527WOSPLIT GUIDE RNA COMPOSITIONS AND METHODS FOR ACTIVATING A CRISPR-CAS EFFECTOR PROTEIN WITH A SHORT NUCLEOTIDE SEQUENCECROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 652,108 filed May 27, 2024, which application is incorporated herein by reference in its entirety.INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS AN XML FILE
[0002] A Sequence Listing is provided herewith as a Sequence Listing XML, “BERK- 527PRV_SEQLIST.xml” created on May 24, 2024 and having a size of 478,931 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.I. INTRODUCTION
[0003] While Cas13a has been successfully adapted by the molecular diagnostics field to detect many ssRNA targets, detecting RNA targets shorter than 21 nt has been a challenge. Critically, this lower-length limit of detection excludes many miRNA species. An estimated 15.5% (411 of 2656) of documented human miRNAs are less than 21 nt long, but it is likely that there are more miRNAs in this range that have not yet been discovered by current technologies. As miRNAs continue to be identified as important biomarkers for disease diagnosis and monitoring, it becomes more important to be able to detect the full range of miRNAs and discover new miRNAs.
[0004] Cas13a is a CRISPR-Cas protein that has found multiple applications in molecular diagnostics and therapeutics. Cas13a, a class 2, type VI CRISPR-Cas system, complexes with a guide RNA (gRNA) to form a Cas13a ribonucleoprotein (RNP). The gRNA contains a stem-loop region that mediates the interaction between the protein and gRNA, which includes a programmable 20-28nt seed region. The Cas13a RNP binds to a target RNA that is complementary to the seed region, activating the RNP and triggering non-specific cleavage of single-stranded RNA (ssRNA). To leverage the programmable Cas13a activation as a diagnostic tool, assays use a quenched fluorescent reporter composed of a fluorophore linked to a quencher by a short ssRNA segment. When the Cas13a RNP is activated by target RNA, the RNP cleaves the ssRNAs of the reporters, unquenching the fluorophores and generating a fluorescent signal that increases over time. The rate at which theAtty Docket No.: BERK-527WO signal increases corresponds to the number of active Cas13a RNPs and enables quantification of the target RNA's abundance in a sample.
[0005] One useful feature of Cas13a is that it can be used without the need for RNA extraction and purification, reverse transcription, and amplification steps that are usually required in PCR-based diagnostics. This enables direct detection of many RNA targets, including viral genomic RNA and host mRNA at levels that are not influenced by losses and variability of RNA extraction and reverse transcription. However, detection of short RNAs (<21 nt) like miRNAs, has been a challenge.
[0006] Circulating miRNAs are important molecular diagnostic targets that can serve as biomarkers for disease diagnosis and progression. Current methods for miRNA detection, however, are error-prone. PCR-based methods, including RT-qPCR and digital droplet PCR (ddPCR), require careful design of primers and probes that accommodate both the small size of miRNA (17-26nt) and the sequence similarity within miRNA families. The modifications involved in the reverse transcription to cDNA (use of stem-loop primers and poly-A tailing to increase the length of the product) often introduce error and reduce the reliability and repeatability of the assay. Furthermore, these methods are restricted to known miRNAs. RT-qPCR and ddPCR methods have a similar sensitivity, with a limit of detection ranging from 0.25 to 8 cDNA copies / uL for RT-qPCR and 1 .25 to 2 cDNA copies / uL for ddPCR. However, the true limit of detection of miRNA copies depends on the efficiency of the reverse transcription step. Ultimately PCR-based strategies are limited by the efficiency and specificity of the RNA purification and reverse transcription steps.
[0007] Next-generation sequencing is an alternate strategy for identifying and quantifying miRNAs, with the added potential for miRNA discovery. However, it is similarly flummoxed by the need to extract, purify, and reverse transcribe miRNAs. Substantial error and bias can be introduced during library preparation when RNA is reverse transcribed to cDNA and amplified. Furthermore, there is no standardized approach for small RNA sequencing, making it difficult to compare relative quantification across different sequencing methods.
[0008] There is a need for a reliable strategy to directly detect, discover, and quantify short RNA sequences, including miRNAs. Compositions and methods provided herein address this need.II. SUMMARY
[0009] Provided are methods and compositions (referred to herein as split guide RNA methods and compositions) for activating a CRISPR-Cas effector protein with aAtty Docket No.: BERK-527WO nucleic acid of interest. This includes contacting a capture nucleic acid (capNucleicAcid) with a CRISPR-Cas effector protein and a CRISPR-Cas guide RNA in the presence of a nucleic acid of interest (referred to as an activating nucleic acid (actNucleicAcid)) (e.g., a DNA of interest / activating DNA (actDNA) or an RNA of interest / activating RNA (actRNA)). For an illustration of an example embodiment, refer to the “split guide system” depicted in FIG. 2A.
[0010] The provided compositions and methods can provide an alternate strategy to detect short nucleic acid sequences, e.g., RNAs, e.g., <21 nucleotides (nt) (e.g., miRNAs) that does not use the traditional paradigm of CRISPR-Cas-based nucleic acid detection. Instead, the guide RNA (gRNA) is split (see, e.g., FIG. 1 D and FIG 2A), and the nucleic acid sequence being detected (referred to herein as an “activating nucleic acid” or “actNucleicAcid”, e.g., an “activating RNA” or “actRNA”, or an “activating DNA” or “actDNA”) acts as if it were the 3’ end of a traditional guide RNA. The sequence of the actNucleicAcid being detected is small (e.g., can detect short RNAs such as miRNAs) with lengths as small as 8 nt. In other words, the guide RNA has a shorter targeting sequence (guide sequence - also referred to herein as a seed sequence) than what is normally used with CRISPR-Cas systems, and the actNucleicAcid (e.g., ‘activating RNA’) acts as the remainder of the guide sequence - thus, the guide RNA has been split into two parts: a guide RNA with a truncated guide sequence, and an actNucleicAcid. The capNucleicAcid (e.g., a capture RNA (capRNA) or capture DNA (capDNA)) (which is in some cases a user provided nucleic acid) takes the place of the RNA or DNA that is targeted by traditional CRISPR-Cas systems. The capNucleicAcid includes two regions: an anchor region that hybridizes to the guide RNA, and a capture region, which hybridizes to the actNucleicAcid. Thus, the capNucleicAcid provides a landing pad - a sequence that can be targeted by traditional CRISPR-Cas systems - however, the guide sequence of the guide RNA (the split guide RNA) only hybridizes to part of that targeted sequence - the actNucleicAcid hybridizes to the remainder.
[0011] Thus, this strategy uses a CRISPR-Cas effector protein (e.g., a Cas13 protein, a Cas12 protein, and the like, e.g., a Cas13a protein), a split gRNA, and a sequencespecific capture nucleic acid (capNucleicAcid) (e.g., a capture RNA (capRNA) or capture DNA (capDNA)) to detect the actNucleicAcid. The split gRNA and actNucleicAcid (which together function as if they were a traditional guide RNA) hybridize to (e.g., are fully complemented by) the capNucleicAcid (e.g., capRNA), which plays the role of a targeted nucleic acid (e.g., RNA or DNA) in a traditional CRISPR-Cas system. The portion of the capNucleicAcid that hybridizes to the split gRNA is referred to as the “anchor region”, and the portion of the capNucleicAcidAtty Docket No.: BERK-527WO that hybridizes to the actNucleicAcid is referred to as the “capture region” (see FIG. 2A).
[0012] In some embodiments, it is the actNucleicAcid (e.g., actRNA or actDNA) that is the limiting component. In the absence of the actNucleicAcid, the CRISPR-Cas effector protein is not activated. In the presence of the actNucleicAcid, the CRISPR-Cas effector protein is activated. A subject CRISPR-Cas effector protein has transcleavage activity (also referred to in the art as collateral cleavage activity). As such, in the presence of all the components (the guide RNA, the actNucleicAcid, and the capNucleicAcid), the trans-cleavage activity of the CRISPR-Cas effector protein is activated. In other words, in the presence of the actNucleicAcid, the trans- cleavage activity of the CRISPR-Cas effector protein is activated. Thus, the present disclosure provides a method of detecting a nucleic acid (e.g., RNA or DNA) in a sample. In some cases, the sample is a cell-free sample. In some cases, the sample comprises cells. In some cases, the sample comprises a cell lysate.
[0013] When configuring the system to detect a desired actNucleicAcid (e.g, actRNA or actDNA), the sequences of the split gRNA and the anchor region of the capNucleicAcid (e.g., capRNA, capDNA), which hybridize to one another, can remain constant. It is the capture region of the capNucleicAcid that can be changed such that it includes a sequence that is perfectly complementary to the desired actNucleicAcid. If a given sample includes the desired actNucleicAcid (e.g., a particular miRNA of interest), contacting the sample with the system (the split gRNA, the capNucleicAcid, the CRISPR-Cas effector protein, e.g., Cas13a protein) will lead to activation of the trans cleavage activity of the CRISPR-Cas effector protein. When a detector nucleic acid is also included, the CRISPR-Cas effector protein can then cleave the detector nucleic acid to generate a detectable signal. The split guide system extends the lower-length range of detectable sequences to 8nt, while maintaining the sensitivity and specificity of a full-length guide system.
[0014] Reagents, compositions, and kits / systems that find use in practicing the subject methods are provided.III. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.Atty Docket No.: BERK-527WO
[0016] FIG. 1A-1D demonstrate Cas13a is activated by ssRNA <20 nucleotides in length with a split gRNA.
[0017] FIG. 2A-2E demonstrate Cas13a detection of 10 nucleotide ssRNA with a split guide system.
[0018] FIG. 3A-3C demonstrate activity of a split guide system across a range of RNA lengths and sequences.
[0019] FIG. 4A-4C demonstrate that activity of a split guide system is specific against RNA mismatches and misalignments.
[0020] FIG. 5A-5F demonstrate detection of endogenous cellular miRNA with a split guide system.
[0021] FIG. 6A-6B demonstrate detection of target RNAs of varying lengths and at varying concentrations with a split guide system.
[0022] FIG. 7A-7D depict activity of a split guide system with varying concentrations, species, and lengths of capRNAs.
[0023] FIG. 8 depicts predicted structures for a split gRNA-capRNA complex with varying capRNAs.
[0024] FIG. 9A-9D depict activity of a split guide system with various combinations of anchor lengths, actRNA lengths, and capRNA lengths.
[0025] FIG. 10A-10E depict a comparison of two sequence-unique split guide systems.
[0026] FIG. 11 A-11 B demonstrate mismatch sensitivity of a split guide system and detection of target actRNA in a total cell RNA background, respectively.
[0027] FIG. 12 depicts a histogram of showing the length distribution of validated human miRNAs.
[0028] FIG. 13 depicts predicted structures for a split gRNA-capRNA complex with varying capRNAs targeting different cellular miRNAs.
[0029] FIG. 14A-14C demonstrate detection of Influenza A viral RNA with a split guide system.IV. DEFINITIONS
[0030] The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, terms “polynucleotide” and “nucleic acid” encompass single-stranded DNA; double-stranded DNA; multi-stranded DNA; single-stranded RNA; double-stranded RNA; multi-stranded RNA; genomic DNA; cDNA; DNA-RNAAtty Docket No.: BERK-527WO hybrids; and a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
[0031] By "hybridizable" or “complementary” or “substantially complementary" it is meant that a nucleic acid (e.g. RNA, DNA) comprises a sequence of nucleotides that allows it to non-covalently bind, i.e. form Watson-Crick base pairs and / or G / U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine / adenosine) (A) pairing with thymidine / thymidine (T), A pairing with uracil / uridine (U), and guanine / guanosine) (G) pairing with cytosine / cytidine (C). In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization of a DNA molecule with an RNA molecule (e.g., when a DNA target nucleic acid base pairs with a guide RNA, etc.): G can also base pair with U. For example, G / U base-pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. Thus, in the context of this disclosure, a G (e.g., of a proteinbinding segment (e.g., dsRNA duplex) of a guide RNA molecule; of a target nucleic acid (e.g., target DNA) base pairing with a guide RNA) is considered complementary to both a U and to C. For example, when a G / U base-pair can be made at a given nucleotide position of a protein-binding segment (e.g., dsRNA duplex) of a guide RNA molecule, the position is not considered to be non- complementary, but is instead considered to be complementary.
[0032] Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. Typically, the length for a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).
[0033] It is understood that the sequence of a polynucleotide need not be 100% complementary (i.e., perfect complementarity) to that of its target nucleic acid to be specifically hybridizable - although in some embodiments nucleic acids are 100%Atty Docket No.: BERK-527WO complementary to one another. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure, a ‘bulge’, and the like). A polynucleotide can comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it will hybridize. For example, an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. The remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method. Example methods include BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656) or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), e.g., using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981 , 2, 482-489).
[0034] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
[0035] "Binding" as used herein (e.g. with reference to an RNA-binding domain of a polypeptide, binding to a target nucleic acid, and the like) refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid; between a guide RNA and a target nucleic acid; and the like). While in a state of non-covalent interaction, the macromolecules are said to be “associated” or “interacting” or “binding” (e.g., when a molecule X is said to interact with a molecule Y, it is meant the molecule X binds to molecule Y in a non-covalent manner). Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), but some portions of a binding interaction may be sequence-specific. Binding interactions are generally characterized by a dissociation constant (Kd) of less than 106M, less than 107M, less than 108M, less than 109M, less than 1010M, less than 1011M, less than 10Atty Docket No.: BERK-527WO12M, less than 1013M, less than 1014M, or less than 1015M. "Affinity" refers to the strength of binding, increased binding affinity being correlated with a lower Kd.
[0036] By "binding domain" it is meant a protein domain that is able to bind non-covalently to another molecule. A binding domain can bind to, for example, an RNA molecule (an RNA-binding domain) and / or a protein molecule (a protein-binding domain). In the case of a protein having a protein-binding domain, it can in some cases bind to itself (to form homodimers, homotrimers, etc.) and / or it can bind to one or more regions of a different protein or proteins.
[0037] The term "conservative amino acid substitution" refers to the interchangeability in proteins of amino acid residues having similar side chains. For example, a group of amino acids having aliphatic side chains consists of glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains consists of serine and threonine; a group of amino acids having amide containing side chains consisting of asparagine and glutamine; a group of amino acids having aromatic side chains consists of phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains consists of lysine, arginine, and histidine; a group of amino acids having acidic side chains consists of glutamate and aspartate; and a group of amino acids having sulfur containing side chains consists of cysteine and methionine. Exemplary conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysinearginine, alanine-valine-glycine, and asparagine-glutamine. Coded amino acids (followed in parentheses by their corresponding three-letter codes and one-letter codes) include: alanine (Ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D), cysteine (Cys; C), glutamic acid (Glu; E), glutamine (Gin; Q), glycine (Gly; G), histidine (His; H), isoleucine (He; I), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F); proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y), or valine (Vai; V).
[0038] A polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same, and in the same relative position, when comparing the two sequences. Sequence identity can be determined in a number of different ways. To determine sequence identity, sequences can be aligned using various methods and computer programs (e.g., BLAST, T-COFFEE, MUSCLE, MAFFT, Phyre2, etc.), available over the world wide web at sites including ncbi.nlm.nili.gov / BLAST, ebi.ac.uk / Tools / msa / tcoffee / , ebi.ac.uk / Tools / msa / muscle / , mafft.cbrc.jp / alignment / software / ,Atty Docket No.: BERK-527WO http: / / www.sbg.bio.ic.ac.uk / ~phyre2 / . See, e.g., Altschul et al. (1990), J. Mol. Bioi. 215:403-10.
[0039] The terms "DNA regulatory sequences," "control elements," and "regulatory elements," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and / or regulate transcription of a non-coding sequence (e.g., guide RNA) or a coding sequence (e.g., protein coding) and / or regulate translation of an encoded polypeptide.
[0040] As used herein, a "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding or non-coding sequence. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes. Various promoters, including inducible promoters, may be used to drive the various nucleic acids (e.g., vectors) of the present disclosure.
[0041] The term "naturally-occurring" or “unmodified” or “wild type” as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature.
[0042] "Recombinant," as used herein, means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and / or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems. DNA sequences encoding polypeptides can be assembled from cDNA fragments or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system. Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of non-translated DNA may be present 5' or 3' from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms (see "DNA regulatory sequences", above). Alternatively, DNA sequences encoding RNA (e.g., guide RNA) that is not translated may also be considered recombinant. Thus, e.g., the term "recombinant" nucleic acid refers to one which is not naturally occurring, e.g, is made by the artificial combination of two otherwise separated segments of sequence through human intervention. ThisAtty Docket No.: BERK-527WO artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a codon encoding the same amino acid (e.g., codon optimization), a conservative amino acid, or a non-conservative amino acid. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. When a recombinant polynucleotide encodes a polypeptide, the sequence of the encoded polypeptide can be naturally occurring (“wild type”) or can be a variant (e.g., a mutant) of the naturally occurring sequence. Thus, the term "recombinant" polypeptide does not necessarily refer to a polypeptide whose sequence does not naturally occur. Instead, a “recombinant” polypeptide is encoded by a recombinant DNA sequence, but the sequence of the polypeptide can be naturally occurring (“wild type”) or non-naturally occurring (e.g., a variant, a mutant, etc.). Thus, a "recombinant" polypeptide is the result of human intervention, but may have a naturally occurring amino acid sequence.
[0043] A "vector" or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, i.e. an “insert”, may be attached so as to bring about the replication of the attached segment in a cell.
[0044] An “expression cassette” comprises a DNA coding sequence operably linked to a promoter. "Operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression (the coding sequence can also be said to be operably linked to the promoter).
[0045] The terms “recombinant expression vector,” or “DNA construct” are used interchangeably herein to refer to a DNA molecule comprising a vector and one insert. Recombinant expression vectors are usually generated for the purpose of expressing and / or propagating the insert(s), or for the construction of other recombinant nucleotide sequences. The insert(s) may or may not be operably linked to a promoter sequence and may or may not be operably linked to DNA regulatory sequences.
[0046] “Heterologous,” as used herein, refers to a nucleotide or polypeptide sequence that is not found in the native nucleic acid or protein, respectively. For example, a CRISPR-Cas effector protein can be fused to an active domain from a nonAtty Docket No.: BERK-527WOCRISPR-Cas effector protein (e.g., a histone deacetylase), and the sequence of the active domain could be considered a heterologous polypeptide (it is heterologous to the CRISPR-Cas effector protein). As another example, a guide sequence of a guide RNA can be heterologous to the protein-binding sequence (a scaffold) of the guide RNA - as such, the guide sequence is not found in nature together with the protein-binding sequence (the scaffold).
[0047] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001 ); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference.
[0048] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0049] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0050] Certain ranges are presented herein with numerical values being preceded by the term "about." The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to orAtty Docket No.: BERK-527WO approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.
[0051] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are now described.
[0052] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
[0053] It is noted that, as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. As such, the articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the polypeptide” includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
[0054] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. For example, it is appreciated that certain features of the invention, which are, forAtty Docket No.: BERK-527WO clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.
[0055] While the apparatus and method has or will be described for the sake of grammatical fluidity with functional explanations, it is to be expressly understood that the claims, unless expressly formulated under 35 U.S.C. §112, are not to be construed as necessarily limited in any way by the construction of "means" or "steps" limitations, but are to be accorded the full scope of the meaning and equivalents of the definition provided by the claims under the judicial doctrine of equivalents, and in the case where the claims are expressly formulated under 35 U.S.C. §112 are to be accorded full statutory equivalents under 35 U.S.C. §112.V. DETAILED DESCRIPTION
[0056] As noted above, provided are methods and compositions (referred to herein as split guide RNA methods and compositions) for activating a CRISPR-Cas effector protein with a nucleic acid of interest. This includes contacting a capture nucleic acid (capNucleicAcid) with a CRISPR-Cas effector protein and a CRISPR-Cas guide RNA in the presence of a nucleic acid of interest (referred to as an activating nucleic acid (actNucleicAcid)) (e.g., a DNA of interest / activating DNA (actDNA) or an RNA of interest / activating RNA (actRNA)). For an illustration of an example embodiment, refer to the “split guide system” depicted in FIG. 2A.
[0057] The provided compositions and methods can provide an alternate strategy to detect short nucleic acid sequences, e.g., RNAs, e.g., <21 nucleotides (nt) (e.g., miRNAs) that does not use the traditional paradigm of CRISPR-Cas-based nucleic acid detection. Instead, the guide RNA (gRNA) is split (see, e.g., FIG. 1 D and FIG 2A), and the nucleic acid sequence being detected (referred to herein as an “activating nucleic acid” or “actNucleicAcid”, e.g., an “activating RNA” or “actRNA”, or an “activating DNA” or “actDNA”) acts as if it were the 3’ end of a traditional guide RNA. The sequence of the actNucleicAcid being detected is small (e.g., canAtty Docket No.: BERK-527WO detect short RNAs such as miRNAs) with lengths as small as 8 nt. In other words, the guide RNA has a shorter targeting sequence (guide sequence - also referred to herein as a seed sequence) than what is normally used with CRISPR-Cas systems, and the actNucleicAcid (e.g., ‘activating RNA’) acts as the remainder of the guide sequence - thus, the guide RNA has been split into two parts: a guide RNA with a truncated guide sequence, and an actNucleicAcid. The capNucleicAcid (e.g., a capture RNA (capRNA) or capture DNA (capDNA)) (which is in some cases a user provided nucleic acid) takes the place of the RNA or DNA that is targeted by traditional CRISPR-Cas systems. The capNucleicAcid includes two regions: an anchor region that hybridizes to the guide RNA, and a capture region, which hybridizes to the actNucleicAcid. Thus, the capNucleicAcid provides a landing pad - a sequence that can be targeted by traditional CRISPR-Cas systems - however, the guide sequence of the guide RNA (the split guide RNA) only hybridizes to part of that targeted sequence - the actNucleicAcid hybridizes to the remainder.
[0058] Thus, this strategy uses a CRISPR-Cas effector protein (e.g., a Cas13 protein, a Cas12 protein, and the like, e.g., a Cas13a protein), a split gRNA, and a sequencespecific capture nucleic acid (capNucleicAcid) (e.g., a capture RNA (capRNA) or capture DNA (capDNA)) to detect the actNucleicAcid. The split gRNA and actNucleicAcid (which together function as if they were a traditional guide RNA) hybridize to (e.g., are fully complemented by) the capNucleicAcid (e.g., capRNA), which plays the role of a targeted nucleic acid (e.g., RNA or DNA) in a traditional CRISPR-Cas system. The portion of the capNucleicAcid that hybridizes to the split gRNA is referred to as the “anchor region”, and the portion of the capNucleicAcid that hybridizes to the actNucleicAcid is referred to as the “capture region” (see FIG. 2A).
[0059] In some embodiments, it is the actNucleicAcid (e.g., actRNA or actDNA) that is the limiting component. In the absence of the actNucleicAcid, the CRISPR-Cas effector protein is not activated. In the presence of the actNucleicAcid, the CRISPR-Cas effector protein is activated. A subject CRISPR-Cas effector protein has transcleavage activity (also referred to in the art as collateral cleavage activity). As such, in the presence of all the components (the guide RNA, the actNucleicAcid, and the capNucleicAcid), the trans-cleavage activity of the CRISPR-Cas effector protein is activated. In other words, in the presence of the actNucleicAcid, the trans- cleavage activity of the CRISPR-Cas effector protein is activated. Thus, the present disclosure provides a method of detecting a nucleic acid (e.g., RNA or DNA) in a sample. In some cases, the sample is a cell-free sample. In some cases, the sample comprises cells. In some cases, the sample comprises a cell lysate.Atty Docket No.: BERK-527WO
[0060] When configuring the system to detect a desired actNucleicAcid (e.g., actRNA or actDNA), the sequences of the split gRNA and the anchor region of the capNucleicAcid (e.g., capRNA, capDNA), which hybridize to one another, can remain constant. It is the capture region of the capNucleicAcid that can be changed such that it includes a sequence that is perfectly complementary to the desired actNucleicAcid. If a given sample includes the desired actNucleicAcid (e.g., a particular miRNA of interest), contacting the sample with the system (the split gRNA, the capNucleicAcid, the CRISPR-Cas effector protein, e.g., Cas13a protein) will lead to activation of the trans cleavage activity of the CRISPR-Cas effector protein. When a detector nucleic acid is also included, the CRISPR-Cas effector protein can then cleave the detector nucleic acid to generate a detectable signal. The split guide system extends the lower-length range of detectable sequences to 8nt, while maintaining the sensitivity and specificity of a full-length guide system.Capture Nucleic Acid (capNucleicAcid)
[0061] A capture Nucleic Acid (capNucleicAcid) includes an anchor region and a capture region. The anchor region hybridizes to the guide RNA (the guide sequence of the guide RNA), while the capture region hybridizes to the nucleic acid of interest (actNucleicAcid). When designing a capNucleicAcid to hybridize to a new / different actNucleicAcid, the anchor region can remain constant, as can the guide sequence of the guide RNA - it is the capture region that is changed in order to hybridize to (or ‘capture’) to different nucleic acid targets of interest (actNucleicAcids). In some cases, the capture region is positioned 5’ of the anchor region (see, e.g., FIG. 2A). In some cases, the capture region is positioned 3’ of the anchor region.
[0062] In some cases, the capNucleicAcid is an RNA (capRNA), e.g., a single stranded RNA (ssRNA). In some cases, the capNucleicAcid is a DNA (capDNA), e.g., a single stranded DNA (ssDNA). In some cases, the capNucleicAcid is a double stranded DNA (dsDNA) (e.g., a Cas12a protein can recognize dsDNA as a target). In such cases, a PAM sequence can be taken into account and included into the capDNA.
[0063] In some cases, the anchor region of the capNucleicAcid (e.g., capRNA) is 9-12 nt long (e.g., 9-11 , 9-10, 10-12, 10-11 , 11-12 nt). In some cases, the anchor region of the capNucleicAcid (e.g., capRNA) is 10-11 nt long. In some cases, the anchor region of the capNucleicAcid (e.g., capRNA) is 9 nt long. In some cases, the anchor region of the capNucleicAcid (e.g., capRNA) is 10 nt long. In some cases,Atty Docket No.: BERK-527WO the anchor region of the capNucleicAcid (e.g., capRNA) is 11 nt long. In some cases, the anchor region of the capNucleicAcid (e.g., capRNA) is 12 nt long.
[0064] In some cases, the capture region of the capNucleicAcid (e.g., capRNA) is 10-21 nt long (e.g., 10-20, 10-18, 10-16, 10-15, 10-14, 10-12, 12-21 , 12-20, 12-18, 12-16, 12-15, 12-14, 14-21 , 14-20, 14-18, 14-16, 14-15, 10-20, 10-18, 10-16, 10-15, IQ- 14, 10-12 nt). In some cases, the capture region of the capNucleicAcid (e.g., capRNA) is about 10 nt long. In some cases, the capture region of the capNucleicAcid (e.g., capRNA) is about 15 nt long. In some cases, the capture region of the capNucleicAcid (e.g., capRNA) is about 20 nt long.
[0065] The capNucleicAcid (e.g., capRNA) can be any convenient length. In some embodiments, the capNucleicAcid (e.g., capRNA) is 20-45 nt long (e.g., 20-40, 20- 35, 20-30, 20-25, 25-45, 25-40, 25-35, 25-30, 30-45, 30-40, 30-35, 35-45, or 35-40 nt). In some embodiments, the capNucleicAcid (e.g, capRNA) is 30-40 nt long (e.g., 30-35 or 35-40 nt).
[0066] A subject capNucleicAcid (e.g., capRNA) can include a 5’ tail region (e.g., in some cases positioned 5’ of the capture region). In some cases, the 5’ tail region is 1-12 nt long (e.g., 1 -10, 1 -8, 1-6, 1 -5, 1-3, 2-12, 2-10, 2-8, 2-6, 4-12, 4-10, 4-8, 4-5, 5-12, 5-10, 5-8, 7-12, 7-10, 7-8, 8-12, 8-10, 10-12 nt). In some cases, the 5’ tail region is3-7 nt long.
[0067] A subject capNucleicAcid (e.g., capRNA) can include a 3’ region (e.g., in some cases positioned 3’ of the anchor region). In some cases, the 3’ region is 1-10 nt long (e.g., 1 -8, 1 -6, 1-5, 1 -3, 2-10, 2-8, 2-6, 2-4, 3-10, 3-8, 3-6, 3-5, 4-10, 4-8, 4-6,4-5, 5-10, 5-8, 5-7, 6-10, 6-8 nt). In some cases, the 3’ region is 3-5 nt long. In some cases, the 3’ region is 3 nt long. In some cases, the 3’ region is 4 nt long. In some cases, the 3’ region is 5 nt long.Guide RNA
[0068] A nucleic acid that binds to and thereby forms a ribonucleoprotein (RNP) complex with a CRISPR-Cas effector protein and targets the complex to a specific location within a target nucleic acid (the capNucleicAcid in the context of the present disclosure) is referred to herein as a “guide RNA” or “CRISPR-Cas guide nucleic acid” or “CRISPR-Cas guide RNA” or simply a “guide.” It is to be understood that in some cases, a hybrid DNA / RNA can be made such that guide RNA suitable for use in a complex with a CRISPR-Cas effector protein includes DNA bases in addition to RNA bases, but the term “guide RNA” is still used to encompass such a hybrid molecule herein. A guide RNA can be referred to by the protein to which itAtty Docket No.: BERK-527WO corresponds. For example, when a CRISPR-Cas effector protein is a Cas12 protein, the corresponding guide RNA can be referred to as a “Cas12 guide RNA.” Likewise, as another example, when a CRISPR-Cas effector protein is a Cas13 protein, the corresponding guide RNA can be referred to as a “Cas13 guide RNA.”
[0069] A subject guide RNA (e.g., a Cas13 guide RNA, a Cas12 guide RNA) (also in some cases referred to as a “crRNA”, e.g., Cas13 crRNA, Cas12 crRNA) includes a “guide sequence” (also referred to as a spacer, or a targeting sequence) and a “scaffold” (also referred to as a direct repeat (DR), handle, protein-binding region, or constant region). The scaffold is 5’ or 3’ of the guide sequence, depending on which type of CRISPR-Cas protein the guide RNA associates with). For Cas13a, the scaffold is 5’ of the guide sequence.Guide sequence
[0070] The guide sequence of has complementarity with (hybridizes to) a target sequence of a target nucleic acid. In the present disclosure, the target sequence with which the guide sequence hybridizes is the anchor region of the capNucleicAcid (e.g., capRNA or capDNA). In some cases, the base of the target RNA that is immediately 3’ of the target sequence (protospacer) is not a G. In some cases, the three bases of the target nucleic acid that are immediately 3’ of the target sequence (protospacer) are NAN or NNA, where N is any nucleotide. In some embodiments, the base of the target sequence that is immediately 5’ of the target sequence (protospacer) is A, U, or G.
[0071] The guide sequence of a subject split guide RNA system is in general shorter than the guide sequence of a standard guide RNA (which is usually about 20 nt long). In some embodiments, the guide sequence is 8-15 nucleotides (nt) long (e.g., 8-14, 8- 13, 8-12, 8-11 , 8-10, 8-9, 9-15, 9-14, 9-13, 9-12, 9-11 , 9-10, 10-15, 10-14, 10-13, 10-12, 10-11 , 11-15, 11 -14, 11-13, 11 -12, 12-15, 12-14, 12-13, 13-15, 13-14, or 14- 15 nt). In some embodiments, the guide sequence is 9-11 nt long (e.g., 9-10, 10-11 nt). In some cases, the guide sequence is 9 nt long. In some cases, the guide sequence is 10 nt long. In some cases, the guide sequence is 11 nt long.
[0072] In some cases, the guide sequence has 80% or more (e.g., 85% or more, 90% or more, 95% or more, or 100% complementarity) with the target sequence of the anchor region of the capNucleicAcid. In some cases, the guide sequence is 100% complementary to the anchor region of the capNucleicAcid.ScaffoldAtty Docket No.: BERK-527WO
[0073] Examples of crRNA repeat sequences (also known as the scaffold) for Cas12a proteins include:LbCas12a crRNA:5’ AAUUUCUACUAAGUGUAGAU 3’ (SEQ ID NO: 246) - [spacer] AsCas12a crRNA:5’ AAUUUCUACUCUUGUAGAU 3’ (SEQ ID NO: 247) - [spacer] FnCas12a crRNA:5’ AAUUUCUACUGUUGUAGAU 3’ (SEQ ID NO: 248) - [spacer] PmCas12a crRNA:5’ AAUUUCUACUAUUGUAGAU 3’ (SEQ ID NO: 249) - [spacer] MbCasI 2a / Mb2Cas12a / Mb3Cas12a crRNA:5’ AAUUUCUACUGUUUGUAGAU 3’ (SEQ ID NO: 250) - [spacer] TsCas12a crRNA5’ AAUUUCUACUGUUGUAGAU 3’ (SEQ ID NO: 251 ) - [spacer] BsCas12a crRNA5’ AAUUUCUACUAUUGUAGAU 3’ (SEQ ID NO: 252) - [spacer]
[0074] In some cases, the scaffold of a guide RNA comprises a nucleotide sequence having 70% or more (e.g., 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100%) sequence identity with the nucleotide sequence of SEQ ID NO: 246. In some cases, the scaffold of a guide RNA comprises a nucleotide sequence having 85% or more (e.g., 90% or more, 95% or more, or 100%) sequence identity with the nucleotide sequence of SEQ ID NO: 246. In some cases, the scaffold of a guide RNA comprises a nucleotide sequence having 95% or more (e.g., 100%) sequence identity with the nucleotide sequence of SEQ ID NO: 246. In some cases, the scaffold of a guide RNA comprises the nucleotide sequence of SEQ ID NO: 246.
[0075] In some cases, the scaffold of a guide RNA comprises a nucleotide sequence having 70% or more (e.g., 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100%) sequence identity with the nucleotide sequence of any one of SEQ ID NOs: 246-252. In some cases, the scaffold of a guide RNA comprises a nucleotide sequence having 85% or more (e.g., 90% or more, 95% or more, or 100%) sequence identity with the nucleotide sequence of any one of SEQ ID NOs: 246-252. In some cases, the scaffold of a guide RNA comprises a nucleotide sequence having 95% or more (e.g., 100%) sequence identity with the nucleotide sequence of any one of SEQ ID NOs: 246-252. In some cases, the scaffold of aAtty Docket No.: BERK-527WO guide RNA comprises the nucleotide sequence of any one of SEQ ID NOs: 246- 252.
[0076] In some cases, the scaffold of a guide RNA is 15 or more nucleotides (nt) in length (e.g., 18 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more nt, 32 or more, 33 or more, 34 or more, or 35 or more nt in length). In some cases, the scaffold of a guide RNA is 18 or more nt in length.
[0077] In some cases, the scaffold of a guide RNA has a length in a range of from 12 to 100 nt (e.g., from 12 to 90, 12 to 80, 12 to 70, 12 to 60, 12 to 50, 12 to 40, 15 to 100, 15 to 90, 15 to 80, 15 to 70, 15 to 60, 15 to 50, 15 to 40, 15 to 30, 15 to 20, 19 to 100, 19 to 90, 19 to 80, 19 to 70, 19 to 60, 19 to 50, 19 to 40, 19 to 30, 19 to 20, 20 to 100, 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 28 to 100, 28 to 90, 28 to 80, 28 to 70, 28 to 60, 28 to 50, 28 to 40, or 28 to 30 nt). In some cases, the scaffold of a guide RNA has a length in a range of from 18-22 nt. In some cases, the scaffold of a guide RNA has a length in a range of from 19-20 nt.
[0078] In some cases, the scaffold of a guide RNA is truncated relative to (shorter than) the corresponding region of a corresponding wild type guide RNA. In some cases, the scaffold of a guide RNA is extended relative to (longer than) the corresponding region of a corresponding wild type guide RNA.
[0079] In some cases, a subject guide RNA is 30 or more nucleotides (nt) in length (e.g., 34 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more, 70 or more, or 80 or more nt in length). In some cases, the guide RNA is 35 or more nt in length. In some cases, a subject guide RNA is 30-60 nt (e.g., 30-50, 30-45, 30-40, , 35-60, 35-50, 35-45, 35-40, 40-60, 40-50, or 40-45 nt) in length.
[0080] The following sequences are each an example of a scaffold of a naturally existing Cas13a guide RNA (e.g., a scaffold that is 5’ of the guide sequence) (See, e.g., Feng et al., Anal Chem. 2023 Jan 10;95(1 ) :206-217):GUAAGAGACUACCUCUAUAUGAAAGAGGACUAAAAC (SEQ ID NO:226) (Listeria seeliger (“Lse”) (LseCas13a)GAUAUAGACCACCCCAAUAUCGAAGGGGACUAAAAC (SEQ ID NO:227) (Leptotrichia shahii) (“Lsh”) (LshCas13a)AUUUAGACCACCCCAAAAAUGAAGGGGACUAAAAC (SEQ ID NO:228)Atty Docket No.: BERK-527WO(Leptotrichia buccalis) (“Lbu”) (LbuCas13a)GACCACCCCAAAAAUGAAGGGGACUAAAAC (SEQ ID NO:229) (Leptotrichia buccalis) (“Lbu”) (LbuCas13a)GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC (SEQ ID NO:230) (LwaCas13a)GUCACAACUCCCAUGUAGGCGGAGACUGCAAC (SEQ ID NO:231 ) (TccCas13a)GGAUUUAGAGUACCCCAAAAAUGAAGGGGACUAAAAC (SEQ ID NO:232) (LtrCas13a)
[0081] In some embodiments, a subject Cas13 guide RNA includes a nucleotide sequence having 70% or more identity (e.g., 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% identity) with the sequence set forth in any one of SEQ ID NOs:226-232. In some embodiments, a subject Cas13 guide RNA includes a nucleotide sequence having 90% or more identity (e.g., 95% or more, 98% or more, 99% or more, or 100% identity) with the sequence set forth in any one of SEQ ID NOs:245-248. In some embodiments, a subject Cas13 guide RNA includes the nucleotide sequence set forth in any one of SEQ ID NOs: 226- 232.
[0082] In some embodiments, a subject Cas13 guide RNA includes a nucleotide sequence having 70% or more identity (e.g., 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% identity) with the sequence set forth in SEQ ID NO:228. In some embodiments, a subject Cas13 guide RNA includes a nucleotide sequence having 90% or more identity (e.g., 95% or more, 98% or more, 99% or more, or 100% identity) with the sequence set forth in SEQ ID NO:228. In some embodiments, a subject Cas13 guide RNA includes the nucleotide sequence set forth in SEQ ID NO:228.
[0083] In some embodiments, a subject Cas13 guide RNA includes a nucleotide sequence having 70% or more identity (e.g., 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% identity) with the sequence set forth in SEQ ID NO:229. In some embodiments, a subject Cas13 guide RNA includes a nucleotide sequence having 90% or more identity (e.g., 95% or more, 98% orAtty Docket No.: BERK-527WO more, 99% or more, or 100% identity) with the sequence set forth in SEQ ID NO:229. In some embodiments, a subject Cas13 guide RNA includes the nucleotide sequence set forth in SEQ ID NO:229.
[0084] In some cases, the constant region of a Cas13 guide RNA is 15 or more nucleotides (nt) in length (e.g., 18 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more nt, 32 or more, 33 or more, 34 or more, or 35 or more nt in length). In some cases, the constant region of a Cas13 guide RNA is 29 or more nt in length.
[0085] In some cases, the constant region of a Cas13 guide RNA has a length in a range of from 12 to 100 nt (e.g., from 12 to 90, 12 to 80, 12 to 70, 12 to 60, 12 to 50, 12 to 40, 15 to 100, 15 to 90, 15 to 80, 15 to 70, 15 to 60, 15 to 50, 15 to 40, 20 to 100, 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 28 to 100, 28 to 90, 28 to 80, 28 to 70, 28 to 60, 28 to 50, 28 to 40, 29 to 100, 29 to 90, 29 to 80, 29 to 70, 29 to 60, 29 to 50, or 29 to 40 nt). In some cases, the constant region of a Cas13 guide RNA has a length in a range of from 28 to 100 nt. In some cases, the constant region of a Cas13 guide RNA has a length in a range of from 28 to 40 nt.
[0086] In some cases, the constant region is truncated relative to (shorter than) the corresponding region of a corresponding wild type Cas13 guide RNA. For example, the mature LseCas13 guide RNA can include a constant region that is 30 nucleotides (nt) in length, and a subject truncated Cas13 guide RNA (relative to the Lse Cas13 guide RNA) can therefore have a constant region that is less than 30 nt in length (e.g., less than 29, 28, 27, 26, 25, 22, or 20 nt in length). In some cases, a truncated Cas13 guide RNA includes a constant region that has a length in a range of from 12 to 29 nt (e.g., from 12 to 28, 12 to 27, 12 to 26, 12 to 25, 12 to 22, 12 to 20, 12 to 18 nt, 14 to 29, 14 to 28, 14 to 27, 14 to 26, 14 to 25, 14 to 22, 14 to 20, 14 to 18 nt, 16 to 29, 16 to 28, 16 to 27, 16 to 26, 16 to 25, 16 to 22, 16 to 20, 16 to 18). In some cases, the truncated Cas13 guide RNA is truncated by one or more nt (e.g., 2 or more, 3 or more, 4 or more, 5 or more, or 10 or more nt), e.g., relative to a corresponding wild type Cas13 guide).
[0087] In some cases, the constant region of the Cas13 guide RNA is extended relative to (longer than) the corresponding region of a corresponding wild type Cas13 guide RNA. For example, a mature LseCas13 guide RNA can include a constant region that is 30 nucleotides (nt) in length, and an extended Cas13 guide RNA (relative to the LseCas13 guide RNA) can therefore have a constant region that is longer thanAtty Docket No.: BERK-527WO30 nt (e.g., longer than 31 , longer than 32, longer than 33, longer than 34, or longer than 35 nt). In some cases, an extended Cas13 guide RNA includes a constant region that has a length in a range of from 30 to 100 nt (e.g., from 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, or 30 to 40 nt). In some cases, the extended Cas13 guide RNA includes a constant that is extended (e.g., relative to the corresponding region of a corresponding wild type Cas13 guide RNA) by one or more nt (e.g., 2 or more, 3 or more, 4 or more, 5 or more, or 10 or more nt).
[0088] In some cases, the constant region of a Cas13 guide RNA is 15 or more nucleotides (nt) in length (e.g., 18 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more nt, 32 or more, 33 or more, 34 or more, or 35 or more nt in length). In some cases, the constant region of a Cas13 guide RNA is 29 or more nt in length.
[0089] In some cases, the constant region of a Cas13 guide RNA has a length in a range of from 12 to 100 nt (e.g., from 12 to 90, 12 to 80, 12 to 70, 12 to 60, 12 to 50, 12 to 40, 15 to 100, 15 to 90, 15 to 80, 15 to 70, 15 to 60, 15 to 50, 15 to 40, 20 to 100, 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 28 to 100, 28 to 90, 28 to 80, 28 to 70, 28 to 60, 28 to 50, 28 to 40, 29 to 100, 29 to 90, 29 to 80, 29 to 70, 29 to 60, 29 to 50, or 29 to 40 nt). In some cases, the constant region of a Cas13 guide RNA has a length in a range of from 28 to 100 nt. In some cases, the constant region of a Cas13 guide RNA has a length in a range of from 28 to 40 nt.
[0090] In some cases, a subject Cas13 guide RNA is 30 or more nucleotides (nt) in length (e.g., 34 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more, 70 or more, or 80 or more nt in length). In some cases, the Cas13 guide RNA is 35 or more nt in length.
[0091] In some cases, a subject Cas13 guide RNA has a length in a range of from 30 to 120 nt (e.g., from 30 to 110, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 35 to 120, 35 to 110, 35 to 100, 35 to 90, 35 to 80, 35 to 70, 35 to 60, 40 to 120, 40 to 110, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 50 to 120, 50 to 110, 50 to 100, 50 to 90, 50 to 80, or 50 to 70 nt). In some cases, the Cas13 guide RNA has a length in a range of from 33 to 80 nt. In some cases, the Cas13 guide RNA has a length in a range of from 35 to 60 nt.
[0092] In some cases, a subject Cas13 guide RNA is truncated relative to (shorter than) a corresponding wild type Cas13 guide RNA. For example, a mature Lse Cas13 guide RNA can be 50 nucleotides (nt) in length, and a truncated Cas13 guide RNAAtty Docket No.: BERK-527WO(relative to the Lse Cas13 guide RNA) can therefore in some cases be less than 50 nt in length (e.g., less than 49, 48, 47, 46, 45, 42, or 40 nt in length). In some cases, a truncated Cas13 guide RNA has a length in a range of from 30 to 49 nt (e.g., from 30 to 48, 30 to 47, 30 to 46, 30 to 45, 30 to 42, 30 to 40, 35 to 49, 35 to 48, 35 to 47, 35 to 46, 35 to 45, 35 to 42, or 35 to 40 nt). In some cases, the truncated Cas13 guide RNA is truncated by one or more nt (e.g., 2 or more, 3 or more, 4 or more, 5 or more, or 10 or more nt), e.g., relative to a corresponding wild type Cas13 guide).
[0093] In some cases, a subject Cas13 guide RNA is extended relative to (longer than) a corresponding wild type Cas13 guide RNA. For example, a mature Lse Cas13 guide RNA can be 50 nucleotides (nt) in length, and an extended Cas13 guide RNA (relative to the Lse Cas13 guide RNA) can therefore in some cases be longer than 50 nt (e.g., longer than 51 , longer than 52, longer than 53, longer than 54, or longer than 55 nt). In some cases, an extended Cas13 guide RNA has a length in a range of from 51 to 100 nt (e.g., from 51 to 90, 51 to 80, 51 to 70, 51 to 60, 53 to 100, 53 to 90, 53 to 80, 53 to 70, 53 to 60, 55 to 100, 55 to 90, 55 to 80, 55 to 70, or 55 to 60 nt). In some cases, the extended Cas13 guide RNA is extended (e.g., relative to a corresponding wild type Cas13 guide RNA) by one or more nt (e.g., 2 or more, 3 or more, 4 or more, 5 or more, or 10 or more nt).
[0094] As would be understood to one of ordinary skill in the art, for embodiments that take place inside of a cell, the guide RNA can be introduced into a cell as an RNA (or as a DNA / RNA hybrid) or can be introduced as a nucleic acid encoding the RNA (e.g., a DNA such as an expression vector such as a viral or plasmid DNA), in which case the cell transcribes the RNA from the introduced DNA. In some cases, the nucleotide sequence encoding the guide RNA is operably linked to a promoter (e.g., a Pol III promoter such as U6 or H1 ). A guide RNA can also be precomplexed with a CRISPR-Cas effector protein (i.e., can be used or introduced into a cell as part of an RNP).Nucleic acid modifications
[0095] In some embodiments, a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) has one or more modifications, e.g., a base modification, a backbone modification, etc., to provide the nucleic acid with a new or enhanced feature (e.g., improved stability). A nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides areAtty Docket No.: BERK-527WO nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', the 3', or the 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound; however, linear compounds are suitable. In addition, linear compounds may have internal nucleotide base complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
[0096] As used herein, the term “2'-modified” or “2'-substituted” means a sugar comprising a substituent at the 2'-position other than H or OH. 2'-modified nucleotides, include moieties with 2' substituents selected from alkyl, allyl, amino, azido, fluoro, thio, O- alkyl, e.g., O-methyl, O-allyl, OCF3, O-(CH2)2-O-CH3 (e.g., 2'-O-methoxyethyl (MOE)), O-(CH2)2SCH3, )-(CH2)2-ONR2, and O-CH2C(O)-NR2, where each R is independently selected from H, alkyl, and substituted alkyl.
[0097] Suitable nucleic acid modifications include, but are not limited to: 2’Omethyl modified nucleotides, 2’ fluoro modified nucleotides, locked nucleic acid (LNA) modified nucleotides, peptide nucleic acid (PNA) modified nucleotides, nucleotides with phosphorothioate linkages, and a 5' cap (e.g., a 7-methylguanylate cap (m7G)). Additional details and additional modifications are described below.
[0098] A 2'-O-Methyl modified nucleotide (also referred to as 2'-O-Methyl RNA) is a naturally occurring modification of RNA found in tRNA and other small RNAs that arises as a post-transcriptional modification. Oligonucleotides can be directly synthesized that contain 2'-O-Methyl RNA. This modification increases Tm of RNA:RNA duplexes but results in only small changes in RNA:DNA stability. It is stabile with respect to attack by single-stranded ribonucleases and is typically 5 to 10-fold less susceptible to DNases than DNA. It is commonly used in antisense oligos as a means to increase stability and binding affinity to the target message.
[0099] 2’ Fluoro modified nucleotides (e.g., 2' Fluoro bases) have a fluorine modified ribose which increases binding affinity (Tm) and also confers some relative nuclease resistance when compared to native RNA. These modifications are commonly employed in ribozymes and siRNAs to improve stability in serum or other biological fluids.Atty Docket No.: BERK-527WO
[0100] LNA bases have a modification to the ribose backbone that locks the base in the C3'-endo position, which favors RNA A-type helix duplex geometry. This modification significantly increases Tm and is also very nuclease resistant. Multiple LNA insertions can be placed in an oligo at any position except the 3'-end. Applications have been described ranging from antisense oligos to hybridization probes to SNP detection and allele specific PCR. Due to the large increase in Tm conferred by LNAs, they also can cause an increase in primer dimer formation as well as self-hairpin formation. In some cases, the number of LNAs incorporated into a single oligo is 10 bases or less.
[0101] The phosphorothioate (PS) bond (i.e., a phosphorothioate linkage) substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of a nucleic acid (e.g., an oligo). This modification renders the internucleotide linkage resistant to nuclease degradation. Phosphorothioate bonds can be introduced between the last 3-5 nucleotides at the 5'- or 3'-end of the oligo to inhibit exonuclease degradation. Including phosphorothioate bonds within the oligo (e.g., throughout the entire oligo) can help reduce attack by endonucleases as well.
[0102] In some cases, a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) has one or more nucleotides that are 2'-O-Methyl modified nucleotides. In some cases, a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) has one or more 2’ Fluoro modified nucleotides. In some cases, a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) has one or more LNA bases. In some cases, a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) has one or more nucleotides that are linked by a phosphorothioate bond (i.e., the guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) has one or more phosphorothioate linkages). In some cases, guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) has a 5’ cap (e.g., a 7-methylguanylate cap (m7G)). In some cases, a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) has a combination of modified nucleotides. For example, a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) can have a 5’ cap (e.g., a 7-methylguanylate cap (m7G)) in addition to having one or more nucleotides with other modifications (e.g., a 2'-O- Methyl nucleotide and / or a 2’ fluoro modified nucleotide and / or a LNA base and / or a phosphorothioate linkage).Modified backbones and modified intemucleoside linkages
[0103] Examples of suitable guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA)s containing modifications include guide RNA and / or capNucleicAcid (e.g.,Atty Docket No.: BERK-527WO capRNA or capDNA)s with modified backbones or non-natural internucleoside linkages. Guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
[0104] Suitable modified nucleic acid backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Suitable oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts (such as, for example, potassium or sodium), mixed salts and free acid forms are also included. Nucleoside subunits can be joined by a variety of intersubunit linkages, including, but not limited to, phosphodiester, phosphotriester, an alkylphosphonate, e.g., methylphosphonate, P3'^N5' phosphoramidate, N3' >P5' phosphoramidate, N3' >P5' thiophosphoramidate, phosphorodiamidate, and phosphorothioate linkages. In certain cases, intersubunit linkage has a chiral atom. Representative chiral intersubunit linkages include, but are not limited to, alkylphosphonates, phosphorodiamidates and phosphorothioates. Further, “oligonucleotides” includes chemical and biochemical modifications, such as those known to one skilled in the art, e.g., to the sugar (e.g., 2' substitutions), the base (see the definition of “nucleoside” below), and / or the 3’ and 5' termini. In embodiments where the oligonucleotide moiety includes a plurality of intersubunit linkages, each linkage may be formed using the same chemistry or a mixture of linkage chemistries may be used. In embodiments where the oligonucleotide moiety includes a plurality of intersubunit linkages, one or more of the linkages may be chiral. Linkages having a chiral atom can be prepared as racemic mixtures, or as separate enantiomers.
[0105] In some cases, a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) comprises one or more phosphorothioate and / or heteroatom internucleoside linkages, in particular -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- (known as aAtty Docket No.: BERK-527WO methylene (methylimino) or MMI backbone), -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)- N(CH3)-CH2- and -O-N(CH3)-CH2-CH2- (wherein the native phosphodiester internucleotide linkage is represented as -O-P(=O)(OH)-O-CH2-). MMI type internucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,489,677, the disclosure of which is incorporated herein by reference in its entirety. Suitable amide internucleoside linkages are disclosed in U.S. Pat. No. 5,602,240, the disclosure of which is incorporated herein by reference in its entirety.
[0106] Also suitable are nucleic acids having morpholino backbone structures as described in, e.g., U.S. Pat. No. 5,034,506. For example, in some embodiments, a subject nucleic acid comprises a 6-membered morpholino ring in place of a ribose ring. In some of these embodiments, a phosphorodiamidate or other non- phosphodiester internucleoside linkage replaces a phosphodiester linkage.
[0107] Suitable modified polynucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.Mimetics
[0108] A subject guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) can include a nucleic acid mimetic. The term "mimetic" as it is applied to polynucleotides is intended to include polynucleotides wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with non-furanose groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. One such nucleic acid, a polynucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA, the sugar-backbone of a polynucleotide is replaced with an amide containingAtty Docket No.: BERK-527WO backbone, in particular an aminoethylglycine backbone. The nucleotides are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
[0109] One polynucleotide mimetic that has been reported to have excellent hybridization properties is a peptide nucleic acid (PNA). The backbone in PNA compounds is two or more linked aminoethylglycine units which gives PNA an amide containing backbone. The heterocyclic base moieties are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that describe the preparation of PNA compounds include, but are not limited to: U.S. Pat. Nos. 5,539,082; 5,714,331 ; and 5,719,262, the disclosures of which are incorporated herein by reference in their entirety.
[0110] Another class of polynucleotide mimetic that has been studied is based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. A number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid. One class of linking groups has been selected to give a non-ionic oligomeric compound. The non-ionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins. Morpholino-based polynucleotides are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41 (14), 4503-4510). Morpholino-based polynucleotides are disclosed in U.S. Pat. No. 5,034,506, the disclosure of which is incorporated herein by reference in its entirety. A variety of compounds within the morpholino class of polynucleotides have been prepared, having a variety of different linking groups joining the monomeric subunits.
[0111] A further class of polynucleotide mimetic is referred to as cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in a DNA / RNA molecule is replaced with a cyclohexenyl ring. CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602, the disclosure of which is incorporated herein by reference in its entirety). In general the incorporation of CeNA monomers into a DNA chain increases its stability of a DNA / RNA hybrid. CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the nativeAtty Docket No.: BERK-527WO complexes. The study of incorporating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichroism to proceed with easy conformational adaptation.
[0112] A further modification includes Locked Nucleic Acids (LNAs) in which the 2'- hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2'-C,4'-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (-CH2-), group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456, the disclosure of which is incorporated herein by reference in its entirety). LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm=+3 to +10° C), stability towards 3'-exonucleolytic degradation and good solubility properties. Potent and nontoxic antisense oligonucleotides containing LNAs have been described (e.g., Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638, the disclosure of which is incorporated herein by reference in its entirety).
[0113] The synthesis and preparation of the LNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (e.g., Koshkin et al., Tetrahedron, 1998, 54, 3607-3630, the disclosure of which is incorporated herein by reference in its entirety). LNAs and preparation thereof are also described in WO 98 / 39352 and WO 99 / 14226, as well as U.S. applications 20120165514, 20100216983, 20090041809, 20060117410, 20040014959, 20020094555, and 20020086998, the disclosures of which are incorporated herein by reference in their entirety.
[0114] A “bicyclic nucleic acid” or a “bridged nucleic acid” (BNA) refers to a modified RNA nucleotide where the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon, thereby forming a bicyclic ring system. BNA monomers can contain a five-membered, six-membered or a seven-membered bridge structure with a fixed 3'-endo conformation. Bridged nucleic acids include without limitation, locked nucleic acids (LNA), ethylene-bridged nucleic acids (ENA) and constrained ethyl (cEt).
[0115] A “bridge” refers to a chain of atoms or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of a ring system (e.g., the ribose ring system) which is bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, the bridge in a BNA has 7-12 ring members and 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Unless otherwise specified, a BNA is optionally substituted with one or more substituents,Atty Docket No.: BERK-527WO e.g., including, but not limited to alkyl, substituted alkyl, alkoxy, substituted alkoxy, hydroxy, amino and halogen.
[0116] An “ethylene-bridged nucleic acid” (ENA) refers to an LNA modified RNA nucleotide where the ribose moiety is modified with an extra bridge containing two carbon atoms between the 2' oxygen and the 4' carbon (see, e.g., Morita et al., Bioorganic Medicinal Chemistry, 2003, 11 (10), 2211 -2226). Ethylene-bridged nucleic acids are also encompassed by the term “bicyclic nucleic acids” or “bridged nucleic acids” (BN A).
[0117] A “constrained ethyl (cEt)” refers to an LNA modified RNA nucleotide where the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon, wherein the carbon atom of the bridge includes a methyl group. In some cases, the cEt is (S)-constrained ethyl. In other cases, the cEt is (R)-constrained ethyl (see, e.g., Pallan et al., Chem. Commun. (Camb)., 2012, 48(66), 8195-8197). Constrained ethyl nucleic acids are also encompassed by the term “bicyclic nucleic acids” or “bridged nucleic acids” (BNA).Modified sugar moieties
[0118] A guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) can also include one or more substituted sugar moieties. Suitable polynucleotides comprise a sugar substituent group selected from: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly suitable are O((CH2)nO) mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON((CH2)nCH3)2, where n and m are from 1 to about 10. Other suitable polynucleotides comprise a sugar substituent group selected from: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A suitable modification includes 2'-methoxyethoxy (2'-O-CH2 CH2OCH3, also known as 2'-O-(2-methoxyethyl) (or 2'-MOE or 2’-O-MOE-RNA) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504, the disclosure of which is incorporated herein by reference in its entirety) i.e., an alkoxyalkoxy group. A further suitable modificationAtty Docket No.: BERK-527WO includes 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy- ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2.
[0119] Other suitable sugar substituent groups include methoxy (-O-CH3), aminopropoxy (-0 CH2 CH2 CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (-0- CH2— CH=CH2) and fluoro (F). 2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. A suitable 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.Base modifications and substitutions
[0120] A guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) may also include nucleobase (often referred to in the art simply as "base'1) modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2- amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7- deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidi ne( 1 H- pyrimido(5,4-b)(1 ,4)benzoxazin-2(3H)-one), phenothiazine cytidine (1 H- pyrimido(5,4-b)(1 ,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido(5,4-(b) (1 ,4)benzoxazin- 2(3H)-one), carbazole cytidine (2H-pyrimido(4,5-b)indol-2-one), pyridoindole cytidine (H-pyrido(3',2':4,5)pyrrolo(2,3-d)pyrimidin-2-one).Atty Docket No.: BERK-527WO
[0121] Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.1., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991 , 30, 613, and those disclosed by Sanghvi, Y.5., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993; the disclosures of which are incorporated herein by reference in their entirety. Certain of these nucleobases are useful for increasing the binding affinity of an oligomeric compound. These include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1 .2° C. (Sanghvi et al., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278; the disclosure of which is incorporated herein by reference in its entirety) and are suitable base substitutions, e.g., when combined with 2'-0-methoxyethyl sugar modifications.Conjugates
[0122] Another possible modification of a guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA) involves chemically linking to the polynucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the guide RNA and / or capNucleicAcid (e.g., capRNA or capDNA). These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Suitable conjugate groups include, but are not limited to, cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and / or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of a subject nucleic acid.Atty Docket No.: BERK-527WO
[0123] Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553- 6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053- 1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765- 2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991 , 10, 1111 -1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl- rac-glycerol or triethylammonium 1 ,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651 -3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).CRISPR-Cas Effector Proteins
[0124] CRISPR-Cas effector proteins can be from Class 1 or Class 2 CRISPR systems. The CRISPR-Cas effector protein of Class 1 CRISPR systems is a multi-subunit complex of proteins (e.g., Cas10 / Csm1 , Csm2, Csm3, Csm4, and Csm5), while the CRISPR-Cas effector protein of Class 2 CRISPR systems is a single protein that carries out the effector functions. In some cases, a CRISPR-Cas effector protein is a Class 1 CRISPR-Cas effector protein, e.g., a Type I, Type III, or Type IV CRISPR-Cas effector protein. In some cases, a CRISPR-Cas effector protein is a Class 2 CRISPR-Cas effector protein, e.g., a Type II, Type V, or Type VI CRISPR- Cas effector protein. See, e.g., Zetsche et al, Cell. 2015 Oct 22;163(3):759-71 ; Makarova et al, Nat Rev Microbiol. 2015 Nov;13(11 ):722-36; Shmakov et al., Mol Cell. 2015 Nov 5;60(3):385-97; Shmakov et al., Nat Rev Microbiol. 2017 Mar;15(3):169-182: “Diversity and evolution of class 2 CRISPR-Cas systems”; and Koonin et al., Curr Opin Microbiol. 2017 Jun:37:67-78). Class 2 CRISPR proteins include, for example, type II CRISPR-Cas proteins (e.g., Cas9), type V CRISPR- Cas proteins (e.g., Cpf1 (Cas12a), C2c1 (Cas12b), C2C3 (Cas12c), CasY (Cas12d), CasX (Cas12e), Cas 12f (also known as Cas14), and type VI CRISPR- Cas proteins (e.g., C2c2 (Cas13a), C2C7 (Cas13c), C2c6 (Cas13b), and the like.Atty Docket No.: BERK-527WOClass 2 CRISPR-Cas effector proteins include type II, type V, and type VI CRISPR- Cas proteins, but the term is also meant to encompass any class 2 CRISPR-Cas protein suitable for binding to a corresponding guide RNA and forming a ribonucleoprotein (RNP) complex.
[0125] Of particular interest in the present disclosure are CRISPR-Cas effector proteins (whether they be Class 1 or Class 2) that exhibit trans-cleavage (also referred to in the art as collateral cleavage) activity. For example, a Cas12 RNP (i.e., Cas12 protein complexed with a guide RNA) can recognize ssDNA and dsDNA with specific sequences. Hybridization between the target and guide RNA activates Cas12, and with the RuvC domain, the active Cas12 cleaves the target (cis- cleavage) and nontarget ssDNA nearby (trans-cleavage). In other words, the activated protein promiscuously cleaves single stranded target nucleic acid (e.g., ssDNAs) (i.e., the nuclease cleaves non-target single stranded target nucleic acid, e.g., ssDNAs). As another example, a Cas13 RNP (i.e., Cas13 protein complexed with a guide RNA) undergoes a conformational change upon binding to its ssRNA target, and then the HEPN1 and HEPN2 domains cleave any ssRNA indiscriminately.
[0126] The collateral cleavage of nontarget nucleic acids by active Cas12 and Cas13 systems is generally called trans-cleavage (or collateral cleavage). With the trans- cleavage activity, Cas12 and Cas13 enzymes have been used for killing cells (e.g., when activated inside of cells such as bacterial cells) and for nucleic acid target recognition, signal generation, and amplification. Upon activation by an on-target target nucleic acid (a target that hybridizes with the guide sequence of the guide RNA), CRISPR-Cas effector proteins with trans-cleavage activity (e.g., Cas12, Cas13, and the like) can cleave short single-stranded reporter oligos (labeled single stranded detector nucleic acids) through trans-cleavage, e.g., separating the fluorophore from the quencher which are typically labeled at opposite ends of the reporter molecule, and generating measurable fluorescence signals. Thus, the technology for CRISPR-based molecular detection is generally based on the specific binding to target DNA or RNA and the trans-cleavage activity against ssRNA or ssDNA that is activated by specific sequence recognition. As would be understood by one of ordinary skill in the art, the target type (RNA or DNA) being detected, e.g., in a sample, is not necessarily constant for a particular CRISPR-Cas effector protein. For example, target DNA and target RNA can be interconverted, i.e., converted to the other type (DNA to RNA, or RNA to DNA), through transcription or reverse transcription.Atty Docket No.: BERK-527WO
[0127] In some cases, the CRISPR-Cas effector protein is a Class 1 protein having transcleavage activity. In some cases, the CRISPR-Cas effector protein is Type III protein (e.g., a Csm (Type 11 IA) complex). In some cases, the CRISPR-Cas effector protein is a Csm (Type 111 A) complex. In some cases, the CRISPR-Cas effector protein is a Cmr (Type II IB) complex.
[0128] In some cases, the CRISPR-Cas effector protein is Class 2 protein having transcleavage activity. In some cases, the CRISPR-Cas effector protein is Type VI protein (e.g., a Cas13 protein). In some cases, the CRISPR-Cas effector protein is a Cas13 protein. In some cases, the CRISPR-Cas effector protein is a Cas13a protein. In some cases, the CRISPR-Cas effector protein is a Cas13b protein. In some cases, the CRISPR-Cas effector protein is a Cas13d protein. In some cases, the CRISPR-Cas effector protein is Type V protein (e.g., a Cas12 protein). In some cases, the CRISPR-Cas effector protein is a Cas12 protein. In some cases, the CRISPR-Cas effector protein is a Cas12a protein. In some cases, the CRISPR-Cas effector protein is a Cas12b protein. In some cases, the CRISPR-Cas effector protein is a Cas12c protein. In some cases, the CRISPR-Cas effector protein is a Cas12c1 protein. In some cases, the CRISPR-Cas effector protein is a Cas12d protein. In some cases, the CRISPR-Cas effector protein is a Cas12f (also known as Cas14 or Cas14a) protein. In some cases, the CRISPR-Cas effector protein is a Cas12i protein. In some cases, the CRISPR-Cas effector protein is a Cas12i2 protein. See, e.g., Huang et al., Biosensors (Basel). 2022 Sep 20;12(10):779; Feng et al., Anal Chem. 2023 Jan 10;95(1 ):206-217; He et al., Genes 2023, 14, 850; and Li et al., Front Mol Biosci. 2023 Sep 21 ;10:1260883.
[0129] As would be understood by one of ordinary skill in the art, many variant forms of CRISPR-Cas effector proteins are known in the art, e.g., those harboring mutations that increase specificity (e.g., decrease off-targeting), and any convenient variant can be used. See, e.g., Vakulskas et al., Nat Med. 2018 Aug;24(8):1216-1224; Kleinstiver et al., Nature. 2016 Jan 28;529(7587):490-5; Yuen et al., Nucleic Acids Res. 2022 Feb 22;50(3):1650-1660; Wei et al., FASEB J. 2023 Aug;37(8):e23060; Tan et al., Proc Natl Acad Sci U S A. 2019 Oct 15;116(42) :20969-20976; Kleinstiver et al., Nat Biotechnol. 2019 Mar;37(3):276-282; DeWeirdt et al., Nat. Biotechnol. 2021 39, 94-104; and Zhang et al., Nat Commun. 2021 Jun 23;12(1 ):3908.
[0130] Examples of CRISPR-Cas effector proteins will be readily available to one of ordinary skill in the art, and any convenient CRISPR-Cas effector protein can be used. In some cases, a subject CRISPR-Cas effector protein will be a Cas12aAtty Docket No.: BERK-527WO protein (e.g., Acidaminococcus sp., strain BV3L6 (AsCas12a), LbCas12a, and FnoCas12a). Sequences for these proteins are readily available to one of ordinary skill in the art. The amino acid sequence of an example wild-type Cas12a polypeptide (Acidaminococcus sp., strain BV3L6 (AsCas12a)) is provided as SEQ ID NO: 234. Other examples of Cas12a include, but are not limited to: LbCas12a and FnoCas12a, as well as AsCas12a ultra nuclease (see, e.g., Zhang et al., Nat Commun. 2021 Jun 23;12(1 ):3908).
[0131] Examples of naturally existing Cas12a proteins are set forth as SEQ ID NOs: 233- 245. In some cases, a subject Cas12 protein includes an amino acid sequence having 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100%) amino acid sequence identity with the amino acid sequence set forth in any one of SEQ ID NOs: 233-245. In some cases, a suitable Cas12 polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, amino acid sequence identity to the Cas12a amino acid sequence set forth in SEQ ID NO: 234.
[0132] A Cas13 effector protein has two HEPN (higher eukaryotes and prokaryotes nucleotide-binding) domains that provide RNase activity. The Cas13 protein, when associated with crRNA, forms an RNA-guided RNA targeting complex to recognize and cleave ssRNA targets. Based on Cas13 phylogeny, features, and functional characterization, this system is further classified into six subtypes: Vl-A (Cas13a, C2c2), Vl-B (Cas13b, C2c4), Vl-C (Cas13c, C2c7), Vl-D (Cas13d), Vl-X (Cas13X) and Vl-Y (Cas13Y). All Cas13 proteins possess two enzymatically distinct RNase activities, which include processing pre-crRNA into mature functional crRNA and the degradation of target RNA by the HEPN domains. The location of these HEPN domains differs based on the type of Cas13 proteins. In Cas13a, 13c, and 13d, the HEPN domains are present at the center and C terminus, whereas in Cas13b, Cas13X, and Y, they are located at the N-terminus and C-terminus of the proteins. The HEPN domains of Cas13 proteins can cleave not only the desired target, but also exhibit a non-specific collateral cleavage activity resulting in the degradation of the RNA near the Cas13 complex. The length of the crRNA or the spacer sequence varies (e.g., 24-30 nt) with the type of Cas13.
[0133] Cas13a has many orthologs such as Listeria seeligeri (Lse) and Leptotrichia wadei (Lwa), Leptotrichia buccalis (Lbu), and Lachnospiraceae bacterium (Lba). Wild type Cas13a CRISPR arrays typically consists of a 5' 28 nt direct repeat (DR) unique to each ortholog and a 28-30 nt spacer sequence (complementary to the targetAtty Docket No.: BERK-527WO sequence). As such, for a Cas13a guide RNA, the constant region is 5’ of the guide sequence. Some orthologs such as LshCas13a have a 3' H (non-G), a single base protospacer flanking site (PFS) preference, whereas LwaCas13a and LbuCas13a do not show any PFS preference.
[0134] Cas13b has its direct repeat (DR) on the 3' end of crRNA compared to the 5' DR present in Cas13a, Cas13c, and Cas13d. Cas13b orthologs such as Bergeyella zoohelcum (BzCas13b) and Porphyromonas gulae (PguCas13b) prefer 5' PFS of D (A, U, or G) and 3' PFS of NAN or NNA. However, Cas13b from Prevotella sp. (PspCas13b) has no PFS requirement. Cas13b is further differentiated into two types based on the presence of regulatory accessory proteins csx27 and csx28 that can repress or enhance the RNA interference activity of Cas13b, respectively.
[0135] Cas13c has its direct repeat (DR) on the 5' end of crRNA and a spacer length (e.g., 28-30 nt), similar to that of Cas13a and Cas13d. Cas13c orthologs include Fusobacterium perfoetens (FpeCas13c).
[0136] Cas13d is the smallest of Cas13a-d. The Cas13d from the Ruminococcus flavefaciens XPD3002 (CasRx / RfxCas13d) is a prominent homolog for multiple organisms. Type Vl-D has no PFS constraints like the other Cas13 enzymes.
[0137] Example naturally existing Cas13a proteins are set forth as SEQ ID NOs: 1 -66 (see Table 1 ). In some cases, a subject Cas13 protein includes an amino acid sequence having 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100%) amino acid sequence identity with the amino acid sequence set forth in any one of SEQ ID NOs: 1 -66 . In some cases, a suitable Cas13 polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, amino acid sequence identity to the Leptotrichia buccalis Cas13a amino acid sequence set forth in SEQ ID NO: 1 .
[0138] Example naturally existing Cas13b proteins are set forth as SEQ ID NOs: 67-200 (see Table 1 ). In some cases, a subject Cas13b protein includes an amino acid sequence having 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100%) amino acid sequence identity with the amino acid sequence set forth in any one of SEQ ID NOs: 67-200.
[0139] Example naturally existing Cas13c proteins are set forth as SEQ ID NOs: 201 -212. In some cases, a subject Cas13c protein includes an amino acid sequence having 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100%) amino acid sequence identity with the amino acid sequence set forth in any one of SEQ ID NOs: 201 -212.Atty Docket No.: BERK-527WO
[0140] Example naturally existing Cas13d proteins are set forth as SEQ ID NOs: 213-224. In some cases, a subject Cas13d protein includes an amino acid sequence having 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100%) amino acid sequence identity with the amino acid sequence set forth in any one of SEQ ID NOs: 213-224.
[0141] Table 1 : Examples of naturally existing Cas13 proteinsAtty Docket No.: BERK-527WOAtty Docket No.: BERK-527WOAtty Docket No.: BERK-527WOAtty Docket No.: BERK-527WO
[0142] In some cases, the CRISPR-Cas effector protein is a Class 1 protein (i.e., a multisubunit protein). In some such cases, the CRISPR-Cas effector protein is a Type III CRISPR-Cas effector polypeptide. As such, in some cases, the CRISPR-Cas effector polypeptide is a multi-subunit Type 111 A CRISPR-Cas effector polypeptide comprising Cas10 / Csm1 , Csm2, Csm3, Csm4, and Csm5 polypeptides. The natural multiprotein Csm complex comprises the five subunits (Csm1 -5) in varying stoichiometries and relies on an additional protein, Cas6, for processing the precursor crRNA. In some cases, the CRISPR-Cas effector polypeptide is a multisubunit Type 11 IB CRISPR-Cas effector polypeptide comprising Cmr1 , Cmr2, Cmr3,Atty Docket No.: BERK-527WOCmr4, Cmr5, and Cmr6 subunits. In other cases, the Class 1 CRISPR system will be a Type I CRISPR-Cas effector polypeptide comprising Cas7.Methods
[0143] The present disclosure provides methods of activating a CRISPR-Cas effector protein with a nucleic acid of interest (actNucleicAcid). As discussed elsewhere herein, such methods generally include contacting a capNucleicAcid (described herein) with a CRISPR-Cas effector protein (described herein) and a CRISPR-Cas guide RNA (described herein) in the presence of a nucleic acid of interest (actNucleicAcid) (described herein). In some cases, such a method is a method of detecting a nucleic acid of interest in a sample. Such a method usually takes place outside of a cell (i.e. , not inside of a cell).
[0144] In some embodiments, the contacting takes place inside of a cell that includes the actNucleicAcid. Such methods can be used, e.g., as a way to kill cells, but only those cells that include actNucleicAcid. For example, if cancerous cells express a particular miRNA that is not expressed in non-cancerous cells, then introduction of components of a split guide RNA system as disclosed herein can be used to specifically target the cancer cells for killing. This is because the activated transcleavage activity of the CRISPR-Cas effector protein (e.g., Cas13a, Cas12a, and the like) (only in cells expressing the actNucleicAcid) will indiscriminately cleave single stranded nucleic acids, e.g., mRNAs, in the cell. As another example, in a similar manor, the split guide system can be used to target prokaryotic cells (those expressing a particular actNucleicAcid) for death.
[0145] Techniques for introducing nucleic acids (RNAs and / or DNAs) and proteins, including preformed RNPs, are well known in the art and any convenient technique can be used, e.g., lipofection, nucleofection, viral transduction, electroporation, injection, etc.Nucleic acid of interest (actNucleicAcid)
[0146] A nucleic acid of interest (also referred to as an “activating nucleic acid” or “actNucleicAcid”) can be any RNA (e.g., single-stranded RNA or double-stranded RNA) or any DNA (e.g., single-stranded DNA or double-stranded DNA), as long as the targeted sequence hybridize with the capture region of the capNucleicAcid (e.g., capRNA, capDNA). In some cases, the actNucleicAcid is single stranded. In some cases, the actNucleicAcid is an RNA. In some cases, the actNucleicAcid is a DNA.Atty Docket No.: BERK-527WO
[0147] In some cases, a Cas13 protein (e.g., Cas13a) is used, the capNucleicAcid is a single stranded RNA, and the actNucleicAcid is also a single stranded RNA (e.g., a miRNA). In some cases, a Cas12 protein (e.g., Cas12a) is used, the capNucleicAcid is a single stranded DNA, and the actNucleicAcid is a single stranded RNA (e.g., a miRNA). In some cases, a Cas12 protein (e.g., Cas12a) is used, the capNucleicAcid is a single stranded DNA, and the actNucleicAcid is a single stranded DNA. In some cases, a Cas12 protein (e.g., Cas12a) is used, the capNucleicAcid is a double stranded DNA, and the actNucleicAcid is a single stranded RNA (e.g., a miRNA). In some cases, a Cas12 protein (e.g., Cas12a) is used, the capNucleicAcid is a double stranded DNA, and the actNucleicAcid is a single stranded DNA.
[0148] In general, the targeted sequence of an actNucleicAcid (e.g., actRNA or actDNA) (i.e., the sequence that hybridizes with the capture region of a capNucleicAcid) is 8- 26 nucleotides (nt) long (e.g., 8-24, 8-23, 8-22, 8-20, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11 , 8-10, 9-26, 9-24, 9-23, 9-22, 9-20, 9-18, 9-17, 9-16, 9-15, 9-14, 9- 13, 9-12, 9-11 , 9-10, 10-26, 10-24, 10-23, 10-22, 10-20, 10-18, 10-17, 10-16, IQ- 15, 10-14, 10-13, 10-12, 10-11 , 12-26, 12-24, 12-23, 12-22, 12-20, 12-18, 12-17, 12-16, 12-15, 12-14, or 12-13 nt). In some cases, the targeted sequence of the actNucleicAcid (e.g., actRNA) is 8-16 nt long (e.g., 8-15, 8-14, 8-13, 8-12, 8-11 , 8-10, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11 , 9-10, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11 , 12-16, 12-15, 12-14, or 12-13 nt).
[0149] In some such cases, the actNucleicAcid is 30-5000 nt long (e.g., 30-3000, 30-2500, 30-2400, 30-2000, 30-1500, 30-1000, 30-800, 30-500, 30-250, 50-3000, 50-2500, 50-2400, 50-2000, 50-1500, 50-1000, 50-800, 50-500, 50-250, 100-3000, 100- 2500, 100-2400, 100-2000, 100-1500, 100-1000, 100-800, 100-500, 100-250, 250- 3000, 250-2500, 250-2400, 250-2000, 250-1500, 250-1000, 250-800, or 250-500 nt). In some cases, the actNucleicAcid is 100-3000 nt long (e.g., 100-2500, 100- 2400, 100-2000, 100-1500, 100-1000, 100-800, 100-500, 100-250, 250-2500, 250- 2400, 250-2000, 250-1500, 250-1000, 250-800, or 250-500 nt). In some cases, the actNucleicAcid is -2500 nt long. In some cases, the actNucleicAcid is greater than 1000 nt long. In some cases, the actNucleicAcid is greater than 2000 nt long.
[0150] For example, in some embodiments, the actNucleicAcid is longer than the targeted sequence (e.g., longer than 26 nucleotides). In some such cases, the targeted sequence (the portion of the actNucleicAcid that will hybridize with the capture region of the capNucleicAcid) is at the 5' end. See, e.g, FIG. 14. In other words, in some cases the sequence detected by the split guide RNA system is part of aAtty Docket No.: BERK-527WO longer nucleic acid. As an illustrative example, in some embodiments the actNucleicAcid is longer than 26 nt, and the targeted sequence (e.g., 8-26 nt) within the actNucleicAcid that acts with the split guide RNA to hybridize to the capNucleicAcid is at the 5’ end of the actNucleicAcid. Such a scenario can be used to detect the presence of a sequence that is present in multiple different nucleic acids of interest (actNucleicAcids). The example embodiment of FIG. 14 illustrates the detection of a sequence in the non coding 5’ UTR region of a viral RNA, where the targeted sequence is shared among different viral RNAs - the presence of any one of the RNAs will be detected. In some embodiments, the 8-26 5’ most nucleotides of the actNucleicAcid hybridize to the capture region of the capNucleicAcid. In some embodiments, the 8-16 5’ most nucleotides of the actNucleicAcid hybridize to the capture region of the capNucleicAcid.
[0151] In some cases, the actNucleicAcid (e.g., actRNA) is 8-26 nucleotides (nt) long (e.g., 8-24, 8-23, 8-22, 8-20, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11 , 8-10, 9- 26, 9-24, 9-23, 9-22, 9-20, 9-18, 9-17, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11 , 9-10, IQ- 26, 10-24, 10-23, 10-22, 10-20, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11 , 12-26, 12-24, 12-23, 12-22, 12-20, 12-18, 12-17, 12-16, 12-15, 12-14, or 12- 13 nt). In some cases, the actNucleicAcid (e.g., actRNA) is 8-16 nt long (e.g., 8-15, 8-14, 8-13, 8-12, 8-11 , 8-10, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11 , 9-10, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11 , 12-16, 12-15, 12-14, or 12-13 nt).
[0152] Examples of actRNAs include but are not limited to mRNA, rRNA, tRNA, noncoding RNA (ncRNA), long non-coding RNA (IncRNA), and microRNA (miRNA). In some cases, the actNucleicAcid is mRNA. In some cases, the actNucleicAcid is a miRNA (e.g., a human miRNA). In some cases, the actNucleicAcid is RNA from a virus (e.g., Zika virus, human immunodeficiency virus, influenza virus, and the like). In some cases, the actNucleicAcid is RNA of a parasite. In some cases, the actNucleicAcid is RNA of a bacterium, e.g., a pathogenic bacterium. The source of the actNucleicAcid can be the same as the source of a sample (e.g., for methods of detection). In some cases, detection of a actNucleicAcid, where the actNucleicAcid is an mRNA, provides for detection of a DNA encoding the mRNA. In some cases, the actNucleicAcid is an mRNA present in a diseased cell (e.g., a cancer cell). In some cases, the actNucleicAcid is a miRNA present in a diseased cell (e.g., a cancer cell).
[0153] Examples of possible actDNAs include, but are not limited to, viral DNAs such as: a papovavirus (e.g, human papillomavirus (HPV), polyomavirus); a hepadnavirus (e.g., Hepatitis B Virus (HBV)); a herpesvirus (e.g, herpes simplex virus (HSV),Atty Docket No.: BERK-527WO varicella zoster virus (VZV), epstein-barr virus (EBV), cytomegalovirus (CMV), herpes lymphotropic virus, Pityriasis Rosea, kaposi’s sarcoma-associated herpesvirus); an adenovirus (e.g., atadenovirus, aviadenovirus, ichtadenovirus, mastadenovirus, siadenovirus); a poxvirus (e.g., smallpox, vaccinia virus, cowpox virus, monkeypox virus, orf virus, pseudocowpox, bovine papular stomatitis virus; tanapox virus, yaba monkey tumor virus; molluscum contagiosum virus (MCV)); a parvovirus (e.g., adeno-associated virus (AAV), Parvovirus B19, human bocavirus, bufavirus, human parv4 G1 ); Geminiviridae; Nanoviridae; Phycodnaviridae; and the like. In some cases, the target DNA is parasite DNA. In some cases, the target DNA is bacterial DNA, e.g., DNA of a pathogenic bacterium.
[0154] In some cases, an actNucleicAcid is not subjected to an amplification step. In some cases, an actNucleicAcid is subject to an amplification step, to generate an amplification product (an amplicon), and the amplification product is detected using a method of the present disclosure. If an amplification step is included, in some cases, the amplifying comprises recombinase polymerase amplification (RPA), transcription mediated amplification (TMA), strand displacement amplification (SDA), helicase dependent amplification (HDA), loop mediated amplification (LAMP), rolling circle amplification (RCA), single primer isothermal amplification (SPIA), ligase chain reaction (LCR), simple method amplifying RNA targets (SMART), or improved multiple displacement amplification (IMDA), or nucleic acid sequence-based amplification (NASBA). In some cases, the amplifying comprises recombinase polymerase amplification (RPA). In some cases, the amplifying comprises loop mediated amplification (LAMP).
[0155] The source of the actNucleicAcid can be any source. In some cases, the actNucleicAcid is a viral nucleic acid (e.g., viral RNA, viral DNA, a genomic DNA of a DNA virus, a genomic RNA of an RNA virus). As such, subject method can be for detecting the presence of a viral actNucleicAcid amongst a population of nucleic acids (e.g., in a sample). A subject method can also be used for the cleavage of non-target single stranded nucleic acids in the present of an actNucleicAcid. For example, if a method takes place in a cell, a subject method can be used to promiscuously cleave non-target single stranded nucleic acids in the cell (single stranded nucleic acids that do not hybridize with the guide sequence of the guide RNA) when a particular actNucleicAcid is present in the cell (e.g., when the cell is infected with a virus and viral target nucleic acid is detected).Atty Docket No.: BERK-527WODetection
[0156] In some embodiments, the components described herein are used in a method of detection - to detect the presence of a nucleic acid of interested (an actNucleicAcid). Thus, the present disclosure provides a method of detecting a nucleic acid of interest (an actNucleicAcid) (e.g., an RNA (actRNA) or a DNA (actDNA) in a sample. In some cases, the sample is a cell-free sample. In some cases, the sample comprises cells. In some cases, the sample comprises a cell lysate. In some embodiments, the methods include contacting a sample (e.g., a sample having a plurality of nucleic acids, e.g., RNAs) with (a) a CRISPR-Cas effector protein (e.g., a Cas13 such as Cas13a); (b) a CRISPR-Cas guide RNA (e.g., a Cas13 guide RNA) that hybridizes with the anchor region of a capture nucleic acid (capNucleicAcid); (c) the capture nucleic acid (capNucleicAcid) (e.g., capRNA) - which has an anchor region that hybridizes with the guide RNA and a capture region that hybridizes with the actNucleicAcid (e.g., actRNA) if the actNucleicAcid is present in the sample; and (d) a labeled single stranded detector nucleic acid (which does not hybridize with the CRISPR-Cas guide RNA). The methods can also include detecting a signal produced by cleavage of the single stranded detector nucleic acid by trans cleavage activity of the CRISPR-Cas effector protein, thereby detecting the actNucleicAcid.
[0157] The trans cleavage activity of the CRISPR-Cas effector protein is activated if the actNucleicAcid is present in the sample being contacted. Once a subject CRISPR- Cas effector protein (e.g., Cas13 such as Cas13a) forms a ribonucleoprotein complex (RNP) with the guide RNA in the presence of the capNucleicAcid and the actNucleicAcid (to which the capNucleicAcid hybridizes), the CRISPR-Cas effector protein is activated and functions as an endoribonuclease that non-specifically cleaves RNAs (including non-target RNAs) present in the sample.
[0158] Thus, when the actNucleicAcid is present in the sample (e.g., in some cases above a threshold amount), the result is cleavage of single stranded (ss) nucleic acids (e.g., ssRNA and / or ssDNA) (including non-actNucleicAcid) in the sample, which can be detected using any convenient detection method (e.g., using a labeled detector nucleic acid (e.g., detector RNA or DNA)). The contacting step is generally carried out in a composition comprising divalent metal ions. The contacting step can be carried out in an acellular environment, e.g., outside of a cell. The contacting step can be carried out inside a cell. The contacting step can be carried out in a cell in vitro. The contacting step can be carried out in a cell ex vivo. The contacting step can be carried out in a cell in vivo. In some cases, the guide RNAAtty Docket No.: BERK-527WO(e.g., Cas13 guide RNA) is provided as RNA; and the CRISPR-Cas effector protein (e.g., Cas13a, Cas12a, and the like) is provided as protein per se. In some cases, the Guide RNA is provided as DNA encoding the guide RNA; and the CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like) is provided as protein per se. In some cases, the Guide RNA is provided as RNA; and the CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like) is provided as RNA encoding the CRISPR-Cas effector protein (e.g., Cas13, Cast 2, and the like). In some cases, the Guide RNA is provided as DNA encoding the guide RNA; and CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like) is provided as RNA encoding the CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like). In some cases, the Guide RNA is provided as RNA; and the CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like) is provided as DNA comprising a nucleotide sequence encoding the CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like). In some cases, the Guide RNA is provided as DNA encoding the guide RNA; and the CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like) is provided as DNA comprising a nucleotide sequence encoding the CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like). For example, in some cases the method detects a control or standard nucleic acid (e.g, RNA). The detection of the control provides an internal control that indicates that the method is working.
[0159] In some cases (e.g., when contacting with a guide RNA and a CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like)), the sample is contacted for 2 hours or less (e.g., 1 .5 hours or less, 1 hour or less, 40 minutes or less, 30 minutes or less, 20 minutes or less, 10 minutes or less, or 5 minutes or less, or 1 minute or less) prior to the measuring step. For example, in some cases the sample is contacted for 40 minutes or less prior to the measuring step. In some cases, the sample is contacted for 20 minutes or less prior to the measuring step. In some cases, the sample is contacted for 10 minutes or less prior to the measuring step. In some cases, the sample is contacted for 5 minutes or less prior to the measuring step. In some cases, the sample is contacted for 1 minute or less prior to the measuring step. In some cases, the sample is contacted for from 50 seconds to 60 seconds prior to the measuring step. In some cases, the sample is contacted for from 40 seconds to 50 seconds prior to the measuring step. In some cases, the sample is contacted for from 30 seconds to 40 seconds prior to the measuring step. In some cases, the sample is contacted for from 20 seconds to 30 seconds prior to the measuring step. In some cases, the sample is contacted for from 10 seconds to 20 seconds prior to the measuring step.Atty Docket No.: BERK-527WO
[0160] In some cases, the includes a plurality of nucleic acids (e.g., RNAs or DNAs) (e.g., comprising a actNucleicAcid and a plurality of non-actNucleicAcids). Detecting an actNucleicAcid (e.g., a single-stranded actNucleicAcid such as RNA) in a sample comprising a plurality of nucleic acids (e.g., RNAs or DNAs) (including the actNucleicAcid and a plurality of non-actNucleicAcids) can detect a actNucleicAcid with a high degree of sensitivity. In some cases, the actNucleicAcid is present at one or more copies per 107non-actNucleicAcids (e.g., one or more copies per 106non-actNucleicAcids, one or more copies per 105non-actNucleicAcids, one or more copies per 104non-actNucleicAcids, one or more copies per 103non- actNucleicAcids, one or more copies per 102non-actNucleicAcids, one or more copies per 50 non-actNucleicAcids, one or more copies per 20 non- actNucleicAcids, one or more copies per 10 non-actNucleicAcids, or one or more copies per 5 non-actNucleicAcids).
[0161] In some cases, a method of the present disclosure can detect a actNucleicAcid present in a sample comprising a plurality of nucleic acids (e.g., RNAs or DNAs) (including the actNucleicAcid and a plurality of non-actNucleicAcids), where the actNucleicAcid is present at from one copy per 107non-actNucleicAcids to one copy per 10 non-actNucleicAcids (e.g., from 1 copy per 107non-actNucleicAcids to 1 copy per 102non-actNucleicAcids, from 1 copy per 107non-actNucleicAcids to 1 copy per 103non-actNucleicAcids, from 1 copy per 107non-actNucleicAcids to 1 copy per 104non-actNucleicAcids, from 1 copy per 107non-actNucleicAcids to 1 copy per 105non-actNucleicAcids, from 1 copy per 107non-actNucleicAcids to 1 copy per 10® non-actNucleicAcids, from 1 copy per 106non-actNucleicAcids to 1 copy per 10 non-actNucleicAcids, from 1 copy per 10® non-actNucleicAcids to 1 copy per 102non-actNucleicAcids, from 1 copy per 10® non-actNucleicAcids to 1 copy per 103non-actNucleicAcids, from 1 copy per 10® non-actNucleicAcids to 1 copy per 104non-actNucleicAcids, from 1 copy per 10® non-actNucleicAcids to 1 copy per 105non-actNucleicAcids, from 1 copy per 105non-actNucleicAcids to 1 copy per 10 non-actNucleicAcids, from 1 copy per 105non-actNucleicAcids to 1 copy per 102non-actNucleicAcids, from 1 copy per 105non-actNucleicAcids to 1 copy per 103non-actNucleicAcids, or from 1 copy per 105non-actNucleicAcids to 1 copy per 104non-actNucleicAcids).
[0162] In some cases, a method of the present disclosure can detect a actNucleicAcid present in a sample comprising a plurality of nucleic acids (e.g., RNAs or DNAs) (including the actNucleicAcid and a plurality of non-actNucleicAcids), where the target single-stranded RNA is present at from one copy per 107nonAtty Docket No.: BERK-527WO actNucleicAcids to one copy per 100 non-actNucleicAcids (e.g., from 1 copy per 107non-actNucleicAcids to 1 copy per 102non-actNucleicAcids, from 1 copy per107non-actNucleicAcids to 1 copy per 103non-actNucleicAcids, from 1 copy per107non-actNucleicAcids to 1 copy per 104non-actNucleicAcids, from 1 copy per107non-actNucleicAcids to 1 copy per 105non-actNucleicAcids, from 1 copy per107non-actNucleicAcids to 1 copy per 106non-actNucleicAcids, from 1 copy per106non-actNucleicAcids to 1 copy per 100 non-actNucleicAcids, from 1 copy per106non-actNucleicAcids to 1 copy per 102non-actNucleicAcids, from 1 copy per106non-actNucleicAcids to 1 copy per 103non-actNucleicAcids, from 1 copy per106non-actNucleicAcids to 1 copy per 104non-actNucleicAcids, from 1 copy per106non-actNucleicAcids to 1 copy per 105non-actNucleicAcids, from 1 copy per105non-actNucleicAcids to 1 copy per 100 non-actNucleicAcids, from 1 copy per105non-actNucleicAcids to 1 copy per 102non-actNucleicAcids, from 1 copy per105non-actNucleicAcids to 1 copy per 103non-actNucleicAcids, or from 1 copy per105non-actNucleicAcids to 1 copy per 104non-actNucleicAcids).
[0163] In some cases, the threshold of detection, for a subject method of detecting a actNucleicAcid in a sample, is 1 pM or less. The term “threshold of detection” is used herein to describe the minimal amount of actNucleicAcid that must be present in a sample in order for detection to occur. Thus, as an illustrative example, when a threshold of detection is 1 pM, then a signal can be detected when a actNucleicAcid is present in the sample at a concentration of 1 pM or more. In some cases, a method of the present disclosure has a threshold of detection of 500 fM or less. In some cases, a method of the present disclosure has a threshold of detection of 200 fM or less. In some cases, a method of the present disclosure has a threshold of detection of 100 fM or less. In some cases, a method of the present disclosure has a threshold of detection of 10 fM or less. In some cases, a method of the present disclosure has a threshold of detection of 1 fM or less. In some cases, a method of the present disclosure has a threshold of detection of 500 aM or less. In some cases, a method of the present disclosure has a threshold of detection of 250 aM or less. In some cases, a method of the present disclosure has a threshold of detection of 100 aM or less. In some cases, a method of the present disclosure has a threshold of detection of 10 aM or less. In some cases, a method of the present disclosure has a threshold of detection of 250 fM or less. In some cases, a method of the present disclosure has a threshold of detection of 50 fM or less. In some cases, a method of the present disclosure has a threshold of detection of about 10 fM. In some cases, a method of the present disclosure has a threshold of detection of about 50 fM. In some cases, a method of the presentAtty Docket No.: BERK-527WO disclosure has a threshold of detection of about 100 fM. In some cases, a method of the present disclosure has a threshold of detection of about 150 fM. In some cases, a method of the present disclosure has a threshold of detection of about 200 fM.
[0164] In some cases, the threshold of detection (for detecting the actNucleicAcid in a subject method), is in a range of from 1 aM to 1 nM (e.g., from 1 aM to 500 fM, from 10 aM to 500 fM, from 50 aM to 500 fM, from 250 aM to 500 fM, 500 aM to 500 fM, from 1 aM to 300 fM, from 10 aM to 300 fM, from 50 aM to 300 fM, from 250 aM to 300 fM, 500 aM to 300 fM, from 100 fM to 500 pM, from 100 fM to 200 pM, from 100 fM to 100 pM, from 100 fM to 10 pM, from 100 fM to 1 pM, from 100 fM to 750 fM, from 200 fM to 1 nM, from 200 fM to 500 pM, from 200 fM to 200 pM, from 200 fM to 100 pM, from 200 fM to 10 pM, from 200 fM to 1 pM, from 200 fM to 750 fM, from 500 fM to 1 nM, from 500 fM to 500 pM, from 500 fM to 200 pM, from 500 fM to 100 pM, from 500 fM to 10 pM, from 500 fM to 1 pM, from 800 fM to 1 nM, from 800 fM to 500 pM, from 800 fM to 200 pM, from 800 fM to 100 pM, from 800 fM to 10 pM, from 800 fM to 1 pM, from 1 pM to 1 nM, from 1 pM to 500 pM, from 1 pM to 200 pM, from 1 pM to 100 pM, or from 1 pM to 10 pM) (where the concentration refers to the threshold concentration of actNucleicAcid at which the actNucleicAcid can be detected).
[0165] In some cases, the threshold of detection (for detecting the actNucleicAcid in a subject method), is in a range of from 100 fM to 1 nM (e.g., from 100 fM to 500 pM, from 100 fM to 200 pM, from 100 fM to 100 pM, from 100 fM to 10 pM, from 100 fM to 1 pM, from 100 fM to 750 fM, from 200 fM to 1 nM, from 200 fM to 500 pM, from 200 fM to 200 pM, from 200 fM to 100 pM, from 200 fM to 10 pM, from 200 fM to 1 pM, from 200 fM to 750 fM, from 500 fM to 1 nM, from 500 fM to 500 pM, from 500 fM to 200 pM, from 500 fM to 100 pM, from 500 fM to 10 pM, from 500 fM to 1 pM, from 800 fM to 1 nM, from 800 fM to 500 pM, from 800 fM to 200 pM, from 800 fM to 100 pM, from 800 fM to 10 pM, from 800 fM to 1 pM, from 1 pM to 1 nM, from 1 pM to 500 pM, from 1 pM to 200 pM, from 1 pM to 100 pM, or from 1 pM to 10 pM) (where the concentration refers to the threshold concentration of actNucleicAcid at which the actNucleicAcid can be detected). In some cases, a method of the present disclosure has a threshold of detection in a range of from 100 fM to 100 pM. In some cases, a method of the present disclosure has a threshold of detection in a range of from 100 fM to 750 fM. In some cases, a method of the present disclosure has a threshold of detection in a range of from 10 fM to 500 fM, e.g., from 10 fM to 50 fM, from 50 fM to 100 fM, from 100 fM to 250 fM, or from 250 fM to 500 fM. In some cases, a method of the present disclosure has a threshold of detection aboutAtty Docket No.: BERK-527WO50 fM. In some cases, a method of the present disclosure has a threshold of detection about 100 fM. In some cases, a method of the present disclosure has a threshold of detection about 150 fM. In some cases, a method of the present disclosure has a threshold of detection about 200 fM.
[0166] In some cases, the minimum concentration at which a actNucleicAcid can be detected in a sample is in a range of from 1 aM to 1 nM (e.g., from 1 aM to 500 fM, from 10 aM to 500 fM, from 50 aM to 500 fM, from 250 aM to 500 fM, 500 aM to 500 fM, from 1 aM to 300 fM, from 10 aM to 300 fM, from 50 aM to 300 fM, from 250 aM to 300 fM, 500 aM to 300 fM, from 100 fM to 500 pM, from 100 fM to 200 pM, from 100 fM to 100 pM, from 100 fM to 10 pM, from 100 fM to 1 pM, from 100 fM to 750 fM, from 200 fM to 1 nM, from 200 fM to 500 pM, from 200 fM to 200 pM, from 200 fM to 100 pM, from 200 fM to 10 pM, from 200 fM to 1 pM, from 200 fM to 750 fM, from 500 fM to 1 nM, from 500 fM to 500 pM, from 500 fM to 200 pM, from 500 fM to 100 pM, from 500 fM to 10 pM, from 500 fM to 1 pM, from 800 fM to 1 nM, from 800 fM to 500 pM, from 800 fM to 200 pM, from 800 fM to 100 pM, from 800 fM to 10 pM, from 800 fM to 1 pM, from 1 pM to 1 nM, from 1 pM to 500 pM, from 1 pM to 200 pM, from 1 pM to 100 pM, or from 1 pM to 10 pM).
[0167] In some cases, the minimum concentration at which a actNucleicAcid can be detected in a sample is in a range of from 100 fM to 1 nM (e.g., from 100 fM to 500 pM, from 100 fM to 200 pM, from 100 fM to 100 pM, from 100 fM to 10 pM, from 100 fM to 1 pM, from 100 fM to 750 fM, from 200 fM to 1 nM, from 200 fM to 500 pM, from 200 fM to 200 pM, from 200 fM to 100 pM, from 200 fM to 10 pM, from 200 fM to 1 pM, from 200 fM to 750 fM, from 500 fM to 1 nM, from 500 fM to 500 pM, from 500 fM to 200 pM, from 500 fM to 100 pM, from 500 fM to 10 pM, from 500 fM to 1 pM, from 800 fM to 1 nM, from 800 fM to 500 pM, from 800 fM to 200 pM, from 800 fM to 100 pM, from 800 fM to 10 pM, from 800 fM to 1 pM, from 1 pM to 1 nM, from 1 pM to 500 pM, from 1 pM to 200 pM, from 1 pM to 100 pM, or from 1 pM to 10 pM). In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is in a range of from 100 fM to 100 pM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is in a range of from 100 fM to 750 fM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is in a range of from 10 fM to 500 fM, e.g., from 10 fM to 50 fM, from 50 fM to 100 fM, from 100 fM to 250 fM, or from 250 fM to 500 fM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is about 50 fM. In some cases, the minimum concentration at which a single stranded actNucleicAcid canAtty Docket No.: BERK-527WO be detected in a sample is about 100 fM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is about 150 fM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is about 200 fM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is about 1 aM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is about 50 aM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is about 250 aM. In some cases, the minimum concentration at which a single stranded actNucleicAcid can be detected in a sample is about 500 aM.
[0168] In some cases, a method of the present disclosure can detect a actNucleicAcid present in a sample comprising a plurality of actNucleicAcids (including the actNucleicAcid and a plurality of non-actNucleicAcids), where the actNucleicAcid is present at a concentration as low as 1 aM (e.g., as low as 1 aM, as low as 50 aM, as low as 100 aM, as low as 200 aM, as low as 500 aM, as low as 50 fM, as low as 100 fM, as low as 200 fM, as low as 500fM, as low as 800 fM, as low as 1 pM, as low as 10 pM or as low as 100 pM).
[0169] In some cases, a method of the present disclosure can be used to determine the amount of a actNucleicAcid in a sample (e.g., a sample comprising the actNucleicAcid and a plurality of non-actNucleicAcids). Determining the amount of a actNucleicAcid in a sample can comprise comparing the amount of detectable signal generated from a test sample to the amount of detectable signal generated from a reference sample. Determining the amount of a actNucleicAcid in a sample can comprise: measuring the detectable signal to generate a test measurement; measuring a detectable signal produced by a reference sample to generate a reference measurement; and comparing the test measurement to the reference measurement to determine an amount of actNucleicAcid present in the sample.
[0170] For example, in some cases, a method of the present disclosure for determining the amount of a actNucleicAcid in a sample comprises: a) contacting the sample (e.g., a sample comprising the actNucleicAcid and a plurality of non- actNucleicAcids) with the components described herein (a guide RNA, a capNucleicAcid, and a CRISPR-Cas effector protein), and b) measuring a detectable signal produced by CRISPR-Cas effector protein (e.g., Cas13, Cas12, and the like)-mediated cleavage, generating a test measurement; c) measuring aAtty Docket No.: BERK-527WO detectable signal produced by a reference sample to generate a reference measurement; and d) comparing the test measurement to the reference measurement to determine an amount of actNucleicAcid present in the sample.Samples
[0171] A subject sample can include a plurality of nucleic acids that are not the intended actNucleicAcid. The term “plurality” is used herein to mean two or more. Thus, in some cases a sample includes two or more (e.g., 3 or more, 5 or more, 10 or more, 20 or more, 50 or more, 100 or more, 500 or more, 1 ,000 or more, or 5,000 or more) nucleic acids (e.g., RNAs, DNAs). A subject method can be used as a very sensitive way to detect a single stranded actNucleicAcid (e.g., an RNA) present in a complex mixture of nucleic acids (e.g., RNAs). Thus, in some cases the sample includes 5 or more nucleic acids (e.g., 10 or more, 20 or more, 50 or more, 100 or more, 500 or more, 1 ,000 or more, or 5,000 or more RNAs) that differ from one another in sequence. In some cases, the sample includes 10 or more, 20 or more, 50 or more, 100 or more, 500 or more, 103or more, 5 x 103or more, 104or more, 5 x 104or more, 105or more, 5 x 105or more, 106or more 5 x 106or more, or 107or more, nucleic acids that differ from one another in sequence. In some cases, the sample comprises from 10 to 20, from 20 to 50, from 50 to 100, from 100 to 500, from 500 to 103, from 103to 5 x 103, from 5 x 103to 104, from 104to 5 x 104, from 5 x 104to 105, from 105to 5 x 105, from 5 x 105to 106, from 106to 5 x 106, or from 5 x 106to 107, or more than 107, nucleic acids (e.g. , RNAs) that differ from one another in sequence. In some cases, the sample comprises from 3 to 107nucleic acids that differ from one another in sequence (e.g., from 5 to 106, from 5 to 105, from 5 to 50,000, from 5 to 30,000, from 10 to 106, from 10 to 105, from 10 to 50,000, from 10 to 30,000, from 20 to 106, from 20 to 105, from 20 to 50,000, or from 20 to 30,000 RNAs that differ from one another in sequence). In some cases, the sample comprises from 3 to 50,000 nucleic acids that differ from one another in sequence (e.g., from 5 to 30,000, from 10 to 50,000, or from 10 to 30,000) RNAs that differ from one another in sequence). In some cases the sample includes 20 or more nucleic acids that differ from one another in sequence. In some cases, the sample includes nucleic acids from a cell lysate (e.g., a eukaryotic cell lysate, a mammalian cell lysate, a human cell lysate, a prokaryotic cell lysate, a plant cell lysate, and the like). For example, in some cases the sample includes expressed RNAs from a cell such as a eukaryotic cell, e.g., a mammalian cell such as a human cell.
[0172] The term “sample” is used herein to mean any sample that includes nucleic acids (e.g., single stranded RNAs). The sample can be derived from any source, e.g., theAtty Docket No.: BERK-527WO sample can be a synthetic combination of purified nucleic acids; the sample can be a cell lysate, a nucleic acid-enriched cell lysate, or nucleic acids isolated and / or purified from a cell lysate. The sample can be from a patient (e.g., for the purpose of diagnosis). The sample can be from permeabilized cells. The sample can be from crosslinked cells. The sample can be in tissue sections. The sample can be from tissues prepared by crosslinking followed by delipidation and adjustment to make a uniform refractive index. Examples of tissue preparation by crosslinking followed by delipidation and adjustment to make a uniform refractive index have been described in, for example, Shah et al., Development (2016) 143, 2862-2867 doi:10.1242 / dev.138560.
[0173] A “sample” can include an actNucleicAcid (e.g., actRNA) and a plurality of nontarget nucleic acids (e.g., DNAs, RNAs). In some cases, the actNucleicAcid is present in the sample at one copy per 10 non-target nucleic acids, one copy per 20 non-target nucleic acids, one copy per 25 non-target nucleic acids, one copy per 50 non-target nucleic acids, one copy per 100 non-target nucleic acids, one copy per 500 non-target nucleic acids, one copy per 103non-target nucleic acids, one copy per 5 x 103non-target nucleic acids, one copy per 104non-target nucleic acids, one copy per 5 x 104non-target nucleic acids, one copy per 105non-target nucleic acids, one copy per 5 x 105non-target nucleic acids, one copy per 106non-target nucleic acids, or less than one copy per 106non-target nucleic acids. In some cases, the target single-stranded RNA is present in the sample at from one copy per 10 non-target nucleic acids to 1 copy per 20 non-target nucleic acids, from 1 copy per 20 non-target nucleic acids to 1 copy per 50 non-target nucleic acids, from 1 copy per 50 non-target nucleic acids to 1 copy per 100 non-target nucleic acids, from 1 copy per 100 non-target nucleic acids to 1 copy per 500 non-target nucleic acids, from 1 copy per 500 non-target nucleic acids to 1 copy per 103non-target nucleic acids, from 1 copy per 103non-target nucleic acids to 1 copy per 5 x 103non-target nucleic acids, from 1 copy per 5 x 103non-target nucleic acids to 1 copy per 104non-target nucleic acids, from 1 copy per 104non-target nucleic acids to 1 copy per 105non-target nucleic acids, from 1 copy per 105non-target nucleic acids to 1 copy per 106non-target nucleic acids, or from 1 copy per 106non-target nucleic acids to 1 copy per 107non-target nucleic acids.
[0174] Suitable samples include but are not limited to blood, serum, plasma, urine, aspirate, and biopsy samples. Thus, the term “sample” with respect to a patient encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The definition also includes samples that have beenAtty Docket No.: BERK-527WO manipulated in any way after their procurement, such as by treatment with reagents; washed; or enrichment for certain cell populations, such as cancer cells. The definition also includes sample that have been enriched for particular types of molecules, e.g., RNAs. The term “sample” encompasses biological samples such as a clinical sample such as blood, plasma, serum, aspirate, cerebral spinal fluid (CSF), and also includes tissue obtained by surgical resection, tissue obtained by biopsy, cells in culture, cell supernatants, cell lysates, tissue samples, organs, bone marrow, and the like. A “biological sample” includes biological fluids derived therefrom (e.g., cancerous cell, infected cell, etc.), e.g., a sample comprising nucleic acids that is obtained from such cells (e.g., a cell lysate or other cell extract comprising nucleic acids).
[0175] A sample can comprise, or can be obtained from, any of a variety of cells, tissues, organs, or acellular fluids. Suitable sample sources include eukaryotic cells, bacterial cells, and archaeal cells. Suitable sample sources include single-celled organisms and multi-cellular organisms. Suitable sample sources include singlecell eukaryotic organisms; a plant or a plant cell; an algal cell, e.g., Botryococcus braunii, Chlamydomonas reinhardtii, Nannochloropsis gaditana, Chlorella pyrenoidosa, Sargassum patens, C. agardh, and the like; a fungal cell (e.g., a yeast cell); an animal cell, tissue, or organ; a cell, tissue, or organ from an invertebrate animal (e.g. fruit fly, cnidarian, echinoderm, nematode, an insect, an arachnid, etc.); a cell, tissue, fluid, or organ from a vertebrate animal (e.g., fish, amphibian, reptile, bird, mammal); a cell, tissue, fluid, or organ from a mammal (e.g., a human; a non-human primate; an ungulate; a feline; a bovine; an ovine; a caprine; etc.). Suitable sample sources include nematodes, protozoans, and the like. Suitable sample sources include parasites such as helminths, malarial parasites, etc.
[0176] Suitable sample sources include a cell, tissue, or organism of any of the six kingdoms, e.g., Bacteria (e.g., Eubacteria); Archaebacteria; Protista; Fungi; Plantae; and Animalia. Suitable sample sources include plant-like members of the kingdom Protista, including, but not limited to, algae (e.g., green algae, red algae, glaucophytes, cyanobacteria); fungus-like members of Protista, e.g., slime molds, water molds, etc.; animal-like members of Protista, e.g., flagellates (e.g., Euglena), amoeboids (e.g., amoeba), sporozoans (e.g, Apicomplexa, Myxozoa, Microsporidia), and ciliates (e.g., Paramecium). Suitable sample sources include include members of the kingdom Fungi, including, but not limited to, members of any of the phyla: Basidiomycota (club fungi; e.g., members of Agaricus, Amanita, Boletus, Cantherellus, etc.); Ascomycota (sac fungi, including, e.g., Saccharomyces); Mycophycophyta (lichens); Zygomycota (conjugation fungi); andAtty Docket No.: BERK-527WODeuteromycota. Suitable sample sources include include members of the kingdom Plantae, including, but not limited to, members of any of the following divisions: Bryophyta (e.g., mosses), Anthocerotophyta (e.g., hornworts), Hepaticophyta (e.g., liverworts), Lycophyta (e.g., club mosses), Sphenophyta (e.g., horsetails), Psilophyta (e.g., whisk ferns), Ophioglossophyta, Pterophyta (e.g., ferns), Cycadophyta, Gingkophyta, Pinophyta, Gnetophyta, and Magnoliophyta (e.g., flowering plants). Suitable sample sources include include members of the kingdom Animalia, including, but not limited to, members of any of the following phyla: Porifera (sponges); Placozoa; Orthonectida (parasites of marine invertebrates); Rhombozoa; Cnidaria (corals, anemones, jellyfish, sea pens, sea pansies, sea wasps); Ctenophora (comb jellies); Platyhelminthes (flatworms); Nemertina (ribbon worms); Ngathostomulida (jawed worms)p Gastrotricha; Rotifera; Priapulida; Kinorhyncha; Loricifera; Acanthocephala; Entoprocta; Nemotoda; Nematomorpha; Cycliophora; Mollusca (mollusks); Sipuncula (peanut worms); Annelida (segmented worms); Tardigrada (water bears); Onychophora (velvet worms); Arthropoda (including the subphyla: Chelicerata, Myriapoda, Hexapoda, and Crustacea, where the Chelicerata include, e.g., arachnids, Merostomata, and Pycnogonida, where the Myriapoda include, e.g., Chilopoda (centipedes), Diplopoda (millipedes), Paropoda, and Symphyla, where the Hexapoda include insects, and where the Crustacea include shrimp, krill, barnacles, etc.; Phoronida; Ectoprocta (moss animals); Brachiopoda; Echinodermata (e.g. starfish, sea daisies, feather stars, sea urchins, sea cucumbers, brittle stars, brittle baskets, etc.); Chaetognatha (arrow worms); Hemichordata (acorn worms); and Chordata. Suitable members of Chordata include any member of the following subphyla: Urochordata (sea squirts; including Ascidiacea, Thaliacea, and Larvacea); Cephalochordata (lancelets); Myxini (hagfish); and Vertebrata, where members of Vertebrata include, e.g., members of Petromyzontida (lampreys), Chondrichthyces (cartilaginous fish), Actinopterygii (ray-finned fish), Actinista (coelocanths), Dipnoi (lungfish), Reptilia (reptiles, e.g., snakes, alligators, crocodiles, lizards, etc.), Aves (birds); and Mammalian (mammals). Suitable plants include any monocotyledon and any dicotyledon.
[0177] Suitable sources of a sample include cells, fluid, tissue, or organ taken from an organism; from a particular cell or group of cells isolated from an organism; etc. For example, where the organism is a plant, suitable sources include xylem, the phloem, the cambium layer, leaves, roots, etc. Where the organism is an animal, suitable sources include particular tissues (e.g., lung, liver, heart, kidney, brain, spleen, skin, fetal tissue, etc.), or a particular cell type (e.g., neuronal cells,Atty Docket No.: BERK-527WO epithelial cells, endothelial cells, astrocytes, macrophages, glial cells, islet cells, T lymphocytes, B lymphocytes, etc.).
[0178] In some cases, the source of the sample is a diseased cell, fluid, tissue, or organ. In some cases, the source of the sample is a normal (non-diseased) cell, fluid, tissue, or organ. In some cases, the source of the sample is a pathogen-infected cell, tissue, or organ. Pathogens include viruses, fungi, helminths, protozoa, malarial parasites, Plasmodium parasites, Toxoplasma parasites, Schistosoma parasites, and the like. “Helminths” include roundworms, heartworms, and phytophagous nematodes (Nematoda), flukes (Tematoda), Acanthocephala, and tapeworms (Cestoda). Protozoan infections include infections from Giardia spp., Trichomonas spp., African trypanosomiasis, amoebic dysentery, babesiosis, balantidial dysentery, Chaga's disease, coccidiosis, malaria and toxoplasmosis. Examples of pathogens such as parasitic / protozoan pathogens include, but are not limited to: Plasmodium falciparum, Plasmodium vivax, Trypanosoma cruzi and Toxoplasma gondii. Fungal pathogens include, but are not limited to: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. Pathogenic viruses include, e.g., immunodeficiency virus (e.g., HIV); influenza virus; dengue; West Nile virus; herpes virus; yellow fever virus; Hepatitis Virus C; Hepatitis Virus A; Hepatitis Virus B; papillomavirus; and the like. Pathogens include, e.g., HIV virus, Mycobacterium tuberculosis, Streptococcus agalactiae, methicillin-resistant Staphylococcus aureus, Legionella pneumophila, Streptococcus pyogenes, Escherichia coli, Neisseria gonorrhoeae, Neisseria meningitidis, Pneumococcus, Cryptococcus neoformans, Histoplasma capsulatum, Hemophilus influenzae B, Treponema pallidum, Lyme disease spirochetes, Pseudomonas aeruginosa, Mycobacterium leprae, Brucella abortus, rabies virus, influenza virus, cytomegalovirus, herpes simplex virus I, herpes simplex virus II, human serum parvo-like virus, respiratory syncytial virus, varicella-zoster virus, hepatitis B virus, hepatitis C virus, measles virus, adenovirus, human T-cell leukemia viruses, Epstein-Barr virus, murine leukemia virus, mumps virus, vesicular stomatitis virus, Sindbis virus, lymphocytic choriomeningitis virus, wart virus, blue tongue virus, Sendai virus, feline leukemia virus, Reovirus, polio virus, simian virus 40, mouse mammary tumor virus, dengue virus, rubella virus, West Nile virus, Plasmodium falciparum, Plasmodium vivax, Toxoplasma gondii, Trypanosoma rangeli, Trypanosoma cruzi, Trypanosoma rhodesiense, Trypanosoma brucei, Schistosoma mansoni, Schistosoma japonicum, Babesia bovis, Eimeria tenella, Onchocerca volvulus, Leishmania tropica, Mycobacterium tuberculosis, Trichinella spiralis,Atty Docket No.: BERK-527WOTheileria parva, Taenia hydatigena, Taenia ovis, Taenia saginata, Echinococcus granulosus, Mesocestoides corti, Mycoplasma arthritidis, M. hyorhinis, M. orale, M. arginini, Acholeplasma laidlawii, M. salivarium and M. pneumoniae.
[0179] In some cases, the sample comprises cancer cells.Measuring a detectable signal
[0180] In some cases, a subject method includes a step of measuring (e.g., measuring a detectable signal produced by CRISPR-Cas effector protein (e.g., Cas13, e.g., Cas13a) -mediated cleavage. Because a CRISPR-Cas effector protein cleaves non-targeted nucleic acids once activated, a detectable signal can be any signal that is produced when nucleic acid (e.g., RNA) is cleaved. For example, in some cases the step of measuring can include one or more of: gold nanoparticle-based detection (e.g., see Xu et al., Angew Chem Int Ed Engl. 2007;46(19):3468-70; and Xia et. al., Proc Natl Acad Sci U S A. 2010 Jun 15;107(24):10837-41 ), fluorescence polarization, colloid phase transition / dispersion (e.g, Baksh et. al., Nature. 2004 Jan 8;427(6970):139-41), electrochemical detection, semiconductor-based sensing (e.g., Rothberg et. al., Nature. 2011 Jul 20;475(7356):348-52; e.g., one could use a phosphatase to generate a pH change after cleavage reactions, by opening 2’-3’ cyclic phosphates, and by releasing inorganic phosphate into solution), and detection of a labeled detector nucleic acid (e.g., detector RNA or detector DNA) (see below for more details). The readout of such detection methods can be any convenient readout. Examples of possible readouts include but are not limited to: a measured amount of detectable fluorescent signal; a visual analysis of bands on a gel (e.g., bands that represent cleaved product versus uncleaved substrate), a visual or sensor based detection of the presence or absence of a color (i.e., color detection method), and the presence or absence of (or a particular amount of) an electrical signal.
[0181] The measuring can in some cases be quantitative, e.g., in the sense that the amount of signal detected can be used to determine the amount of actNucleicAcid (e.g., actRNA, actDNA) present in the sample. The measuring can in some cases be qualitative, e.g., in the sense that the presence or absence of detectable signal can indicate the presence or absence of actNucleicAcid. In some cases, a detectable signal will not be present (e.g., above a given threshold level) unless the actNucleicAcid is present above a particular threshold concentration. In some cases, the threshold of detection can be titrated by modifying the amount of protein, guide RNA, sample volume, and / or detector nucleic acid (e.g, detector RNA) (ifAtty Docket No.: BERK-527WO one is used). As such, for example, as would be understood by one of ordinary skill in the art, a number of controls can be used if desired in order to set up one or more reactions, each set up to detect a different threshold level of actNucleic Acid (e.g., actRNA, actDNA), and thus such a series of reactions could be used to determine the amount of actNucleic Acid (e.g., actRNA, actDNA) present in a sample (e.g., one could use such a series of reactions to determine that a actNucleic Acid (e.g., actRNA, actDNA) is present in the sample ‘at a concentration of at least X’).Labeled detector nucleic acid (e.g., detector FIN A or detector DNA)
[0182] In some cases, a subject method includes also contacting the sample (e.g., a sample comprising a actNucleic Acid (e.g., actRNA, actDNA) and a plurality of non- actNucleic Acid (e.g., actRNA, actDNA)s) with a labeled detector nucleic acid (e.g., detector RNA). For example, in some cases, a subject method includes contacting a sample with a labeled detector nucleic acid (e.g., detector RNA) comprising a fluorescence-emitting dye pair; the CRISPR-Cas effector protein cleaves the labeled detector nucleic acid (e.g., detector RNA) after it is activated; and the detectable signal that is measured is produced by the fluorescence-emitting dye pair. For example, in some cases, a subject method includes contacting a sample with a labeled detector nucleic acid (e.g., detector RNA) comprising a fluorescence resonance energy transfer (FRET) pair or a quencher / fluor pair, or both. In some cases, a subject method includes contacting a sample with a labeled detector nucleic acid (e.g., detector RNA) comprising a FRET pair. In some cases, a subject method includes contacting a sample with a labeled detector nucleic acid (e.g., detector RNA) comprising a fluor / quencher pair. Fluorescence-emitting dye pairs comprise a FRET pair or a quencher / fluor pair. In both cases of a FRET pair and a quencher / fluor pair, the emission spectrum of one of the dyes overlaps a region of the absorption spectrum of the other dye in the pair. As used herein, the term “fluorescence-emitting dye pair” is a generic term used to encompass both a “fluorescence resonance energy transfer (FRET) pair” and a “quencher / fluor pair,” both of which terms are discussed in more detail below. The term “fluorescenceemitting dye pair” is used interchangeably with the phrase “a FRET pair and / or a quencher / fluor pair.”
[0183] In some cases (e.g., when the detector nucleic acid (e.g., detector RNA) includes a FRET pair) the labeled detector nucleic acid (e.g., detector RNA) produces an amount of detectable signal prior to being cleaved, and the amount of detectable signal that is measured is reduced when the labeled detector nucleic acid (e.g.,Atty Docket No.: BERK-527WO detector RNA) is cleaved. In some cases, the labeled detector nucleic acid (e.g., detector RNA) produces a first detectable signal prior to being cleaved (e.g., from a FRET pair) and a second detectable signal when the labeled detector nucleic acid (e.g., detector RNA) is cleaved (e.g., from a quencher / fluor pair). As such, in some cases, the labeled detector nucleic acid (e.g., detector RNA) comprises a FRET pair and a quencher / fluor pair.
[0184] In some cases, the labeled detector nucleic acid (e.g., detector RNA) comprises a FRET pair. FRET is a process by which radiationless transfer of energy occurs from an excited state fluorophore to a second chromophore in close proximity. The range over which the energy transfer can take place is limited to approximately 10 nanometers (100 angstroms), and the efficiency of transfer is extremely sensitive to the separation distance between fluorophores. Thus, as used herein, the term “FRET” (“fluorescence resonance energy transfer”; also known as “Forster resonance energy transfer”) refers to a physical phenomenon involving a donor fluorophore and a matching acceptor fluorophore selected so that the emission spectrum of the donor overlaps the excitation spectrum of the acceptor, and further selected so that when donor and acceptor are in close proximity (usually 10 nm or less) to one another, excitation of the donor will cause excitation of and emission from the acceptor, as some of the energy passes from donor to acceptor via a quantum coupling effect. Thus, a FRET signal serves as a proximity gauge of the donor and acceptor; only when they are in close proximity to one another is a signal generated. The FRET donor moiety (e.g., donor fluorophore) and FRET acceptor moiety (e.g., acceptor fluorophore) are collectively referred to herein as a "FRET pair".
[0185] The donor-acceptor pair (a FRET donor moiety and a FRET acceptor moiety) is referred to herein as a “FRET pair” or a “signal FRET pair.” Thus, in some cases, a subject labeled detector nucleic acid (e.g., detector RNA) includes two signal partners (a signal pair), when one signal partner is a FRET donor moiety and the other signal partner is a FRET acceptor moiety. A subject labeled detector nucleic acid (e.g., detector RNA) that includes such a FRET pair (a FRET donor moiety and a FRET acceptor moiety) will thus exhibit a detectable signal (a FRET signal) when the signal partners are in close proximity (e.g., while on the same RNA molecule), but the signal will be reduced (or absent) when the partners are separated (e.g., after cleavage of the RNA molecule by a Cas13 protein).
[0186] FRET donor and acceptor moieties (FRET pairs) will be known to one of ordinary skill in the art and any convenient FRET pair (e.g., any convenient donor andAtty Docket No.: BERK-527WO acceptor moiety pair) can be used. Examples of suitable FRET pairs include but are not limited to those presented in Table 2. See also: Bajar et al. Sensors (Basel). 2016 Sep 14;16(9); and Abraham et al. PLoS One. 2015 Aug 3;10(8):e0134436.
[0187] Table 2. Examples of FRET pairs (donor and acceptor FRET moieties)(1 ) 5-(2-iodoacetylaminoethyl)aminonaphthalene-1 -sulfonic acid(2) N-(4-dimethylamino-3,5-dinitrophenyl)maleimide(3) carboxyfluorescein succinimidyl ester(4) 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene
[0188] In some cases, a detectable signal is produced when the labeled detector nucleic acid (e.g., detector RNA) is cleaved (e.g., in some cases, the labeled detector nucleic acid (e.g., detector RNA) comprises a quencher / fluor pair. One signal partner of a signal quenching pair produces a detectable signal and the other signal partner is a quencher moiety that quenches the detectable signal of the first signal partner (i.e., the quencher moiety quenches the signal of the signal moiety such that the signal from the signal moiety is reduced (quenched) when the signal partners are in proximity to one another, e.g., when the signal partners of the signal pair are in close proximity).
[0189] For example, in some cases, an amount of detectable signal increases when the labeled detector nucleic acid (e.g., detector RNA) is cleaved. For example, in some cases, the signal exhibited by one signal partner (a signal moiety) is quenched byAtty Docket No.: BERK-527WO the other signal partner (a quencher signal moiety), e.g., when both are present on the same RNA molecule prior to cleavage by a CRISPR-Cas effector protein. Such a signal pair is referred to herein as a “quencher / fluor pair”, “quenching pair”, or “signal quenching pair.” For example, in some cases, one signal partner (e.g., the first signal partner) is a signal moiety that produces a detectable signal that is quenched by the second signal partner (e.g., a quencher moiety). The signal partners of such a quencher / fluor pair will thus produce a detectable signal when the partners are separated (e.g., after cleavage of the detector nucleic acid (e.g., detector RNA) by a CRISPR-Cas effector protein), but the signal will be quenched when the partners are in close proximity (e.g., prior to cleavage of the detector nucleic acid (e.g., detector RNA) by a CRISPR-Cas effector protein).
[0190] A quencher moiety can quench a signal from the signal moiety (e.g., prior to cleave of the detector nucleic acid (e.g., detector RNA) by a CRISPR-Cas effector protein) to various degrees. In some cases, a quencher moiety quenches the signal from the signal moiety where the signal detected in the presence of the quencher moiety (when the signal partners are in proximity to one another) is 95% or less of the signal detected in the absence of the quencher moiety (when the signal partners are separated). For example, in some cases, the signal detected in the presence of the quencher moiety can be 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the signal detected in the absence of the quencher moiety. In some cases, no signal (e.g., above background) is detected in the presence of the quencher moiety.
[0191] In some cases, the signal detected in the absence of the quencher moiety (when the signal partners are separated) is at least 1 .2 fold greater (e.g., at least 1 .3f old , at least 1 .5 fold, at least 1 .7 fold, at least 2 fold, at least 2.5 fold, at least 3 fold, at least 3.5 fold, at least 4 fold, at least 5 fold, at least 7 fold, at least 10 fold, at least 20 fold, or at least 50 fold greater) than the signal detected in the presence of the quencher moiety (when the signal partners are in proximity to one another).
[0192] In some cases, the signal moiety is a fluorescent label. In some such cases, the quencher moiety quenches the signal (the light signal) from the fluorescent label (e.g., by absorbing energy in the emission spectra of the label). Thus, when the quencher moiety is not in proximity with the signal moiety, the emission (the signal) from the fluorescent label is detectable because the signal is not absorbed by the quencher moiety. Any convenient donor acceptor pair (signal moiety / quencher moiety pair) can be used and many suitable pairs are known in the art.Atty Docket No.: BERK-527WO
[0193] In some cases, the quencher moiety absorbs energy from the signal moiety (also referred to herein as a “detectable label”) and then emits a signal (e.g., light at a different wavelength). Thus, in some cases, the quencher moiety is itself a signal moiety (e.g., a signal moiety can be 6-carboxyfluorescein while the quencher moiety can be 6-carboxy-tetramethylrhodamine), and in some such cases, the pair could also be a FRET pair. In some cases, a quencher moiety is a dark quencher. A dark quencher can absorb excitation energy and dissipate the energy in a different way (e.g., as heat). Thus, a dark quencher has minimal to no fluorescence of its own (does not emit fluorescence). Examples of dark quenchers are further described in U.S. patent numbers 8,822,673 and 8,586,718; U.S. patent publications 20140378330, 20140349295, and 20140194611 ; and international patent applications: WO200142505 and WO200186001 , all if which are hereby incorporated by reference in their entirety.
[0194] Examples of fluorescent labels include, but are not limited to: an Alexa Fluor® dye, an ATTO dye (e.g., ATTO 390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 514, ATTO 520, ATTO 532, ATTO Rho6G, ATTO 542, ATTO 550, ATTO 565, ATTO Rho3B, ATTO Rho11 , ATTO Rho12, ATTO Thiol 2, ATTO Rho101 , ATTO 590, ATTO 594, ATTO Rho13, ATTO 610, ATTO 620, ATTO Rho14, ATTO 633, ATTO 647, ATTO 647N, ATTO 655, ATTO Oxa12, ATTO 665, ATTO 680, ATTO 700, ATTO 725, ATTO 740), a DyLight dye, a cyanine dye (e.g., Cy2, Cy3, Cy3.5, Cy3b, Cy5, Cy5.5, Cy7, Cy7.5), a FluoProbes dye, a Sulfo Cy dye, a Seta dye, an IRIS Dye, a SeTau dye, an SRfluor dye, a Square dye, fluorescein isothiocyanate (FITC), tetramethylrhodamine (TRITC), Texas Red, Oregon Green, Pacific Blue, Pacific Green, Pacific Orange, quantum dots, and a tethered fluorescent protein.
[0195] In some cases, a detectable label is a fluorescent label selected from: an Alexa Fluor® dye, an ATTO dye (e.g., ATTO 390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 514, ATTO 520, ATTO 532, ATTO Rho6G, ATTO 542, ATTO 550, ATTO 565, ATTO Rho3B, ATTO Rho11 , ATTO Rho12, ATTO Thiol 2, ATTO Rho101 , ATTO 590, ATTO 594, ATTO Rho13, ATTO 610, ATTO 620, ATTO Rho14, ATTO 633, ATTO 647, ATTO 647N, ATTO 655, ATTO Oxa12, ATTO 665, ATTO 680, ATTO 700, ATTO 725, ATTO 740), a DyLight dye, a cyanine dye (e.g., Cy2, Cy3, Cy3.5, Cy3b, Cy5, Cy5.5, Cy7, Cy7.5), a FluoProbes dye, a Sulfo Cy dye, a Seta dye, an IRIS Dye, a SeTau dye, an SRfluor dye, a Square dye, fluorescein (FITC), tetramethylrhodamine (TRITC), Texas Red, Oregon Green, Pacific Blue, Pacific Green, and Pacific Orange.Atty Docket No.: BERK-527WO
[0196] In some cases, a detectable label is a fluorescent label selected from: an Alexa Fluor® dye, an ATTO dye (e.g., ATTO 390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 514, ATTO 520, ATTO 532, ATTO Rho6G, ATTO 542, ATTO 550, ATTO 565, ATTO Rho3B, ATTO Rho11 , ATTO Rho12, ATTO Thiol 2, ATTO Rho101 , ATTO 590, ATTO 594, ATTO Rho13, ATTO 610, ATTO 620, ATTO Rho14, ATTO 633, ATTO 647, ATTO 647N, ATTO 655, ATTO Oxa12, ATTO 665, ATTO 680, ATTO 700, ATTO 725, ATTO 740), a DyLight dye, a cyanine dye (e.g., Cy2, Cy3, Cy3.5, Cy3b, Cy5, Cy5.5, Cy7, Cy7.5), a FluoProbes dye, a Sulfo Cy dye, a Seta dye, an IRIS Dye, a SeTau dye, an SRfluor dye, a Square dye, fluorescein (FITC), tetramethylrhodamine (TRITC), Texas Red, Oregon Green, Pacific Blue, Pacific Green, Pacific Orange, a quantum dot, and a tethered fluorescent protein.
[0197] Examples of ATTO dyes include, but are not limited to: ATTO 390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 514, ATTO 520, ATTO 532, ATTO Rho6G, ATTO 542, ATTO 550, ATTO 565, ATTO Rho3B, ATTO Rho11 , ATTO Rho12, ATTO Thiol 2, ATTO Rho101 , ATTO 590, ATTO 594, ATTO Rho13, ATTO 610, ATTO 620, ATTO Rho14, ATTO 633, ATTO 647, ATTO 647N, ATTO 655, ATTO Oxa12, ATTO 665, ATTO 680, ATTO 700, ATTO 725, and ATTO 740.
[0198] Examples of AlexaFluor dyes include, but are not limited to: Alexa Fluor® 350, Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 500, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 635, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor® 700, Alexa Fluor® 750, Alexa Fluor® 790, and the like.
[0199] Examples of quencher moieties include, but are not limited to: a dark quencher, a Black Hole Quencher® (BHQ®) (e.g., BHQ-0, BHQ-1 , BHQ-2, BHQ-3), a Qxl quencher, an ATTO quencher (e.g., ATTO 540Q, ATTO 580Q, and ATTO 612Q), dimethylaminoazobenzenesulfonic acid (Dabsyl), Iowa Black RQ, Iowa Black FQ, IRDye QC-1 , a QSY dye (e.g., QSY 7, QSY 9, QSY 21 ), AbsoluteQuencher, Eclipse, and metal clusters such as gold nanoparticles, and the like.
[0200] In some cases, a quencher moiety is selected from: a dark quencher, a Black Hole Quencher® (BHQ®) (e.g., BHQ-0, BHQ-1 , BHQ-2, BHQ-3), a Qxl quencher, an ATTO quencher (e.g., ATTO 540Q, ATTO 580Q, and ATTO 612Q), dimethylaminoazobenzenesulfonic acid (Dabsyl), Iowa Black RQ, Iowa Black FQ, IRDye QC-1 , a QSY dye (e.g., QSY 7, QSY 9, QSY 21 ), AbsoluteQuencher, Eclipse, and a metal cluster.Atty Docket No.: BERK-527WO
[0201] Examples of an ATTO quencher include, but are not limited to: ATTO 540Q, ATTO 580Q, and ATTO 612Q. Examples of a Black Hole Quencher® (BHQ®) include, but are not limited to: BHQ-0 (493 nm), BHQ-1 (534 nm), BHQ-2 (579 nm) and BHQ-3 (672 nm).
[0202] For examples of some detectable labels (e.g., fluorescent dyes) and / or quencher moieties, see, e.g., Bao et al., Annu Rev Biomed Eng. 2009;11 :25-47; as well as U.S. patent numbers 8,822,673 and 8,586,718; U.S. patent publications 20140378330, 20140349295, 20140194611 , 20130323851 , 20130224871 , 20110223677, 20110190486, 20110172420, 20060179585 and 20030003486; and international patent applications: WQ200142505 and WO200186001 , all of which are hereby incorporated by reference in their entirety.
[0203] In some cases, cleavage of a labeled detector nucleic acid (e.g., detector RNA) can be detected by measuring a colorimetric read-out. For example, the liberation of a fluorophore (e.g., liberation from a FRET pair, liberation from a quencher / fluor pair, and the like) can result in a wavelength shift (and thus color shift) of a detectable signal. Thus, in some cases, cleavage of a subject labeled detector nucleic acid (e.g., detector RNA) can be detected by a color-shift. Such a shift can be expressed as a loss of an amount of signal of one color (wavelength), a gain in the amount of another color, a change in the ration of one color to another, and the like.
[0204] For examples of detector nucleic acids and the use of CRISPR systems with trans cleavage activity, e.g., for nucleic acid detection, see, e.g., Huang et al., Biosensors (Basel). 2022 Sep 20;12(10):779; and Feng et al., Anal Chem. 2023 Jan 10;95(1):206-217.Kits
[0205] Also provided are kits / systems for carrying out a subject method. Such kits comprise various combinations of components useful in any of the methods described elsewhere herein.
[0206] A kit can further include one or more additional reagents, where such additional reagents can be any convenient reagent. Components of a subject kit can be in separate containers; or can be combined in a single container. In some cases one or more of a kit’s components are pharmaceutically formulated for administration to a human.Atty Docket No.: BERK-527WO
[0207] In addition to above-mentioned components, a subject kit can further include instructions for using the components of the kit to practice the subject methods (e.g., dosing instructions, instructions to administer the component(s) to an individual. The instructions for practicing the subject methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e. , associated with the packaging or subpackaging) etc. In some embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, flash drive, etc. In some embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.Exemplary Non-Limiting Aspects of the Disclosure
[0208] Aspects, including embodiments, of the present subject matter described above may be beneficial alone or in combination, with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the disclosure are provided below. As will be apparent to those of ordinary skill in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or following individually numbered aspects. This is intended to provide support for all such combinations of aspects and is not limited to combinations of aspects explicitly provided below. It will be apparent to one of ordinary skill in the art that various changes and modifications can be made without departing from the spirit or scope of the invention.1 . A method of activating a CRISPR-Cas effector protein with a nucleic acid of interest, the method comprising: contacting a capture nucleic acid (capNucleicAcid) with a CRISPR- Cas effector protein and a CRISPR-Cas guide RNA in the presence of a nucleic acid of interest (actNucleicAcid), wherein:(a) the capNucleicAcid comprises:Atty Docket No.: BERK-527WO an anchor region that hybridizes to the CRISPR-Cas guide RNA, and a capture region that hybridizes to the actNucleicAcid;(b) the CRISPR-Cas guide RNA comprises: a protein-binding region that binds to the CRISPR-Cas effector protein, and an 8-15 nucleotide (nt) guide sequence that hybridizes with the anchor region of the capNucleicAcid; and(c) said contacting results in activation of trans cleavage activity of the CRISPR-Cas effector protein.2. The method of 1 , wherein said contacting takes place inside of a cell that comprises the actNucleicAcid.3. The method of 2, wherein said contacting comprises introducing into the cell: (i) the capNucleicAcid, and (ii) the CRISPR-Cas guide RNA, or a nucleic acid encoding the CRISPR-Cas guide RNA.4. The method of 1 , wherein said contacting occurs in a sample that comprises the actNucleicAcid, and wherein said contacting does not take place inside of a cell.5. A method of detecting a nucleic acid of interest in a sample, the method comprising:(a) contacting a sample with:(i) a CRISPR-Cas effector protein;(ii) a CRISPR-Cas guide RNA comprising: a protein-binding region that binds to the CRISPR-Cas effector protein, and an 8-15 nucleotide (nt) guide sequence that hybridizes with an anchor region of a capture nucleic acid (capNucleicAcid);(iii) the capNucleicAcid, which comprises: said anchor region that hybridizes to the CRISPR-Cas guide RNA, and a capture region that hybridizes to a nucleic acid of interest (actNucleicAcid); and(iv) a labeled single stranded detector nucleic acid that does not hybridize with the CRISPR-Cas guide RNA; andAtty Docket No.: BERK-527WO(b) detecting a signal produced by cleavage of the single stranded detector nucleic acid by trans cleavage activity of the CRISPR-Cas effector protein, thereby detecting the actNucleicAcid.6. The method of any one of 1 -5, wherein the actNucleicAcid is an RNA (actRNA).7. The method of any one of 1 -5, wherein the actNucleicAcid is a DNA (actDNA).8. The method of any one of 1 -7, wherein the capNucleicAcid is an RNA (capRNA).9. The method of any one of 1 -7, wherein the capNucleicAcid is a DNA (capDNA).10. The method of any one of 1 -9, wherein the CRISPR-Cas effector protein is a Cas13 protein or a Cas 12 protein.11 . The method of any one of 1 -10, wherein the actNucleicAcid is 8-26 nucleotides (nt) long.12. The method of any one of 1 -10, wherein the actNucleicAcid is 8-16 nt long.13. The method of any one of 1 -10, wherein the actNucleicAcid is longer than 26 nucleotides and the 8-26 5’ most nucleotides of the actNucleicAcid hybridize to the capture region of the capNucleicAcid.14. The method of 13, wherein the actNucleicAcid is 30-5000 nt long.15. The method of any one of 1 -14, wherein the guide sequence of the guide RNA is 9-11 nt long.16. The method of any one of 1 -14, wherein the guide sequence of the guide RNA is 10 nt long.17. The method of any one of 1 -16, wherein the anchor region of the capRNA is 9-12 nt long.18. The method of any one of 1 -17, wherein the capture region of the capRNA is 10-21 nt long.19. The method of any one of 1 -18, wherein the capRNA is 20-45 nt long.20. The method of any one of 1 -18, wherein the capRNA is 30-40 nt long.21 . The method of any one of 1 -20, wherein the capRNA comprises a 5’ tail region that is positioned 5’ of the capture region.22. The method of 21 , wherein the 5’ tail region 1 -12 nt long.23. The method of 21 , wherein the 5’ tail region 3-7 nt long.24. The method of any one of 1 -23, wherein the capRNA comprises a 3’ region that is positioned 3’ of the anchor region.Atty Docket No.: BERK-527WO25. The method of 24, wherein the 3’ region is 1-10 nt long.26. The method of 24, wherein the 3’ region is 3-5 nt long.27. The method of any one of 1 -26, wherein the actNucleicAcid is a microRNA.28. The method of any one of 1 -26, wherein the actNucleicAcid is a human microRNA.29. The method of any one of 1 -28, wherein the actNucleicAcid in the sample is present in a range of from 1 aM to 1 nM.30. The method of any one of 1 -28, wherein the actNucleicAcid in the sample is present in a range of from 100 fM to 1 nM.31 . The method of any one of 1 -30, wherein the sample comprises from 3 RNAs to 107RNAs that differ from one another in nucleotide sequence.32. The method of any one of 1 -31 , wherein said detecting comprises measuring the amount of the signal produced by cleavage of the single stranded detector nucleic acid.33. The method of any one of 1 -32, wherein said detecting comprises: gold nanoparticle-based detection, fluorescence polarization, colloid phase transition / dispersion, electrochemical detection, fluorescent signal detection, semiconductor-based sensing, or any combination thereof.34. The method of any one of 1 -33, wherein the labeled single stranded detector nucleic acid is an RNA.35. The method of any one of 1 -34, wherein the labeled single stranded detector nucleic acid comprises a fluorescence-emitting dye pair.36. The method of any one of 1 -34, wherein the labeled single stranded detector nucleic acid comprises a quencher / fluor pair.37. The method of any one of 1 -36, wherein the labeled single stranded detector nucleic acid comprises one or more non-natural internucleoside linkages, one or more nucleic acid mimetics, one or more modified sugar moieties, one or more modified nucleobases, one or more locked nucleic acids (LNAs), one or more peptide nucleic acids (PNAs), one or more morpholino nucleic acids, one or more cyclohexenyl nucleic acids (CeNAs), or any combination thereof.38. The method of any one of 1 -37, wherein the actNucleicAcid is from a human.39. The method of any one of 1 -37, wherein the actNucleicAcid is from a virus, a parasite, a helminth, a fungus, a protozoan, a bacterium, or a pathogenic bacterium.Atty Docket No.: BERK-527WO40. The method of any one of 1 -37, wherein the actNucleicAcid is from a virus selected from: Zika virus, human immunodeficiency virus (HIV), hepatitis B virus, hepatitis C virus, herpes virus, herpes simplex virus I, herpes simplex virus II, papillomavirus, rabies virus, cytomegalovirus, human serum parvo- like virus, respiratory syncytial virus, varicella-zoster virus, measles virus, adenovirus, human T-cell leukemia viruses, Epstein-Barr virus, murine leukemia virus, mumps virus, vesicular stomatitis virus, Sindbis virus, lymphocytic choriomeningitis virus, wart virus, blue tongue virus, Sendai virus, feline leukemia virus, reovirus, polio virus, simian virus 40, mouse mammary tumor virus, dengue virus, rubella virus, west Nile virus, a coronavirus, and yellow fever virus.41 . The method of any one of 1 -37, wherein the actNucleicAcid is from pathogenic bacteria selected from: Mycobacterium tuberculosis, Streptococcus agalactiae, methicillin-resistant Staphylococcus aureus, Legionella pneumophila, Streptococcus pyogenes, Escherichia coli, Neisseria gonorrhoeae, Neisseria meningitidis, Pneumococcus, Cryptococcus neoformans, Treponema pallidum, Lyme disease spirochetes, Pseudomonas aeruginosa, Mycobacterium leprae, and Brucella abortus.42. The method of any one of 1 -37, wherein the actNucleicAcid is from a human cell, an animal cell, a plant cell, a cancerous cell, an infected cell, or a diseased cell.43. A kit for detecting a nucleic acid of interest, the kit comprising:(a) a CRISPR-Cas guide RNA comprising: a protein-binding region that can bind to a CRISPR-Cas effector protein, and an 8-15 nucleotide (nt) guide sequence that can hybridize with an anchor region of a capture nucleic acid (capNucleicAcid);(b) the capNucleicAcid, which comprises: said anchor region that can hybridize to the CRISPR-Cas guide RNA, and a capture region that can hybridize to a nucleic acid of interest (actNucleicAcid).44. The kit of 43, further comprising: a labeled single stranded detector nucleic acid that does not hybridize with the CRISPR-Cas guide RNA.45. The kit of 43 or 44, further comprising the CRISPR-Cas effector protein or a nucleic acid encoding the CRISPR-Cas effector protein.Atty Docket No.: BERK-527WO46. The kit of any one of 43-45, further comprising a positive control actNucleicAcid.47. The kit of any one of 43-46, wherein the actNucleicAcid is an RNA (actRNA).48. The kit of any one of 43-46, wherein the actNucleicAcid is a DNA (actDNA).49. The kit of any one of 43-48, wherein the capNucleicAcid is an RNA (capRNA).50. The kit of any one of 43-48, wherein the capNucleicAcid is a DNA (capDNA).51 . The kit of any one of 43-50, wherein the CRISPR-Cas effector protein is a Cas13 protein or a Cas 12 protein.52. The kit of any one of 43-51 , wherein the actNucleicAcid is 8-26 nucleotides (nt) long.53. The kit of any one of 43-51 , wherein the actNucleicAcid is 8-16 nt long.54. The kit of any one of 43-53, wherein the actNucleicAcid is longer than 26 nucleotides and the 8-26 5' most nucleotides of the actNucleicAcid hybridize to the capture region of the capNucleicAcid.55. The kit of 54, wherein the actNucleicAcid is 30-5000 nt long.56. The kit of any one of 43-55, wherein the guide sequence of the guide RNA is 9-11 nt long.57. The kit of any one of 43-55, wherein the guide sequence of the guide RNA is 10 nt long.58. The kit of any one of 43-57, wherein the anchor region of the capRNA is9-12 nt long.59. The kit of any one of 43-58, wherein the capture region of the capRNA is10-21 nt long.60. The kit of any one of 43-59, wherein the capRNA is 20-45 nt long.61 . The kit of any one of 43-59, wherein the capRNA is 30-40 nt long.62. The kit of any one of 43-61 , wherein the capRNA comprises a 5’ tail region that is positioned 5’ of the capture region.63. The kit of 62, wherein the 5’ tail region 1 -12 nt long.64. The kit of 62, wherein the 5’ tail region 3-7 nt long.65. The kit of any one of 43-64, wherein the capRNA comprises a 3’ region that is positioned 3’ of the anchor region.66. The kit of 65, wherein the 3’ region is 1-10 nt long.Atty Docket No.: BERK-527WOEXPERIMENTAL EXAMPLES
[0209] The following examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0210] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples therefore are not to be construed as limiting in any way the remainder of the disclosure.
[0211] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference. Reagents, cloning vectors, cells, and kits for methods referred to in, or related to, this disclosure are available from commercial vendors such as BioRad, Agilent Technologies, Thermo Fisher Scientific, Sigma-Aldrich, New England Biolabs (NEB), Takara Bio USA, Inc., and the like, as well as repositories such as e.g., Addgene, Inc., American Type Culture Collection (ATCC), and the likeExample 1 : miRNA detection with CRISPR-Cas13a using a split guide RNA ResultsRedesigning the Cas13a RNP to detect ssRNA <21 nt
[0212] We first characterized the lower limit of target RNA length that Cas13a can robustly detect using a conventional Cas13s RNP (Cas enzyme and gRNA). We used L. buccalis Cas13a (LbuCas13a) with a gRNA containing a 20nt seed region and tested three different target RNA lengths: (i) a 36nt target RNA containing a 20nt seguence complementary to the seed region, (ii) a 20nt target RNA complementary to the seed region, and (iii) a 10nt target RNA complementary to the first 10nt of theAtty Docket No.: BERK-527WO gRNA seed (FIG. 1 B, top). We quantified Cas13a activation for each target RNA at a range of concentrations by extracting the slope of the linear region of the reaction curve (fluorescence vs time) and plotting the slope (reaction rate) vs target concentration (FIG. 1 B, bottom; see FIG. 6A and Methods). We saw significantly reduced activation between the 36nt and 20nt targets at all concentrations tested and no activation from the 10nt target (p<0.001 ANOVA of slope between all slopes).
[0213] We estimated that the 36nt target RNA has an LOD of 2.7e4 copies / uL, while the 20nt target RNA has an LOD roughly 6x higher at 1 .6e5 copies / uL, using the Clinical and Laboratory Standards Institute guideline20. Critically, the 10nt target was not detected over the background signal. We tested a different 10nt target complementary to the second half of the gRNA seed region (1 Ont target B, position 11 -20) and found that it was also undetectable above background, even at a concentration of 1 e8 copies / uL (FIG. 6B). This reduced sensitivity for 20nt ssRNA targets and inability to detect 10nt ssRNA targets limits the utility of conventional Cas13a RNPs in applications where short ssRNAs are of interest, such as detecting miRNAs.
[0214] To overcome these limitations, we tested two different approaches to detect shorter ssRNA targets: (i) splitting the target RNA into two parts, one of which is the short ssRNA of interest (FIG. 1C, top) and (ii) splitting the gRNA within the seed region (FIG. 1 D, top). To test the ‘split target’ approach, we split the 36nt target in two at the midpoint of the 20nt seed complement region. Part A of the split target (light pink) is 15nt long (5nt 3’ flanking region and 10nt seed complement). Part B of the split target (yellow) is 21 nt long (1 Ont seed complement and 11 nt 5' tail). We then added split target part A, part B, or both at a concentration of 1 e7 copies / uL to the Cas13a RNP mixture. None of the conditions generated a reaction rate above the no target control (FIG. 1C, bottom).
[0215] We next tested the ‘split guide’ approach (FIG. 1 D, bottom) by similarly splitting the gRNA into two parts in the seed region. Part a (hot pink) contains the 30nt stem loop region and the first 10nt of the seed region. Part b (yellow) contains the remaining 10nt of the seed region. To test the ‘split guide’ strategy, we formed the RNPs by incubating Cas13a with equimolar amounts of split gRNA part a or split gRNA parts a and b and then added 36nt target RNA at 1e7 copies / uL. Only when all three RNA segments were present (split gRNA parts a, b, and target RNA) was a reaction rate generated that was significantly above the no target controls. The ‘split guide’ approach generated a signal that was roughly 28% of the full-lengthAtty Docket No.: BERK-527WO gRNA system (1 .09 ± SD 0.29 AU / s and 3.87 ± SD 0.16 AU / s, respectively). Together, these experiments suggest that splitting the gRNA is a viable strategy to detect short ssRNA where split gRNA part b is the target.
[0216] FIG.1 : Cas13a activated by ssRNA <20nt with a split gRNA. (A) Schematic illustrating ssRNA detection by Cas13a. Cas13a (light blue) complexes with a gRNA (hot pink) to form a Cas13a ribonucleoprotein complex (RNP). The RNP binds to target RNA (grey), activates, and cleaves quenched fluorophore reporters. (B) Top: Schematic illustrating a Cas13a full-length gRNA with a 20nt seed region (hot pink) complemented with a 10nt (yellow), 20nt (green), and 36nt (grey) target RNA. Bottom: Scatter plot showing reaction rate (AU / s) for Cas13a RNPs activated by 10nt, 20nt, and 36nt targets across a range of target concentrations (n = 3 technical replicates per target and concentration). Reaction rate is calculated as the slope of the linear region of the reaction progress curve (AU vs. time). Reaction rates for each target length are fit to a linear curve to compare limit of detection across different target lengths. Linear regression is plotted with 95% prediction bands. Cas13a and gRNA are equimolar at 25nM. (C) Top: Schematic illustrating split target approach, where gRNA (hot pink) complexes to two pieces of target RNA (A, in light pink, and B, in yellow), that together complement the 20nt seed region. Bottom: Reaction rates (AU / s) of different combinations of split target system compared to full-length gRNA and 36nt target RNA. Split target parts A and B are both at 1 e6 copies / uL in the final reaction, as is the full-length target. Cas13a and gRNA are equimolar at 25nM. Mean with three technical replicates is plotted. (D) Top: Schematic illustrating ‘split guide’ approach, where gRNA is split in two parts in the seed region, the first part, a (hot pink), contains the 30nt direct repeat region and 10nt of the seed region. The second part, b (yellow), contains the remaining 10nt of the seed region. The split gRNA complements to the full-length target RNA (36nt, with 20nt sequence complementary to the seed region, shown in grey). Bottom: Reaction rates (AU / s) of different combinations of the ‘split guide’ system compared to full-length gRNA and 36nt target RNA. Target RNA is at 1e6 copies / uL in the final reaction. Both parts of the split gRNA are at 25nM in the reaction, equimolar to the Cas13a. Full-length gRNA is also at 25nM. Mean with three technical replicates is plotted. Stats For C and D, we used pairwise analysis of the reaction rates between experimental conditions and negative controls using a Brown- Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for multiple comparisons. We report multiplicity-adjusted p-values.Atty Docket No.: BERK-527WONon-signif icant interactions (p>0.05) not plotted. * is p<0.05, ** is p<0.01 , *** is p<0.001 . See FIG. 6 for more details.
[0217] FIG.6: Supporting data for Figure 1. (A) Fluorescence intensity time course data for full-length gRNA and 36nt target RNA at two-fold dilutions ranging from 5e6 copies / uL to 1 .6e5 copies / uL in the final reaction. Each concentration of target RNA has three technical replicates; each replicate is plotted separately. Exponential or linear regression fit to data. Slope of the linear region is calculated and plotted in FIG. 1 B. Guide RNA equimolar to Cas13a at 25nM. (B) Scatter plot showing reaction rate (AU / s) for Cas13a RNPs activated by target RNA of different lengths and concentrations. Activation of Cas13a RNP is tested with 10nt target A or B at 1e8 copies / uL or both at 5e7 copies / uL each, for a total of 1e8 copies / uL of total RNA (A, yellow, complementary to the first 10nt of the gRNA seed region; B, pink, complementary to the final 10nt of the seed region). Activity with 10nt targets is compared to known activators: 20nt target RNA (green bar, squares, 1 e7 copies / uL) and 36nt target RNA (grey bar, circles, 1e6 copies / uL). Reaction rate is calculated as the slope of the linear region of the reaction progress curve (AU vs. time). Cas13a and gRNA are equimolar at 25nM. Stats For B we used pairwise analysis of the reaction rates between experimental conditions and negative controls using a Brown- Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for multiple comparisons. We report multiplicity- adjusted p-values. Non-significant interactions (p>0.05), * is p<0.05, “ is p<0.01.Split guide system enables detection of reaction-limiting 10nt FIN A targets
[0218] For the split gRNA system to be a useful strategy to detect short ssRNA, it must work when the short ssRNA that completes the split gRNA is the limiting reagent. In FIG. 1 D, we showed that the split guide strategy works when both parts of the split gRNA were equimolar to the Cas13a and the target RNA was the limiting reagent. We next tested the split guide strategy when the short ssRNA was limiting. To clarify the new roles of the RNAs in the Cas13a split guide system (FIG. 2A), we call the short ssRNA of interest the activating RNA, or ‘actRNA’ (yellow) and the remaining portion of the standard gRNA the ‘split gRNA’ (hot pink). The split gRNA contains the 30nt stem-loop region and a portion of the seed region that we call the ‘anchor region’ (light pink). The target RNA from the conventional guide system is now called the capture RNA, or ‘capRNA' (grey). It is added to the split guide system and fully complements to the anchor region of the split gRNA, becoming a part of the RNP. The capRNA also contains a sequence complementary to theAtty Docket No.: BERK-527WO actRNA (short ssRNA of interest), which we call the ‘capture region’ (yellow). The capRNA thus holds the split gRNA and actRNA together, completing the dsRNA seed region. With the Cas13a split guide system, we change only the capture region sequence to detect different actRNAs.
[0219] We tested the split guide system for short ssRNA detection using a 10nt acRNA where the Cas13a, split gRNA, and capRNA are equimolar and the actRNA is the limiting reagent (FIG. 2B). We successfully detected the 10nt actRNA at 1e6 copies / uL over the no target control; the background-subtracted reaction rate for the split guide system with a 10nt actRNA was roughly 20% that of the full-length guide system with a 36nt actRNA (0.37 ± SEM 0.06 AU / s and 1 .9 ± SEM 0.03 AU / s, respectively; FIG. 7A).
[0220] While an improvement over the lack of 10nt ssRNA detection by conventional gRNA, the sensitivity of the split guide system is limited in part by the background activity of the RNP and capRNA in the absence of actRNA, which was significantly higher than that of the full-length guide system (0.12 ± SEM 0.02 AU / s and 0.051 ± SEM 0.003 AU / s, respectively, from FIG. 2B). Since the capRNA could be binding the split gRNA and causing activation of the Cas13a RNP without actRNA, we tested whether different concentrations of capRNA (FIG. 2C) and different lengths and sequences (FIG. 2D) could reduce the background signal.
[0221] We found that decreasing the capRNA concentration from 25nM to 1.7nM (~15x decrease) reduced the activity with and without the 10nt actRNA (FIG. 2C). However, when we subtracted the background activity, the reaction rates were not significantly different between the 25nM and 1 .7nM capRNA conditions (0.52 ± SEM 0.04 AU / s and 0.49 ± SEM 0.06 AU / s, respectively; FIG. 7B). Further decreasing the capRNA concentration to 170pM and 17pM decreased the background to practically zero, but also decreased the positive signal such that it was not significantly higher than the background. In subsequent experiments, we used 25nM or 2.5nM capRNA, depending on whether we wanted to maximize the positive signal (25nM) or minimize the background signal (2.5nM).
[0222] Next we tested four different capRNAs with varied lengths and sequences but constant anchor and capture regions (FIG. 2D). We compared our original 36nt capRNA (capRNA 1 , shown in blue with two asterisks) with a new 36nt capRNA (capRNA 2). Both had the same 10nt anchor and 10nt capture regions, but different sequences for the 3’ flanking region (5nt) and the 5’ tail (11 nt). CapRNAs 1 and 2 had drastically different levels of background activity (1 .2 ± SEM 0.1 AU / s and 0.08 ± SEM 0.01 AU / s, respectively) but similar levels of activity in the presence of theAtty Docket No.: BERK-527WO10nt actRNA (1 .5 ± SD 0.04 AU / s and 1 .6 ± SEM 0.1 AU / s, respectively), such that their background-subtracted reaction rates were significantly different (adjusted p- value of 0.0050; FIG. 7C). Of note, capRNA 2 had such a high background that the positive reaction rate was not significantly different from the background (adjusted p-value of 0.0503). Similarly, when the 5’ tail was increased to 18nt (capRNA 3), the 10nt actRNA reaction rate was not significantly different from the background (adjusted p-value of 0.3969). However, when the 5’ tail was reduced to 7nt (capRNA 4), the background reaction rate decreased such that the 10nt actRNA reaction rate was significantly higher (adjusted p-value of 0.0003). When considering the difference in the positive signal over the background, capRNA 4 (7nt 5’ tail) performed significantly better than sequence-matched capRNA 2 (11 nt 5’ tail) and capRNA 3 (18nt 5’ tail) but performed similarly to capRNA 1 (original 11 nt 5’ tail) (FIG. 7C). We further tested capRNA 1 to evaluate the importance of the 3’ flanking sequence and the 5’ tail and found that deleting either 3’ flank or 5’ tail reduced the 10nt actRNA reaction rate (FIG. 7D).
[0223] With capRNA 1 at 2.5nM, our estimated limit of detection for a 10nt actRNA is 1 .2e5 copies / uL (FIG. 2E), significantly better than our inability to detect a 10nt target RNA with a full-length gRNA (FIG. 1 B). Unless otherwise noted, we use capRNA 1 for subsequent experiments.
[0224] FIG. 2: Cas13a detects 10nt ssRNA with split guide system. (A) Schematic illustrating the standard full-length guide system (left) and introducing the split guide system and nomenclature (right). The full-length gRNA is split in two in the seed region. The first part of the gRNA is referred to as the split gRNA (hot pink). The second part of the gRNA is now called the activating RNA, or actRNA (yellow); it is the limiting reagent of the system. In the split guide system, the target RNA becomes the capture RNA, or capRNA. The capRNA complements to the split gRNA via the anchor region (light pink) and the actRNA via the capture region (pale yellow). (B) Test of the split guide system. Reaction rates (AU / s) plotted for split guide system with or without capRNA 1 (labelled on axis) and with (yellow bars, triangles) or without actRNA (grey bars, empty circles). Cas13a, split gRNA (1 Ont anchor), and capRNA (36nt) all equimolar at 25nM. 10nt actRNA at 1e6 copies / uL. For the full-length guide system, gRNA is equimolar to Cas13a at 25nM and 36nt target is at 1 e6 copies / uL. Mean reaction rate (AU / s) with three technical replicates plotted. (C) Test of the split guide system with varied capRNA concentrations to determine the effects on actRNA detection over background signal. For the split guide system, capRNA 1 concentration was tested ranging from 25nM to 17pM. AtAtty Docket No.: BERK-527WO each capRNA concentration, the reaction was tested with actRNA (yellow bars, triangles) or without actRNA (grey bars, empty circles). Cas13a and split gRNA are at 25nM. 10nt actRNA is at 1 e6 copies / uL in the final reaction. For the full-length guide system, gRNA is equimolar to Cas13a at 25nM and 36nt target is at 1 e6 copies / uL. Mean reaction rate (AU / s) with three technical replicates plotted. (D) Top: Schematic illustrating the split guide system with split gRNA (1 Ont anchor) and 10nt actRNA bound to different capRNAs. The sequence of the anchor and capture regions are held constant, but the length of the 5’ tail of capRNA varies. For capRNAs 3, 2, and 4, shown in light grey with 18nt, 11 nt, and 7nt 5’ tails, respectively, the sequences of the 5’ tail and 3’ flanking sequence are constant. For capRNA 1 , shown in blue with an 11 nt 5’ tail, the sequences of the 5’ tail and 3’ flanking sequences are different from the length-matched capRNA 2. Bottom: For each capRNA species, the reaction was tested with actRNA (yellow bars, triangles) or without actRNA (grey bars, empty circles). Cas13a and split gRNA present at 25nM, capRNA at 2.5nM. Reaction rate (AU / s) shown with and without 10nt actRNA at 1 e6 copies / uL. For the full-length guide system, gRNA is equimolar to Cas13a at 25nM and 36nt target is at 1 e6 copies / uL. Mean reaction rate (AU / s) with three technical replicates plotted. (E) Limit of detection of 10nt actRNA determined with optimized reaction conditions. LOD of 1 Ont actRNA was tested with Cas13a equimolar to split gRNA (1 Ont anchor) at 25nM and capRNA 1 at 2.5nM. Concentration of 10nt actRNA tested at 2-fold dilutions from 1e7 copies / uL to 4e4 copies / uL. Reaction rate (AU / s) plotted for each of three technical replicated across range of actRNA concentrations. Linear regression fit to the reaction rate data and plotted with 95% prediction bands. Stats For B, C, and D, we used pairwise analysis of the reaction rates for each experimental conditions with and without actRNA using a Brown-Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for multiple comparisons. We report multiplicity-adjusted p-values. Non-significant interactions (p>0.05) not plotted. * is p<0.05, ** is p<0.01 , *** is p<0.001. See Figs. 7 and 8 for more details.
[0225] FIG. 7 Supporting Data for Figure 2. (A) Supporting figure for Fig. 2b. Reaction rate (AU / s) for split guide or full-length guide system with the mean background activity subtracted (Cas13a RNP and capRNA alone for split guide system, or Cas13a RNP alone for the full-length guide system). Cas13a, split gRNA, and capRNA 1 are equimolar at 25nM. 10nt actRNA at 1 e6 copies / uL. For the full- length guide system, gRNA is equimolar to Cas13a at 25nM and 36nt target is at 1e6 copies / uL. Mean reaction rate (AU / s) with mean background activity subtracted is plotted with SEM (n=3). (B) Supporting figure for Fig. 2c. Reaction rate (AU / s) forAtty Docket No.: BERK-527WO split guide or full-length guide system with the mean background activity subtracted. Cas13a and split gRNA are equimolar at 25nM. Concentration of capRNA 1 varies from 25nM to 17pM. 10nt actRNA at 1 e6 copies / uL. For the full- length guide system, gRNA is equimolar to Cas13a at 25nM and 36nt target is at 1 e6 copies / uL. Mean reaction rate (AU / s) with mean background activity subtracted is plotted with SEM (n=3). (C) Supporting figure for Fig. 2d. Reaction rate (AU / s) for split guide or full-length guide system with the mean background activity subtracted. Cas13a and split gRNA are equimolar at 25nM. CapRNA is at 2.5nM, but capRNA species varies. See Fig 2d for details on capRNAs tested. 10nt actRNA at 1 e6 copies / uL. For the full-length guide system, gRNA is equimolar to Cas13a at 25nM and 36nt target is at 1 e6 copies / uL. Mean reaction rate (AU / s) with mean background activity subtracted is plotted with SEM (n=3). (D) Left: Schematic illustrating the split guide system with split gRNA (1 Ont anchor) and 10nt actRNA bound to different capRNAs. The sequence of the anchor and capture regions are held constant, but the presence of the 3’ flank or 5’ tail varies. Right: For each capRNA species, the reaction was tested with actRNA (yellow bars, triangles) or without actRNA (grey bars, empty pink circles). Cast 3a, split gRNA, and capRNAs are present at 25nM. Reaction rate (AU / s) shown with and without 10nt actRNA at 1 e6 copies / uL. For the full-length guide system, gRNA is equimolar to Cas13a at 25nM and 36nt target is at 1 e6 copies / uL. Mean reaction rate (AU / s) with three technical replicates plotted. Stats For B, C, and D, we performed a Brown- Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for follow-up testing of key experimental conditions. We report multiplicity- adjusted p-values. Non-significant interactions are p>0.05. * is p<0.05, “ is p<0.01 .
[0226] FIG. 8: Predicted structures for split gRNA-capRNA complex. Predicted complex structure with same split gRNA (10nt anchor region) and varying capRNAs. Split gRNA highlighted in pink. On capRNA, anchor region highlighted in pink and capture region is highlighted in yellow. For capRNA 1 and 9, the sequence of the 3’ flanking region is such that there is an additional 1 nt of complementary base pairing with the split gRNA, making the anchor region effectively 1 1 nt. Complex structure predicted with the NUPACK web application.Split guide system detects 8 to 24nt-long actRNA
[0227] We next investigated the limits of short ssRNA detection with the split guide system and its robustness to variations in the anchor and capture regions.Atty Docket No.: BERK-527WO
[0228] The initial configuration for testing the split guide system used a split gRNA with a 10nt anchor region and a 10nt actRNA, which together replaced the 20nt seed region of a full-length gRNA. We next tested whether the split gRNA system could detect actRNAs with different lengths by varying the ratio of anchor to actRNA length while maintaining a constant 20nt combined length and sequence (FIG. 3A, top). We varied the length of the anchor region from 5nt to 12nt, complemented with an actRNA ranging from 15nt to 8nt. When adding actRNA at 1 e7 copies / uL, we saw significant activation over background from an anchor region as small as 9nt and as long as 12nt (FIG. 3A, bottom, and FIG. 9A). The greatest activation over background was from the 10nt anchor plus 10nt actRNA and the 12nt anchor plus 8nt actRNA (2.9 ± SEM 0.2 AU / s, and 3.1 ± SEM 0.4 AU / s, respectively). The 12nt anchor, however, had the highest background activation, so we selected the 10nt anchor for further testing (FIG. 9A).
[0229] With the 10nt anchor split gRNA, we next tested detection of actRNA of increasing length paired with capRNAs of different lengths (FIG. 3B, top). We first tested actRNA from 10 to 24nt long paired with short capRNA 5 (1 Ont capture region, in blue). With capRNA 5, all actRNA binds to the 10nt capture region but has variable lengths of unbound RNA. When tested with 1 e6 copies / uL of actRNA, all actRNA lengths were detectable above background except the 10nt and 21 nt actRNAs (adjusted p-value of 0.4728 and 0.1887, respectively; FIG. 3B, bottom, blue bars, and FIG. 9C, left panel).
[0230] We then tested whether the signal would improve if more nucleotides of the actRNA were bound. We paired the actRNA with capRNA 6 (17nt capture region, in orange) or capRNA 7 (21 nt capture region, in grey). The 10nt, 13nt, 15nt, and 17nt actRNA paired with capRNA 6 were all detectable above background (FIG. 3B, bottom, orange bars, and FIG. 9C, middle panel). The 20nt, 21 nt, and 24nt actRNAs paired with capRNA 7 were also all detectable above background (FIG. 3B, bottom, grey bars, and FIG. 9C, right panel).
[0231] Of the actRNAs that were detectable with both capRNAs tested (13nt, 15nt, 17nt, 20nt, and 24nt), a subset had significantly different background-subtracted reaction rates between the two capRNAs: for the 15nt and 20nt actRNAs, the longer capRNAs resulted in a higher signal than the short capRNA 5 (1 Ont capture region). Critically, both the 10nt and 21 nt actRNA, which weren’t detectable above background with capRNA 5, were detectable with capRNAs 6 and 7, respectively. Together, these results demonstrate the important role the capRNA plays in the success of the split guide system.Atty Docket No.: BERK-527WO
[0232] Finally, we wanted to confirm that the split gRNA performance was not dependent on the specific sequences we initially chose and would work with different capture and anchor region sequences. We built a second split guide system with capRNA and split gRNA based on a previously validated gRNA with a 20nt seed (full-length gRNA 2). Split gRNA 2 (blue) had the same direct repeat sequence as split gRNA 1 (hot pink), but a different 10nt anchor region (FIG. 3C, top, and FIG. 10A and FIG. 10B). The capture regions for the capRNAs in both systems were the same length but different sequences. For both split gRNAs, we tested a 10nt and 21 nt actRNA at 1e6 copies / uL. Split guide system 2 detected both actRNAs above background and showed the same trend as the split system 1 where the 10nt actRNA resulted in higher activity than the 21 nt actRNA (FIG. 3C, bottom, and FIG. 10C). However, when comparing the activity of the 10nt and 21 nt actRNAs relative to the full-length control, the split guide system 2 performed proportionally better than the split guide system 1 . The 10nt actRNA was 46% of the control and the 21 nt actRNA was 22% of the control for split guide system 2, whereas the 10nt actRNA was 27% of the control and the 21 nt actRNA was 11% of the control for split guide system 1 (FIG. 10D).
[0233] With optimized selection of the split gRNA (anchor length and sequence) and capRNA (length and sequence), the split guide system can detect actRNA ranging from 8nt to at least 24nt.
[0234] FIG. 3: Split guide system works across a range of RNA lengths and sequences. (A) Top: Schematic illustrating the split gRNA (hot pink) with varied length of its anchor region (ranging from 5 to 12nt) and the corresponding actRNA (yellow, ranging from 15 to 8nt) such that the anchor plus capture region remains constant at 20nt. Bottom: Reaction rate (AU / s) of different split gRNA and actRNA pairs with the mean background activity of the Cas13a RNP and capRNA alone subtracted. Cas13a, split gRNA, and capRNA 1 are equimolar at 25nM. All actRNA is at 1e7 copies / uL in the final reaction. Mean reaction rate (AU / s) with mean background activity subtracted is plotted with SEM (n=3). (B) Top: Schematic illustrating split guide system with actRNA (yellow) of increasing length, ranging from 10nt to 24nt. All actRNA are paired with capRNA 5 (blue) containing a 10nt capture region and either the capRNA 6 (orange) with a 17nt capture region or capRNA 7 (grey) with a 21 nt capture region. Thus, actRNA may either complement perfectly with a capRNA with a blunt end (1 Ont actRNA with capRNA 5, 17nt actRNA with capRNA 6) or there may be an overhang of the actRNA (17nt actRNA with capRNA 5 has a 7nt overhang of the actRNA) or the capRNA (20nt actRNAAtty Docket No.: BERK-527WO with capRNA 7 has a 1 nt overhang of the capRNA). Bottom: Reaction rate (AU / s) of different actRNA and capRNA pairs, with mean background activity of the Cas13a RNP and capRNA alone subtracted. For each actRNA, background- subtracted reaction rate for two different capRNAs is plotted. All actRNA are paired with the capRNA 5 (blue bars, triangles) and either capRNA 6 (orange bars, empty circles) or capRNA 7 (grey bars, circles). For each actRNA, the background- subtracted reaction rate is compared between the two capRNA conditions. Cas13a is equimolar to split gRNA (1 Ont anchor) at 25nM. All capRNA is at 2.5nM, and all actRNA is at 1 e6 copies / uL in the final reaction. Mean reaction rate (AU / s) with mean background activity subtracted is plotted with SEM (n = 3). (C) Top: Schematic illustrating two different split guide systems. Split gRNA 1 (hot pink) with actRNA 1 (yellow) and capRNA 1 (grey) are the same sequence as previously tested in this paper. Split gRNA 2 (blue) with actRNA 2 (blue) and capRNA 8 (grey) are distinct RNA sequences from split guide system 1. Both systems are tested with a 10nt and 21 nt actRNA and compared to their sequence-matched full-length gRNA variants. Bottom: Split guide system works with different RNA sequences. Split gRNA 1 is tested with a 10nt and 21 nt actRNA and compared to full-length gRNA 1 with a 36nt target. The same is shown for split gRNA 2 and full-length gRNA 2. All reaction rates are reported with mean background activity subtracted. For split guide systems, Cas13a is equimolar to split gRNA at 25nM, capRNA is at 2.5nM, and actRNA is at 1 e6 copies / uL. For full-length guide systems, Cas13a is equimolar to gRNA at 25nM, and target RNA is at 1 e6 copies / uL. Mean reaction rate (AU / s) with mean background activity subtracted is plotted with SEM (n=3). Stats In B, for each actRNA, the background-subtracted reaction rate is compared between the two capRNA conditions using a Brown- Forsythe ANOVA to account for variation in standard deviation and Dunnet's T3 test for multiple comparisons. We report multiplicity-adjusted p-values. Non-significant interactions (p>0.05) are not plotted. * is p<0.05, ** is p<0.01 , *** is p<0.001 . See FIG. 9 and FIG. 10 for more details.
[0235] FIG. 9: Supporting Data for Figure 3. (A) Supporting figure for FIG. 3A. For each split gRNA species, the reaction was tested with corresponding actRNA (yellow bars, rhombuses) or without actRNA (grey bars, empty circles). Cas13a, split gRNAs, and capRNA 1 are equimolar at 25nM. All actRNA is at 1e7 copies / uL in the final reaction. Mean reaction rate (AU / s) with three technical replicates plotted. (B) The melting temperature (°C) of the capture region versus anchor region is plotted for each split gRNA and actRNA pair. For a given pair, if the signal wasAtty Docket No.: BERK-527WO detected over background (see A), the dot is colored pink. If not, the dot is colored blue. Grey dotted lines at 37°C mark the reaction temperature. (C) Supporting data for FIG 3B. Left: Reaction rate (AU / s) of actRNA of varying lengths paired with capRNA 5 (1 Ont capture region). Middle: Reaction rate (AU / s) of subset of actRNA paried with capRNA 6 (17nt capture region). Right: Reaction rate (AU / s) of subset of actRNA paired with capRNA 7 (21 nt capture region). Cas13a is equimolar to split gRNA (1 Ont anchor) at 25nM. All capRNA is at 2.5nM, and all actRNA is at 1e6 copies / uL in the final reaction. Mean reaction rate (AU / s) with three technical replicates plotted. All reactions compared to control with no actRNA. (D) For each capRNA-actRNA combo, the background-subtracted reaction rate (see Fig. 3b) is plotted versus the melting temperature of the capture region (°C). Data for the 10nt capture region (capRNA 5) is shown with blue triangles, 17nt capture region (capRNA 6) in orange circle outlines, and the 21 nt capture region (capRNA 7) in solid black circles. Dashed lines connect points for the same actRNA paired with different capRNAs to emphasize the change in signal. ActRNA length is labelled next to the data points. Grey dotted line marks the reaction temperature (37°C). Stats For A and C, we performed a Brown-Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for follow-up testing of experimental conditions versus their appropriate no target control. We report multiplicity-adjusted p-values. Non-significant interactions are p>0.05. * is p<0.05, ** is p<0.01 , *** is p<0.001.
[0236] FIG. 10: Comparison of two sequence-unique split guide systems. (A,B) Predicted complex structure for gRNA system 1 (A) and 2 (B). Top row is full- length gRNA bound to a 36nt target. Middle row is split gRNA bound to capRNA. Bottom row is split gRNA and 21 nt actRNA bound to capRNA. Stability of complex reported as free energy (AG, kcal / mol). Complex structures and free energy predicted with the NUPACK web application. (C) Supporting figure for FIG. 3C. Reaction rates (AU / s) for gRNA system 1 and 2, either split gRNA paired with 21 nt or 10nt actRNA or full-length gRNA paired with a 36nt target. All conditions compared to their appropriate no actRNA control. For split guide systems, Cas13a is equimolar to split gRNA at 25nM, capRNA is at 2.5nM, and actRNA is at 1 e6 copies / uL. For full-length guide systems, Cas13a is equimolar to gRNA at 25nM, and target RNA is at 1 e6 copies / uL. Mean reaction rate (AU / s) is plotted with SEM (n=3). (D) Supporting figure for FIG. 3C. Background-subtracted reaction rates are normalized by dividing by the background-subtracted reaction rate of the full-length gRNA with a 36nt target RNA. This normalized reaction index is plotted with SEMAtty Docket No.: BERK-527WO(n=3). Normalized values are reported to the right of the bars. (E) For each capRNA-actRNA combo, the mean background-subtracted reaction rate and SEM (n=3, see Fig. 3c) is plotted versus the predicted melting temperature of the capture region (°C). Data for gRNA 1 system is plotted with pink circles, while data for gRNA 2 system is plotted with blue outlined triangles. ActRNA length is labelled next to the data points. Grey dotted line marks the reaction temperature (37°C). Stats For C, we performed a Brown- Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for follow-up testing of experimental conditions versus their appropriate no actRNA control. We report multiplicity- adjusted p-values. Non-significant interactions are p>0.05. * is p<0.05, ** is p<0.01.Split guide system is specific against RNA mismatches and misalignments
[0237] For the Cas13a split guide system to be a useful strategy for molecular diagnostics and RNA discovery, it must demonstrate target specificity. We sought to characterize the specificity of the system to on-target vs off-target actRNA, looking at mismatches between the actRNA and capRNA, and extensions and truncations of the actRNA.
[0238] We first tested our system for specificity in the presence of 2nt consecutive mismatches. We tiled 2nt mismatches across the first 10nt of a 17nt actRNA and paired them with capRNA 5 (1 Ont capture region) (FIG. 4A, top). When we added actRNA at 1 e7 copies / uL, which produces a strong signal in the no mismatch condition, we saw a total reduction in signal for all the mismatch conditions (FIG. 4A, bottom). We also tested specificity for mismatches with capRNA 6 (17nt capture region) that binds the entire 17nt actRNA and saw a partial reduction in activity for all mismatch conditions except when the mismatch was at positions 3-4 (FIG. 11 A, bottom).
[0239] We next investigated how the split guide system performed when probed with ssRNA segments that were misaligned with the capture region. We first tested actRNA that extended into the split gRNA, resulting in a 1 -5nt overlap (FIG. 4B, top). We hypothesized that this overlap would sterically hinder the actRNA from nestling in the groove of the Cas13a RNP’s nuclease lobe, since the spacing between the split gRNA and actRNA is controlled by the sequence of the capRNA. At 1e7 copies / uL of actRNA, we saw significant reduction in signal with a 1 nt overlap and complete reduction in signal for 2-5nt overlaps (FIG. 4B, bottom). We then tested the effect of truncated and misaligned actRNA that introduced gaps between the split gRNA and the start of the actRNA. We either truncated the 5' endAtty Docket No.: BERK-527WO of a 10nt actRNA to create 1 -2nt gaps or misaligned a 17nt actRNA to introduce 1 - 4nt gaps (FIG. 40, top). The truncated actRNA with a 1 nt and 2nt gap both showed a complete reduction in activity relative to the full-length actRNA with no gap (FIG. 4C, bottom, green bars). Importantly, we know that both truncated actRNAs are detectable when no gaps are present, so the reduction in signal can’t be fully attributed to the decreased binding interaction with the capRNA (FIG. 3A). With the misaligned 17nt actRNA, we saw a partial reduction in activity at a 1 nt and 2nt gap, and a complete reduction to background levels for a 4nt gap (FIG. 4C, bottom, grey bars).
[0240] These results show that the split guide system has high specificity against actRNA containing mismatches and modest specificity against actRNA that are misaligned with the capture region.
[0241] FIG. 4: Split guide system is specific against RNA mismatches and misalignments. (A) Top: Schematic illustrating test of mismatch sensitivity. The split gRNA (hot pink, 10nt anchor) and 17nt actRNA (yellow) containing a 2nt mismatch tiled across the first 10nt of the actRNA are bound to capRNA 5. The capRNA contains a 10nt anchor region and a 10nt capture region, such that only the first 10nt of the actRNA bind to the capRNA, leaving 7nt unbound on the 3’ end of the actRNA. Bottom: Split guide system is tested with 17nt actRNA containing 2nt mismatches. Cas13a is equimolar to split gRNA at 25nM, capRNA 5 is at 2.5nM, and all actRNA is at 1 e7 copies / uL. Mean reaction rate (AU / s) is plotted with three technical replicates. All reactions are compared to the actRNA with no mismatches. (B) Top: Schematic illustrating test of overlap sensitivity. Split gRNA (hot pink, 10nt anchor) is paired with actRNA (yellow) ranging from 10 to 15nt, with the actRNA overlapping the anchor region of the split gRNA up to 5nt. The region of the actRNA that overlaps the split gRNA has the same sequence as the split gRNA. The split gRNA and actRNA complement to capRNA 1 . Bottom: Split guide system is tested with actRNA that increasingly overlaps the anchor region of the split gRNA. Cas13a is equimolar to split gRNA at 25nM, capRNA 1 is at 2.5nM, and all actRNA is at 1e7 copies / uL. Mean reaction rate (AU / s) is plotted with three technical replicates. All reactions are compared to the actRNA with no overlap (overlap length = 0). (C) Top: Schematic illustrating test of gap sensitivity. In top schematic, split gRNA (hot pink, 10nt anchor) is shown with actRNA (yellow) of decreasing lengths: a 10nt actRNA with no gap and an 8nt actRNA with a 2nt gap between the 3’ end of the split gRNA and the 5’ end of the actRNA. All are in complex with capRNA 1 . The bottom schematic shows the same split gRNA adjacent to a 17nt actRNA. Multiple 17nt actRNAs are tested with a gap betweenAtty Docket No.: BERK-527WO the 3’ end of the split gRNA and the 5’ end of the actRNA. The gap size ranges from Ont to 4nt. The split gRNA and 17nt actRNAs are in complex with capRNA 6 containing a 17nt capture region. Thus, as the gap size increases, the portion of the actRNA that binds to the capRNA decreases (for a gap of 4nt, only the first 13nt of the actRNA bind). Bottom: Split guide system is tested for sensitivity to gaps between split gRNA and actRNA. Top four bars (yellow, triangles) show split gRNA with actRNA of decreasing length (1 Ont to 8nt) with capRNA 1 . Bottom five bars (grey, circles) show split gRNA with 17nt actRNA bound to capRNA 6. Cas13a is equimolar to split gRNA at 25nM, capRNA is at 2.5nM, and all actRNA is at 1 e7 copies / uL. Mean reaction rate (AU / s) is plotted with three technical replicates. All reactions are compared to the actRNA with no gap (gap length = 0). Stats In A, B, and C for reaction rate of experimental conditions is compared to the appropriate control (for A, the no mismatch actRNA, for B, the no gap actRNA, and for C, the no overlap actRNA) using a Brown- Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for multiple comparisons. We report multiplicity-adjusted p-values. Non-significant interactions are p>0.05, * is p<0.05. See FIG. 11 for more details.
[0242] FIG. 11 : Supporting Data for Figures 4 and 5. (A) Supporting figure for FIG. 4A. Top: Schematic illustrating further testing of mismatch sensitivity. The split gRNA (hot pink, 10nt anchor) and 17nt actRNA (yellow) containing a 2nt mismatch tiled across the first 10nt of the actRNA are bound to capRNA 6. CapRNA 6 contains a 10nt anchor region and a 17nt capture region, such that the entire actRNA binds to the capRNA. Bottom: Reaction rates (AU / s) for all mismatch actRNAs paired with capRNA 6. Cas13a is equimolar to split gRNA at 25nM, capRNA 6 is at 2.5nM, and all actRNA is at 1e7 copies / uL. Mean reaction rate (AU / s) is plotted with three technical replicates. All reactions are compared to the actRNA with no mismatches. (B) Test of synthetic 17nt actRNA detection in total cell RNA background. Cell RNA, extracted from Lenti-X HEK 293T cells (grey bars), Jurkat (pink bars), or HL- 60 cells (yellow bars), is added at three different concentrations in the final reaction. Cas13a is equimolar to split gRNA at 25nM, capRNA 6 (17nt capture region) is at 2.5nM, and 17nt actRNA is at 1e7 copies / uL. For each concentration and species of cell RNA, mean background-subtracted reaction rate (AU / s) is plotted with SEM (n=3). Stats For A, we performed a Brown-Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for follow-up testing of experimental conditions versus the actRNA with no mismatches. WeAtty Docket No.: BERK-527WO report multiplicity-adjusted p-values. Non-significant interactions are p>0.05. * is p<0.05, “ is p<0.01 .Split guide system detects synthetic and endogenous cellular miRNA
[0243] To demonstrate the split guide system’s ability to work in a more complex matrix, we first tested synthetic actRNA detection in a cellular RNA background, which introduced many off-target RNA species. We extracted total cell RNA from lenti-X HEK 293T cells and dosed it into our reaction at 1 ng / uL (FIG. 5A). To that matrix, we added synthetic 20nt actRNA at a range of concentrations. The presence of the cell RNA background resulted in a slightly increased signal compared to the no cell RNA control (linear regression fit to each condition have significantly different slopes, p = 0.0013) (FIG. 5B). Spiking in higher concentrations of cell RNA resulted in a reduced signal, while lower concentrations resulted in a higher signal than the control (FIG. 11 B).
[0244] Next, we tested whether the split guide system could detect known cellular miRNAs. We selected six miRNA targets ranging in length from 17nt to 23nt that are found in HEK 293 cells21. We designed a capRNA for each miRNA containing a 5nt 3’ flank, 10nt anchor region, and a capture region that fully complemented to the miRNA with no 5’ tail. We then screened the capRNA to identify those that had low activity in the absence of the cellular miRNA (FIG. 5C). We selected the three capRNAs with the lowest background activity for further testing. For each capRNA, we added either synthetic miRNA at 1 e7 copies / uL or cell RNA extract from Lenti-X HEK 293T cells at 1 ng / uL (FIG. 5D). For all three miRNA targets, the synthetic miRNAs were detected above background (yellow bars). miR_3178 (17nt) and miR_4505 (18nt) were also detected above background in the cell RNA sample (blue bars). Pre-annealing the capRNA with either the synthetic miRNA or cell RNA extract further boosted the signal for all conditions tested, except miR_31 in total cell RNA extract (FIG. 5E, striped vs solid bars).
[0245] Finally, we tested the detection of endogenous cellular miRNAs in whole cell lysate (FIG. 5F). We lysed Lenti-X HEK 293T cells and added cell lysate to the reaction mixture at a final concentration of 10 cells / uL (FIG. 5F, left panel). In the cell lysate, we detected all three miRNAs (miR_31 , 4505, and 3178) above background (FIG. 5F, middle panel, pink bars). We further tested whether pre-annealing the capRNA with the cell lysate would boost the signal, but found no significant difference in the background-subtracted reaction rate between the unannealed and annealed conditions (FIG. 5F, right panel, pink striped bars).Atty Docket No.: BERK-527WO
[0246] FIG. 5: Split guide system detects endogenous cellular miRNA. (A) Schematic illustrating the detection of synthetic actRNA in the presence of total cell RNA. The total cell RNA acts as a general RNA background to which the actRNA of interest is spiked in. Any Cas13a RNP activated by the actRNA will cleave both the fluorescent reporter and the cell RNA. (B) Limit of detection analysis of 20nt actRNA in a cell RNA background. Cell RNA, extracted from Lenti-X HEK 293T cells, is at 1 ng / uL in the final reaction. Cas13a is equimolar to split gRNA (1 Ont anchor) at 25nM, capRNA 7 (21 nt capture region) is at 2.5nM, and 20nt actRNA concentration varies. For each concentration of actRNA, reaction rate (AU / s) is plotted for three technical replicates. Linear regression fit to the reaction rate data and plotted with 95% prediction bands. The slope of the linear regression is compared for the two conditions with an unpaired t-test; p = 0.0013. (C) For miRNA detection, screening capRNA for low background signal is critical. Top: Schematic illustrating addition of capRNA to Cas13a RNPs and resultant fluorescent signal generated from RNPs activated by capRNA in the absence of the activating miRNA. CapRNAs tested contain the same 3’ flanking sequence (5nt) and 10nt anchor region. The capture region is unique to each capRNA and perfectly complementary to the miRNA of interest, with 5’ tail. Bottom: CapRNA for six miRNA targets tested for background activity. Mean reaction rate (AU / s) of Cas13a RNPs plus capRNA plotted with three technical replicates. Cas13a is equimolar to split gRNA (1 Ont anchor) at 25nM. All capRNA present at 2.5nM. The three capRNAs with the lowest activity were selected for further testing. (D) Top: Schematic illustrating miRNA detection by split guide system. CapRNA and synthetic miRNA were added to Cas13a RNPs containing a split gRNA (1 Ont anchor) (top schematic). Alternately, total cell RNA was added in lieu of synthetic miRNA (bottom schematic). Bottom: Three miRNAs were tested: miR_31 (21 nt), miR_4505 (18nt), and miR_3178 (17nt). For each miRNA target, mean reaction rate (AU / s) is plotted with three technical replicates for the condition with synthetic miRNA (yellow bars, circles), total cell RNA (blue bars, triangles), and no activating RNA (Cas13a RNP and capRNA only; grey bars, rhombuses). For all conditions, Cas13a is equimolar to split gRNA at 25nM and the capRNA is at 2.5nM. Synthetic miRNA is added at a final concentration of 1e7 copies / uL. Total cell RNA from Lenti-X HEK 293T cells is added at a final concentration of 1 ng / uL. All reactions compared to their specific no target control. (E) Top: Schematic illustrating use of annealing miRNA and capRNA to improve detection. Synthetic miRNA (box with yellow outline, top) or total cell RNA (box with blue outline, bottom) is annealed with capRNA before adding it to the Cas13a RNP mixture. Bottom: Detection ofAtty Docket No.: BERK-527WO miR_31 and miR_4505 was tested with a pre-annealing step. Mean background- subtracted reaction rate (AU / s) of annealed and unannealed conditions is plotted with three technical replicates. The graph shows the background-subtracted reaction rate of synthetic miRNA (yellow bars), synthetic miRNA annealed to capRNA (striped yellow bars), total cell RNA (blue bars), and total cell RNA annealed to capRNA (striped blue bars). For all conditions, Cas13a is equimolar to split gRNA at 25nM and the capRNA is at 2.5nM. Synthetic miRNA is added at a final concentration of 1 e7 copies / uL. Total cell RNA from Lenti-X HEK 293T cells is added at a final concentration of 1 ng / uL. Detection of miRNA is compared with and without annealing for each miRNA target and source. (F) Left: Schematic illustrating addition of whole cell lysate, containing all cellular RNA to the Cas13a reaction mixture. Middle: Tested detection of miR_31 , 4505, and 3178 in whole cell lysate. For each miRNA target, mean reaction rate (AU / s) is plotted with three technical replicates for the condition with no target (Cas13a RNP and capRNA only; grey bars, rhombuses), synthetic miRNA (yellow bars, circles), and whole cell lysate (pink bars, triangles). For all conditions, Cas13a is equimolar to split gRNA at 25nM and the capRNA is at 2.5nM. Synthetic miRNA is added at a final concentration of 1 e7 copies / uL. Whole cell lysate from Lenti-X HEK 293T cells is added at a final concentration of 10 cells / uL. All reactions compared to their specific no target control. Right: Detection of all three miRNAs was tested with pre-annealing of the whole cell lysate and capRNA. Mean background-subtracted reaction rate (AU / s) of annealed and unannealed cell lysate conditions is plotted with three technical replicates. The graph shows the background-subtracted reaction rate of synthetic miRNA (yellow bars), whole cell lysate (pink bars), and whole cell lysate annealed to capRNA (striped pink bars). For all conditions, Cas13a is equimolar to split gRNA at 25nM and the capRNA is at 2.5nM. Synthetic miRNA is added at a final concentration of 1e7 copies / uL. Whole cell lysate from Lenti-X HEK 293T cells is added at a final concentration of 10 cells / uL. Detection of miRNA is compared with and without annealing for each miRNA target in whole cell lysate. Stats We used pairwise analysis of the reaction rates for each experimental conditions with and without actRNA (D, F middle) or with and without annealing (E, F right) using a Brown-Forsythe ANOVA to account for variation in standard deviation and Dunnet’s T3 test for multiple comparisons. For all data sets, we report multiplicity-adjusted p-values. * is p<0.05, ** is p<0.01 , *** is p<0.001 . See FIG. 11 and FIG. 13 for more details.
[0247] FIG. 12: Length distribution of validated human miRNAs. Histogram of lengths of all human-annotated miRNAs in miRbase release 22.1.Atty Docket No.: BERK-527WO
[0248] FIG. 13: Predicted structures for split gRNA-capRNA complex for miRNA targets. Supporting data for FIG. 5A. Predicted complex structure for split gRNA bound to capRNA targeting six different cellular miRNAs. The split gRNA is highlighted in pink, with the 10nt anchor region highlighted with a grey box. The capture region (length varies) is highlighted with a yellow box. Stability of complex reported as free energy (AG, kcal / mol). Complex structures and free energy predicted with the NUPACK web application.Discussion
[0249] Here we present a Cas13a split guide system that expands the lower-length limit of target RNA detectable by Cas13a, enabling the use of Cas13a for detection of known miRNA and potentially discovery of even shorter miRNAs. The Cas13a split guide system uses a gRNA with a short seed region (split gRNA) paired with a capture RNA (capRNA) to detect RNA targets ranging from 8nt to 24nt. Previously published methods to detect miRNAs focus on longer miRNAs (>21 nt)16, though one paper demonstrates detection of a 17nt miRNA17; our system extends that range down to 8nt in a system that can be reconfigured by modifying only the capRNA. The split guide system is sensitive, even with small targets. We show that the split guide system can detect a 10nt target with an estimated LOD of 1 .2e5 copies / uL (200fM), which is within the range of concentrations that clinically- relevant miRNAs are found in serum (8.9e3 to 1 .3e5 copies / uL for low-to-moderate abundance miRNAs, and around 1e7 copies / uL for high abundance miRNA)10 19. We also show that the split guide system is specific for the desired actRNA, showing no or limited activity for 2nt mismatches, actRNA truncations, and actRNA extensions. We further demonstrate applications of the split guide system to detect known human miRNAs within total cell RNA extract and whole cell lysate, proving that the split guide system can detect miRNAs even without RNA purification. Together, our findings with the split guide system expand the repertoire of RNA detectable with Cas13a, and further suggest applications in miRNA discovery.
[0250] Successful ssRNA detection by the split guide system depended in large part upon the activity of the system in the absence of the activating RNA. This background activity varied with the length of the anchor region and capRNA, with increasing length of the anchor region increasing the overall background activity when paired with the same capRNA (FIG. 9A). This increase in background activity is likely due in part to the increased stability of the interaction between the split gRNA and the capRNA, as modelled by an increase in melting temperature of the anchor regionAtty Docket No.: BERK-527WO(FIG. 9B). However, melting temperature doesn’t fully explain the stability of the interaction between the split gRNA and the capRNA; the Cas13a protein itself likely plays a role in further stabilizing the interaction. Furthermore, Tambe et al found that the central portion of the gRNA seed region (positions 9-12) was particularly sensitive to mismatches, with mismatches in those positions resulting in a decrease in binding affinity23. This aligns with our findings that the split gRNA with a 12nt anchor region (no “mismatches” in the 9-12 position) had a background activity more than 10x that of the split gRNA with an 11 nt anchor region (1 equivalent mismatch / gap in position 12) (FIG. 9A).
[0251] Background activity of the split guide RNP is not only affected by the split gRNA anchor region, but also by the capRNA. We varied the length and sequence of the capRNA outside of the anchor and capture region and found no consistent trends with either length or sequence (FIG. 2D). We believe that both the length and sequence contribute to the secondary and tertiary structure of the capRNA, which then affect the accessibility to binding with the split gRNA and actRNA. CapRNA that forms stable same-species duplexes, for example, are unlikely to interact with either the split gRNA or actRNA, resulting in poor detection of actRNA. Alternately, capRNAs that form stem-loops in the capture region may be sufficient to activate the RNP when bound via the anchor region, such as with capRNAs 3, 8, and most capRNAs designed for the cellular miRNA targets, resulting in high background activity (FIG. 8, FIG. 10B, and FIG. 13).
[0252] Further design iterations to mutate the capRNA and reduce the probability of the stem-loop structure forming may boost the signal-to-background ratio. However, secondary and tertiary structure, as predicted with NUPACK24, isn’t sufficient to explain all the variability we see. For example, capRNA 1 and 2, which both have a 5nt 3’ flank and 11 nt 5’ tail but with different sequences, have dramatically different background activities (FIG. 2D). The predicted structure of the capRNA bound with the split gRNA, however, does not include any stem-loop structures that might lead to activation (FIG. 8). This suggests that the sequence of the 3’ flank and 5’ tail may play a larger role in background activation.
[0253] We also find that different capRNAs result in varied reaction rates, consistent with the variability in activity observed in the conventional Cas13a system for different guide and target RNA combinations. This may be partially explained by differences in the stability of binding in the capture region, as it was in the anchor region. When comparing split gRNA 1 and split gRNA 2, the capRNA for split gRNA 2 had a slightly higher melting temperature than that for split gRNA 1 and generated aAtty Docket No.: BERK-527WO higher relative signal for the same length actRNA targets (FIG. 10E). We also see this trend in increased signal when the capture region length and therefore melting temperature is increased, binding more of a given actRNA (FIG. 9D). Beyond changes in the length, sequence, and resultant melting temperature of the capture region, we see differences in capRNA performance. We tested three capRNAs with the same anchor and capture regions, but varied whether they had a 3’ flank and / or a 5’ tail (FIG. 7D). All three capRNAs had similarly low background activity, but resulted in significantly different activity when a 10nt actRNA was added. The capRNA with both the 3’ flanking sequence and 5’ tail resulted in the greatest reaction rate.
[0254] Together, these data suggest that capRNA design will be a focus for optimizing actRNA detection with the split guide system. Designs aimed at optimizing signal- to-background ratio should consider sequence, melting temperature of the anchor and capture regions, and secondary and tertiary structure of the complex. The design of the capRNA, however, is an asset to the system, as it allows the split guide system to be tuned based on the needs of the assay. For detection with high specificity, reducing the portion of the actRNA that binds to the capRNA will increase the specificity to mismatches (FIG. 4A, FIG. 11 A). Alternately, for applications that value high sensitivity, increasing the length of the capture region will likely enhance detection at low concentrations. Molecular dynamics simulations of the capRNA bound with the Cas13a and split gRNA may aid the design process, especially when these complexes are compared to predicted structures of experimentally-optimized split guide structures.
[0255] The Cas13a split guide system will further benefit from advances to the conventional Cas13a assay. Switching from a linear to a hairpin ssRNA reporter, for example, may reduce background signal and increase assay speed and sensitivity as it did with DNA hairpin reporters for Cas12a DNA-detection assays25. We could also adopt a droplet-based approach to boost sensitivity, which we have previously demonstrated in our lab for conventional Cas13a assays5.
[0256] While the Cas13a split guide system is a promising approach to detect miRNAs and other small RNA species, our testing thus far has been focused on idealized conditions. Most of our validation studies used synthetic miRNA, but we know that some miRNAs have post-transcriptional modifications26. Working toward a more complex reaction matrix, we tested detection of miRNAs in RNA extracted from cells. These cell-derived miRNAs may have modifications not reflected in the synthetic miRNA, which could alter the signal generated. The total cell RNA extract,Atty Docket No.: BERK-527WO which was not enriched for small RNA, provided a lot of off-target RNA, but was still clean of potentially disrupting cell protein debris. We then tested our assay using whole cell lysate with no RNA purification. The split guide system was able to detect endogenous miRNAs in the sample, including miR_31 , which was previously undetected in the purified RNA sample, suggesting that there is critical RNA loss during the extraction and purification steps.
[0257] We have presented the Cas13a split guide system as a viable strategy for detecting miRNAs and other ultra-short ssRNA species. This approach does not require purification, reverse transcription, or amplification of the RNA target and instead directly detects the RNA. Removing those processing steps reduces opportunities to introduce error and enables quantification of RNA concentration. Together, these results demonstrate the use of a split gRNA and capRNA to extend the capabilities of Cas13a to detect smaller RNA than ever before, bolstering the use of Cas13a for miRNA detection and discovery.
[0258] References1. Abudayyeh, O. O. et al. C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science 353, aaf5573 (2016).2. Chandrasekaran, S. S. et al. Rapid detection of SARS-CoV-2 RNA in saliva via Casl3. Nature Biomedical Engineering 2022 6:86, 944-956 (2022).3. East-Seletsky, A., O’connell, M. R., Burstein, D., Knott, G. J. & Doudna Correspondence, J. A. RNA Targeting by Functionally Orthogonal Type VI-A CRISPR-Cas Enzymes. Mol Cell 66, 373-383.e3 (2017).4. Fozouni, P. et al. Amplification-free detection of SARS-CoV-2 with CRISPR-Cas 13a and mobile phone microscopy. Cell 184, 323-333.e9 (2021).5. Son, S. et al. Sensitive and multiplexed RNA detection with Casl3 droplets and kinetic barcoding. medRxiv 2021.08.02.21261509 (2021) doi:10.1101 / 2021.08.02.21261509.6. Shinoda, H. et al. Amplification-free RNA detection with CRISPR-Casl3. Communications Biology 2021 4:1 4, 1-7 (2021).7. Arizti-Sanz, J. et al. Streamlined inactivation, amplification, and Cas 13-based detection of SARS-CoV-2. Nat Commun 11, 17 (2020).8. Myhrvold, C. et al. Field-deployable viral diagnostics using CRISPR-Casl3. Science 360, 444 (2018).9. Ho, P. T. B., Clark, I. M. & Le, L. T. T. MicroRNA-Based Diagnosis and Therapy. Int J Mol Sci 23, (2022).10. Krepelkova, I. et al. Evaluation of miRNA detection methods for the analytical characteristics necessary for clinical utilization. Biotechniques 66, 277-284 (2019).11. Hindson, C. M. et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nature Methods 2013 10:1010, 1003-1005 (2013).12. Benesova, S., Kubista, M. & Valihrach, L. Small RNA-Sequencing: Approaches and Considerations for miRNA Analysis. Diagnostics 11, (2021).13. Shan, Y., Zhou, X., Huang, R. & Xing, D. High-Fidelity and Rapid Quantification of miRNA Combining crRNA Programmability and CRISPR / Casl3a trans-Cleavage Activity. Anal Chem 91, 5278-5285 (2019).Atty Docket No.: BERK-527WO14. Zhou, T. et al. CRISPR / Casl3a Powered Portable Electrochemiluminescence Chip for Ultrasensitive and Specific MiRNA Detection. Advanced Science 7, (2020).15. Bruch, R. et al. CRISPR / Casl 3a- Powered Electrochemical Microfluidic Biosensor for Nucleic Acid Amplification-Free miRNA Diagnostics. Advanced Materials 31, 1905311 (2019).16. Granados-Riveron, J. T., Aquino- Jarquin, G., Malpeli, G. & Taguchi, Y.-H. CRISPR / Casl3-Based Approaches for Ultrasensitive and Specific Detection of microRNAs. Cells 2021, Vol. 10, Page 1655 10, 1655 (2021).17. Chen, Y. et al. Foldback-crRNA-Enhanced CRISPR / Casl3a System (FCECasl3a) Enables Direct Detection of Ultrashort sncRNA. Anal Chem 95, 15606-15613 (2023).18. Rananaware, S. R. et al. Programmable RNA detection with CRISPR-Casl2a. Nature Communications 2023 14:1 14, 1—14 (2023).19. Mitchell, P. S. et al. Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A 105, 10513-10518 (2008).20. Armbruster, D. A. & Pry, T. Limit of Blank, Limit of Detection and Limit of Quantitation. Clin Biochem Rev 29, S49 (2008).21. Jiao, H. et al. MicroRNA expression profiles from HEK293 cells expressing H5N1 avian influenza virus non-structural protein 1. Innate Immun 25, 110-117 (2019).22. Kozomara, A., Birgaoanu, M. & Griffiths-Jones, S. miRBase: from microRNA sequences to function. Nucleic Acids Res 47. D155 (2019).23. Tambe, A., East-Seletsky, A., Knott, G. J., Doudna, J. A. & O’Connell, M. R. RNA- binding and HEPN-nuclease activation are decoupled in CRISPR-Casl3a. Cell Rep 24, 1025 (2018).24. Fornace, M. E. et al. NUPACK: Analysis and Design of Nucleic Acid Structures, Devices, and Systems. (2022) doi: 10.26434 / CHEMRXIV-2022-XV98L.25. Rossetti, M. el al. Enhancement of CRISPR / Casl2a trans-cleavage activity using hairpin DNA reporters. Nucleic Acids Res 50, 8377 (2022).26. Xiong, Q. & Zhang, Y. Small RNA modifications: regulatory molecules and potential applications. Journal of Hematology & Oncology 2023 16:1 16, 1-24 (2023).Example 2: short RNA sequence detection with CRISPR-Casl 3a using a split guide RNA
[0259] Results
[0260] Whether the Cas13a split guide system could be useful not only for detecting miRNAs but also for detecting short, conserved RNA sequences, such as in Influenza viral RNA was explored. Influenza A virus (IAV) has a genome composed of eight viral RNA segments (Fig. 14A). Each segment is composed of an internal coding region flanked on the 5’ and 3’ end by non-coding regions (NCR). The 13nt on the 5’ end (5’ untranslated region, or UTR) and 12nt on the 3’ end (3’ UTR) are highly conserved across all segments2425. One capRNA designed to bind the 5’ UTR should theoretically bind all eight viral RNA (vRNA) segments (Fig. 14B). Thus, one virion would yield eight detectable copies of vRNA. Another approach to increasing vRNA detection is designing full-length gRNAs that target different sequences within the viral genome, which we and others have done to targetAtty Docket No.: BERK-527WOSARS-CoV-24'6. This strategy requires testing and validation of multiple targets, and results in multiple Cas13a RNP species in one reaction. With the split gRNA system, only one split Cas13a RNP and one capRNA is needed to detect the equivalent of eight vRNA targets. We tested this approach first with synthetic Influenza A viral RNA at a concentration of 7e5 copies / uL, and we found activation over background (Fig. 14C). We then extracted viral RNA from Influenza A virions and estimated the number of vRNA segments based on the titer of the virions. The split Cas13a RNP detected the extracted vRNA at an estimated concentration of 2e6 copies / uL. This approach for detecting IAV vRNA demonstrates the ability of the split gRNA system to detect short segments that are appended to longer RNA strands; IAV vRNA can be up to ~2400nt long25.
[0261] FIG. 14: split gRNA system detects cellular miRNA and Influenza A viral RNA.(A) Schematic illustrating structure of Influenza A viral RNA (IAV vRNA). Influenza A is composed of eight segments of negative sense RNA. Each segment contains a coding region (light blue) and a non-coding region (NCR) on both the 5’(dark blue and pink) and 3’ ends (pink and grey). The non-coding region is composed of 5’ untranslated region (UTR) and 3’ UTR that are conserved across all eight segments. The 5’ UTR (dark blue) is 13nt and the 3’ UTR (grey) is 12 nt. (B) Schematic illustrating the proposed method of detecting IAV vRNA with the split gRNA system. A split gRNA (1 Ont anchor, hot pink) complements capRNA 5.1 with a 10nt anchor region. The 13nt 5’ UTR (dark blue) serves at the actRNA and complements to the 13nt capture region of the capRNA. All eight segments should be detectable with the same Cas13a RNP and capRNA since the 5’ UTR is conserved. (C) Detection of IAV vRNA with split gRNA system. Synthetic vRNA (NP segment) is added to Cas13a RNP at a final concentration of 7e5 copies / uL (blue bar, circles). vRNA is extracted from Influenza A virions and added to Cas13a RNP for an estimated final concentration of 2e6 vRNA segments / uL (orange bar, rhombuses). Cas13a RNP with capRNA and no activating RNA is also shown (grey bar, empty circles). For each condition, mean reaction rate (AU / s) with three technical replicates is plotted. Stats Non-significant interactions (p>0.05) are not plotted. * is p<0.05, ** is p<0.01 , *** is p<0.001 .
[0262] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this inventionAtty Docket No.: BERK-527WO that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
[0263] Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Moreover, nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the claims.
[0264] The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims. In the claims, 35 U.S.C. §112(f) or 35 U.S.C. §112(6) is expressly defined as being invoked for a limitation in the claim only when the exact phrase "means for" or the exact phrase "step for" is recited at the beginning of such limitation in the claim; if such exact phrase is not used in a limitation in the claim, then 35 U.S.C. § 112 (f) or 35 U.S.C. §112(6) is not invoked.
Claims
Atty Docket No.: BERK-527WOCLAIMSWhat is claimed is:1 . A method of activating a CRISPR-Cas effector protein with a nucleic acid of interest, the method comprising: contacting a capture nucleic acid (capNucleicAcid) with a CRISPR-Cas effector protein and a CRISPR-Cas guide RNA in the presence of a nucleic acid of interest (actNucleicAcid), wherein:(a) the capNucleicAcid comprises: an anchor region that hybridizes to the CRISPR-Cas guide RNA, and a capture region that hybridizes to the actNucleicAcid;(b) the CRISPR-Cas guide RNA comprises: a protein-binding region that binds to the CRISPR-Cas effector protein, and an 8-15 nucleotide (nt) guide sequence that hybridizes with the anchor region of the capNucleicAcid; and(c) said contacting results in activation of trans cleavage activity of the CRISPR-Cas effector protein.
2. The method of claim 1 , wherein said contacting takes place inside of a cell that comprises the actNucleicAcid.
3. The method of claim 2, wherein said contacting comprises introducing into the cell: (i) the capNucleicAcid, and (ii) the CRISPR-Cas guide RNA, or a nucleic acid encoding the CRISPR-Cas guide RNA.
4. The method of claim 1 , wherein said contacting occurs in a sample that comprises the actNucleicAcid, and wherein said contacting does not take place inside of a cell.
5. A method of detecting a nucleic acid of interest in a sample, the method comprising:(a) contacting a sample with:(i) a CRISPR-Cas effector protein;(ii) a CRISPR-Cas guide RNA comprising: a protein-binding region that binds to the CRISPR-Cas effector protein, and an 8-15 nucleotide (nt) guide sequence that hybridizes with an anchor region of a capture nucleic acid (capNucleicAcid);(iii) the capNucleicAcid, which comprises: said anchor region that hybridizes to the CRISPR-Cas guide RNA, andAtty Docket No.: BERK-527WO a capture region that hybridizes to a nucleic acid of interest (actNucleicAcid); and(iv) a labeled single stranded detector nucleic acid that does not hybridize with the CRISPR-Cas guide RNA; and(b) detecting a signal produced by cleavage of the single stranded detector nucleic acid by trans cleavage activity of the CRISPR-Cas effector protein, thereby detecting the actNucleicAcid.
6. The method of any one of claims 1 -5, wherein the actNucleicAcid is an RNA (actRNA).
7. The method of any one of claims 1 -5, wherein the actNucleicAcid is a DNA (actDNA).
8. The method of any one of claims 1 -7, wherein the capNucleicAcid is an RNA (capRNA).
9. The method of any one of claims 1 -7, wherein the capNucleicAcid is a DNA (capDNA).
10. The method of any one of claims 1 -9, wherein the CRISPR-Cas effector protein is a Cas13 protein or a Cas 12 protein.11 . The method of any one of claims 1 -10, wherein the actNucleicAcid is 8-26 nucleotides (nt) long.
12. The method of any one of claims 1 -10, wherein the actNucleicAcid is 8-16 nt long.
13. The method of any one of claims 1 -10, wherein the actNucleicAcid is longer than 26 nucleotides and the 8-26 5’ most nucleotides of the actNucleicAcid hybridize to the capture region of the capNucleicAcid.
14. The method of claim 13, wherein the actNucleicAcid is 30-5000 nt long.
15. The method of any one of claims 1 -14, wherein the guide sequence of the guide RNA is 9-11 nt long.
16. The method of any one of claims 1 -14, wherein the guide sequence of the guide RNA is 10 nt long.Atty Docket No.: BERK-527WO17. The method of any one of claims 1 -16, wherein the anchor region of the capRNA is 9-12 nt long.
18. The method of any one of claims 1 -17, wherein the capture region of the capRNA is 10- 21 nt long.
19. The method of any one of claims 1 -18, wherein the capRNA is 20-45 nt long.
20. The method of any one of claims 1 -18, wherein the capRNA is 30-40 nt long.21 . The method of any one of claims 1 -20, wherein the capRNA comprises a 5’ tail region that is positioned 5’ of the capture region.
22. The method of claim 21 , wherein the 5’ tail region 1-12 nt long.
23. The method of claim 21 , wherein the 5’ tail region 3-7 nt long.
24. The method of any one of claims 1 -23, wherein the capRNA comprises a 3’ region that is positioned 3’ of the anchor region.
25. The method of claim 24, wherein the 3’ region is 1 -10 nt long.
26. The method of claim 24, wherein the 3’ region is 3-5 nt long.
27. The method of any one of claims 1 -26, wherein the actNucleicAcid is a microRNA.
28. The method of any one of claims 1 -26, wherein the actNucleicAcid is a human microRNA.
29. The method of any one of claims 1 -28, wherein the actNucleicAcid in the sample is present in a range of from 1 aM to 1 nM.
30. The method of any one of claims 1 -28, wherein the actNucleicAcid in the sample is present in a range of from 100 fM to 1 nM.31 . The method of any one of claims 1 -30, wherein the sample comprises from 3 RNAs to 107RNAs that differ from one another in nucleotide sequence.Atty Docket No.: BERK-527WO32. The method of any one of claims 1 -31 , wherein said detecting comprises measuring the amount of the signal produced by cleavage of the single stranded detector nucleic acid.
33. The method of any one of claims 1 -32, wherein said detecting comprises: gold nanoparticle-based detection, fluorescence polarization, colloid phase transition / dispersion, electrochemical detection, fluorescent signal detection, semiconductor-based sensing, or any combination thereof.
34. The method of any one of claims 1 -33, wherein the labeled single stranded detector nucleic acid is an RNA.
35. The method of any one of claims 1 -34, wherein the labeled single stranded detector nucleic acid comprises a fluorescence-emitting dye pair.
36. The method of any one of claims 1 -34, wherein the labeled single stranded detector nucleic acid comprises a quencher / fluor pair.
37. The method of any one of claims 1 -36, wherein the labeled single stranded detector nucleic acid comprises one or more non-natural internucleoside linkages, one or more nucleic acid mimetics, one or more modified sugar moieties, one or more modified nucleobases, one or more locked nucleic acids (LNAs), one or more peptide nucleic acids (PNAs), one or more morpholino nucleic acids, one or more cyclohexenyl nucleic acids (CeNAs), or any combination thereof.
38. The method of any one of claims 1 -37, wherein the actNucleicAcid is from a human.
39. The method of any one of claims 1 -37, wherein the actNucleicAcid is from a virus, a parasite, a helminth, a fungus, a protozoan, a bacterium, or a pathogenic bacterium.
40. The method of any one of claims 1 -37, wherein the actNucleicAcid is from a virus selected from: Zika virus, human immunodeficiency virus (HIV), hepatitis B virus, hepatitis C virus, herpes virus, herpes simplex virus I, herpes simplex virus II, papillomavirus, rabies virus, cytomegalovirus, human serum parvo-like virus, respiratory syncytial virus, varicellazoster virus, measles virus, adenovirus, human T-cell leukemia viruses, Epstein-Barr virus, murine leukemia virus, mumps virus, vesicular stomatitis virus, Sindbis virus, lymphocytic choriomeningitis virus, wart virus, blue tongue virus, Sendai virus, feline leukemia virus,Atty Docket No.: BERK-527WO reovirus, polio virus, simian virus 40, mouse mammary tumor virus, dengue virus, rubella virus, west Nile virus, a coronavirus, and yellow fever virus.41 . The method of any one of claims 1 -37, wherein the actNucleicAcid is from pathogenic bacteria selected from: Mycobacterium tuberculosis, Streptococcus agalactiae, methicillin- resistant Staphylococcus aureus, Legionella pneumophila, Streptococcus pyogenes, Escherichia coli, Neisseria gonorrhoeae, Neisseria meningitidis, Pneumococcus, Cryptococcus neoformans, Treponema pallidum, Lyme disease spirochetes, Pseudomonas aeruginosa, Mycobacterium leprae, and Brucella abortus.
42. The method of any one of claims 1 -37, wherein the actNucleicAcid is from a human cell, an animal cell, a plant cell, a cancerous cell, an infected cell, or a diseased cell.
43. A kit for detecting a nucleic acid of interest, the kit comprising:(a) a CRISPR-Cas guide RNA comprising: a protein-binding region that can bind to a CRISPR-Cas effector protein, and an 8-15 nucleotide (nt) guide sequence that can hybridize with an anchor region of a capture nucleic acid (capNucleicAcid);(b) the capNucleicAcid, which comprises: said anchor region that can hybridize to the CRISPR-Cas guide RNA, and a capture region that can hybridize to a nucleic acid of interest (actNucleicAcid).
44. The kit of claim 43, further comprising: a labeled single stranded detector nucleic acid that does not hybridize with the CRISPR-Cas guide RNA.
45. The kit of claim 43 or claim 44, further comprising the CRISPR-Cas effector protein or a nucleic acid encoding the CRISPR-Cas effector protein.
46. The kit of any one of claims 43-45, further comprising a positive control actNucleicAcid.
47. The kit of any one of claims 43-46, wherein the actNucleicAcid is an RNA (actRNA).
48. The kit of any one of claims 43-46, wherein the actNucleicAcid is a DNA (actDNA).
49. The kit of any one of claims 43-48, wherein the capNucleicAcid is an RNA (capRNA).
50. The kit of any one of claims 43-48, wherein the capNucleicAcid is a DNA (capDNA).Atty Docket No.: BERK-527WO51 . The kit of any one of claims 43-50, wherein the CRISPR-Cas effector protein is a Cas13 protein or a Cas 12 protein.
52. The kit of any one of claims 43-51 , wherein the actNucleicAcid is 8-26 nucleotides (nt) long.
53. The kit of any one of claims 43-51 , wherein the actNucleicAcid is 8-16 nt long.
54. The kit of any one of claims 43-53, wherein the actNucleicAcid is longer than 26 nucleotides and the 8-26 5’ most nucleotides of the actNucleicAcid hybridize to the capture region of the capNucleicAcid.
55. The kit of claim 54, wherein the actNucleicAcid is 30-5000 nt long.
56. The kit of any one of claims 43-55, wherein the guide sequence of the guide RNA is 9-11 nt long.
57. The kit of any one of claims 43-55, wherein the guide sequence of the guide RNA is 10 nt long.
58. The kit of any one of claims 43-57, wherein the anchor region of the capRNA is 9-12 nt long.
59. The kit of any one of claims 43-58, wherein the capture region of the capRNA is 10-21 nt long.
60. The kit of any one of claims 43-59, wherein the capRNA is 20-45 nt long.61 . The kit of any one of claims 43-59, wherein the capRNA is 30-40 nt long.
62. The kit of any one of claims 43-61 , wherein the capRNA comprises a 5’ tail region that is positioned 5’ of the capture region.
63. The kit of claim 62, wherein the 5’ tail region 1-12 nt long.
64. The kit of claim 62, wherein the 5’ tail region 3-7 nt long.Atty Docket No.: BERK-527WO65. The kit of any one of claims 43-64, wherein the capRNA comprises a 3’ region that is positioned 3’ of the anchor region.
66. The kit of claim 65, wherein the 3’ region is 1 -10 nt long.