Pyrrolo-six-membered aromatic ring compound, preparation method therefor and use thereof

Abstract

The present invention belongs to the field of medicine, and relates to a pyrrolo-six-membered aromatic ring compound, a preparation method therefor, and the use thereof in the field of pharmaceuticals. Specifically, the compound of the present invention has a structure represented by formula (I), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof. The compound of the present invention and a pharmaceutical composition thereof can be used for preparing a drug for treating HIF-2α-mediated related diseases, such as hematopoietic disorders, wound healing, kidney diseases, cardiovascular diseases, infections, inflammatory diseases, and acute respiratory distress syndrome.

Description

Pyrrolohexaazabenzenes and methods of making and using the same

[0001] This application claims priority to and the benefit of Chinese Patent Application No. 202410741682.5, filed on June 7, 2024, in the China National Intellectual Property Office, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0002] The present application belongs to the field of medicine, and relates to a pyrrolohexaazabenzenes and methods of making and using the same. BACKGROUND

[0003] In a low oxygen environment, the body can spontaneously occur in hypoxic response to maintain the body's oxygen acquisition ability. In 1992, Semenza et al. found that a protein can specifically bind to the hypoxic response element (HRE) of erythropoietin gene and affect the expression of certain genes, which is called hypoxia-inducible factor (HIF) (Semenza GL et al., Mol. Cell Biol., 1992, 12, 5447-5454). The target genes of HIF are very extensive, which can affect the body's hematopoietic function, angiogenesis, iron ion transport, glucose utilization, resistance to oxidative stress, cell differentiation, cell survival and apoptosis, extracellular matrix homeostasis and tumor occurrence. HIF is a heterodimer composed of α and β subunits, and the α subunit belongs to the functional subunit, which is very sensitive to changes in intracellular oxygen concentration and is highly regulated, and has the function of regulating HIF activity; the β subunit is a structural subunit, also known as aryl hydrocarbon receptor nuclear transporter (ARNT), which is stably expressed in cells, and the mRNA transcription and protein expression level is not affected by the change of oxygen concentration. Both α and β subunits of HIF belong to the basic helix-loop-helix transcription factor superfamily members. There are three subtypes of HIF-1α, HIF-2α and HIF-3α in humans. HIF-1α is widely distributed in the body and plays an important role in angiogenesis triggered by local tissue ischemia or hypoxia, but has less effect on iron metabolism; HIF-2α is locally distributed and plays an important role in the process of EPO (erythropoietin) gene expression and synthesis in kidney tissue, in addition, it also improves iron absorption in the intestine by up-regulating the expression of duodenum cytochrome and divalent metal transporter-1, and has the effect of reducing the expression of liver bactericidal peptide, and plays a leading role in iron metabolism; HIF-3α has a different structure from other subtypes, and cannot affect gene expression because it has no DNA binding region. Studies have shown that HIF-3α may have a negative regulatory effect on HIF-mediated gene expression. Therefore, HIF-1α and HIF-2α play a certain role in the hypoxic response process. In a HIF-1α and HIF-2α gene deletion mouse experiment, it is confirmed that HIF-1α and HIF-2α are necessary in the hypoxic response process. In the development of compounds for treating chronic renal anemia, the change of HIF-2α is more important than that of HIF-1α.

[0004] Both the HIF-2α subunit and the ARNT subunit belong to the Per-ARNT-Sim (PAS) subfamily within the basic helix-loop-helix (bHLH) family. The two subunits have similar structures, primarily consisting of an N-terminal bHLH (DNA Bonding Domain, DBD) and two adjacent PASA and PASB domains (Ligand Bonding Domain, LBD). The C-terminus binds to transcriptional cofactors, regulating the transcription of downstream genes. Studies have found that the PASB domain of the HIF-2α subunit contains approximately [missing information - likely a specific structure or feature]. The cavity of HIF-2α, when combined with regulators, can influence the heterodimerization of the HIF-2α and ARNT subunits, thereby blocking or activating DNA binding and the transcription of target genes. Downstream target genes of HIF-2α include vascular endothelial growth factor (VEGF), erythropoietin (EPO), and glycolytic enzymes, which are associated with chronic kidney disease, renal anemia, cardiovascular disease, infection, and cancer.

[0005] Diseases regulated by HIF-2α protein, including but not limited to: treatment of hematopoietic disorders, such as renal anemia, primary anemia, and anemia associated with cancer (especially chemotherapy-induced anemia); anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, developmental and aplastic anemia, or hemolytic anemia; anemia due to iron utilization disorders (iron loss anemia) or other endocrine disorders (e.g., hypothyroidism); postoperative surgical ischemic states and their continuous symptoms, especially cardiac interventions using a cardiopulmonary bypass machine (e.g., shunt surgery, heart valve transplantation), carotid artery intervention, aortic intervention, and interventions using instruments to open or penetrate the skull; surgical wound healing; chronic kidney disease, such as primary glomerulonephritis, hypertensive nephrotic arteriosclerosis, diabetic nephropathy, and secondary glomerulonephritis. Nephritis, tubulointerstitial nephropathy (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathy (polycystic kidney disease, hereditary nephritis); cardiovascular diseases, especially heart failure, coronary artery disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease; infections, especially HIV infection; inflammatory diseases, such as rheumatoid arthritis; cancer and damage to health conditions that occur during cancer treatment, especially after the use of cytosolic inhibitors, antibiotics and radiation therapy; diseases of the rheumatic form and other forms of diseases considered autoimmune diseases, especially damage to health conditions that occur during drug treatment of such diseases; continuous symptoms of acute and prolonged cerebral ischemia (e.g. stroke, childbirth asphyxia); acute respiratory distress syndrome. Summary of the Invention

[0006] SUMMARY

[0007] The present application provides a new pyrrolohexa-arene compound, a preparation method thereof and an application thereof in the pharmaceutical field. The compound or a pharmaceutical composition thereof can be effectively used for preparing a medicine for preventing, treating or reducing HIF-2α-mediated related diseases such as hematopoietic disorders, wound healing, kidney diseases, cardiovascular diseases, infections, inflammatory diseases and the like.

[0008] In a first aspect, the present application provides a compound.

[0009] In a second aspect, the present application provides a pharmaceutical composition comprising the compound of the first aspect.

[0010] In a third aspect, the present application provides use of the compound of the first aspect or the pharmaceutical composition of the second aspect.

[0011] In a fourth aspect, the present application provides a drug combination, a drug combination kit or a complex preparation.

[0012] DETAILED DESCRIPTION

[0013] Specifically, in the first aspect, the present application provides a compound having a structure as shown in formula (I), or a stereoisomer, a tautomer, a solvate, a metabolite, a pharmaceutically acceptable salt or a prodrug thereof,

[0014] wherein,

[0015] X 1 is N or CR 7 ;

[0016] A is C 6-12 aryl or 5-12 membered heteroaryl;

[0017] each R 1 and R 2 is independently H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , C1-4 alkyl (e.g., C1alkyl, C2alkyl, C3alkyl, C4alkyl), C 2-4 alkenyl (e.g., C2alkenyl, C3alkenyl, C4alkenyl), C 2-4 alkynyl (e.g., C2alkynyl, C3alkynyl, C4alkynyl), C 1-4 haloalkyl (e.g., C1haloalkyl, C2haloalkyl, C3haloalkyl, C4haloalkyl, -CF3, CHF2, ), C 2-4 haloalkenyl (e.g., C2haloalkenyl, C3haloalkenyl, C4haloalkenyl), or C 2-4 haloalkynyl (e.g., C2haloalkynyl, C3haloalkynyl, C4haloalkynyl);

[0018] R 3 is H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , or -B(OR 7 )2;

[0019] each R 4 and R 5 is independently H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -NHS(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, C 1-4 alkyl (e.g., C1alkyl, C2alkyl, C3alkyl, C4alkyl), C 1-4hydroxy-substituted alkyl (e.g., C1 hydroxy-substituted alkyl, C2 hydroxy-substituted alkyl, C3 hydroxy-substituted alkyl, C4 hydroxy-substituted alkyl), C 2-4 alkenyl (e.g., C2 alkenyl, C3 alkenyl, C4 alkenyl), C 2-4 alkynyl (e.g., C2 alkynyl, C3 alkynyl, C4 alkynyl), C 3-6 cycloalkyl (e.g., C3 cycloalkyl, C4 cycloalkyl, C5 cycloalkyl, C6 cycloalkyl), 3-6 membered heterocyclyl (e.g., 3 membered heterocyclyl, 4 membered heterocyclyl, 5 membered heterocyclyl, 6 membered heterocyclyl), C 1-4 haloalkyl (e.g., C1 haloalkyl, C2 haloalkyl, C3 haloalkyl, C4 haloalkyl, -CF3, CHF2), C 2-4 haloalkenyl (e.g., C2 haloalkenyl, C3 haloalkenyl, C4 haloalkenyl), C 2-4 haloalkynyl (e.g., C2 haloalkynyl, C3 haloalkynyl, C4 haloalkynyl), C 3-6 halocycloalkyl (e.g., C3 halocycloalkyl, C4 halocycloalkyl, C5 halocycloalkyl, C6 halocycloalkyl), or 3-6 membered haloheterocyclyl (e.g., 3 membered haloheterocyclyl, 4 membered haloheterocyclyl, 5 membered haloheterocyclyl, 6 membered haloheterocyclyl);

[0020] R 6 is H, D, F, Cl, Br, I, OH, CN, NH2, NO2, C 1-4 alkyl (e.g., C1 alkyl, C2 alkyl, C3 alkyl, C4 alkyl), C 2-4 alkenyl (e.g., C2 alkenyl, C3 alkenyl, C4 alkenyl), C 2-4 alkynyl (e.g., C2 alkynyl, C3 alkynyl, C4 alkynyl), C 1-4 haloalkyl (e.g., C1 haloalkyl, C2 haloalkyl, C3 haloalkyl, C4 haloalkyl, -CF3, CHF2), C 2-4 haloalkenyl (e.g., C2 haloalkenyl, C3 haloalkenyl, C4 haloalkenyl), or C 2-4 haloalkynyl (e.g., C2 haloalkynyl, C3 haloalkynyl, C4 haloalkynyl);

[0021] each R 7 is independently H, D, C 1-4 alkyl (e.g., C1 alkyl, C2 alkyl, C3 alkyl, C4 alkyl), C 2-4 alkenyl (e.g., C2 alkenyl, C3 alkenyl, C4 alkenyl), C 2-4 alkynyl (e.g., C2 alkynyl, C3 alkynyl, C4 alkynyl), C 3-6 cycloalkyl (e.g., C3 cycloalkyl, C4 cycloalkyl, C5 cycloalkyl, C6 cycloalkyl), 3-6 membered heterocyclyl (e.g., 3 membered heterocyclyl, 4 membered heterocyclyl, 5 membered heterocyclyl, 6 membered heterocyclyl), C1-4 Haloalkyl (e.g., C1 haloalkyl, C2 haloalkyl, C3 haloalkyl, C4 haloalkyl, -CF3, CHF2), C 2-4 Haloalkenyl groups (such as C2-haloalkenyl, C3-haloalkenyl, C4-haloalkenyl), C 2-4 Halogenated alkyne groups (such as C2-halogenated alkyne, C3-halogenated alkyne, C4-halogenated alkyne), C 3-6 Halogenated cycloalkyl groups (such as C3-halogenated cycloalkyl, C4-halogenated cycloalkyl, C5-halogenated cycloalkyl, C6-halogenated cycloalkyl) or 3-6-membered halogenated heterocyclic groups (such as 3-membered halogenated heterocyclic groups, 4-membered halogenated heterocyclic groups, 5-membered halogenated heterocyclic groups, 6-membered halogenated heterocyclic groups);

[0022] Each R a and R b H, D, C independently 1-4 Alkyl groups (such as C1 alkyl, C2 alkyl, C3 alkyl, C4 alkyl), C 1-4 Alkoxy groups (e.g., C1 alkoxy, C2 alkoxy, C3 alkoxy, C4 alkoxy), C 2-4 Alkenyl (such as C2 alkenyl, C3 alkenyl, C4 alkenyl), C 2-4 Alkyne groups (such as C2 alkynyl, C3 alkynyl, C4 alkynyl), C 3-6 Cycloalkyl groups (such as C3 cycloalkyl, C4 cycloalkyl, C5 cycloalkyl, C6 cycloalkyl), 3-6 membered heterocyclic groups (such as 3-membered heterocyclic, 4-membered heterocyclic, 5-membered heterocyclic, 6-membered heterocyclic), C 1-4 Haloalkyl (e.g., C1 haloalkyl, C2 haloalkyl, C3 haloalkyl, C4 haloalkyl, -CF3, CHF2), C 1-4 Haloalkoxy groups (e.g., C1 haloalkoxy, C2 haloalkoxy, C3 haloalkoxy, C4 haloalkoxy), C 2-4 Haloalkenyl groups (such as C2-haloalkenyl, C3-haloalkenyl, C4-haloalkenyl), C 2-4 Halogenated alkyne groups (such as C2-halogenated alkyne, C3-halogenated alkyne, C4-halogenated alkyne), C 3-6 Halogenated cycloalkyl groups (such as C3-halogenated cycloalkyl, C4-halogenated cycloalkyl, C5-halogenated cycloalkyl, C6-halogenated cycloalkyl), 3-6-membered halogenated heterocyclic groups (such as 3-membered halogenated heterocyclic groups, 4-membered halogenated heterocyclic groups, 5-membered halogenated heterocyclic groups, 6-membered halogenated heterocyclic groups);

[0023] m can be 0, 1, 2, or 3.

[0024] In some embodiments, A is selected from 5-membered aryl, 6-membered aryl, 5-part 5-membered aryl, 5-part 6-membered aryl or 6-part 6-membered aryl, 5-membered heteroaryl, 6-membered heteroaryl, 5-part 5-membered heteroaryl, 5-part 6-membered heteroaryl or 6-part 6-membered heteroaryl;

[0025] at least two of R3, R4, R5, and R6are H; or two or three of R3, R4, R5, and R6are H and the others are not H.

[0026] In some embodiments, A is selected from phenyl, imidazolyl, pyrazolyl, thienyl, thiazolyl, pyridyl, pyrimidyl, pyrazinyl, benzofuran, benzimidazole, indolyl, or quinolinyl; preferably, A is selected from phenyl or pyridyl.

[0027] In some embodiments, the present compounds have a structure according to Formula (II-1), (II-2), (II-3), (II-4), (II-5), (II-6), (II-7), (II-8), (II-9), (II-10), (II-11), or (II-12), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof,

[0028] wherein each m is independently 1, 2, or 3;

[0029] R 1 , R 2 , R 3 , R 4 , R 5 , R 6 are as described for the corresponding groups in the structure according to Formula (I) of the present application.

[0030] In some embodiments, the present compounds have a structure according to Formula (III-1), (III-2), (III-3), or (III-4), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof,

[0031] wherein each A1is independently a 5-membered heteroaryl, a 5-membered and 5-membered heteroaryl, a 5-membered and 6-membered heteroaryl, or a 6-membered and 6-membered heteroaryl;

[0032] R 1 , R 2 , R 3 , R 4 , R 5 , R 6 are as described for the corresponding groups in the structure according to Formula (I) of the present application.

[0033] In some embodiments, each A1is independently imidazolyl, pyrazolyl, thienyl, thiazolyl, pyrimidyl, pyrazinyl, benzofuran, benzimidazole, indolyl, or quinolinyl.

[0034] In some embodiments, each R 1 and R 2 is independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl.

[0035] In some embodiments, R 4 and R 5 is independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -NHS(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, methyl, ethyl, 2-hydroxyethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl.

[0036] In some embodiments, R 6 is H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl.

[0037] In some embodiments, each R 7independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl.

[0038] independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl. a and R b independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl.

[0039] independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl. 1-4 alkyl can be C1alkyl, C2alkyl, C3alkyl, C4alkyl; C 1-4 hydroxyl-substituted alkyl can be C1hydroxyl-substituted alkyl, C2hydroxyl-substituted alkyl, C3hydroxyl-substituted alkyl, C4hydroxyl-substituted alkyl), C 2-4 alkenyl can be C2alkenyl, C3alkenyl, C4alkenyl; C 2-4 alkynyl can be C2alkynyl, C3alkynyl, C4alkynyl; C 3-6 cycloalkyl can be C3cycloalkyl, C4cycloalkyl, C5cycloalkyl, C6cycloalkyl; 3-6 membered heterocyclyl can be 3 membered heterocyclyl, 4 membered heterocyclyl, 5 membered heterocyclyl, 6 membered heterocyclyl; C 1-4 haloalkyl can be C1haloalkyl, C2haloalkyl, C3haloalkyl, C4haloalkyl, -CF3, CHF2; C 2-4 haloalkenyl can be C2haloalkenyl, C3haloalkenyl, C4haloalkenyl; C 2-4 haloalkynyl can be C2haloalkynyl, C3haloalkynyl, C4haloalkynyl; C 3-6 halocycloalkyl can be C3halocycloalkyl, C4halocycloalkyl, C5halocycloalkyl, C6halocycloalkyl; 3-6 membered haloheterocyclyl can be 3 membered haloheterocyclyl, 4 membered haloheterocyclyl, 5 membered haloheterocyclyl, 6 membered haloheterocyclyl; C 1-4 alkoxy can be C1alkoxy, C2alkoxy, C3alkoxy, C4alkoxy; C 1-4 haloalkoxy can be C1haloalkoxy, C2haloalkoxy, C3haloalkoxy, C4haloalkoxy.

[0040] In some embodiments, the present application provides a compound having one of the following structures, or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof,

[0041] In a second aspect, the present application provides a pharmaceutical composition comprising a compound according to the first aspect of the present application.

[0042] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant.

[0043] In some embodiments, the pharmaceutical composition is any one of a tablet, a pill, a capsule, an injection.

[0044] In a third aspect, the present application provides the use of a compound or a pharmaceutical composition according to the present application for the manufacture of a medicament for the prevention, treatment or alleviation of a HIF-2a mediated related disease.

[0045] In some embodiments, the HIF-2a mediated related disease is selected from the group consisting of hematopoietic disorders, such as renal anemia, primary anemia, and anemia associated with neoplastic diseases (in particular chemotherapy-induced anemia), anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, dysplasia and aplastic anemia or hemolytic anemia, anemia due to disorders of iron utilization (iron deficiency anemia) or due to other endocrine disorders (e.g. hypothyroidism); post-surgical states of ischemia associated with surgery and their sequelae, in particular cardiac interventions using a heart-lung machine (e.g. shunt operations, heart valve implantation), carotid interventions, aortic interventions and interventions using instruments opening or penetrating the skull; wound healing of surgical interventions; chronic renal diseases, such as primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesions (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathies (polycystic kidney, hereditary nephritis); cardiovascular diseases, in particular cardiac insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease; infections, in particular HIV infection; inflammatory diseases, such as rheumatoid arthritis; cancer and impairment of health status occurring during cancer therapy, in particular after treatment with cytostatic agents, antibiotics and radiation therapy, diseases in the rheumatic spectrum and other disease forms regarded as autoimmune diseases, in particular impairment of health status occurring during pharmacotherapy of such diseases; acute and prolonged states of cerebral ischemia (e.g. stroke, birth asphyxia); acute respiratory distress syndrome.

[0046] In some embodiments, the HIF-2a mediated related disease comprises any one of:

[0047] (a) anemia; (b) ischemic states following surgery and their sequelae; (c) impaired surgical wound healing; (d) chronic kidney disease; (e) cardiovascular disease; (f) infection; (g) inflammatory disease; (h) cancer; (i) health impairment resulting from cancer treatment; (j) continuous conditions of acute or chronic cerebral ischemia; (k) acute respiratory distress syndrome.

[0048] In some embodiments, the anemia comprises renal anemia, primary anemia, tumor disease-related anemia, chemotherapy-induced anemia, anemia of blood loss, anemia of iron deficiency, anemia of vitamin deficiency, anemia of developmental insufficiency, anemia of aplastic, anemia of hemolysis, anemia of iron utilization disorder, or anemia related to endocrine disorder.

[0049] In some embodiments, the surgery comprises cardiac intervention using a heart-lung machine, carotid intervention, aortic intervention, or intervention requiring opening or penetration of the skull.

[0050] In some embodiments, the chronic kidney disease comprises primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesion, ischemic nephropathy, or genetic nephropathy.

[0051] In some embodiments, the tubulointerstitial lesion comprises chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, or drug-induced nephropathy; and / or

[0052] In some embodiments, the genetic nephropathy comprises polycystic kidney or genetic nephritis.

[0053] In some embodiments, the cardiovascular disease comprises cardiac insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary hypertension, pulmonary hypertension, malignant hypertension, or peripheral arterial occlusive disease.

[0054] In some embodiments, the infection comprises HIV infection.

[0055] In some embodiments, the inflammatory disease comprises rheumatoid arthritis.

[0056] In some embodiments, the health impairment resulting from cancer treatment comprises impairment of health status following use of cytostatic agents, antibiotics, and radiation therapy, or impairment of health status occurring during the course of treatment of the disease or its medicaments in the range of rheumatic forms of the disease or other forms of the disease that are considered autoimmune diseases.

[0057] In some embodiments, the continuous condition comprises stroke or asphyxia during delivery.

[0058] In some embodiments, the HIF-2a mediated related disease is wound healing of surgical operation.

[0059] In some embodiments, the HIF-2a mediated related disease is kidney disease, such as primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesion (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathy (polycystic kidney, hereditary nephritis).

[0060] In some embodiments, the HIF-2a mediated related disease is cardiovascular disease, in particular, cardiac insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease.

[0061] In some embodiments, the HIF-2a mediated related disease is infection, in particular, HIV infection.

[0062] In some embodiments, the HIF-2a mediated related disease is inflammatory disease, such as rheumatoid arthritis; cancer and impairment of health status occurring during cancer treatment, in particular, after treatment with cytostatic agents, antibiotics and radiation therapy, rheumatic forms of disease and other forms of disease considered as autoimmune diseases, in particular, impairment of health status occurring during drug treatment of such diseases.

[0063] In some embodiments, the HIF-2a mediated related disease is continuous symptoms of acute and prolonged cerebral ischemic states, such as stroke, birth asphyxia.

[0064] In some embodiments, the HIF-2a mediated related disease is disease respiratory distress syndrome.

[0065] In a fourth aspect, the present application provides a pharmaceutical combination for treating a disease related to HIF-2a activity, wherein the pharmaceutical combination is a combination of a compound of the present application or a pharmaceutical composition thereof and a prolyl hydroxylase inhibitor.

[0066] In some embodiments, a pharmaceutical combination kit or a combined preparation, wherein the pharmaceutical combination kit or the combined preparation comprises a compound of the present application or a pharmaceutical composition of the present application and a prolyl hydroxylase inhibitor.

[0067] In some embodiments, in the pharmaceutical combination kit, the compound of the present application or the pharmaceutical composition of the present application and the prolyl hydroxylase inhibitor are in a physically separated form or mixed with each other.

[0068] In some embodiments, the drug combination, the drug combination kit, or the combined preparation is used for preventing, treating, or alleviating a disease associated with HIF-2a activity.

[0069] In some embodiments, the disease associated with HIF-2a activity includes a HIF-2a mediated disease in the use of the present application.

[0070] In some embodiments, the prolyl hydroxylase inhibitor drug includes any one of Roxadustat, Daprodustat, Vadadustat, Enarodustat, Molidustat.

[0071] Detailed description of the application

[0072] Definitions

[0073] Certain embodiments of the application are now described in detail by referring to certain embodiments which are illustrated in the accompanying drawings and in the following description. All alternatives, modifications and equivalents of the processes and materials described herein can be made and come within the scope of the application, which is defined not by the foregoing description but by the claims that follow. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. The application is intended to cover all such alternatives, modifications and equivalents. In the event that one or more of the incorporated literature, patents, and similar materials differs from or contradicts this application, including but not limited to defined terms, term application, described techniques, etc., this application controls.

[0074] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. All patents and publications identified are incorporated herein by reference in their entirety.

[0075] In the description of the specification, the description using the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" and the like means that a specific feature, structure, material or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. Descriptive expressions of the above terms in the specification do not necessarily refer to the same embodiment or example. Also, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in one or more embodiments or examples. In addition, the person skilled in the art can combine and combine the different embodiments or examples described in the specification and the features of the different embodiments or examples without contradiction.

[0076] The term "patient" used in the present application means a human (including adult and child) or other animal. In some embodiments, the "patient" means a human.

[0077] Unless otherwise indicated, the structural formulae depicted and the compounds described herein encompass all isomeric forms (e.g., enantiomeric, diastereomeric, geometric isomeric or conformational isomers), hydrates, solvates, metabolites, pharmaceutically acceptable salts, and prodrugs thereof. Accordingly, individual stereochemical isomers, enantiomeric, diastereomeric, geometric isomeric, conformational isomers, hydrates, solvates, metabolites, pharmaceutically acceptable salts, and prodrugs of the compounds of the present application are within the scope of the application. In addition, unless otherwise indicated, the structural formulae depicted and the compounds described herein encompass isotopically enriched forms of one or more atoms.

[0078] As used herein, the compounds of the present application can be optionally substituted independently with one or more substituents as described herein. It will be understood that the term "independently optionally substituted" is used interchangeably with the term "substituted or unsubstituted." In general, the term "substituted" means that one or more hydrogen atoms in a given structure are replaced with a particular substituent. Unless otherwise indicated, an optional substituent group can be substituted at any available position on the group. When more than one position in a given structure can be substituted with one or more substituents selected from a particular group, the substituents can be the same or different at each occurrence.

[0079] As used herein, the phrases "each...is independently" and "each...is independently" are used interchangeably and are to be interpreted broadly. They mean that the particular options expressed by the same symbol in different groups are independent of each other, and that the particular options expressed by the same symbol in the same group are independent of each other.

[0080] As used herein, when any variable (e.g., R a , R b , etc.) occurs more than one time in any constituent or substituent, its significance in each occurrence is independent of its significance in every other occurrence. Also, combinations of substituents and variables are permissible only if such combinations result in chemically sensible compounds.

[0081] The term "room temperature" means ambient temperature, which can be 10°C to 35°C, or 15°C to 30°C, or 20°C to 30°C.

[0082] As used herein, "C q1-q2 " means the number of carbon atoms in the group being described, e.g., C 1-6 Alkyl means an alkyl group containing 1 to 6 carbon atoms; C 3-6 Cycloalkyl means a cycloalkyl group containing 3 to 6 carbon atoms.

[0083] The term "q3-q4-membered" or "consisting of q3-q4atoms" refers to the number of ring-forming atoms of the described ring, e.g., 3-6 membered heterocyclyl refers to a heterocyclyl group containing 3-6 ring-forming atoms.

[0084] The term "alkyl" refers to a saturated straight or branched chain monovalent hydrocarbon radical containing one to twenty carbon atoms. In another embodiment, the alkyl group contains one to six carbon atoms; in yet another embodiment, the alkyl group contains one to four carbon atoms; and in still yet another embodiment, the alkyl group contains one to three carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, sec-butyl (s-Bu, -CH(CH3)CH2CH3), t-butyl, n-pentyl, 2-pentyl, and the like.

[0085] The term "alkenyl" refers to a straight or branched chain monovalent hydrocarbon radical containing two to twelve carbon atoms having at least one site of 2 double bond, wherein the alkenyl group can be optionally substituted with one or more substituents described herein, including "cis" and "trans" positioning, or "E" and "Z" positioning. In one embodiment, the alkenyl group contains two to ten carbon atoms; in one embodiment, the alkenyl group contains two to six carbon atoms; and in another embodiment, the alkenyl group contains two to four carbon atoms. Examples of alkenyl groups include, but are not limited to, ethenyl (-CH=CH2), allyl (-CH2CH=CH2), propenyl (-C=CHCH3), isopropenyl (-C(CH3)=CH2), and the like.

[0086] The term "alkynyl" refers to a straight or branched chain monovalent hydrocarbon radical containing two to twelve carbon atoms having at least one site of

[0087] The term "hydroxyalkyl" refers to an alkyl group substituted with one or more hydroxyl groups. In some embodiments, hydroxyalkyl refers to an alkyl group substituted with one, two, three, or four hydroxyl groups. In some embodiments, hydroxyalkyl refers to an alkyl group substituted with one or two hydroxyl groups. In some embodiments, hydroxyalkyl refers to a C 1-6 hydroxyalkyl, i.e., a C 1-6alkyl substituted with one or more hydroxy groups, preferably, C 1-6 hydroxyalkyl means, i.e., C 1-6 alkyl substituted with one hydroxy group. In some embodiments, hydroxyalkyl means C 1-4 hydroxyalkyl. In some embodiments, hydroxyalkyl means C 1-3 hydroxyalkyl. Examples of hydroxyalkyl include, but are not limited to, CH2OH-, CH2OHCH2CH2CH2-, CH2OHCH2-, CH2OHCH2CHOHCH2-, CH(CH3)OHCH2CHOHCH2-, and the like.

[0088] The term "haloalkyl" means an alkyl group substituted with one or more halogen atoms. Examples include, but are not limited to, monofluoromethyl, difluoromethyl, trifluoromethyl, monofluoroethyl, 1,2-difluoroethyl, 1,1-difluoroethyl, 2,2-difluoroethyl, monochloromethyl, dichloromethyl, trichloromethyl, monochloroethyl, 1,2-dichloroethyl, 1,1-dichloroethyl, 2,2-dichloroethyl, 1,1-dibromoethyl, and the like.

[0089] The term "halogen" means F (fluorine), Cl (chlorine), Br (bromine), or I (iodine). Halo means substitution with the corresponding hydrogen with a halogen.

[0090] The term "alkoxy" means an alkyl group attached to the remainder of the molecule through an oxygen atom. In one embodiment, the alkoxy group contains 1 to 6 carbon atoms; in another embodiment, the alkoxy group contains 1 to 4 carbon atoms; in yet another embodiment, the alkoxy group contains 1 to 3 carbon atoms. Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH3), ethoxy (EtO, -OCH2CH3), 1-propoxy (n-PrO, n-propoxy, -OCH2CH2CH3), 2-propoxy (i-PrO, i-propoxy, -OCH(CH3)2), 1-butoxy (n-BuO, n-butoxy, -OCH2CH2CH2CH3), 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH2CH(CH3)2), and the like.

[0091] The term "heterocyclyl" denotes a monovalent, nonaromatic, saturated or partially unsaturated monocyclic ring system of 3 to 12 ring atoms, and which system contains at least one carbon atom and contains one, two, or three heteroatoms selected from O, N, S. Unless otherwise specified, a heterocyclyl group can be carbon-based or nitrogen-based, and a -CH2- group can optionally be replaced by -C(O)-. A sulfur atom of the ring can optionally be oxidized to the S-oxide or the S-oxide can optionally be oxidized to the S-dioxide. In some embodiments, the heterocycle contains 4 to 7 ring atoms, i.e., represents a 4 to 7 membered heterocycle; in other embodiments, the heterocycle contains 4 to 7 ring atoms, i.e., represents a 4 to 7 membered heterocycle. Examples of heterocycles include, but are not limited to, oxiranyl, azirdinyl, oxetanyl, thietanyl, pyrrolidinyl, 2-pyrrolinyl, 3-pyrrolinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, 1,3-dioxolanyl, dithiolanyl, tetrahydropyranyl, dihydropyranyl, 2H-pyranyl, 4H-pyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, dioxanyl, dithianyl, thioxanyl, homopiperazinyl, homopiperidinyl, 1,1-dioxo-l,3-thiomorpholinyl, and the like. Examples of heterocyclyl groups in which a -CH2- group is replaced by -C(O)- include, but are not limited to, 2-oxopyrrolidinyl, oxo-l,3-thiazolidinyl, 2-piperidonyl, 3,5-dioxopiperidinyl. Examples of heterocyclyl groups in which a nitrogen atom is oxidized to an N-oxide include, but are not limited to, 1,1-dioxo-l,3-thiomorpholinyl.

[0092] The term "aryl" denotes a monovalent aromatic ring carbon atom from which one hydrogen atom has been removed from an aromatic ring. Examples of aryl groups can include phenyl, naphthyl, and anthryl, and the like.

[0093] The term "heteroaromatic ring" means a monovalent monocyclic, bicyclic and tricyclic ring system containing 5 to 12 ring atoms, or 5 to 10 ring atoms, or 5 to 6 ring atoms, wherein at least one ring system is aromatic, and at least one ring system contains one or more heteroatoms, wherein each ring system contains 5 to 7 atoms in a ring. In one embodiment, the 5 to 10 membered heteroaryl contains 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In some embodiments, the term "heteroaryl" means a heteroaromatic ring group containing 5 ring atoms, or a 5-membered heteroaryl group, wherein 1, 2, 3 or 4 heteroatoms are independently selected from O, S and N. Examples of heteroaryl groups include, but are not limited to, 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, pyridazinyl (e.g., 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (e.g., 5-tetrazolyl), triazolyl (e.g., 2-triazolyl and 5-triazolyl), 2-thiophenyl, 3-thiophenyl, pyrazolyl (e.g., 2-pyrazolyl), isothiazolyl, 1,2,3-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,3-triazolyl, 1,2,3-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,5-thiadiazolyl, pyrazinyl, 1,3,5-triazinyl; also included are bicyclic rings, but are by no means limited to these: benzimidazolyl, benzofuranyl, benzothiophenyl, indolyl (e.g., 2-indolyl), purinyl, quinolinyl (e.g., 2-quinolinyl, 3-quinolinyl, 4-quinolinyl), isoquinolinyl (e.g., 1-isoquinolinyl, 3-isoquinolinyl or 4-isoquinolinyl), imidazo[l,2-a]pyridinyl, pyrazolo[l,5-a]pyridinyl, pyrazolo[l,5-a]pyrimidinyl, imidazo[l,2-b]pyridazinyl, [l,2,4]triazolo[4,3-b]pyridazinyl, [l,2,4]triazolo[l,5-a]pyrimidinyl, [l,2,4]triazolo[l,5-a]pyridinyl, and the like.

[0094] The term "prodrug" as used herein means a compound that is converted into a compound of Formula (I) in vivo. Such conversion is affected by the hydrolysis of the prodrug in the blood or by enzymatic conversion in the blood or tissues to the parent structure. The prodrug class of compounds of the present invention can be esters, and in the present invention esters that can act as prodrugs are benzoic esters, aliphatic (C 1-24) esters, acyloxymethyl esters, carbonates, carbamates, and amino acid esters. For example, a compound of the application containing a hydroxyl group can be acylated to produce a prodrug form of the compound. Other prodrug forms include phosphate esters, such as those produced by phosphorylating a hydroxyl group on the parent molecule.

[0095] "Metabolite" refers to a product produced through metabolism of a specified compound or salt thereof in the body. Metabolites of a compound can be identified using techniques known in the art, and have activities generally similar to those of the compound from which they are derived. Such products can be oxidized, reduced, hydrolyzed, aminated, deaminated, esterified, deesterified, enzymatically cleaved, and the like. Accordingly, the application includes metabolites of a compound, including those produced when a compound of the application is administered to a mammal for a period of time sufficient to yield a metabolic product.

[0096] "Pharmaceutically acceptable salt" as used herein refers to organic and inorganic salts of the compounds of the application. Pharmaceutically acceptable salts are well known in the art, for examples of which see S. M. Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66: 1-19. Pharmaceutically acceptable, non-toxic acid addition salts include those derived from inorganic acids, such as hydrochloric, hydrobromic, phosphoric, sulfuric, perchloric, and organic acids, such as acetic, oxalic, maleic, tartaric, citric, succinic, malonic, and other similar acids. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, stearate, sulfocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Salts derived from an appropriate base include alkali metal, alkaline earth metal, ammonium, and N + (C 1-4Salts of alkyl groups (4). This invention also contemplates quaternary ammonium salts formed from any compound containing an N group. Water-soluble or oil-soluble or dispersed products can be obtained by quaternization. Alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Pharmaceutically acceptable salts further include suitable, non-toxic ammonium, quaternary ammonium salts, and amine cations resistant to the formation of equilibrium ions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C 1-8 Sulfonates and aromatic sulfonates.

[0097] Furthermore, the compounds disclosed in this invention, including their salts, can also be obtained in their hydrated form or in the form containing their solvents (e.g., ethanol, DMSO, etc.) for their crystallization. The compounds disclosed in this invention can inherently or by design form solvates with pharmaceutically acceptable solvents (including water); therefore, this invention is intended to include both solvated and unsolvated forms.

[0098] In this invention, "solvent" refers to an association formed by one or more solvent molecules with the compound of this invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, and aminoethanol. The term "hydrate" refers to an association formed when the solvent molecules are water.

[0099] As used in this invention, the term "treatment" refers to any disease or condition, and in some embodiments, it means improving the disease or condition (i.e., slowing down or stopping or alleviating the development of the disease or at least one of its clinical symptoms). In other embodiments, "treatment" means alleviating or improving at least one bodily parameter, including bodily parameters that may not be perceived by the patient. In still other embodiments, "treatment" means regulating the disease or condition physically (e.g., stabilizing perceptible symptoms) or physiologically (e.g., stabilizing bodily parameters) or both. In still other embodiments, "treatment" means preventing or delaying the onset, occurrence, or worsening of the disease or condition.

[0100] "Combination" refers to a fixed combination or portion of a cassette for combined administration in the form of a single dose unit, wherein the compounds disclosed in this invention and their combination partners can be administered independently at the same time or separately at time intervals, particularly to enable the combination partners to exhibit cooperative, e.g., synergistic, effects. The terms "co-administration" or "combination administration" as used herein are intended to encompass administering a selected combination partner to a single individual (e.g., a patient) in need of it, and are intended to include treatment regimens in which the substances do not necessarily take place via the same route of administration or are administered simultaneously.

[0101] The term "pharmaceutical combination" as used herein means a product comprising two or more active ingredients, wherein at least one of the active ingredients is a compound of the present disclosure, and wherein the combination provides therapeutically effective levels of the two or more active ingredients in the body. The term "fixed combination" means that the active ingredients, e.g. a compound of the present disclosure, and the combination partner, are packaged together in the same package, e.g. a pharmaceutical kit. The term "non-fixed combination" means that the active ingredients, e.g. a compound of the present disclosure, and the combination partner, are packaged separately but used in combination to treat a condition or disease. The term "co-administration" means the administration of at least two active ingredients to a patient in need thereof. The two active ingredients can be administered simultaneously, concurrently or sequentially with no specific time limits. The latter also applies to cocktail therapy, e.g. the administration of three or more active ingredients.

[0102] The term "v:v" means volume to volume. DCM means dichloromethane; PE means petroleum ether; EA means ethyl acetate. BRIEF DESCRIPTION OF DRAWINGS

[0103] Figure 1A is a graph showing the down-regulation of a-SMA gene and protein expression by compounds in a TGF-β1 -induced rat kidney fibroblast activation assay, as measured by real-time quantitative PCR, according to an embodiment of the present disclosure. In the graph, relative mRNA level means mRNA relative level.

[0104] Figure 1B is a graph showing the down-regulation of Collagen III gene and protein expression by compounds in a TGF-β1 -induced rat kidney fibroblast activation assay, as measured by real-time quantitative PCR, according to an embodiment of the present disclosure. In the graph, relative mRNA level means mRNA relative level.

[0105] Figure 2A is a graph showing the up-regulation of VEGF, a downstream target gene of HIF-2, by compounds in 786-O cells, as measured by real-time quantitative PCR, according to an embodiment of the present disclosure. In the graph, relative mRNA level means mRNA relative level.

[0106] Figure 2B is a graph showing the up-regulation of NDRG1, a downstream target gene of HIF-2, by compounds in 786-O cells, as measured by real-time quantitative PCR, according to an embodiment of the present disclosure. In the graph, relative mRNA level means mRNA relative level.

[0107] Figure 2C is a graph showing the up-regulation of EPO, a downstream target gene of HIF-2, by compounds in 786-O cells, as measured by real-time quantitative PCR, according to an embodiment of the present disclosure. In the graph, relative mRNA level means mRNA relative level.

[0108] Figure 3 is a histogram showing the results of real-time quantitative PCR for detecting the transcription of EPO, a downstream target gene of HIF-2, in Hep3B cells treated with compound 16 and Roxadustat, according to an embodiment of the present application. In the figure, relative mRNA level: relative mRNA level.

[0109] Figure 4A is a histogram showing the results of detecting the improvement of renal edema in zebrafish induced by aristolochic acid in the presence of compound 16, according to an embodiment of the present application. In the figure, control: normal control group; model: model control group; aristolochic acid-induced model: aristolochic acid-induced model.

[0110] Figure 4B is a histogram showing the results of detecting the improvement of glomerular filtration rate in zebrafish induced by aristolochic acid in the presence of compound 16, according to an embodiment of the present application. In the figure, control: normal control group; model: model control group; aristolochic acid-induced model: aristolochic acid-induced model.

[0111] Figure 4C is a histogram showing the results of detecting the increase of heart red blood cell signal intensity in zebrafish induced by aristolochic acid in the presence of compound 16, according to an embodiment of the present application. In the figure, control: normal control group; model: model control group; aristolochic acid-induced model: aristolochic acid-induced model.

[0112] Figure 5A is a histogram showing the results of HE staining (A) (40x magnification) of compound 16 and 76 in a unilateral ureteral obstruction-induced kidney injury model, according to an embodiment of the present application.

[0113] Figure 5B is a histogram showing the results of Masson's trichrome staining (B) (20x magnification) of compound 16 and 76 in a unilateral ureteral obstruction-induced kidney injury model, according to an embodiment of the present application.

[0114] Figure 5C is a histogram showing the results of semi-quantitative analysis of tubular injury in HE-stained sections (C) of Figure 5A, according to an embodiment of the present application. In the figure, paller scores: Paller scores; serum CREA: serum creatinine; UREA: urea.

[0115] Figure 5D is a histogram showing the results of semi-quantitative analysis of tubular injury in Masson's trichrome-stained sections of Figure 5B, according to an embodiment of the present application. In the figure, paller scores: Paller scores; serum CREA: serum creatinine; UREA: urea. DETAILED DESCRIPTION

[0116] General synthetic methods for compounds of the present application

[0117] Generally, the compounds of the present application can be prepared by the methods described herein. The following reaction schemes and examples are intended to further illustrate the present application. Those skilled in the art will appreciate that the examples are merely illustrative and should not be viewed as specific limitations to the present application.

[0118] The following synthetic schemes describe the preparation of the compounds disclosed herein.

[0119] Synthetic Scheme (I):

[0120] Compound (la) can be prepared by the synthetic method of synthetic scheme (I), wherein R 1 , R 2 , R 3 , R 4 , R 5 and R 6 each have the meaning as described herein. The coupling of compound (la-1) with a bromo / iodo compound (la-2) under suitable conditions (e.g. with N,N'-dimethyl-1,2- cyclohexanediamine, copper iodide and potassium carbonate in N,N-dimethylformamide as solvent at 135 °C for 2 h or with N,N'-dimethyl-1,2-cyclohexanediamine, copper iodide and potassium phosphate in toluene as solvent at 110 °C for 24 h) gives compound (la) which can be converted into the final product by various chemical reactions.

[0121] Example 1: Synthesis of ethyl 1-(3,5-difluorophenyl)-1H-indole-4-carboxylate (1)

[0122] Step 1: Preparation of 4-bromo-1-(3,5-difluorophenyl)-1H-indole

[0123] To a solution of 4-bromo-1H-indole (600 mg), 1,3-difluoro-5-iodobenzene (881 mg), N,N'-dimethyl-1,2-cyclohexanediamine (108 mg), copper iodide (116 mg) and potassium carbonate (845 mg) in 20 mL of N,N-dimethylformamide (DMF) was added under argon protection. The mixture was heated at 135 °C for 2 h. After cooling to room temperature, 200 mL of saturated aqueous ammonium chloride solution was added and the mixture was extracted with ethyl acetate three times. The combined organic layers were washed with saturated aqueous sodium bicarbonate solution once, dried over anhydrous sodium sulfate, and the organic solution was removed by rotary evaporation. The residue was purified by column chromatography on silica gel (DCM:PE (v:v) = 1:1) to give the target compound 4-bromo-1-(3,5-difluorophenyl)-1H-indole (680 mg). 1H NMR (400 MHz, CDC13) δ 7.66-7.53 (m, 1H), 7.41 (s, 2H), 7.19-6.98 (m, 3H), 6.87 (tt, J = 9.0, 2.5 Hz, 1H), 6.81-6.66 (m, 1H).

[0124] Step 2: Preparation of methyl 1-(3,5-difluorophenyl)-1H-indole-4-carboxylate

[0125] To 4-bromo-1-(3,5-difluorophenyl)-1H-indole (680 mg), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (389 mg) and triethylamine (718 mg) was added into 20 mL of ethanol, charged with carbon monoxide (15 bar), and reacted at 80 °C for 12 hours. Cooled to room temperature, slowly released carbon monoxide gas. Added 100 mL of water, extracted with ethyl acetate three times, combined the organic layer, washed with saturated aqueous sodium chloride once, dried with anhydrous sodium sulfate, and the organic solvent was removed by rotary evaporation. The residue was purified by silica gel column chromatography (DCM:PE (v / v) = 2:1) to give 1-(3,5-difluorophenyl)-1H-indole-4-carboxylate 416 mg. 1 H NMR (400 MHz, DMSO-d6) δ 7.95 (d, J = 8.3 Hz, 1H), 7.91 (d, J = 3.4 Hz, 1H), 7.90-7.84 (m, 1H), 7.52-7.43 (m, 2H), 7.45-7.25 (m, 2H), 7.29-7.19 (m, 1H), 4.40 (q, J = 7.1 Hz, 2H), 1.40 (t, J = 7.1 Hz, 3H).

[0126] Example 2: Synthesis of (1-(3,5-difluorophenyl)-1H-indol-4-yl)methanol (2)

[0127] To methyl 1-(3,5-difluorophenyl)-1H-indole-4-carboxylate (80 mg) was added into 10 mL of super dry tetrahydrofuran, and lithium aluminum hydride tetrahydrofuran solution (2.5 mol / L, 0.22 mL) was added dropwise slowly. Reacted at room temperature for 1 h. Added saturated aqueous ammonium chloride solution dropwise slowly to quench the reaction, extracted with ethyl acetate three times, combined the organic layer, washed with saturated aqueous sodium chloride once, dried with anhydrous sodium sulfate, and the organic solution was removed by rotary evaporation. The residue was purified by silica gel column chromatography (PE:EA = 2:1) to give the target compound (1-(3,5-difluorophenyl)-1H-indol-4-yl)methanol 60 mg. 1H NMR (400 MHz, CDC13): δ 7.59 (d, J = 8.1 Hz, 1H), 7.37 (d, J = 3.4 Hz, 1H), 7.34-7.18 (m, 3H), 7.17-7.03 (m, 2H), 6.93-6.80 (m, 2H), 5.05 (s, 2H).

[0128] Example 3: Synthesis of 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid (3)

[0129] To methyl 1-(3,5-difluorophenyl)-1H-indole-4-carboxylate (100 mg) was added to 2 mL of tetrahydrofuran, 2 mL of 2N aqueous lithium hydroxide solution was added dropwise, and the reaction was allowed to proceed at room temperature for 1 h. The tetrahydrofuran was distilled off, diluted with dilute hydrochloric acid to adjust the pH to 7, and filtered under suction. The filter cake was washed with water three times and dried to obtain 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid (30 mg). 1 H NMR (400 MHz, CDC13): δ 7.59 (d, J = 8.1 Hz, 1H), 7.37 (d, J = 3.4 Hz, 1H), 7.34-7.18 (m, 3H), 7.17-7.03 (m, 2H), 6.93-6.80 (m, 2H), 5.05 (s, 2H).

[0130] Example 4: Synthesis of 1-(3,5-difluorophenyl)-1H-indole-4-carboxamide (4)

[0131] To methyl 1-(3,5-difluorophenyl)-1H-indole-4-carboxylate (100 mg) was added to 2 mL of tetrahydrofuran, 2 mL of 2N aqueous lithium hydroxide solution was added dropwise, and the reaction was allowed to proceed at room temperature for 1 h. The tetrahydrofuran was distilled off, diluted with dilute hydrochloric acid to adjust the pH to 7, and filtered under suction. The filter cake was washed with water three times and dried to obtain 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid (30 mg). 1 H NMR (400 MHz, CDC13): δ 7.59 (d, J = 8.1 Hz, 1H), 7.37 (d, J = 3.4 Hz, 1H), 7.34-7.18 (m, 3H), 7.17-7.03 (m, 2H), 6.93-6.80 (m, 2H), 5.05 (s, 2H).

[0132] Example 5: Synthesis of 1-(3,5-difluorophenyl)-N-methyl-1H-indole-4-carboxamide (5)

[0133] To 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid (80 mg) in 10 mL DMF was added methylammonium hydrochloride (27 mg), 1-(3-dimethylaminopropyl)-3- ethylcarbodiimide hydrochloride (EDCI, 105 mg) and 2-(7-azobenzotriazol)-N,N,N',N'- tetramethyluronium hexafluorophosphate (HATU, 19 mg). The reaction was stirred at room temperature for 2 h, 100 mL water was added, the organic layer was extracted with ethyl acetate for three times, combined and washed with saturated aqueous sodium chloride solution once, dried over anhydrous sodium sulfate, the organic solution was removed by rotary evaporation, and the residue was purified by silica gel column chromatography (PE:EA = 3:1) to give the target compound 1-(3,5-difluorophenyl)-N-methyl-1H-indole-4- carboxamide 62 mg. 1 H NMR (400 MHz, DMSO-d6) δ 8.34 (d, J = 4.7 Hz, 1H), 7.89 - 7.74 (m, 2H), 7.54 (d, J = 7.4 Hz, 1H), 7.50 - 7.41 (m, 2H), 7.39 - 7.24 (m, 2H), 7.16 (d, J = 3.4 Hz, 1H), 2.84 (d, J = 4.5 Hz, 3H).

[0134] Example 6: Synthesis of 1-(3,5-difluorophenyl)-4-(methylsulfonyl)-1H-indole (6)

[0135] To 4-bromo-1-(3,5-difluorophenyl)-1H-indole (100 mg), sodium methanesulfinate (30 mg) and cuprous iodide (304 mg) in 10 mL dimethyl sulfoxide was added under argon protection. The reaction was stirred at 100 °C for 3 h. The reaction was cooled to room temperature, 100 mL water was added, the organic layer was extracted with ethyl acetate for three times, combined and washed with saturated aqueous sodium chloride solution once, dried over anhydrous sodium sulfate, the organic solution was removed by rotary evaporation, and the residue was purified by silica gel column chromatography (PE:EA (v:v) = 3:1) to give the target compound 82 g. 1 H NMR (400 MHz, DMSO-d6) δ 8.34 (d, J = 4.7 Hz, 1H), 7.89 - 7.74 (m, 2H), 7.54 (d, J = 7.4 Hz, 1H), 7.50 - 7.41 (m, 2H), 7.39 - 7.24 (m, 2H), 7.16 (d, J = 3.4 Hz, 1H), 2.84 (d, J = 4.5 Hz, 3H).

[0136] Example 7: Synthesis of N-(1-(3,5-difluorophenyl)-1H-indol-4-yl)methanesulfonamide (7)

[0137] To 4-bromo-1-(3,5-difluorophenyl)-1H-indole (100 mg), N,N'-dimethyl-1,2- cyclohexanediamine (91 mg), methanesulfonamide (152 mg), trifluoromethanesulfononate (196 mg) and potassium carbonate (441 mg) in 10 mL of N-methylpyrrolidone (NMP) was added under argon protection. The mixture was subjected to microwave reaction at 125 °C for 2 h. After cooling to room temperature, 100 mL of water was added. The mixture was extracted with ethyl acetate for three times. The organic layers were combined and washed with saturated aqueous sodium chloride solution once. The mixture was dried over anhydrous sodium sulfate. The organic solution was removed by rotary evaporation. The residue was purified by silica gel column chromatography (EA:PE (v:v) = 5:1) to give the target compound N-(1-(3,5-difluorophenyl)-1H-indol-4-yl)methanesulfonamide 45 mg. 1 H NMR (400 MHz, DMSO-d6) δ 7.86 (d, J = 3.4 Hz, 1H), 7.69 (d, J = 8.3 Hz, 1H), 7.53 - 7.44 (m, 2H), 7.41 (d, J = 7.6 Hz, 1H), 7.38 - 7.32 (m, 1H), 7.19 (t, J = 8.0 Hz, 1H), 6.71 (d, J = 3.4 Hz, 1H), 3.37 (s, 3H).

[0138] Example 8: Synthesis of 1-(3,5-difluorophenyl)-1H-indole-4-carbonitrile (8)

[0139] To 4-bromo-1-(3,5-difluorophenyl)-1H-indole (300 mg), palladium trifluoroacetate (112 mg), 2-(di-tert-butylphosphino)-1,1'-binaphthyl (Trixie Phos, 77 mg), zinc cyanide (567 mg) and zinc powder (252 mg) in 20 mL of DMF was added under argon protection. The mixture was subjected to microwave reaction at 120 °C for 3 h. After cooling to room temperature, 100 mL of water was added. The mixture was extracted with ethyl acetate for three times. The organic layers were combined and washed with saturated aqueous sodium chloride solution once. The mixture was dried over anhydrous sodium sulfate. The organic solution was removed by rotary evaporation. The residue was purified by silica gel column chromatography (EA:PE (v:v) = 1:5) to give the target compound 1-(3,5-difluorophenyl)-1H-indole-4-carbonitrile 45 mg. 1 H NMR (400 MHz, DMSO-d6) δ 8.16 - 7.93 (m, 2H), 7.72 (d, J = 7.3 Hz, 1H), 7.57 - 7.48 (m, 2H), 7.45 - 7.31 (m, 2H), 6.91 (d, J = 3.4 Hz, 1H).

[0140] Example 9: Synthesis of (1-(3,5-difluorophenyl)-1H-indol-4-yl)boronic acid (9)

[0141] To 4-bromo-1-(3,5-difluorophenyl)-1H-indole (100 mg) in 10 mL of dry tetrahydrofuran, under argon protection, the temperature was lowered to -78 °C. n-Butyllithium (1 mol / L, 0.64 mL) was added dropwise and the reaction was continued at -78 °C for 0.5 h. Triethyl borate (0.64 mmol) was added dropwise to the reaction system and the reaction was continued for 1 h. The reaction was quenched by slowly adding 10 mL of saturated aqueous ammonium chloride solution, 100 mL of water was added, and the organic layer was extracted with ethyl acetate three times, the combined organic layer was washed with saturated aqueous sodium chloride solution once, dried over anhydrous sodium sulfate, and the organic solution was removed by rotary evaporation. The residue was purified by silica gel column chromatography (PE:EA (v:v) = 2:1) to obtain the target compound (1-(3,5-difluorophenyl)-1H-indol-4-yl)boronic acid 32 mg. 1 H NMR (400 MHz, DMSO-d6) δ 8.04 (s, 1H), 7.79-7.68 (m, 2H), 7.62 (d, J = 7.0 Hz, 1H), 7.46-7.39 (m, 2H), 7.32-7.17 (m, 3H), 7.12 (d, J = 3.4 Hz, 1H).

[0142] Example 10: Synthesis of 1-(3,5-difluorophenyl)-6-fluoro-1H-indole-4-carboxylic acid methyl ester (10)

[0143] The synthesis method is referred to step 1 of Example 1, and 4-bromo-1H-indole is replaced by 6-fluoro-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.04 (s, 1H), 7.79-7.68 (m, 2H), 7.62 (d, J = 7.0 Hz, 1H), 7.46-7.39 (m, 2H), 7.32-7.17 (m, 3H), 7.12 (d, J = 3.4 Hz, 1H).

[0144] Example 11: Synthesis of 1-(3,5-difluorophenyl)-6-fluoro-1H-indole-4-carboxylic acid (11)

[0145] The synthesis method is referred to Example 3, and 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester is replaced by 1-(3,5-difluorophenyl)-6-fluoro-1H-indole-4-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 13.24 (s, 1H), 7.87 (d, J = 3.4 Hz, 1H), 7.80-7.72 (m, 1H), 7.61 (dd, J = 10.0, 2.4 Hz, 1H), 7.56-7.45 (m, 2H), 7.38-7.33 (m, 1H), 7.24 (d, J = 3.4 Hz, 1H).

[0146] Example 12: Synthesis of 1-(3,5-difluorophenyl)-6-fluoro-1H-indole-4- carboxamide (12)

[0147] The synthesis method refers to Example 4, replacing 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3,5-difluorophenyl)-6-fluoro-1H- indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.98 (s, 1H), 7.80 (d, J = 3.4 Hz, 1H), 7.65 (dd, J = 9.7, 2.2 Hz, 1H), 7.53-7.44 (m, 4H), 7.37-7.30 (m, 1H), 7.19 (d, J = 3.3 Hz, 1H).

[0148] Example 13: Synthesis of 6-chloro-1-(3,5-difluorophenyl)-1H-indole-4- carboxylic acid methyl ester (13)

[0149] The synthesis method refers to step 1 of Example 1, replacing 4-bromo-1H- indole with 6-chloro-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.97 (d, J = 3.4 Hz, 2H), 7.81 (d, J = 1.8 Hz, 1H), 7.64-7.47 (m, 2H), 7.42-7.38 (m, 1H), 7.23 (d, J = 3.4 Hz, 1H), 3.95 (s, 3H).

[0150] Example 14: Synthesis of 6-chloro-1-(3,5-difluorophenyl)-1H-indole-4- carboxylic acid (14)

[0151] The synthesis method refers to Example 3, replacing 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3,5-difluorophenyl)-6-chloro-1H- indole-4-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 13.31 (s, 1H), 7.92 (dd, J = 4.3, 2.5 Hz, 2H), 7.78 (d, J = 1.8 Hz, 1H), 7.58 - 7.47 (m, 2H), 7.44 - 7.33 (m, 1H), 7.24 (d, J = 3.4 Hz, 1H).

[0152] Example 15: Synthesis of methyl l-(3-fluoro-5-methoxyphenyl)-lH-indole-4- carboxylate (15)

[0153] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-lH-indole with methyl lH-indole-4-carboxylate and 1,3-difluoro-5- iodobenzene with l-bromo-3-fluoro-5-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.96 - 7.82 (m, 3H), 7.35 (t, J = 7.9 Hz, 1H), 7.22 (dd, J = 3.3, 0.8 Hz, 1H), 7.11 (d, J = 9.7 Hz, 1H), 7.04 (s, 1H), 7.04 - 6.91 (m, 1H), 3.94 (s, 3H), 3.88 (s, 3H).

[0154] Example 16: Synthesis of l-(3-fluoro-5-methoxyphenyl)-lH-indole-4-carboxylic acid (16)

[0155] The synthesis was performed according to the procedure of Example 3, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-fluoro-5- methoxyphenyl)-lH-indole-4-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 7.89 (d, J = 8.2 Hz, 1H), 7.87 - 7.80 (m, 2H), 7.32 (t, J = 7.9 Hz, 1H), 7.23 (d, J = 3.3 Hz, 1H), 7.13 - 7.09 (m, 1H), 7.04 (d, J = 2.2 Hz, 1H), 6.93 (dt, J = 10.9, 2.3 Hz, 1H), 3.88 (s, 3H).

[0156] Example 17: Synthesis of l-(3-fluoro-5-methoxyphenyl)-lH-indole-4-carboxamide (17)

[0157] The synthesis was performed according to the procedure of Example 4, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-fluoro-5- methoxyphenyl)-lH-indole-4-carboxylate.1 H NMR (400 MHz, DMSO-d6) δ 7.87-7.83 (m, 1H), 7.82-7.69 (m, 2H), 7.60 (d, J = 7.2 Hz, 1H), 7.35-7.22 (m, 2H), 7.17 (d, J = 3.3 Hz, 1H), 7.13-7.07 (m, 1H), 7.02 (d, J = 8.6 Hz, 1H), 6.93-6.89 (m, 1H), 3.88 (s, 3H).

[0158] Example 18: Synthesis of methyl l-(3-methoxyphenyl)-lH-indole-4-carboxylate (18)

[0159] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-lH-indole with methyl lH-indole-4-carboxylate and 1,3-difluoro-5- iodobenzene with l-iodo-3-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.86 (d, J = 7.8 Hz, 3H), 7.51 (t, J = 8.1 Hz, 1H), 7.32 (t, J = 7.9 Hz, 1H), 7.21 (d, J = 3.3 Hz, 1H), 7.20-7.16 (m, 1H), 7.15 (t, J = 2.3 Hz, 1H), 7.03 (dd, J = 8.3, 2.5 Hz, 1H), 3.94 (s, 3H), 3.86 (s, 3H).

[0160] Example 19: Synthesis of l-(3-methoxyphenyl)-lH-indole-4-carboxylic acid (19)

[0161] The synthesis was performed according to the procedure of Example 3, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-methoxyphenyl)-lH-indole-4- carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 7.86 (d, J = 7.8 Hz, 3H), 7.51 (t, J = 8.1 Hz, 1H), 7.32 (t, J = 7.9 Hz, 1H), 7.21 (d, J = 3.3 Hz, 1H), 7.20-7.16 (m, 1H), 7.15 (t, J = 2.3 Hz, 1H), 7.03 (dd, J = 8.3, 2.5 Hz, 1H), 3.94 (s, 3H), 3.86 (s, 3H).

[0162] Example 20: Synthesis of l-(3-methoxyphenyl)-lH-indole-4-carboxamide (20)

[0163] The synthesis was performed according to the procedure of Reference Example 4, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3- chloro-5-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.85 (dd, J = 17.7, 9.8 Hz, 2H), 7.79 - 7.55 (m, 2H), 7.54 - 7.42 (m, 1H), 7.40 - 7.22 (m, 2H), 7.21 - 7.07 (m, 3H), 7.05 - 6.98 (m, 1H), 3.85 (s, 3H).

[0164] Example 21 : Synthesis of 1-(3-chloro-5-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (21)

[0165] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5- iodobenzene with 1-bromo-3-chloro-5-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.88 (dd, J = 8.7, 5.3 Hz, 3H), 7.37 (s, 1H), 7.28 (s, 1H), 7.22 (d, J = 3.3 Hz, 1H), 7.16 (s, 1H), 7.12 (s, 1H), 3.94 (s, 3H), 3.88 (s, 3H).

[0166] Example 22: Synthesis of 1-(3-chloro-5-methoxyphenyl)-1H-indole-4-carboxylic acid (22)

[0167] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3-chloro-5- methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.88 (dd, J = 8.7, 5.3 Hz, 3H), 7.37 (s, 1H), 7.28 (s, 1H), 7.22 (d, J = 3.3 Hz, 1H), 7.16 (s, 1H), 7.12 (s, 1H), 3.94 (s, 3H), 3.88 (s, 3H).

[0168] Example 23: Synthesis of 1-(3-chloro-5-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (21)

[0169] The synthesis was performed according to the procedure described in Example 4, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3-chloro-5- methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.93 - 7.83 (m, 1H), 7.76 (dd, J = 12.5, 5.8 Hz, 2H), 7.61 (d, J = 7.4 Hz, 1H), 7.35 (d, J = 7.7 Hz, 1H), 7.31 - 7.22 (m, 2H), 7.22 - 7.05 (m, 3H), 3.88 (s, 3H).

[0170] Example 24: Synthesis of 1-(2-methoxypyridin-4-yl)-1H-indole-4-carboxylic acid methyl ester (24)

[0171] The synthesis was performed according to the procedure described in Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5- iodobenzene with 4-bromo-2-methoxypyridine. 1 H NMR (400 MHz, DMSO-d6) δ 8.34 (d, J = 5.6 Hz, 1H), 8.06 (s, 1H), 8.00 (d, J = 3.5 Hz, 1H), 7.93 - 7.86 (m, 1H), 7.40 (d, J = 7.9 Hz, 1H), 7.38 - 7.34 (m, 1H), 7.28 (d, J = 3.5 Hz, 1H), 7.10 (d, J = 1.9 Hz, 1H), 3.95 (s, 3H), 3.94 (s, 3H).

[0172] Example 25: Synthesis of 1-(2-methoxypyridin-4-yl)-1H-indole-4-carboxylic acid (25)

[0173] The synthesis was performed according to the procedure described in Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(2-methoxypyridin-4-yl)-1H- indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.34 (d, J = 5.6 Hz, 1H), 8.06 (s, 1H), 8.00 (d, J = 3.5 Hz, 1H), 7.93 - 7.86 (m, 1H), 7.40 (d, J = 7.9 Hz, 1H), 7.38 - 7.34 (m, 1H), 7.28 (d, J = 3.5 Hz, 1H), 7.10 (d, J = 1.9 Hz, 1H), 3.95 (s, 3H), 3.94 (s, 3H).

[0174] Example 26: Synthesis of 1-(2-methoxypyridin-4-yl)-1H-indole-4-carboxamide (26)

[0175] The synthesis was performed according to the procedure of Reference Example 4, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(2-methoxypyridin-4-yl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.32 (d, J = 5.6 Hz, 1H), 7.99 - 7.85 (m, 3H), 7.71 - 7.55 (m, 1H), 7.42 - 7.27 (m, 3H), 7.23 (dd, J = 3.4, 0.8 Hz, 1H), 7.07 (d, J = 1.9 Hz, 1H), 3.94 (s, 3H).

[0176] Example 27: Synthesis of 1-(3,5-dimethoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (27)

[0177] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 1-iodo-3,5-dimethoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.90 (d, J = 8.3 Hz, 1H), 7.88 - 7.80 (m, 2H), 7.33 (t, J = 7.9 Hz, 1H), 7.20 (d, J = 3.2 Hz, 1H), 6.75 (d, J = 2.1 Hz, 2H), 6.58 (d, J = 2.1 Hz, 1H), 3.94 (s, 3H), 3.84 (d, J = 1.8 Hz, 6H).

[0178] Example 28: Synthesis of 1-(3,5-dimethoxyphenyl)-1H-indole-4-carboxylic acid (28)

[0179] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3,5-dimethoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.79 (s, 1H), 7.93 - 7.75 (m, 3H), 7.30 (t, J = 7.9 Hz, 1H), 7.21 (d, J = 3.3 Hz, 1H), 6.74 (d, J = 2.1 Hz, 2H), 6.58 (d, J = 2.1 Hz, 1H), 3.84 (s, 6H).

[0180] Example 29: Synthesis of 1-(3,5-dimethoxyphenyl)-1H-indole-4-carboxamide (29)

[0181] The synthesis method refers to Example 4, replacing 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3,5-dimethoxyphenyl)-1H-indole-4- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.94-7.79 (m, 1H), 7.79-7.71 (m, 2H), 7.58 (d, J = 7.3 Hz, 1H), 7.36-7.28 (m, 1H), 7.25 (t, J = 7.8 Hz, 1H), 7.16 (d, J = 3.3 Hz, 1H), 6.73 (d, J = 2.2 Hz, 2H), 6.57 (t, J = 2.3 Hz, 1H), 3.83 (s, 6H).

[0182] Example 30: Synthesis of 1-(3,5-dichlorophenyl)-1H-indole-4-carboxylic acid methyl ester (30)

[0183] The synthesis method refers to Step 1 of Example 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 1,3-dichloro-5-iodobenzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.93 (d, J = 3.4 Hz, 1H), 7.88 (d, J = 7.9 Hz, 2H), 7.77 (d, J = 1.8 Hz, 2H), 7.70 (t, J = 1.9 Hz, 1H), 7.37 (t, J = 7.9 Hz, 1H), 7.24 (d, J = 3.4 Hz, 1H), 3.94 (s, 3H).

[0184] Example 31: Synthesis of 1-(3,5-dichlorophenyl)-1H-indole-4-carboxylic acid (31)

[0185] The synthesis method refers to Example 3, replacing 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3,5-dichlorophenyl)-1H-indole-4- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.92-7.82 (m, 3H), 7.76 (d, J = 1.8 Hz, 2H), 7.70 (t, J = 1.8 Hz, 1H), 7.35 (t, J = 7.9 Hz, 1H), 7.25 (d, J = 3.5 Hz, 1H).

[0186] Example 32: Synthesis of 1-(3,5-dichlorophenyl)-1H-indole-4-carboxamide (32)

[0187] The synthesis was performed according to the procedure of Example 4, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3,5-dichlorophenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.87 (s, 1H), 7.81 (d, J = 3.4 Hz, 1H), 7.79 - 7.71 (m, 3H), 7.68 (t, J = 1.8 Hz, 1H), 7.62 (d, J = 7.3 Hz, 1H), 7.29 (t, J = 7.9 Hz, 2H), 7.20 (d, J = 3.4 Hz, 1H).

[0188] Example 33: Synthesis of 1-(2-fluoropyridin-4-yl)-1H-indole-4-carboxylic acid methyl ester (33)

[0189] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 4-bromo-2-fluoropyridine. 1 H NMR (400 MHz, DMSO-d6) δ 8.41 (d, J = 5.6 Hz, 1H), 8.14 (d, J = 8.4 Hz, 1H), 8.07 (d, J = 3.5 Hz, 1H), 7.92 (dd, J = 7.5, 0.9 Hz, 1H), 7.76 - 7.58 (m, 1H), 7.59 (d, J = 1.9 Hz, 1H), 7.43 (t, J = 7.9 Hz, 1H), 7.33 (dd, J = 3.5, 0.8 Hz, 1H), 3.94 (s, 3H).

[0190] Example 34: Synthesis of 1-(2-fluoropyridin-4-yl)-1H-indole-4-carboxylic acid (34)

[0191] The synthesis was performed according to the procedure of Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(2-fluoropyridin-4-yl)-1H-indole-4-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 8.40 (d, J = 5.6 Hz, 1H), 8.11 (d, J = 8.3 Hz, 1H), 8.03 (d, J = 3.5 Hz, 1H), 7.90 (d, J = 7.5 Hz, 1H), 7.74 (dd, J = 5.6, 1.6 Hz, 1H), 7.58 (d, J = 1.8 Hz, 1H), 7.40 (t, J = 7.9 Hz, 1H), 7.33 (d, J = 3.5 Hz, 1H).

[0192] Example 35: Synthesis of methyl l-(3-(trifluoromethyl)phenyl)-lH-indole-4- carboxylate (35)

[0193] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-lH-indole with methyl lH-indole-4-carboxylate and 1,3-difluoro-5- iodobenzene with 1-bromo-3-(trifluoromethyl)benzene. 1 H NMR (400 MHz, DMSO-d6) δ 8.05 - 7.90 (m, 3H), 7.93 - 7.73 (m, 4H), 7.35 (t, J = 7.9 Hz, 1H), 7.26 (dd, J = 3.3, 0.8 Hz, 1H), 3.94 (s, 3H).

[0194] Example 36: Synthesis of l-(3-(trifluoromethyl)phenyl)-lH-indole-4-carboxylic acid (36)

[0195] The synthesis was performed according to the procedure of Example 3, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-(trifluoromethyl)phenyl)- lH-indole-4-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 8.05 - 7.90 (m, 3H), 7.93 - 7.73 (m, 4H), 7.35 (t, J = 7.9 Hz, 1H), 7.26 (dd, J = 3.3, 0.8 Hz, 1H), 3.94 (s, 3H).

[0196] Example 37: Synthesis of l-(3-(trifluoromethyl)phenyl)-lH-indole-4-carboxamide (37)

[0197] The synthesis was performed according to the procedure of Example 4, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-(trifluoromethyl)phenyl)- lH-indole-4-carboxylate. 1H NMR (400 MHz, DMSO-d6) δ 7.99 - 7.92 (m, 2H), 7.92 - 7.76 (m, 4H), 7.70 (d, J = 8.3 Hz, 1H), 7.62 (d, J = 7.3 Hz, 1H), 7.33 (s, 1H), 7.28 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 3.3 Hz, 1H).

[0198] Example 38: Synthesis of methyl l-(3-(trifluoromethoxy)phenyl)-lH-indole-4- carboxylate (38)

[0199] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-lH-indole with methyl lH-indole-4-carboxylate and 1,3-difluoro-5- iodobenzene with l-bromo-3-(trifluoromethoxy)benzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.99 - 7.82 (m, 3H), 7.81 - 7.64 (m, 3H), 7.47 (d, J = 8.0 Hz, 1H), 7.36 (t, J = 7.8 Hz, 1H), 7.25 (d, J = 3.3 Hz, 1H), 3.94 (s, 3H).

[0200] Example 39: Synthesis of l-(3-(trifluoromethoxy)phenyl)-lH-indole-4-carboxylic acid (39)

[0201] The synthesis was performed according to the procedure of Example 3, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-(trifluoromethoxy)phenyl)- lH-indole-4-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 7.99 - 7.82 (m, 3H), 7.81 - 7.64 (m, 3H), 7.47 (d, J = 8.0 Hz, 1H), 7.36 (t, J = 7.8 Hz, 1H), 7.25 (d, J = 3.3 Hz, 1H), 3.94 (s, 3H).

[0202] Example 40: Synthesis of l-(3-(trifluoromethoxy)phenyl)-lH-indole-4-carboxamide (40)

[0203] The synthesis was performed according to the procedure of Example 4, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-(trifluoromethoxy)phenyl)- lH-indole-4-carboxylate. 1H NMR (400 MHz, DMSO-d6) δ 7.87 (s, 1H), 7.80 (d, J = 3.4 Hz, 1H), 7.78-7.66 (m, 3H), 7.64 (s, 1H), 7.61 (d, J = 7.4 Hz, 1H), 7.44 (d, J = 8.0 Hz, 1H), 7.33 (s, 1H), 7.28 (t, J = 7.8 Hz, 1H), 7.20 (d, J = 3.3 Hz, 1H).

[0204] Example 41: Synthesis of methyl l-(2,5-dimethoxyphenyl)-lH-indole-4-carboxylate (41)

[0205] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-lH-indole with methyl lH-indole-4-carboxylate and 1,3-difluoro-5-iodobenzene with 2-bromo-l,4-dimethoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.82 (dd, J = 7.5, 1.0 Hz, 1H), 7.64 (d, J = 3.2 Hz, 1H), 7.39 (d, J = 8.2 Hz, 1H), 7.31-7.20 (m, 2H), 7.15 (d, J = 3.2 Hz, 1H), 7.12-7.05 (m, 1H), 7.02 (d, J = 3.0 Hz, 1H), 3.93 (s, 3H), 3.77 (s, 3H), 3.68 (s, 3H).

[0206] Example 42: Synthesis of l-(2,5-dimethoxyphenyl)-lH-indole-4-carboxylic acid (42)

[0207] The synthesis was performed according to the procedure of Example 3, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(2,5-dimethoxyphenyl)-lH-indole-4-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 7.79 (d, J = 7.3 Hz, 1H), 7.59 (d, J = 3.2 Hz, 1H), 7.35 (d, J = 8.1 Hz, 1H), 7.28-7.19 (m, 2H), 7.15 (d, J = 3.2 Hz, 1H), 7.07 (dd, J = 9.0, 3.1 Hz, 1H), 7.01 (d, J = 3.1 Hz, 1H), 3.77 (s, 3H), 3.68 (s, 3H).

[0208] Example 43: Synthesis of l-(2,5-dimethoxyphenyl)-lH-indole-4-carboxamide (43)

[0209] The synthesis method of Reference Example 4 was used, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(2,5-dimethoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.82 (s, 1H), 7.59 - 7.48 (m, 2H), 7.29 (s, 1H), 7.24 (d, J = 2.7 Hz, 1H), 7.22 (d, J = 3.6 Hz, 1H), 7.17 (dd, J = 8.2, 7.2 Hz, 1H), 7.09 (dd, J = 3.3, 0.8 Hz, 1H), 7.06 (dd, J = 9.0, 3.1 Hz, 1H), 6.98 (d, J = 3.1 Hz, 1H), 3.77 (s, 3H), 3.68 (s, 3H).

[0210] Example 44: Synthesis of 1-(3-fluoro-2-methylphenyl)-1H-indole-4-carboxylic acid methyl ester (44)

[0211] To 1H-indole-4-carboxylic acid methyl ester (2 g), 1-bromo-3-fluoro-2-methylbenzene (2.58 g), N,N'-dimethyl-1,2-cyclohexanediamine (322 mg), cuprous iodide (216 mg) and potassium phosphate (4.8 g) were added into 100 mL of toluene under argon protection. The reaction was carried out at 110 °C for 24 h. After cooling to room temperature, toluene was removed under reduced pressure. 200 mL of water was added, and the organic layer was extracted with ethyl acetate three times, washed with saturated aqueous sodium chloride once, dried over anhydrous sodium sulfate, and the organic solution was removed by rotary evaporation. The residue was purified by silica gel column chromatography (EA:PE (v:v) = 1:5) to obtain the target compound 1-(3-fluoro-2-methylphenyl)-1H-indole-4-carboxylic acid methyl ester 767 mg. 1 H NMR (400 MHz, DMSO-d6) δ 7.85 (dd, J = 7.2, 1.3 Hz, 1H), 7.71 (d, J = 3.2 Hz, 1H), 7.47 (q, J = 7.5 Hz, 1H), 7.43 - 7.36 (m, 1H), 7.32 (d, J = 8.0 Hz, 1H), 7.30 - 7.26 (m, 2H), 7.20 (d, J = 3.2 Hz, 1H), 3.94 (s, 3H), 1.90 (d, J = 2.2 Hz, 3H).

[0212] Example 45: Synthesis of 1-(3-fluoro-2-methylphenyl)-1H-indole-4-carboxylic acid (45)

[0213] The synthesis was performed according to the procedure described in Example 3, substituting 1 -(3,5-difluorophenyl)-1 H-indole-4-carboxylic acid methyl ester with 1 -(3-fluoro-2- methoxyphenyl)-1 H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.80 (dd, J = 5.8, 2.6 Hz, 1 H), 7.62 (d, J = 3.2 Hz, 1 H), 7.44 (q, J = 7.6 Hz, 1 H), 7.36 (t, J = 8.8 Hz, 1 H), 7.28 - 7.20 (m, 3H), 7.19 (d, J = 3.2 Hz, 1 H), 1.88 (d, J = 2.2 Hz, 3H).

[0214] Example 46: Synthesis of 1 -(3-fluoro-2-methylphenyl)-1 H-indole-4-carboxamide (46)

[0215] The synthesis was performed according to the procedure described in Example 4, substituting 1 -(3,5-difluorophenyl)-1 H-indole-4-carboxylic acid methyl ester with 1 -(3-fluoro-2- methoxyphenyl)-1 H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.80 (dd, J = 5.8, 2.6 Hz, 1 H), 7.62 (d, J = 3.2 Hz, 1 H), 7.44 (q, J = 7.6 Hz, 1 H), 7.36 (t, J = 8.8 Hz, 1 H), 7.28 - 7.20 (m, 3H), 7.19 (d, J = 3.2 Hz, 1 H), 1.88 (d, J = 2.2 Hz, 3H).

[0216] Example 47: Synthesis of 1 -(3-fluoro-2-methoxyphenyl)-1 H-indole-4-carboxylic acid methyl ester (47)

[0217] The synthesis was performed according to the procedure described in Example 1, step 1, substituting 4-bromo-1 H-indole with 1 H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5- iodobenzene with 4-bromo-3-fluoro-2-methoxypyridine. 1 H NMR (400 MHz, DMSO-d6) δ 7.80 (dd, J = 5.8, 2.6 Hz, 1 H), 7.62 (d, J = 3.2 Hz, 1 H), 7.44 (q, J = 7.6 Hz, 1 H), 7.36 (t, J = 8.8 Hz, 1 H), 7.28 - 7.20 (m, 3H), 7.19 (d, J = 3.2 Hz, 1 H), 1.88 (d, J = 2.2 Hz, 3H).

[0218] Example 48: Synthesis of 1 -(3-fluoro-2-methoxyphenyl)-1 H-indole-4-carboxylic acid (48)

[0219] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3-fluoro-2- methoxypyridin-4-yl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.15 (d, J = 5.4 Hz, 1H), 7.85 (d, J = 7.4 Hz, 1H), 7.78 (dd, J = 3.4, 1.8 Hz, 1H), 7.63 (dd, J = 8.2, 2.9 Hz, 1H), 7.45 - 7.25 (m, 3H), 4.03 (s, 3H).

[0220] Example 49: Synthesis of 1-(4-fluoro-3-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (49)

[0221] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5- iodobenzene with 4-bromo-1-fluoro-2-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.92 - 7.79 (m, 3H), 7.50 - 7.37 (m, 2H), 7.33 (t, J = 7.9 Hz, 1H), 7.21 (d, J = 3.3 Hz, 1H), 7.20 - 7.14 (m, 1H), 4.06 - 3.83 (m, 6H).

[0222] Example 50: Synthesis of 1-(4-fluoro-3-methoxyphenyl)-1H-indole-4-carboxylic acid (50)

[0223] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(4-fluoro-3- methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.92 - 7.79 (m, 3H), 7.50 - 7.37 (m, 2H), 7.33 (t, J = 7.9 Hz, 1H), 7.21 (d, J = 3.3 Hz, 1H), 7.20 - 7.14 (m, 1H), 4.06 - 3.83 (m, 6H).

[0224] Example 51: Synthesis of 1-(4-fluoro-3-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (51)

[0225] The synthesis was performed according to the procedure described in Example 4, substituting 1 -(3,5-difluorophenyl)-1 H-indole-4-carboxylic acid methyl ester with 1 -(4- chlorophenyl)-1 H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.84 (s, 1 H), 7.73 (d, J = 3.3 Hz, 1 H), 7.69 (d, J = 8.2 Hz, 1 H), 7.64 - 7.57 (m, 1 H), 7.42 (dd, J = 11.3, 8.6 Hz, 1 H), 7.36 (dd, J = 7.7, 2.5 Hz, 1 H), 7.30 (s, 1 H), 7.25 (t, J = 7.8 Hz, 1 H), 7.20 - 7.08 (m, 2 H), 3.94 (s, 3 H).

[0226] Example 52: Synthesis of 1 -(2-cyano-3-methoxyphenyl)-1 H-indole-4-carboxylic acid methyl ester (52)

[0227] The synthesis was performed according to the procedure described in Example 44, substituting 1 -bromo-3-fluoro-2-methylbenzene with 2-bromo-6-methoxybenzonitrile. 1 H NMR (400 MHz, DMSO-d6) δ 7.84 (s, 1 H), 7.73 (d, J = 3.3 Hz, 1 H), 7.69 (d, J = 8.2 Hz, 1 H), 7.64 - 7.57 (m, 1 H), 7.42 (dd, J = 11.3, 8.6 Hz, 1 H), 7.36 (dd, J = 7.7, 2.5 Hz, 1 H), 7.30 (s, 1 H), 7.25 (t, J = 7.8 Hz, 1 H), 7.20 - 7.08 (m, 2 H), 3.94 (s, 3 H).

[0228] Example 53: Synthesis of 1 -(3-methoxy-4-nitrophenyl)-1 H-indole-4-carboxylic acid methyl ester (53)

[0229] The synthesis was performed according to the procedure described in Example 1, Step 1, substituting 4-bromo-1 H-indole with 1 H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5- iodobenzene with 4-bromo-2-methoxy-1 -nitrobenzene. 1 H NMR (400 MHz, DMSO-d6) δ 7.84 (s, 1 H), 7.73 (d, J = 3.3 Hz, 1 H), 7.69 (d, J = 8.2 Hz, 1 H), 7.64 - 7.57 (m, 1 H), 7.42 (dd, J = 11.3, 8.6 Hz, 1 H), 7.36 (dd, J = 7.7, 2.5 Hz, 1 H), 7.30 (s, 1 H), 7.25 (t, J = 7.8 Hz, 1 H), 7.20 - 7.08 (m, 2 H), 3.94 (s, 3 H).

[0230] Example 54: Synthesis of 1-(3-methoxy-4-nitrophenyl)-1H-indole-4-carboxylic acid (54)

[0231] The synthesis method refers to Example 3, and 1-(3,5-difluorophenyl)-1H-indole-4- carboxylic acid methyl ester is replaced by 1-(3-methoxy-4-nitrophenyl)-1H-indole-4- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.93 (s, 1H), 8.14 (d, J = 8.7 Hz, 1H), 8.02 (d, J = 8.3 Hz, 1H), 7.98 (d, J = 3.4 Hz, 1H), 7.88 (d, J = 7.4 Hz, 1H), 7.56 (d, J = 2.1 Hz, 1H), 7.44 - 7.34 (m, 2H), 7.31 (d, J = 3.4 Hz, 1H), 4.06 (s, 3H).

[0232] Example 55: Synthesis of 1-(4-amino-3-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (55)

[0233] Methyl 1-(3-methoxy-4-nitrophenyl)-1H-indole-4-carboxylate (400 mg), Pd / C (80 mg) were added into 20 mL of methanol, and the reaction was carried out under hydrogen atmosphere at room temperature for 3 h. Filtration was performed, and the filtrate was evaporated to obtain 335 mg of methyl 1-(4-amino-3-methoxyphenyl)-1H-indole-4-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 7.82 (dd, J = 7.5, 1.0 Hz, 1H), 7.75 - 7.60 (m, 2H), 7.35 - 7.19 (m, 1H), 7.13 (dd, J = 3.1, 0.8 Hz, 1H), 6.97 (d, J = 2.3 Hz, 1H), 6.87 (dd, J = 8.2, 2.2 Hz, 1H), 6.79 (d, J = 8.2 Hz, 1H), 4.99 (s, 2H), 3.93 (s, 3H), 3.83 (s, 3H).

[0234] Example 56: Synthesis of 1-(2-fluoro-3-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (56)

[0235] The synthesis method refers to step 1 of Example 1, 4-bromo-1H-indole is replaced by 1H- indole-4-carboxylic acid methyl ester, and 1,3-difluoro-5-iodobenzene is replaced by 1- bromo-2-fluoro-3-methoxybenzene. 1H NMR (400 MHz, DMSO-d6) δ 7.97 - 7.81 (m, 1H), 7.75 (dd, J = 3.3, 1.3 Hz, 1H), 7.59 - 7.44 (m, 1H), 7.42 - 7.26 (m, 3H), 7.22 (d, J = 3.3 Hz, 1H), 7.21 - 7.15 (m, 1H), 3.95 (s, 3H), 3.94 (s, 3H).

[0236] Example 57: Synthesis of l-(2-fluoro-3-methoxyphenyl)-lH-indole-4-carboxylic acid (57)

[0237] The synthesis method refers to Example 3, replacing 1-(3,5-difluorophenyl)-lH- indole-4-carboxylic acid methyl ester with 1-(2-fluoro-3-methoxyphenyl)-lH-indole-4- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.97 - 7.81 (m, 1H), 7.75 (dd, J = 3.3, 1.3 Hz, 1H), 7.59 - 7.44 (m, 1H), 7.42 - 7.26 (m, 3H), 7.22 (d, J = 3.3 Hz, 1H), 7.21 - 7.15 (m, 1H), 3.95 (s, 3H), 3.94 (s, 3H).

[0238] Example 58: Synthesis of l-(2-fluoro-3-methoxyphenyl)-lH-indole-4-carboxamide (58)

[0239] The synthesis method refers to Example 4, replacing 1-(3,5-difluorophenyl)-lH- indole-4-carboxylic acid methyl ester with 1-(2-fluoro-3-methoxyphenyl)-lH-indole-4- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 7.97 - 7.81 (m, 1H), 7.75 (dd, J = 3.3, 1.3 Hz, 1H), 7.59 - 7.44 (m, 1H), 7.42 - 7.26 (m, 3H), 7.22 (d, J = 3.3 Hz, 1H), 7.21 - 7.15 (m, 1H), 3.95 (s, 3H), 3.94 (s, 3H).

[0240] Example 59: Synthesis of l-(2-hydroxy-3-methoxyphenyl)-lH-indole-4-carboxylic acid methyl ester (59)

[0241] The synthesis was performed according to the procedure described in Reference Example 44, replacing 1-bromo-3-fluoro-2-methylbenzene with 2-bromo-6-methoxyphenol. 1 H NMR (400 MHz, DMSO-d6) δ 9.23 (s, 1H), 7.93 - 7.70 (m, 1H), 7.61 (d, J = 3.2 Hz, 1H), 7.38 (d, J = 8.1 Hz, 1H), 7.24 (t, J = 7.8 Hz, 1H), 7.15 (d, J = 3.2 Hz, 1H), 7.13 - 7.08 (m, 1H), 6.96 (d, J = 1.3 Hz, 1H), 6.94 (s, 1H), 3.93 (s, 3H), 3.90 (s, 3H).

[0242] Example 60: Synthesis of 1-(2-hydroxy-3-methoxyphenyl)-1H-indole-4-carboxylic acid (60)

[0243] The synthesis was performed according to the procedure described in Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(2-hydroxy-3-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 9.23 (s, 1H), 7.93 - 7.70 (m, 1H), 7.61 (d, J = 3.2 Hz, 1H), 7.38 (d, J = 8.1 Hz, 1H), 7.24 (t, J = 7.8 Hz, 1H), 7.15 (d, J = 3.2 Hz, 1H), 7.13 - 7.08 (m, 1H), 6.96 (d, J = 1.3 Hz, 1H), 6.94 (s, 1H), 3.93 (s, 3H), 3.90 (s, 3H).

[0244] Example 61: Synthesis of 1-(4-fluoro-3-methoxyphenyl)-1H-indole-3-carboxylic acid methyl ester (61)

[0245] The synthesis was performed according to the procedure described in Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-3-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 4-bromo-1-fluoro-2-methoxybenzene. 1 H NMR (400 MHz, Chloroform-d) δ 8.32 - 8.22 (m, 1H), 8.01 (s, 1H), 7.48 - 7.46 (m, 1H), 7.40 - 7.31 (m, 2H), 7.28 - 7.22 (m, 1H), 7.10 (dd, J = 7.4, 2.5 Hz, 1H), 7.09 - 7.04 (m, 1H), 3.98 (s, 3H), 3.96 (s, 3H).

[0246] Example 62: Synthesis of l-(4-fluoro-3-methoxyphenyl)-lH-indole-3-carboxylic acid (62)

[0247] The synthesis method refers to Example 3, replacing 1-(3,5-difluorophenyl)-lH- indole-4-carboxylic acid methyl ester with 1-(4-fluoro-3-methoxyphenyl)-lH-indole-3- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.32 (s, 1H), 8.28 (s, 1H), 8.22-8.00 (m, 1H), 7.61-7.53 (m, 1H), 7.50-7.39 (m, 2H), 7.32-7.27 (m, 2H), 7.25-7.16 (m, 1H), 3.94 (s, 3H).

[0248] Example 63: Synthesis of l-(4-fluoro-3-methoxyphenyl)-lH-indole-3-carboxylic acid amide (63)

[0249] The synthesis method refers to Example 4, replacing 1-(3,5-difluorophenyl)-lH- indole-4-carboxylic acid methyl ester with 1-(4-fluoro-3-methoxyphenyl)-lH-indole-3- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.31 (s, 1H), 8.29-8.23 (m, 1H), 7.61-7.38 (m, 4H), 7.31-7.21 (m, 2H), 7.20-7.16 (m, 1H), 7.00 (s, 1H), 3.94 (s, 3H).

[0250] Example 64: Synthesis of l-(2-fluoro-3-methoxyphenyl)-lH-indole-3-carboxylic acid methyl ester (64)

[0251] The synthesis method refers to Example 1, Step 1, replacing 4-bromo-lH-indole with lH-indole-3-carboxylic acid methyl ester, and replacing 1,3-difluoro-5-iodobenzene with 1- bromo-2-fluoro-3-methoxybenzene. 1 H NMR (400 MHz, CDCl3) δ 8.27 (dd, J = 7.6, 1.2 Hz, 1H), 8.00 (d, J = 1.4 Hz, 1H), 7.40-7.33 (m, 1H), 7.31-7.20 (m, 3H), 7.15-7.03 (m, 2H), 4.00 (s, 3H), 3.97 (d, J = 0.9 Hz, 3H).

[0252] Example 65: Synthesis of l-(2-fluoro-3-methoxyphenyl)-lH-indole-3-carboxylic acid (65)

[0253] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(2-fluoro-3- methoxyphenyl)-1H-indole-3-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.34 (s, 1H), 8.19 (d, J = 1.2 Hz, 1H), 8.16 - 8.07 (m, 1H), 7.45 - 7.33 (m, 2H), 7.33 - 7.27 (m, 2H), 7.26 - 7.22 (m, 2H), 3.95 (s, 3H).

[0254] Example 66: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-indole-3-carboxylic acid methyl ester (66)

[0255] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-3-carboxylic acid methyl ester and 1,3-difluoro-5- iodobenzene with 1-bromo-3-fluoro-5-methoxybenzene. 1 H NMR (400 MHz, CDCl3) δ 8.39 - 8.17 (m, 1H), 8.03 (s, 1H), 7.69 - 7.54 (m, 1H), 7.42 - 7.31 (m, 2H), 6.89 - 6.87 (m, 2H), 6.74 - 6.70 (m, 1H), 3.97 (s, 3H), 3.89 (s, 3H).

[0256] Example 67: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-indole-3-carboxylic acid (67)

[0257] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3-fluoro-5- methoxyphenyl)-1H-indole-3-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.42 - 8.04 (m, 2H), 7.74 - 7.56 (m, 1H), 7.30 (d, J = 5.6 Hz, 2H), 7.18 (d, J = 9.5 Hz, 1H), 7.09 (s, 1H), 6.98 - 6.94 (m, 1H), 3.88 (s, 3H).

[0258] Example 68: Synthesis of 1-(2-methoxypyridin-4-yl)-1H-indole-3-carboxylic acid methyl ester (68)

[0259] The synthetic method was referred to the step 1 of the example 1, 4-bromo-1H-indole-3- carboxylic acid methyl ester was replaced with 1H-indole-3-carboxylic acid methyl ester, 1,3- difluoro-5-iodobenzene was replaced with 4-bromo-2-methoxypyridine. 1 H NMR (400 MHz, CDC13) δ 8.35 (d, J = 5.6 Hz, 1H), 8.30 - 8.20 (m, 1H), 8.08 (s, 1H), 7.83 - 7.60 (m, 1H), 7.46 - 7.32 (m, 2H), 7.12 (dd, J = 5.6, 1.9 Hz, 1H), 6.96 (d, J = 1.9 Hz, 1H), 4.06 (s, 3H), 3.98 (s, 3H).

[0260] Example 69: Synthesis of 1-(2-methoxypyridin-4-yl)-1H-indole-3-carboxylic acid (69)

[0261] The synthetic method was referred to the example 3, 1-(3,5-difluorophenyl)-1H-indole-4- carboxylic acid methyl ester was replaced with 1-(2-fluoro-3-methoxyphenyl)-1H-indole-3- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.49 (s, 1H), 8.39 (s, 1H), 8.36 (d, J = 5.6 Hz, 1H), 8.21 - 8.09 (m, 1H), 7.80 - 7.70 (m, 1H), 7.40 (dd, J = 5.7, 1.9 Hz, 1H), 7.39 - 7.28 (m, 2H), 7.18 (d, J = 2.0 Hz, 1H), 3.95 (s, 3H).

[0262] Example 70: Synthesis of 1-(3-cyano-5-fluorophenyl)-1H-indole-4-carboxylic acid methyl ester (70)

[0263] The synthetic method was referred to the example 44, 1-bromo-3-fluoro-2-methylbenzene was replaced with 3-bromo-5-fluorobenzonitrile. 1 H NMR (400 MHz, DMSO-d6) δ 8.08 (t, J = 1.7 Hz, 1H), 8.04 - 7.97 (m, 2H), 7.97 - 7.91 (m, 2H), 7.90 (dd, J = 7.6, 0.9 Hz, 1H), 7.38 (t, J = 7.9 Hz, 1H), 7.27 (dd, J = 3.4, 0.8 Hz, 1H), 3.94 (s, 3H).

[0264] Example 71: Synthesis of 1-(3-(methylsulfonyl)phenyl)-1H-indole-4-carboxylic acid methyl ester (71)

[0265] The synthesis was performed according to reference example 44, replacing 1-bromo-3-fluoro-2-methylbenzene with 1-bromo-2-chloro-3-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 8.11 (t, J = 1.9 Hz, 1H), 8.04-8.01 (m, 1H), 8.00 (d, J = 1.3 Hz, 1H), 7.99-7.97 (m, 1H), 7.91-7.87 (m, 3H), 7.38 (dd, J = 8.3, 7.5 Hz, 1H), 7.28 (dd, J = 3.3, 0.8 Hz, 1H), 3.95 (s, 3H), 3.36 (s, 3H).

[0266] Example 72: Synthesis of 1-(3-(methylsulfonyl)phenyl)-1H-indole-4-carboxylic acid (72)

[0267] The synthesis was performed according to reference example 3, replacing 1-(3,5- difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3-(methylsulfonyl)phenyl)- 1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.11 (t, J = 1.9 Hz, 1H), 8.04-8.01 (m, 1H), 8.00 (d, J = 1.3 Hz, 1H), 7.99-7.97 (m, 1H), 7.91-7.87 (m, 3H), 7.38 (dd, J = 8.3, 7.5 Hz, 1H), 7.28 (dd, J = 3.3, 0.8 Hz, 1H), 3.95 (s, 3H), 3.36 (s, 3H).

[0268] Example 73: Synthesis of 1-(2-chloro-3-methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (73)

[0269] The synthesis was performed according to reference example 44, replacing 1-bromo-3-fluoro-2-methylbenzene with 1-bromo-2-chloro-3-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 8.11 (t, J = 1.9 Hz, 1H), 8.04-8.01 (m, 1H), 8.00 (d, J = 1.3 Hz, 1H), 7.99-7.97 (m, 1H), 7.91-7.87 (m, 3H), 7.38 (dd, J = 8.3, 7.5 Hz, 1H), 7.28 (dd, J = 3.3, 0.8 Hz, 1H), 3.95 (s, 3H), 3.36 (s, 3H).

[0270] Example 74: Synthesis of 1-(2-chloro-3-methoxyphenyl)-1H-indole-4-carboxylic acid (74)

[0271] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(2-chloro-3- methoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.81 (s, 1H), 7.81 (dd, J = 6.0, 2.4 Hz, 1H), 7.63 (d, J = 3.2 Hz, 1H), 7.53 (t, J = 8.2 Hz, 1H), 7.36 (dd, J = 8.5, 1.3 Hz, 1H), 7.29 - 7.23 (m, 2H), 7.23 - 7.15 (m, 2H), 3.97 (s, 3H).

[0272] Example 75: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4- carboxylic acid methyl ester (75)

[0273] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-pyrrolo[2,3-b]pyridine-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 1-bromo-3-fluoro-5-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 8.51 (d, J = 4.9 Hz, 1H), 8.25 (d, J = 3.7 Hz, 1H), 7.73 (d, J = 5.0 Hz, 1H), 7.50 (dt, J = 10.4, 2.1 Hz, 1H), 7.46 - 7.37 (m, 1H), 7.12 (d, J = 3.7 Hz, 1H), 6.87 (dt, J = 10.9, 2.3 Hz, 1H), 3.98 (s, 3H), 3.86 (s, 3H).

[0274] Example 76: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4- carboxylic acid (76)

[0275] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3-fluoro-5- methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 8.50 (d, J = 4.9 Hz, 1H), 8.22 (d, J = 3.8 Hz, 1H), 7.72 (d, J = 4.9 Hz, 1H), 7.51 (dt, J = 10.4, 2.1 Hz, 1H), 7.44 (d, J = 2.3 Hz, 1H), 7.13 (d, J = 3.7 Hz, 1H), 6.87 (dd, J = 10.9, 2.3 Hz, 1H), 3.86 (s, 3H).

[0276] Example 77: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4- carboxamide (77)

[0277] The synthesis method refers to Example 4, replacing 1-(3,5-difluorophenyl)-1H-indole-4- carboxylic acid methyl ester with 1-(3-fluoro-5-methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4- carboxylic acid methyl ester. 1 H NMR (400 MHz, CDCl 3) δ 8.49 (dd, J = 4.9, 3.7 Hz, 1H), 7.69 - 7.58 (m, 1H), 7.43 (dd, J = 31.1, 4.8 Hz, 1H), 7.23 - 7.09 (m, 2H), 7.08 (d, J = 3.7 Hz, 1H), 6.68 - 6.63 (m, 1H), 6.29 - 6.06 (m, 2H), 3.89 (s, 3H).

[0278] Example 78: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-indole-5-carboxylic acid methyl ester (78)

[0279] The synthesis method refers to step 1 of Example 1, replacing 4-bromo-1H-indole with 1H- indole-5-carboxylic acid methyl ester and replacing 1,3-difluoro-5-iodobenzene with 1-bromo-3- fluoro-5-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 8.36 (d, J = 1.6 Hz, 1H), 7.93 - 7.79 (m, 2H), 7.72 (d, J = 8.7 Hz, 1H), 7.12 (dt, J = 9.6, 2.1 Hz, 1H), 7.04 (t, J = 2.2 Hz, 1H), 6.94 (dt, J = 10.9, 2.3 Hz, 1H), 6.89 (dd, J = 3.4, 0.8 Hz, 1H), 3.87 (s, 6H).

[0280] Example 79: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-indole-5-carboxylic acid (79)

[0281] Synthetic method according to reference example 3, replace 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3-fluoro-5-methoxyphenyl)-1H-indole-5- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.64 (s, 1H), 8.32 (d, J = 1.6 Hz, 1H), 7.91 - 7.78 (m, 2H), 7.70 (d, J = 8.7 Hz, 1H), 7.12 (dt, J = 9.7, 2.1 Hz, 1H), 7.05 (d, J = 2.2 Hz, 1H), 6.93 (dt, J = 10.9, 2.3 Hz, 1H), 6.87 (d, J = 3.3 Hz, 1H), 3.87 (s, 3H).

[0282] Example 80: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-indole-5-carboxamide (80)

[0283] Synthetic method according to reference example 4, replace 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3-fluoro-5-methoxyphenyl)-1H-indole-5- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.26 (d, J = 1.7 Hz, 1H), 7.96 (s, 1H), 7.80 (dd, J = 8.2, 2.4 Hz, 2H), 7.67 (d, J = 8.7 Hz, 1H), 7.23 (s, 1H), 7.11 (dt, J = 9.8, 2.1 Hz, 1H), 7.04 (d, J = 2.2 Hz, 1H), 6.91 (dt, J = 10.9, 2.3 Hz, 1H), 6.81 (d, J = 3.3 Hz, 1H), 3.87 (s, 3H).

[0284] Example 81: Synthesis of 1-(3-fluoro-5-methoxyphenyl)-1H-indole-4-carboxylic acid (81)

[0285] To 1-(3-fluoro-5-methoxyphenyl)-1H-indole-4-carboxylic acid (120 mg) was added to 6 mL acetonitrile / pyridine (5 mL / 1 mL) mixed solvent, and fluorinating agent Selectfluor (106 mg) was added. The reaction was carried out at room temperature for 16 hours. After the reaction was completed, ethyl acetate was added, washed with saturated sodium chloride aqueous solution once, dried with anhydrous sodium sulfate, and the organic solution was removed. The residue was purified by silica gel column chromatography (EA: PE (v / v) = 1:10) to obtain 3-fluoro-1H-indole-4-carboxylic acid methyl ester 18 mg. 1H NMR (400 MHz, DMSO-d6) δ 12.92 (s, 1H), 7.94 (d, J = 2.4 Hz, 1H), 7.87 - 7.82 (m, 1H), 7.78 - 7.68 (m, 1H), 7.34 (dd, J = 8.5, 7.4 Hz, 1H), 7.10 (dt, J = 9.7, 2.1 Hz, 1H), 7.03 (d, J = 2.4 Hz, 1H), 6.93 (dt, J = 10.9, 2.3 Hz, 1H), 3.87 (d, J = 2.8 Hz, 3H).

[0286] Example 82: Synthesis of methyl l-(3-(difluoromethoxy)phenyl)-lH-indole-4-carboxylate (82)

[0287] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-lH-indole with methyl lH-indole-4-carboxylate and 1,3-difluoro-5-iodobenzene with 1-bromo-3-(difluoromethoxy)benzene. 1 H NMR (400 MHz, CDC13) δ 8.00 (d, J = 7.4 Hz, 1H), 7.77 (d, J = 8.0 Hz, 1H), 7.60 - 7.52 (m, 1H), 7.48 (d, J = 3.3 Hz, 1H), 7.39 (dd, J = 6.6, 2.7 Hz, 2H), 7.34 - 7.29 (m, 2H), 7.19 (dd, J = 8.1, 2.4 Hz, 1H), 6.62 (t, J = 73.2 Hz, 1H), 4.04 (s, 3H).

[0288] Example 83: Synthesis of l-(3-(difluoromethoxy)phenyl)-lH-indole-4-carboxylic acid (83)

[0289] The synthesis was performed according to the procedure of Example 3, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-(difluoromethoxy)phenyl)-lH-indole-4-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 12.89 (s, 1H), 7.84 (dd, J = 7.4, 2.1 Hz, 3H), 7.65 (t, J = 8.1 Hz, 1H), 7.61 - 7.22 (m, 6H).

[0290] Example 84: Synthesis of methyl l-(3-ethoxyphenyl)-lH-indole-4-carboxylate (84)

[0291] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 1-bromo-3-ethoxybenzene. 1 H NMR (400 MHz, CDC13) δ 7.98 (dd, J = 7.5, 0.9 Hz, 1H), 7.79 (dt, J = 8.3, 0.9 Hz, 1H), 7.49 (d, J = 3.3 Hz, 1H), 7.44 (t, J = 8.1 Hz, 1H), 7.34 (dd, J = 3.2, 0.8 Hz, 1H), 7.28 (s, 1H), 7.10-7.08 (m, 1H), 7.04 (t, J = 2.2 Hz, 1H), 6.93-6.92 (m, 1H), 4.11 (q, J = 7.0 Hz, 2H), 4.03 (s, 3H), 1.48 (t, J = 7.0 Hz, 3H).

[0292] Example 85: Synthesis of 1-(3-ethoxyphenyl)-1H-indole-4-carboxylic acid (85)

[0293] The synthesis was performed according to the procedure of Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(3-ethoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.84 (s, 1H), 7.82 (dd, J = 7.5, 2.7 Hz, 3H), 7.49 (t, J = 8.1 Hz, 1H), 7.30 (t, J = 7.9 Hz, 1H), 7.21 (d, J = 3.3 Hz, 1H), 7.16 (dd, J = 7.7, 2.0 Hz, 1H), 7.12 (t, J = 2.2 Hz, 1H), 7.00 (dd, J = 8.3, 2.5 Hz, 1H), 4.13 (q, J = 7.0 Hz, 2H), 1.36 (t, J = 7.0 Hz, 3H).

[0294] Example 86: Synthesis of 1-(3-ethoxy-5-fluorophenyl)-1H-indole-4-carboxylic acid methyl ester (86)

[0295] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 1-bromo-3-ethoxy-5-fluorobenzene. 1H NMR (400 MHz, CDC13) δ 7.99 (dd, J = 7.5, 0.9 Hz, 1H), 7.81 (dt, J = 8.3, 0.9 Hz, 1H), 7.46 (d, J = 3.3 Hz, 1H), 7.36 (dd, J = 3.3, 0.8 Hz, 1H), 7.32 (d, J = 7.9 Hz, 1H), 6.83 (dd, J = 8.4, 2.2 Hz, 2H), 6.68 - 6.64 (m, 1H), 4.10 (q, J = 7.0 Hz, 2H), 4.03 (s, 3H), 1.48 (t, J = 7.0 Hz, 3H).

[0296] Example 87: Synthesis of 1-(3-ethoxy-5-fluorophenyl)-1H-indole-4-carboxylic acid (87)

[0297] The synthesis method refers to Example 3, replacing 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3-ethoxy-5-fluorophenyl)-1H-indole-4- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.86 (s, 1H), 7.92 - 7.80 (m, 3H), 7.32 (t, J = 7.9 Hz, 1H), 7.22 (d, J = 3.3 Hz, 1H), 7.09 (dt, J = 9.6, 2.1 Hz, 1H), 7.01 (d, J = 2.1 Hz, 1H), 6.91 (dt, J = 10.9, 2.3 Hz, 1H), 4.15 (q, J = 7.0 Hz, 2H), 1.36 (t, J = 7.0 Hz, 3H).

[0298] Example 88: Synthesis of 1-(2-ethoxypyridin-4-yl)-1H-indole-4-carboxylic acid methyl ester (88)

[0299] The synthesis method refers to Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 4-bromo-2-ethoxypyridine. 1H NMR (400 MHz, CDC13) δ 8.29 (d, J = 5.6 Hz, 1H), 8.01 (dd, J = 7.5, 0.9 Hz, 1H), 7.93 (d, J = 8.4 Hz, 1H), 7.52 (d, J = 3.4 Hz, 1H), 7.42 (dd, J = 3.5, 0.8 Hz, 1H), 7.34 (t, J = 7.9 Hz, 1H), 7.08 (dd, J = 5.6, 1.9 Hz, 1H), 6.90 (d, J = 1.9 Hz, 1H), 4.03 (s, 3H), 4.47 (q, J = 7.1 Hz, 2H), 1.46 (t, J = 7.1 Hz, 3H).

[0300] Example 89: Synthesis of 1-(2-ethoxypyridin-4-yl)-1H-indole-4-carboxylic acid (89)

[0301] The synthesis method refers to Example 3, replacing 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(2-ethoxypyridin-4-yl)-1H-indole-4- carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.92 (s, 1H), 8.31 (d, J = 5.6 Hz, 1H), 8.01 (d, J = 8.3 Hz, 1H), 7.95 (d, J = 3.4 Hz, 1H), 7.87 (d, J = 7.4 Hz, 1H), 7.41 - 7.25 (m, 3H), 7.05 (d, J = 1.9 Hz, 1H), 4.39 (q, J = 7.0 Hz, 2H), 1.37 (t, J = 7.1 Hz, 3H).

[0302] Example 90: Synthesis of 1-(3-propoxyphenyl)-1H-indole-4-carboxylic acid methyl ester (90)

[0303] The synthesis method refers to step 1 of Example 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 1-bromo-3-propoxybenzene. 1H NMR (400 MHz, CDC13) δ 7.98 (d, J = 7.5 Hz, 1H), 7.79 (d, J = 8.2 Hz, 1H), 7.49 (d, J = 3.3 Hz, 1H), 7.44 (t, J = 8.1 Hz, 1H), 7.35 (d, J = 3.3 Hz, 1H), 7.29 - 7.25 (m, 1H), 7.10 - 7.07 (m, 1H), 7.04 (t, J = 2.2 Hz, 1H), 6.97 - 6.94 (m, 1H), 4.04 (s, 3H), 4.00 (t, J = 6.5 Hz, 2H), 1.91 - 1.86 (m, 2H), 1.09 (t, J = 7.4 Hz, 3H).

[0304] Example 91: Synthesis of 1-(3-propoxyphenyl)-1H-indole-4-carboxylic acid (91)

[0305] The synthesis method refers to Example 3, replacing 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3-propoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.86 - 7.78 (m, 3H), 7.48 (t, J = 8.1 Hz, 1H), 7.30 (t, J = 7.8 Hz, 1H), 7.21 (d, J = 3.2 Hz, 1H), 7.19 - 7.09 (m, 2H), 7.00 (dd, J = 8.3, 2.4 Hz, 1H), 4.03 (t, J = 6.5 Hz, 2H), 1.78 - 1.74 (m, 2H), 1.00 (t, J = 7.4 Hz, 3H).

[0306] Example 92: Synthesis of 1-(3-(2,2,2-trifluoroethoxy)phenyl)-1H-indole-4-carboxylic acid methyl ester (92)

[0307] The synthesis method refers to step 1 of Example 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 1-bromo-3-(2,2,2-trifluoroethoxy)benzene. 1H NMR (400 MHz, CDC13) δ 7.99 (dd, J = 7.5, 0.9 Hz, 1H), 7.77 (dd, J = 8.3, 1.0 Hz, 1H), 7.55 - 7.45 (m, 2H), 7.37 (dd, J = 3.3, 0.9 Hz, 1H), 7.31 (d, J = 7.9 Hz, 1H), 7.23 - 7.20 (m, 1H), 7.12 (t, J = 2.2 Hz, 1H), 7.10 - 7.08 (m, 1H), 4.45 (q, J = 8.0 Hz, 2H), 4.04 (s, 3H).

[0308] Example 93: Synthesis of 1-(3-(2,2,2-trifluoroethoxy)phenyl)-1H-indole-4- carboxylic acid (93)

[0309] The synthesis method refers to Example 3, replacing 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester with 1-(3-(2,2,2-trifluoroethoxy)phenyl)-1H- indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.83 (s, 1H), 7.88 - 7.82 (m, 3H), 7.55 (t, J = 8.1 Hz, 1H), 7.34 - 7.30 (m, 3H), 7.23 (d, J = 3.3 Hz, 1H), 7.13 (dd, J = 8.3, 2.5 Hz, 1H), 4.90 (q, J = 8.9 Hz, 2H).

[0310] Example 94: Synthesis of 1-(3-ethylphenyl)-1H-indole-4-carboxylic acid methyl ester (94)

[0311] The synthesis method refers to step 1 of Example 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and replacing 1,3-difluoro-5-iodobenzene with 1-bromo-3-ethylbenzene. 1 H NMR (400 MHz, CDC13) δ 7.98 (dd, J = 7.5, 1.0 Hz, 1H), 7.75 (dt, J = 8.2, 0.9 Hz, 1H), 7.53 - 7.43 (m, 2H), 7.36 - 7.28 (m, 4H), 7.27 - 7.25 (m, 1H), 4.04 (s, 3H), 2.78 (q, J = 7.6 Hz, 2H), 1.33 (t, J = 7.6 Hz, 3H).

[0312] Example 95: Synthesis of 1-(3-ethylphenyl)-1H-indole-4-carboxylic acid (95)

[0313] The synthetic method was referred to that of Example 3, with 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester replaced by 1-(3-ethoxyphenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.83 (s, 1H), 7.87 - 7.76 (m, 3H), 7.50 (t, J = 7.7 Hz, 1H), 7.45 - 7.39 (m, 2H), 7.29 (dt, J = 7.9, 4.0 Hz, 2H), 7.21 (d, J = 3.3 Hz, 1H), 2.72 (q, J = 7.6 Hz, 2H), 1.25 (t, J = 7.6 Hz, 3H).

[0314] Example 96: Synthesis of methyl 1-(2-fluoro-3-(trifluoromethyl)phenyl)-1H-indole-4- carboxylate (96)

[0315] The synthetic method was referred to that of Example 1, Step 1, with 4-bromo-1H-indole replaced by 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene replaced by 1-bromo-2-fluoro-3-(trifluoromethyl)benzene. 1 H NMR (400 MHz, CDCl3) δ 8.01 (dd, J = 7.5, 0.9 Hz, 1H), 7.75 - 7.71 (m, 2H), 7.51 - 7.42 (m, 4H), 7.32 (t, J = 7.9 Hz, 1H), 4.04 (s, 3H).

[0316] Example 97: Synthesis of 1-(2-fluoro-3-(trifluoromethyl)phenyl)-1H-indole-4-carboxylic acid (97)

[0317] The synthetic method was referred to that of Example 3, with 1-(3,5-difluorophenyl)-1H- indole-4-carboxylic acid methyl ester replaced by 1-(2-fluoro-3-(trifluoromethyl)phenyl)-1H- indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.92 (s, 1H), 8.08 - 8.00 (m, 1H), 7.98 - 7.90 (m, 1H), 7.86 (d, J = 7.4 Hz, 1H), 7.80 (dd, J = 3.4, 1.4 Hz, 1H), 7.64 (t, J = 8.0 Hz, 1H), 7.50 (dd, J = 8.2, 2.2 Hz, 1H), 7.38 - 7.27 (m, 2H).

[0318] Example 98: Synthesis of 1-(2-chloro-3-(trifluoromethyl)phenyl)-1H-indole-4-carboxylic acid (98)

[0319] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(2-chloro-3-(trifluoromethyl)phenyl)-1H-indole-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 12.87 (s, 1H), 8.09 (dd, J = 8.0, 1.6 Hz, 1H), 7.96 (dd, J = 8.0, 1.6 Hz, 1H), 7.88 - 7.77 (m, 2H), 7.73 (d, J = 2.9 Hz, 1H), 7.26 (dd, J = 11.4, 3.5 Hz, 3H).

[0320] Example 99: Synthesis of 1-(2-hydroxy-3-(trifluoromethyl)phenyl)-1H-indole-4- carboxylic acid methyl ester (99)

[0321] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-indole-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 2-bromo-6-(trifluoromethyl)phenol. 1 H NMR (400 MHz, CDCl3) δ 8.00 (dd, J = 6.9, 1.6 Hz, 1H), 7.72 (d, J = 7.9 Hz, 1H), 7.50 (dd, J = 7.9, 1.6 Hz, 1H), 7.45 (d, J = 3.2 Hz, 1H), 7.38 - 7.30 (m, 3H), 7.17 (t, J = 7.9 Hz, 1H), 4.04 (s, 3H)

[0322] Example 100: Synthesis of 1-(3-(trifluoromethyl)phenyl)-1H-pyrrolo[2,3-b]pyridine-4- carboxylic acid methyl ester (100)

[0323] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-pyrrolo[2,3-b]pyridine-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 1-bromo-3-trifluoromethylbenzene. 1 H NMR (400 MHz, CDCl3) δ 8.51 (d, J = 4.9 Hz, 1H), 8.06 (d, J = 7.9 Hz, 2H), 7.81 (d, J = 4.9 Hz, 1H), 7.74 - 7.62 (m, 3H), 7.28 (d, J = 2.4 Hz, 1H), 4.07 (s, 3H).

[0324] Example 101: Synthesis of 1-(3-(trifluoromethyl)phenyl)-1H-pyrrolo[2,3-b]pyridine-4- carboxylic acid (101)

[0325] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(4-fluoro-3- methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) d 13.63 (s, 1H), 8.50 (d, J = 4.9 Hz, 1H), 8.36 (t, J = 2.1 Hz, 1H), 8.30 - 8.21 (m, 2H), 7.81 (t, J = 8.0 Hz, 1H), 7.77 - 7.71 (m, 2H), 7.17 (d, J = 3.7 Hz, 1H).

[0326] Example 102: Synthesis of 1-(4-fluoro-3-methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4- carboxylic acid methyl ester (102)

[0327] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-1H-indole with 1H-pyrrolo[2,3-b]pyridine-4-carboxylic acid methyl ester and 1,3-difluoro-5-iodobenzene with 4-bromo-1-fluoro-2-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) d 8.47 (d, J = 4.9 Hz, 1H), 8.17 (d, J = 3.7 Hz, 1H), 7.71 (d, J = 4.9 Hz, 1H), 7.62 (dd, J = 7.8, 2.3 Hz, 1H), 7.48 - 7.35 (m, 2H), 7.11 (d, J = 3.6 Hz, 1H), 3.98 (s, 3H), 3.92 (s, 3H).

[0328] Example 103: Synthesis of 1-(4-fluoro-3-methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4- carboxylic acid (103)

[0329] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4-carboxylic acid methyl ester with 1-(4-fluoro-3- methoxyphenyl)-1H-pyrrolo[2,3-b]pyridine-4-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 13.57 (s, 1H), 8.46 (d, J = 4.9 Hz, 1H), 8.13 (d, J = 3.7 Hz, 1H), 7.70 (d, J = 4.9 Hz, 1H), 7.63 (dd, J = 7.8, 2.4 Hz, 1H), 7.52 - 7.32 (m, 2H), 7.12 (d, J = 3.7 Hz, 1H), 3.93 (s, 3H).

[0330] Example 104: Synthesis of methyl l-(3-(trifluoromethoxy)phenyl)-lH-pyrrolo[2,3- b]pyridine-4-carboxylate (104)

[0331] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-lH-indole with methyl lH-pyrrolo[2,3-b]pyridine-4-carboxylate and 1,3-difluoro-5- iodobenzene with 1-bromo-3-trifluoromethoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 13.57 (s, 1H), 8.46 (d, J = 4.9 Hz, 1H), 8.13 (d, J = 3.7 Hz, 1H), 7.70 (d, J = 4.9 Hz, 1H), 7.63 (dd, J = 7.8, 2.4 Hz, 1H), 7.52 - 7.32 (m, 2H), 7.12 (d, J = 3.7 Hz, 1H), 3.93 (s, 3H).

[0332] Example 105: Synthesis of l-(3-(trifluoromethoxy)phenyl)-lH-pyrrolo[2,3-b]pyridine-4- carboxylic acid (105)

[0333] The synthesis was performed according to the procedure of Example 3, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(3-(trifluoromethoxy)phenyl)-lH- pyrrolo[2,3-b]pyridine-4-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 13.57 (s, 1H), 8.46 (d, J = 4.9 Hz, 1H), 8.13 (d, J = 3.7 Hz, 1H), 7.70 (d, J = 4.9 Hz, 1H), 7.63 (dd, J = 7.8, 2.4 Hz, 1H), 7.52 - 7.32 (m, 2H), 7.12 (d, J = 3.7 Hz, 1H), 3.93 (s, 3H).

[0334] Example 106: Synthesis of methyl l-(3-methoxyphenyl)-lH-pyrrolo[2,3-b]pyridine-4- carboxylate (106)

[0335] The synthesis was performed according to the procedure of Reference Example 1, Step 1, replacing 4-bromo-lH-indole with methyl 1H-pyrrolo[2,3-b]pyridine-4-carboxylate and 1,3-difluoro-5-iodobenzene with 1-bromo-3-methoxybenzene. 1 H NMR (400 MHz, DMSO-d6) δ 8.48 (d, J = 4.9 Hz, 1H), 8.17 (d, J = 3.6 Hz, 1H), 7.71 (d, J = 4.9 Hz, 1H), 7.51 - 7.41 (m, 3H), 7.11 (d, J = 3.7 Hz, 1H), 6.97 (ddt, J = 5.7, 3.6, 2.0 Hz, 1H), 3.98 (s, 3H), 3.84 (s, 3H).

[0336] Example 107: Synthesis of 1-(3-methoxyphenyl)-lH-pyrrolo[2,3-b]pyridine-4-carboxylic acid (107)

[0337] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-lH-indole-4-carboxylic acid methyl ester with 1-(3-methoxyphenyl)-lH-pyrrolo[2,3-b]pyridine-4-carboxylic acid methyl ester. 1 H NMR (400 MHz, DMSO-d6) δ 8.48 (d, J = 4.9 Hz, 1H), 8.17 (d, J = 3.6 Hz, 1H), 7.71 (d, J = 4.9 Hz, 1H), 7.51 - 7.41 (m, 3H), 7.11 (d, J = 3.7 Hz, 1H), 6.97 (ddt, J = 5.7, 3.6, 2.0 Hz, 1H), 3.98 (s, 3H), 3.84 (s, 3H).

[0338] Example 108: Synthesis of 1-(2-hydroxy-3-methoxyphenyl)-lH-pyrrolo[2,3-b]pyridine-4-carboxylic acid (108)

[0339] The synthesis was performed according to the procedure of Reference Example 3, replacing 1-(3,5-difluorophenyl)-lH-indole-4-carboxylic acid methyl ester with 1-(2-hydroxy-3-methoxyphenyl)-lH-pyrrolo[2,3-b]pyridine-4-carboxylic acid methyl ester. 1H NMR (400 MHz, DMSO-d6) δ 13.41 (s, 1H), 9.10 (s, 1H), 8.34 (d, J = 5.0 Hz, 1H), 7.77 (d, J = 3.5 Hz, 1H), 7.65 (d, J = 4.9 Hz, 1H), 7.09 (d, J = 8.1 Hz, 1H), 7.06 - 7.01 (m, 2H), 6.92 (t, J = 8.1 Hz, 1H), 3.89 (s, 3H).

[0340] Example 109: Synthesis of methyl l-(2-methoxypyridin-4-yl)-lH-pyrrolo[2,3- b]pyridine-4-carboxylate (109)

[0341] The synthesis was performed according to the procedure of Example 1, Step 1, replacing 4-bromo-lH-indole with methyl lH-pyrrolo[2,3-b]pyridine-4-carboxylate and 1,3-difluoro-5- iodobenzene with 4-bromo-2-methoxypyridine. 1 H NMR (400 MHz, DMSO-d6) δ 8.56 (d, J = 4.9 Hz, 1H), 8.40 (d, J = 3.9 Hz, 1H), 8.30 (d, J = 5.8 Hz, 1H), 7.82 - 7.76 (m, 2H), 7.68 (d, J = 1.8 Hz, 1H), 7.18 (d, J = 3.8 Hz, 1H), 3.99 (s, 3H), 3.93 (s, 3H).

[0342] Example 110: Synthesis of l-(5-methoxypyridin-3-yl)-lH-pyrrolo[2,3-b]pyridine-4- carboxylic acid (110)

[0343] The synthesis was performed according to the procedure of Example 3, replacing methyl l-(3,5-difluorophenyl)-lH-indole-4-carboxylate with methyl l-(2-methoxypyridin-4-yl)-lH- pyrrolo[2,3-b]pyridine-4-carboxylate. 1 H NMR (400 MHz, DMSO-d6) δ 8.56 (d, J = 4.9 Hz, 1H), 8.40 (d, J = 3.9 Hz, 1H), 8.30 (d, J = 5.8 Hz, 1H), 7.82 - 7.76 (m, 2H), 7.68 (d, J = 1.8 Hz, 1H), 7.18 (d, J = 3.8 Hz, 1H), 3.99 (s, 3H), 3.93 (s, 3H).

[0344] Example 111: Synthesis of methyl 3-chloro-l-(3-fluoro-5-methoxyphenyl)-lH-indole- 4-carboxylate (111)

[0345] The synthesis method refers to step 1 of reference example 1, replacing 4-bromo-1H- indole with 3-chloro-1H-indole-4-carboxylic acid methyl ester, and replacing 1,3-difluoro-5- iodobenzene with 1-bromo-3-fluoro-5-methoxybenzene. 1 H NMR (400 MHz, CDC13) δ 7.71 (dt, J = 8.4, 0.9 Hz, 1H), 7.62 (dt, J = 7.3, 0.8 Hz, 1H), 7.44 (s, 1H), 7.32 (dd, J = 8.4, 7.4 Hz, 1H), 6.81 (dt, J = 4.3, 2.3 Hz, 2H), 6.70 (dt, J = 10.3, 2.3 Hz, 1H), 4.04 (d, J = 0.6 Hz, 3H), 3.88 (s, 3H).

[0346] Example 112: Synthesis of 3-chloro-1-(3-fluoro-5-methoxyphenyl)-1H-indole-4- carboxylic acid (112)

[0347] The synthesis method refers to example 3, replacing 1-(3,5-difluorophenyl)-1H-indole-4- carboxylic acid methyl ester with 3-chloro-1-(3-fluoro-5-methoxyphenyl)-1H-indole-4- carboxylic acid. 1 H NMR (400 MHz, DMSO-d6) δ 13.06 (s, 1H), 8.04 (s, 1H), 7.79 (d, J = 8.4 Hz, 1H), 7.49 (d, J = 7.2 Hz, 1H), 7.34 (dd, J = 8.4, 7.4 Hz, 1H), 7.19 - 7.11 (m, 1H), 7.04 (d, J = 2.2 Hz, 1H), 6.96 (dd, J = 10.9, 2.3 Hz, 1H), 3.87 (s, 3H).

[0348] Example 113: Luciferase Reporter Gene Experiment

[0349] 1. Purpose of Experiment: To determine the agonistic effect of the compound of the present application on the HIF-2a gene regulated HRE gene in HRE reporter gene 786-0 stable cell line.

[0350] 2. Experimental Method: 6000 stable 3x HRE containing 786-0 cells were seeded in 96 well plates with 100 μL RPMI-1640 medium containing 10% fetal bovine serum per well. After 24 h, each compound was added to each well in the form of DMSO solution at the corresponding concentration. In the initial screening of the compound, it was first tested at two concentrations of 2 μM and 20 μM, and if it showed agonistic activity, the EC 50 was selected for further evaluation.50 During the evaluation, the compound was tested at 9 concentrations of 50, 16.66, 5.55, 1.85, 0.61, 0.20, 0.06, 0.02 and 0.007 μM, with 3 replicates for each concentration. After 24 hours of incubation, the culture solution was discarded, 20 μL of firefly luciferase reporter gene cell lysate (RG126M, Beyotime) was added to each well, and the 96-well plate was placed on a microplate rapid shaker for 10 min of shaking. After the shaking was completed, 10 μL of lysate was transferred to a white non-transparent plate, then 10 μL of Steady-LumiTM firefly luciferase detection reagent (RG058S, Beyotime) was added to each well, and finally the luminescence was detected in an enzyme-labeled instrument (Agilent Synergy Neo2). In order to characterize the agonist activity, the effective concentration of the compound producing 50% of the assay signal (EC50) was calculated using Graphpad software. 50

[0351] 3x HRE SEQ ID:

[0352] 3. Experimental results: Table 1 lists the compounds with agonist activity, where “A” refers to EC 50 less than or equal to 1 μM, “B” refers to EC 50 between 1 μM and 5 μM, “C” refers to EC 50 between 5 μM and 20 μM.

[0353] Table 1

[0354] The data in Table 1 shows that the compounds of the present application have good agonist activity for the transcription level of HIF-2α protein.

[0355] Example 114: In the experiment of TGF-β1-induced fibrosis of rat kidney fibroblasts, the regulatory effect of the compound on renal fibrosis genes was determined.

[0356] Principle of the experiment: Transforming growth factor (TGF-β1) is the main factor driving fibrosis, which can promote the transformation of fibroblasts into myofibroblasts, and can also promote the differentiation of myofibroblasts into a fibrosis-promoting phenotype. TGF-β1 stimulates rat kidney fibroblasts (NRK-49F), thereby increasing the upregulation of fibrosis-promoting genes such as a-smooth muscle actin (α-SMA) and collagen III (Collagen III).

[0357] ​Experimental methods: Rat kidney fibroblasts were seeded into 12-well plates. After 24 hours, the culture medium was aspirated, and fresh medium containing 0.5% FBS was added, followed by 2 ng / mL TGF-β1 (dissolved in DMEM). After 6 hours, the test compound was added to a final concentration of 10 μM, and incubation continued for another 24 hours. RNA extraction was performed using TRIZOL reagent. cDNA transcription was performed using an all-in-one... TM First-Strand cDNA Synthesis Kit (see instruction manual for detailed operating procedures). Signal labeling was performed using SYBR reagent, with β-actin as an internal control. qRT-PCR primers are:

[0358] β-actin group

[0359] β-actin_fwd,GGAGATTACTGCCCTGGGCTCCTA;

[0360] β-actin_rev,GACTCATCGTACTCCTGCTTGCTG;

[0361] α-SMA group:

[0362] α-SMA_fwd,CGGGAGAAAATGACCCAGAT

[0363] α-SMA_rev,CCAGAGTCCAGCACAATACCCA

[0364] Collagen III

[0365] Collagen III_fwd,TCCAATGAGGGAGAATTCAAGGCTG

[0366] Collagen III_rev,CTGTTCTTGCTCCATTCACCAGTG

[0367] The results are shown in FIG. 1A and FIG. 1B. The expression levels of a-SMA and Collagen III genes were normalized to 1.00 (with the proline hydroxylase inhibitor roxadustat as a positive reference) after treatment with 2 ng / mL TGF-β1. Compared with the control group (Control) without TGF-β1 treatment, the basal expression levels of a-SMA and Collagen III genes were 0.24 and 0.23 (P < 0.001), respectively, which confirmed that TGF-β1 could significantly up-regulate the expression of the above fibrosis marker genes (induction fold > 4-fold). The drug screening results showed that: experimental compounds 16, 20, 25, 47, 56, 60, 76, 85, 93, 103, 105, 107, 110 and 112 showed significant inhibitory effect on the up-regulation of a-SMA gene induced by TGF-β1 (P < 0.05 to P < 0.001); at the same time, compounds 16, 17, 20, 22, 25, 28, 31, 34, 36, 39, 47, 48, 56, 57, 60, 76, 85, 87, 89, 91, 93, 95, 101 and 103 could significantly reduce the expression level of Collagen III gene (P < 0.05 to P < 0.001). The experimental data was statistically analyzed by GraphPad Prism software (version 8.0). Compared with the 2 ng / mL TGF-β1 treatment group, a two-tailed test was used, and the significance level was set as *P < 0.05, **P < 0.01, ***P < 0.001.

[0368] Example 115: Determination of the regulatory effect of the compound on the renal anemia gene on 786-O cells.

[0369] 786-O cell line is a cell model derived from renal carcinoma, which is characterized by the deletion of VHL gene. The deletion of VHL gene leads to the stability of HIF-2a under normoxic conditions without degradation. This feature makes 786-O cells an ideal tool for studying the transcriptional activity of HIF-2a and its related signaling pathways. Vascular endothelial growth factor (VEGF) is a key pro-angiogenic factor that plays a central role in various physiological and pathological processes. N-Myc downstream regulated gene 1 (NRDG1) is a multifunctional regulatory gene that plays an important role in biological processes such as cell differentiation, proliferation, apoptosis, iron metabolism, and hypoxic response. NRDG1 may affect iron absorption and utilization by regulating the expression of hepcidin, thereby playing a role in iron metabolism balance. In addition, the up-regulation of NRDG1 expression under hypoxic conditions may promote angiogenesis. Erythropoietin (EPO), also known as erythropoietic factor and erythropoietin, is an endogenous glycoprotein hormone in the human body that stimulates erythropoiesis. M1002 is an agonist of HIF-2a, which is used as a positive control here.

[0370] Experimental method: Renal carcinoma cells 786-O were seeded into 12-well plates. After 24 h, 2 μM concentration of test compounds were added, and the cells were incubated with the compounds for 24 h. TRIZOL reagent was used for RNA extraction. cDNA transcription was performed using All-in-one First-Strand cDNA Synthesis Kit (specific operation steps are described in the instruction manual). SYBR reagent was used for signal calibration, and GAPDH was used as an internal reference. qRT-PCR primers were: TM GAPDH_fwd, GCACCGTCAAGGCTGAGAAC;

[0371] GAPDH_rev, TGGTGAAGACGCCAGTGGA;

[0372] GAPDH_fwd, GCACCGTCAAGGCTGAGAAC;

[0373] GAPDH_rev, TGGTGAAGACGCCAGTGGA;

[0374] VEGF_fwd, AGGGCAGAATCATCACGAAGT;

[0375] VEGF_rev, AGGGTCTCGATTGGATGGCA;

[0376] VEGF_fwd, AGGGCAGAATCATCACGAAGT;

[0377] NDRG1_fwd, CTCCTGCAAGAGTTTGATGTCC;

[0378] NDRG1_fwd, CTCCTGCAAGAGTTTGATGTCC;

[0379] NDRG1_rev,TCATGCCGATGTCATGGTAGG;

[0380] The results are shown in Figures 2A, 2B, and 2C. At a concentration of 2 μM, compounds 16, 22, 25, 36, 85, 103, and 110 significantly upregulated the expression level of the VEGF gene; compounds 16, 20, 22, 25, 36, 95, and 105 significantly upregulated the expression level of the NDRG1 gene; and compounds 6, 17, 19, 20, 22, 25, 28, 31, 34, 47, 56, 57, 76, 95, 110, and 112 significantly upregulated the expression level of the EPO gene. These results indicate that the above compounds can effectively activate the expression of downstream target genes of HIF-2α, and this activation may provide a potential therapeutic strategy for treating ischemic diseases or anemia. Experimental data were statistically analyzed using GraphPad Prism software (version 8.0) with a two-tailed assay. *P<0.05, **P<0.01, ***P<0.001.

[0381] Example 116: Determination of the regulatory effect of the compound in combination with roxadustat on the renal anemia gene.

[0382] The Hep3B cell line is derived from human hepatocellular carcinoma tissue, and the liver is one of the main organs for EPO gene expression. Under physiological conditions, the liver (especially during fetal development) and kidneys are the main sites of EPO production. Although the kidneys become the primary source of EPO in adulthood, the liver can reactivate EPO expression under certain pathological conditions (such as hypoxia or anemia). Therefore, the Hep3B cell line provides a suitable model for studying the regulation of EPO gene expression in hepatocytes. Roxadustat, a proline hydroxylase inhibitor, and ZG-2033, an HIF-2α agonist, were used as positive controls.

[0383] Experimental methods: Hep3B liver cancer cells were seeded into 12-well plates. After 24 hours, 2.5 μM Roxadustat was added, and after 6 hours, 10 μM of the test compound was added, followed by incubation for 24 hours. RNA extraction was performed using TRIZOL reagent. cDNA transcription was performed using an all-in-one assay. TM First-Strand cDNA Synthesis Kit (see instruction manual for detailed operating procedures). Signal labeling was performed using SYBR reagent, with GAPDH as an internal control. qRT-PCR primers are:

[0384] GAPDH Group:

[0385] GAPDH_fwd,GCACCGTCAAGGCTGAGAAC;

[0386] GAPDH_rev, TGGTGAAGACGCCAGTGGA;

[0387] EPO group:

[0388] EPO_fwd, AACAATCACTGCTGACACTT;

[0389] EPO_rev, AGAGTTGCTCTCTGGACAGT.

[0390] The detection results are shown in FIG. 3. The expression level of the EPO gene after treatment with 2.5 μM Roxadustat is normalized to 1.00. Compared with the control group (Control) without applying Roxadustat, the basal expression level of the EPO gene is 0.84 (P < 0.05), which proves that Roxadustat can significantly up-regulate the expression of the erythropoietin gene. The drug screening results show that 10 μM of compounds 16, 19, 20, 22, 28, 31, 34, 36, 49, 56, 57, 60, 76, 83, 93, 103, and 110 further up-regulate the expression of the EPO gene compared with the Roxadustat group (FIG. 4), showing an enhancement effect. These results suggest that the combination of the above drugs can effectively activate the expression of the target genes downstream of HIF-2a, and this synergistic activation may provide a new treatment strategy for treating ischemic diseases or anemia and the like. The experimental data is statistically analyzed using GraphPad Prism software (version 8.0), a two-tailed test is used, *P < 0.05, **P < 0.01, ***P < 0.001.

[0391] Example 117: Aristolochic Acid-induced Zebrafish Kidney Injury Combined with Renal Anemia Experiment

[0392] 1. Improving the incidence of renal edema

[0393] Randomly select wild-type AB strain zebrafish 2 days after fertilization (2dpf) in a 6-well plate, and treat 30 zebrafish per well (experimental group). Except for the normal control group, the rest of the experimental groups are given aristolochic acid in water to establish a zebrafish renal anemia model. After 18h of treatment at 28°C, samples are given in water, and normal control and model control groups are set up, with a volume of 3mL per well. After continuing to treat at 28°C for 30h, each experimental group is observed under a dissecting microscope, and the number of zebrafish with renal edema is counted to calculate the incidence of renal edema (%) in each experimental group.

[0394] 2. Reducing glomerular filtration

[0395] Randomly selected 2dpf wild type AB strain zebrafish in 6-hole plate, each hole (experimental group) was treated with 30 zebrafish. Except for the normal control group, the rest of the experimental groups were given aqueous Aristolochic acid to establish zebrafish renal anemia model. After 18h treatment at 28℃, the samples were given respectively (concentration see table 1-2), and the normal control group and model control group were set up, and the volume of each hole was 3mL. After 4h continuous treatment at 28℃, each experimental group was intravenously injected with fluorescent marker (Dextran tetramethylrhodamine), and after 1 day of continuous treatment at 28℃, 10 zebrafish were randomly selected from each experimental group and placed under a fluorescence microscope for photography. The data were analyzed and collected using NIS-Elements D 3.20 advanced image processing software, and the whole body fluorescence intensity of zebrafish was analyzed. The statistical analysis results of this index were used to evaluate the efficacy of the sample on the repair of kidney damage. The statistical processing results were expressed as mean±SE. Statistical analysis was performed using SPSS 26.0 software, and p<0.05 indicated that the difference was statistically significant.

[0396] 3. Evaluation of the efficacy of improving renal anemia (heart red blood cell staining intensity)

[0397] Randomly selected 2dpf wild type AB strain zebrafish in 6-hole plate, each hole (experimental group) was treated with 30 zebrafish. Except for the normal control group, the rest of the experimental groups were given aqueous Aristolochic acid to establish zebrafish renal anemia model. After 18h treatment at 28℃, the samples were given respectively, and the normal control group and model control group were set up, and the volume of each hole was 3mL. After 30h continuous treatment at 28℃, o-phenylenediamine staining was used, and after staining, 10 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. Data were collected using NIS-Elements D 3.20 advanced image processing software, and the heart red blood cell staining intensity of zebrafish was analyzed. The statistical significance of this index was used to evaluate the efficacy of the sample in improving renal anemia. Statistical analysis was performed using SPSS 26.0 software, and p<0.05 indicated that the difference was statistically significant.

[0398] Detection results: (1) The incidence of nephrotic edema in the aristolochic acid-induced zebrafish model group was 100%, and the incidence of nephrotic edema in the 10 μM compound 16 group decreased from 100% to 37%, and the incidence of nephrotic edema in the 30 μM compound 16 group decreased from 100% to 37% (Figure 4A). (2) The glomerular filtration rate of normal zebrafish was 100%, the glomerular filtration rate of the aristolochic acid-induced zebrafish model group was 239%, the glomerular filtration rate of the 1 μM compound 16 experimental group was 145%, the glomerular filtration rate of the 10 μM compound 16 experimental group was 140%, and the glomerular filtration rate of the 30 μM compound 16 experimental group was 151%, indicating that compound 16 has the function of improving glomerular filtration (Figure 4B). (3) The heart red blood cell count of the normal zebrafish group was 100%, the heart red blood cell count of the aristolochic acid-induced zebrafish model group was 46%, the heart red blood cell count of the 10 μM compound 16 experimental group was 67%, and the heart red blood cell count of the 30 μM compound 16 experimental group was 79%, indicating that compound 16 has the effect of treating renal anemia (Figure 4C).

[0399] Example 118: Renal fibrosis experiment caused by unilateral ureteral obstruction (UUO).

[0400] 6.1 Establishment of animal model, administration and sampling

[0401] After the male Balb / c mice were anesthetized with isoflurane, they were fixed on the operating table with medical tape, and the skin was prepared at the midline incision of the abdomen. The surgical site skin was disinfected with 75% alcohol-iodine-alcohol. Then, the opening along the mouse abdominal white line was fixed with an open abdominal fixator, the left ureter was isolated with a sterile cotton swab and a small curved forceps, and was ligated with a 3-0 line near the upper pole of the bladder. After a drop of normal saline was dropped into the abdominal cavity, the abdomen was sutured, and after recovery on the heating pad, it was returned to the cage. Then, normal diet, drinking water were given and observation was carried out, and the model construction was completed. The sham group (Sham group) was the same as the model group except that it was not ligated. The experimental group of UUO model of male Balb / c mice, after one week of adaptation period, was given 10 mg / kg / day of compound 16, 76 or roxadustat by oral gavage for three consecutive days. The administration was continued for seven days after the unilateral ureteral obstruction surgery. The mice in the sham group and the UUO control group were given the solvent according to the same administration schedule, and the rats were euthanized after the last treatment. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test for comparison with the UUO control group (*P<0.05, **P<0.01, ***P<0.001).

[0402] 6.2 Renal pathological study

[0403] Mouse left kidney samples were fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned. Tissue sections were 4 pm thick and subsequently subjected to histological staining such as H&E and Masson’s trichrome staining. After staining, sections were scanned using advanced 3D histology imaging technology and high-resolution images were captured using the Pannoramic DESK / MIDI / 250 / 1000 system. Tubular injury was assessed by analysis of H&E staining, and 10 fields per sample were randomly selected at x40 magnification for examination and scored using a semi-quantitative scoring system (Pallar score): 0 (no injury), 1 (<25% injury), 2 (25-50% injury), 3 (50-75% injury) and 4 (>75% injury). In addition, the entire tissue section was evaluated at x0.7 magnification to determine the extent of collagen deposition shown by Masson’s trichrome staining. Semi-quantitative analysis of the collagen area was performed using Image-Pro Plus 6.0 software. Statistical significance was determined by one-way ANOVA followed by Dunnett’s test for comparison with the UUO control group (*P < 0.05, **P < 0.01, ***P < 0.001).

[0404] Results analysis: Histopathological evaluation by H&E staining and Pallar scoring system (Figures 5A, 5C) showed that the inflammatory infiltrate and tubular injury were still very severe in the 10 mg / kg Roxadustat experimental group (4.78 ± 0.09, P = 0.98) compared to the UUO control group (4.56 ± 0.19). Compound 16 (2.85 ± 0.68, P = 0.004) and compound 76 (3.46 ± 0.27, P = 0.09) at 10 mg / kg reduced tubular injury and significantly decreased the pathological score.

[0405] Analysis by Masson’s trichrome staining (Figures 5B, 5D) showed that there was no significant change in kidney fibrosis in the 10 mg / kg Roxadustat experimental group (21.8 ± 1.6%, P = 0.37) compared to the UUO control group (26.0 ± 1.9%). Compound 16 (18.6 ± 1.5%, P = 0.02) and compound 76 (14.4 ± 2.6%, P = 0.002) at 10 mg / kg significantly reduced kidney fibrosis.

[0406] These experimental results confirmed that the compounds have a significant therapeutic effect on kidney damage caused by ureteral obstruction.

[0407] The present application is illustrated by the above examples, but the present application is not limited to the above methods, i.e. it does not mean that the present application must rely on the above detailed methods to be implemented. It should be understood by those skilled in the art that any improvement of the present application, equivalent replacement of each raw material of the product of the present application, addition of auxiliary ingredients, selection of specific modes, etc. fall within the protection scope and disclosure scope of the present application.

Claims

1. A compound having a structure as shown in Formula (I), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof, wherein X 1 is N or CR 7 ; A is C 6-12 aryl or 5-12 membered heteroaryl; each R 1 and R 2 is independently H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , C 1-4 1-6 alkyl, C 2-4 1-6 alkenyl, C 2-4 1-6 alkynyl, C 1-4 1-6 haloalkyl (e.g., -CF3, CHF2, ), C 2-4 1-6 haloalkenyl, or C 2-4 1-6 haloalkynyl; R 3 H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b or -B(OR 7 )2; each R 4 and R 5 is independently H, D, F, Cl, Br, I, OH, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -NHS(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, C 1-4 alkyl, C 1-4 hydroxy-substituted alkyl, C 2-4 alkenyl, C 2-4 alkynyl, C 3-6 cycloalkyl, 3-6 membered heterocyclyl, C 1-4 haloalkyl (e.g., -CF3, CHF2), C 2-4 haloalkenyl, C 2-4 haloalkynyl, C 3-6 halocycloalkyl, or 3-6 membered haloheterocyclyl; R 6 H, D, F, Cl, Br, I, OH, CN, NH2, NO2, C 1-4 alkyl, C 2-4 alkenyl, C 2-4 alkynyl, C 1-4 haloalkyl (e.g., -CF3, CHF2), C 2-4 haloalkenyl or C 2-4 haloalkynyl; Each R 7 H, D, C independently 1-4 Alkyl, C 2-4 alkenyl, C 2-4 alkynyl group, C 3-6 cycloalkyl, 3-6 membered heterocyclic, C 1-4 Haloalkyl, C 2-4 Haloalkenyl, C 2-4 Halogenated alkynyl group, C 3-6 Halogenated cycloalkyl groups or 3-6 membered halogenated heterocyclic groups; Each R a and R b H, D, C independently 1-4 Alkyl, C 1-4 Alkoxy, C 2-4 alkenyl, C 2-4 alkynyl group, C 3-6 cycloalkyl, 3-6 membered heterocyclic, C 1-4 Haloalkyl, C 1-4 Halogenated alkoxy groups, C 2-4 Haloalkenyl, C 2-4 Halogenated alkynyl group, C 3-6 Halocycloalkyl groups, 3-6 membered haloheterocyclic groups; m is 0, 1, 2 or 3.

2. The compound of claim 1, A is selected from 5-membered aryl, 6-membered aryl, 5-membered and 5-membered aryl, 5-membered and 6-membered aryl or 6-membered and 6-membered aryl, 5-membered heteroaryl, 6-membered heteroaryl, 5-membered and 5-membered heteroaryl, 5-membered and 6-membered heteroaryl or 6-membered and 6-membered heteroaryl; R 3 R 4 R 5 R 6 At least two of them are H; or R 3 R 4 R 5 R 6 Two or three of them are H, and the rest are not H.

3. The compound of claim 2, A is selected from phenyl, imidazolyl, pyrazolyl, thienyl, thiazolyl, pyridyl, pyrimidyl, pyrazinyl, benzofuran, benzimidazole, indolyl or quinolinyl; preferably, A is selected from phenyl or pyridyl.

4. The compound of claim 1 having a structure according to Formula (II-1), (II-2), (II-3), (II-4), (II-5), (II-6), (II-7), (II-8), (II-9), (II-10), (II-11), or (II-12), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof, wherein each m is independently 1, 2 or 3.

5. The compound of claim 1 having the structure according to Formula (III-1), (III-2), (III-3), or (III-4), or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof, wherein, each A1is independently 5-membered heteroaryl, 6-membered heteroaryl, 5-membered and 5-membered heteroaryl, 5-membered and 6-membered heteroaryl or 6-membered and 6-membered heteroaryl; optionally, each A1is independently imidazolyl, pyrazolyl, thienyl, thiazolyl, pyridyl, pyrimidyl, pyrazinyl, benzofuran, benzimidazole, indolyl or quinolinyl.

6. The compound of claim 1, wherein, each R 1 and R 2 independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 4 and R 5 are independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -NHS(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, methyl, ethyl, 2-hydroxyethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 6 H, D, F, CI, Br, I, OH, CF3, CHF2, CN, NH2, NO2, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or Each R 7 Independently, it is H, D, methyl, ethyl, n-propyl, isopropyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl; and / or each R a and R b is independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 1,2-dichloroethyl, 2-fluoropropyl, 3-fluoropropyl, methoxy, ethoxy, n-propoxy, i-propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl.

7. The compound of claim 2, wherein, each R 1 and R 2 is independently H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 4 and R 5 are independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -NHS(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, methyl, ethyl, 2-hydroxyethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 6 H, D, F, CI, Br, I, OH, CF3, CHF2, CN, NH2, NO2, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or Each R 7 Independently, it is H, D, methyl, ethyl, n-propyl, isopropyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl; and / or each R a and R b is independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 1,2-dichloroethyl, 2-fluoropropyl, 3-fluoropropyl, methoxy, ethoxy, n-propoxy, i-propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl.

8. The compound of claim 3, wherein, each R 1 and R 2 is independently H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 4 and R 5 are independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -NHS(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, methyl, ethyl, 2-hydroxyethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 6 H, D, F, Cl, Br, I, OH, CF3, CHF2, CN, NH2, NO2, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or Each R 7 Independently, it is H, D, methyl, ethyl, n-propyl, isopropyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl; and / or each R a and R b is independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 1,2-dichloroethyl, 2-fluoropropyl, 3-fluoropropyl, methoxy, ethoxy, n-propoxy, i-propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl.

9. The compound of claim 4, wherein, each R 1 and R 2 is independently H, D, F, Cl, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 4 and R 5 are independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -NHS(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, methyl, ethyl, 2-hydroxyethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 6 H, D, F, Cl, Br, I, OH, CF3, CHF2, CN, NH2, NO2, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or Each R 7 Independently, it is H, D, methyl, ethyl, n-propyl, isopropyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl; and / or each R a and R b is independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 1,2-dichloroethyl, 2-fluoropropyl, 3-fluoropropyl, methoxy, ethoxy, n-propoxy, i-propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl.

10. The compound of claim 5, wherein, each R 1 and R 2 independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , methyl, ethyl, n-propyl, i-propyl, t-butyl, ethenyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 4 and R 5 are independently H, D, F, CI, Br, I, OH, -CF3, CHF2, CN, NH2, NO2, -C(=O)OR 7 , -C(=O)R 7 , -S(=O)2R 7 , -NHS(=O)2R 7 , -OR 7 , -SR 7 , -S(=O)R 7 , -C(=O)NR a R b , -NR a C(=O)NR a R b , -S(=O)2NR a R b , -B(OR 7 )2, methyl, ethyl, 2-hydroxyethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or R 6 H, D, F, Cl, Br, I, OH, CF3, CHF2, CN, NH2, NO2, methyl, ethyl, n-propyl, i-propyl, t-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl; and / or Each R 7 Independently, it is H, D, methyl, ethyl, n-propyl, isopropyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propynyl, propargyl, propyl, cyclobutyl, cyclopentyl, cyclohexyl; and / or each R a and R b is independently H, D, methyl, ethyl, n-propyl, i-propyl, t-butyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 1,2-dichloroethyl, 2-fluoropropyl, 3-fluoropropyl, methoxy, ethoxy, n-propoxy, i-propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl.

11. The compound of claim 1 having one of the following structures, or a stereoisomer, tautomer, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof, 12. A pharmaceutical composition comprising the compound of any one of claims 1-11.

13. The pharmaceutical composition of claim 12, further comprising a pharmaceutically acceptable adjuvant.

14. The pharmaceutical composition of claim 13, which is any one of a tablet, a pill, a capsule, an injection.

15. The pharmaceutical composition of claim 14, which is any one of a tablet, a pill, a capsule, an injection.

16. Use of the compound of any one of claims 1-11 or the pharmaceutical composition of any one of claims 12-15 in the manufacture of a medicament for preventing, treating or alleviating a HIF-2a mediated related disease.

17. The use according to claim 16, wherein, The HIF-2a mediated related disease is selected from hematopoietic disorders.

18. The use of claim 16, wherein the HIF-2a mediated related disease comprises any one of: (a) anemia; (b) post-surgical ischemic conditions and their sequelae; (c) post-surgical wound healing disorders; (d) chronic kidney disease; (e) cardiovascular disease; (f) infection; (g) inflammatory disease; (h) cancer; (i) health impairment caused by cancer treatment; (j) continuous symptoms of acute or chronic cerebral ischemic conditions; (k) acute respiratory distress syndrome.

19. The use according to claim 18, wherein the anemia comprises: renal anemia, primary anemia, tumor disease-related anemia, chemotherapy-induced anemia, blood loss anemia, iron deficiency anemia, vitamin deficiency anemia, developmental anemia, aplastic anemia, hemolytic anemia, iron utilization disorder anemia or endocrine disorder-related anemia; and / or the surgery comprises cardiac intervention using a heart-lung machine, carotid intervention, aortic intervention or intervention requiring opening or penetration of the skull; and / or the chronic kidney disease comprises primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesion, ischemic nephropathy or genetic nephropathy; and / or the tubulointerstitial lesion comprises chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy or drug-induced nephropathy; and / or the cardiovascular disease comprises myocardial infarction, angina pectoris, heart failure, stroke, peripheral arterial disease, aortic aneurysm, peripheral arterial disease, peripheral arterial occlusive disease, peripheral vascular disease, peripheral circulatory disorder, peripheral circulatory disease, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral vascular disorder, peripheral vascular disease, peripheral the genetic kidney disease comprises polycystic kidney or genetic nephritis; and / or the cardiovascular disease comprises heart insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary hypertension, pulmonary hypertension, malignant hypertension or peripheral arterial occlusive disease; and / or the infection comprises HIV infection; and / or the inflammatory disease comprises rheumatoid arthritis; and / or the health damage caused by cancer treatment comprises health status damage in a range of rheumatic forms of diseases or diseases in the process of drug treatment of the diseases, or other forms of diseases considered as autoimmune diseases or health status damage in the process of drug treatment of the diseases; and / or the continuous symptom comprises stroke or asphyxia during delivery.

20. A pharmaceutical association, a pharmaceutical kit or a pharmaceutical combination, wherein, the pharmaceutical combination, the pharmaceutical combination kit or the combined preparation comprises the compound of any one of claims 1-11 or the pharmaceutical composition of any one of claims 12-15 and a prolyl hydroxylase inhibitor drug; optionally, the prolyl hydroxylase inhibitor drug comprises any one of Roxadustat, Daprodustat, Vadadustat, Enasidenib, Molidustat; and / or in the pharmaceutical combination kit, the compound of any one of claims 1-11 or the pharmaceutical composition of any one of claims 12-15 and the prolyl hydroxylase inhibitor drug exist in a physically separated or mixed form; and / or the pharmaceutical combination, the pharmaceutical combination kit or the combined preparation is used for preventing, treating or alleviating a disease related to HIF-2α activity; and / or the disease related to HIF-2α activity comprises the HIF-2α mediated disease in the use of any one of claims 17-19. the genetic kidney disease comprises polycystic kidney or genetic nephritis; and / or the cardiovascular disease comprises heart insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary hypertension, pulmonary hypertension, malignant hypertension or peripheral arterial occlusive disease; and / or the infection comprises HIV infection; and / or the inflammatory disease comprises rheumatoid arthritis; and / or the health damage caused by cancer treatment comprises health status damage in a range of rheumatic forms of diseases or diseases in the process of drug treatment of the diseases, or other forms of diseases considered as autoimmune diseases or health status damage in the process of drug treatment of the diseases; and / or the continuous symptom comprises stroke or asphyxia during delivery. the pharmaceutical combination, the pharmaceutical combination kit or the combined preparation comprises the compound of any one of claims 1-11 or the pharmaceutical composition of any one of claims 12-15 and a prolyl hydroxylase inhibitor drug; optionally, the prolyl hydroxylase inhibitor drug comprises any one of Roxadustat, Daprodustat, Vadadustat, Enasidenib, Molidustat; and / or in the pharmaceutical combination kit, the compound of any one of claims 1-11 or the pharmaceutical composition of any one of claims 12-15 and the prolyl hydroxylase inhibitor drug exist in a physically separated or mixed form; and / or the pharmaceutical combination, the pharmaceutical combination kit or the combined preparation is used for preventing, treating or alleviating a disease related to HIF-2α activity; and / or the disease related to HIF-2α activity comprises the HIF-2α mediated disease in the use of any one of claims 17-19.

Images