Fertilizer nanoparticles and methods thereof

Abstract

Certain embodiments of the invention provide new nanomaterials (e.g., fertilizer nanoparticles) and methods suitable for delivery (e.g., foliar delivery) of nutrients such as Calcium, phosphorous, and / or nitrogen to plants (e.g., controlled by the plant pH gradients). For example, nitrogen uptake and utilization efficiency may be enhanced by the nanomaterials and use thereof as described herein.

Description

[0001] FERTILIZER NANOPARTICLES AND METHODS THEREOF

[0002] CROSS-REFERENCE TO RELATED APPLICATION

[0003] This application claims priority to United States Provisional Application Number

[0004] 63 / 656,728 that was filed on June 6, 2024. The entire content of the application referenced above is hereby incorporated by reference herein.

[0005] GOVERNMENT FUNDING

[0006] This invention was made with government support under 2133568 awarded by the National Science Foundation. The government has certain rights in the invention.

[0007] BACKGROUND OF THE INVENTION

[0008] Nitrogen fertilizer delivery inefficiencies limit crop productivity and contribute to environmental pollution. Efficient composition and methods for nitrogen delivery and utilization may benefit agriculture productivity and reduce environmental impacts.

[0009] SUMMARY OF THE INVENTION

[0010] Certain embodiments of the invention provide a nanoparticle comprising Fe (III) doped hydroxyapatite (e.g., comprising Fe (III) doped hydroxyapatite and urea).

[0011] Certain embodiments of the invention provide a composition comprising a nanoparticle described herein and a carrier.

[0012] Certain embodiments of the invention provide a method of nutrient delivery to a plant (e.g., controlled by pH), comprising introducing to the plant a nanoparticle or a composition as described herein (e.g., via foliar delivery).

[0013] BRIEF DESCRIPTION OF THE FIGURES

[0014] Figure 1. Foliar delivery of ZnHAU and FeHAU in plants for pH controlled release of nitrogen. Hydroxyapatite nanoparticles loaded with urea molecules through hydrogen bonds and metal-ligand interactions attached and enter the wheat leaf surface. The HAU nanoparticles showcase a pH controlled release of N at a slower rate on the leaf surface and within the leaf epidermis apoplast, in stark contrast to the rapid release of urea fertilizers. The controlled release of urea by HAU nanoparticles ensures an extended and improved uptake of N that promotes plant growth. Urease activity in the apoplast converts some of the urea into ammonium, where these N containing molecules are taken up by plant cells through various plasma membrane transporters (DUR3, MIPs, and AMT).

[0015] Figures 2A-2F. Characterization of hydroxyapatite nanoparticles for foliar nitrogen delivery in plants. Fig.2A) Hydrodynamic diameter (n = 3-8), Fig.2B) TEM images (n = 3), and Fig.2C) Zeta potential of ZnHA, ZnHAU, ZnHA-FITC, GdHA, GdHA-FITC, FeHA, FeHAU, FeHAU-FITC nanoparticles (pH 6.8, DI water) (n = 5) (**** p <0.0001). Data represent means and errors standard deviations. Statistical analysis using one-way ANOVA and post-hoc Sidak’s comparison test. Fig.2D) FTIR analysis of Urea, ZnHA, ZnHAU, FeHA, and FeHAU indicating hydrogen bonding between urea and HA nanoparticles. X-ray photoelectron spectra (XPS) of E) ZnHA, ZnHAU; Fig.2F) FeHA, FeHAU nanoparticles highlighting P 2p, N Is, Ca 2p, Zn 2p and Fe 2p core levels.

[0016] Figures 3A-3F. Plant leaf epidermal attachment and uptake of hydroxyapatite nanoparticles. Leaf epidermis Fig.3A) confocal microscopy images, Fig.3B) reconstructed 3D views from confocal microscopy z-stacks, and Fig.3C) orthogonal projections in the z-axis of plant leaves treated with FITC only, ZnHA-FITC, GdHA-FITC, and FeHA-FITC nanoparticles and stained with FM 4-64 lipid membrane dye. Fig.3D) Colocalization analysis of HA nanoparticles labeled with FITC and FM4-64 fluorescent dye indicating a significantly higher colocalization of nanoparticles compared with FITC dye in the leaf epidermis (n = 3). Scale bar = 10pm. Fig.3E) GdHA nanoparticle interactions on the leaf surface, in the cuticle and uptaken by leaf tissues determined by ICP-MS (n = 5). Fig.3F) SEM images of cuticle attached ZnHA, GdHA, and FeHA nanoparticles. Data represent mean and errors standard deviations. Statistical analysis using one-way ANOVA and post-hoc Tukey’s multiple comparison test (* p <0.05, ** p <0.005, *** p < 0.001, **** p <0.0001).

[0017] Figures 4A-4C. Nitrogen release and rainfastness efficiency of nanoparticles.

[0018] Fig.4A) Nitrogen release from Zn and Fe doped hydroxyapatite-urea at simulate apoplast pH 5.8 and spraying nanoformulation pH 6.8. (n = 3) Statistical analysis using two-way ANOVA and post-hoc Tukey’s multiple comparison test (** p <0.005, *** p < 0.001, **** p <0.0001). Leaf surface rainfastness analysis of Fig.4B) ZnHA and FeHA nanoparticles, and Fig.4C) urea loaded ZnHAU and FeHAU at low (10 mm), moderate (30 mm), and high (50 mm) rainfall events (n = 3) Statistical analysis two-way ANOVA and Sidak’s post-hoc test. (* p <0.05, ** p <0.005, ****p <0.0001). Data represent mean and errors standard deviations.

[0019] Figures 5A-5D. Hydroxyapatite nanoparticle impact on plant growth and nitrogen uptake. Fig.5A) Fresh weight (n = 10), Fig.5B) dry weight (n = 10), Fig.5C) height (n = 30), Fig.5D) nitrogen uptake (n = 3) of wheat plants grown under 30 mg (low) and 140 mg (adequate) nitrogen dosages. Foliar applied ZnHAU and FeHAU improved plant biomass, height, and nitrogen uptake in the plants compared to urea. Statistical analysis using two-way ANOVA and post-hoc Dunnett’s multiple comparison test (* p <0.05, ** p < 0.009, *** p <0.0005, **** p <0.0001).

[0020] Figures 6A-6B. Quantification of element doping and nitrogen loading on hydroxyapatite nanoparticles. Fig.6A) Doping (% mass) quantification of Zn, Gd, and Fe elements in ZnHA, GdHA, and FeHA nanostructures. Fig.6B) Total nitrogen loading (% mass) on ZnHAU and FeHAU nanoparticles (n = 3). Data represent means and error standard deviations.

[0021] Figures 7A-7C. Scanning transmission electron microscopy with energy dispersive X-ray spectroscopy (STEM-EDS) of hydroxyapatite nanoparticles. High angle annular darkfield (HAADF) images, and elemental mapping (N, P, Zn / Fe) by STEM-EDS of (Fig.7A) ZnHA and ZnHAU (50 nm scale bar), (Fig.7B) FeHA and FeHAU (50 nm scale bar), and (Fig.7C) Fe clusters in FeHA, including EDS spectrum of selected areas (20 nm scale bar). The brown area represents overlap between the two spectra in the EDS spectra.

[0022] Figures 8A-8D. Transmission electron micrographs (TEM) of hydroxyapatite nanoparticles. Fig.8A) TEM image of the GdHA nanoparticles. Fig.8B) Length, Fig.8C) width, and Fig.8D) aspect ratio of ZnHA, ZnHAU, FeHA, FeHAU, and GdHA nanoparticles determined from TEM images. Statistical analysis using one-way ANOVA and post hoc Dunn’s multiple comparison test (n = 150) (* p <0.05, ** p <0.001, *** p <0.005, ****<0.0001)

[0023] Figure 9. X-ray diffraction (XRD) spectra of the hydroxyapatite nanoparticles.

[0024] Upper labels related to HA for reference. X-ray diffraction (XRD) patterns of FeHAU, FeHA, ZnHAU, ZnHA GdHA and urea confirms crystalline phase HA and presence of urea.

[0025] Figures 10A-10H. X-ray photoelectron spectroscopy (XPS) characterization of hydroxyapatite nanoparticles. Fig. lOA) P 2p, Fig.10B) Ca 2p, Fig.10C) N Is, Fig.lOD) Zn 2p core levels of ZnHA and ZnHAU nanoparticles. Fig.lOE) P 2p, Fig.1 OF) Ca 2p, Fig.lOG) N Is, Fig. lOH) Fe 2p core levels of FeHA and FeHAU nanoparticles.

[0026] Figure 11. Schematic representation of FITC labeling on ZnHA, GdHA and FeHA nanoparticles. APTES was covalently attached to the hydroxyapatite nanoparticle surface through sialylation, mediated by the interaction between phosphate and silane groups. Subsequently, FITC dye was conjugated to the free amine groups of APTES molecules using the amine-reactive isothiocyanate moiety.

[0027] Figures 12A-12B. Characterization of FITC labeled ZnHA, GdHA, and FeHA nanoparticles. Fig. l2A) Absorbance spectra and Fig. l2B) fluorescence spectra of ZnHA, GdHA, FeHA, FITC dye, ZnHA-FITC, GdHA-FITC, and FeHA-FITC nanoparticles. The absorbance and fluorescence spectra analysis confirm the functionalization of FITC on the surface of Zn-, Gd-, or Fe-doped hydroxyapatite nanoparticles.

[0028] Figure 13 FTIR analysis of FITC, APTES, FeHA-FITC, ZnHA-FITC, and GdHA-FITC nanoparticles. The FTIR spectra of the hydroxyapatite nanoparticles reveals the presence of peaks corresponding to the Si-C and Si-0 bonds originating from APTES (3- aminopropyltriethoxysilane), C=C in FITC, as well as characteristic peaks associated with the PO43and P-0 functional groups indicative of hydroxyapatite nanoparticles.

[0029] Figures 14A-14C. Characterization of FITC release from hydroxyapatite nanoparticles. The absorbance spectra of FITC released from Fig. l4A) ZnHA-FITC, Fig.l4B) GdHA-FITC, and Fig.14C) FeHA-FITC nanoparticles encapsulated within a 100 kDa MWCO (molecular weight cutoff) dialysis membrane over a 24, 48, 72, 96 hours. The ZnHA-FITC, GdHA-FITC, and FeHA-FITC represent the absorbance spectrum of FITC-tagged nanoparticles.

[0030] Figure 15. Gadolinium (Gd) release from GdHA nanoparticles. Gd release from GdHA nanoparticles encapsulated within a 100 kDa MWCO (molecular weight cutoff) dialysis membrane measured through ICP-OES (Inductively Coupled Plasma Optical Emission Spectroscopy) at 24-hour intervals for a total duration of 72 hours. n= 3.

[0031] Figures 16A-16C. Plant leaf uptake of hydroxyapatite nanoparticles labelled with FITC. Fig.l6A) Confocal microscopy images of control wheat leaves showing no background FITC fluorescence in leaf epidermal and mesophyll cells. Fig. l6B) Confocal microscopy images of leaf mesophyll cells treated with FITC, ZnHA-FITC, GdHA-FITC, and FeHA-FITC nanoparticles. Scale bar = 10 pm. Fig. l6C) fluorescence intensity analysis of FITC tagged nanoparticles indicating an order of magnitude stronger FITC signal in leaf epidermal cells relative to mesophyll cells (n = 3) (p <0.0001, * p < 0.05, ** p = 0.005, *** p = 0.0005). Data represent means and error standard deviations. Statistical analysis using two-way ANOVA and post-hoc Sidak’s multiple comparison test.

[0032] Figure 17. Scanning electron microscopy (SEM) images of the wheat leaf surface after simulated rainfall events in the laboratory. The SEM images of controls (without nanoparticles) and ZnHA, FeHA and ZnHAU, FeHAU nanoparticles showing attachment to wheat leaf cuticle after low (10 mm), moderate (30 mm), and high (50 mm) simulated rainfall events. Scale bar = 30 pm.

[0033] Figures 18A-18B. Biocompatibility assessment of hydroxyapatite nanoparticles.

[0034] Confocal images depicting wheat leaf mesophyll, with dead cell nuclei highlighted in red due to staining by propidium iodide, along with chloroplasts (magenta). Leaf samples were treated with Fig.18 A) ZnHAU, FeHAU, and Urea at 2-6% N dose, and Fig.l8B) ZnHA and FeHA nanoparticles at 0.5-50 mg / ml doses, in comparison to the controls (DI water, Silwet L-77 0.05 %). Scale bar = 50 pm.

[0035] Figure 19. Quantitative analysis of propidium iodide (PI) cell viability assay of leaf cells exposed to hydroxyapatite nanoparticles. Wheat leaf cell viability was quantified from confocal images of leaf samples treated with ZnHAU, FeHAU, and Urea at 2-6% N doses, as well as ZnHA and FeHA nanoparticles at 50 mg / ml, in comparison with control (DI water, Silwet L-77 0.05 %). Data represent mean and error standard deviations. Statistical analysis was performed using one-way ANOVA followed by post-hoc Dunnett’s multiple comparison test (n = 3) (* p <0.05, *** p <0.0005, **** p <0.0001).

[0036] Figure 20. Biocompatibility assessment of bare and nitrogen-loaded hydroxyapatite nanoparticles through chlorophyll content measurements (SPAD meter). SPAD values were measured for control (DI water, Silwet L-77 0.05 %), bare NPs (ZnHA, FeHA; 0.5 mg / ml - 50 mg / ml) and N formulations (ZnHAU, FeHAU, and Urea; 2- 6% N) at 7th and 14th day post treatment (DPT). Data represent means and errors standard deviations. Statistical analysis using two-way ANOVA and post-hoc Tukey’s multiple comparison test (n = 5).

[0037] Figures 21A-21B: Impact of the hydroxyapatite nanomaterials on GS / GOGAT N assimilation genes in wheat plants. RT-qPCR analysis of Fig.21A) TaGSl, and Fig.21B) TaFd-GOGAT genes fold change expression (normalized to UBIQUITIN) at 1, 3 and 7 days post foliar application of Urea, ZnHAU, FeHAU, ZnHA and FeHA under low N conditions. Data are shown as means ± standard deviations. Statistical analysis using two-way ANOVA and post-hoc Dunnett’s multiple comparison test (n = 3).

[0038] Figure 22. Average (Log) number of juveniles of Eisenia fetida in soils containing urea foliar (UF), FeHAP, and FeHAU treatments at 0, 56 or 112 kg N / ha. Controls are soils without urea or nanomaterials.

[0039] Figure 23. Principal Component Analysis based on the earthworm tissue concentrations of 23 trace-elements with Principal components axes 1 and 2. There was no clear differentiation by treatment.

[0040] DETAILED DESCRIPTION

[0041] Agriculture is the single largest cause of the dramatically distorted global nitrogen (N) cycle. Inefficient N delivery causes environmental pollution, soil degradation, and greenhouse gas emissions. Conventional practices of chemical fertilizers are inefficient where crop plants usually take up less than 50% of the applied N. Urea-N experiences rapid dissolution, transformation, and atmospheric loss, particularly in extreme weather conditions. The rapid absorption of excessive urea and transformation into ammonium ions can lead to toxicity in plant tissues. Described herein includes methods for delivery (e.g., foliar delivery) of fertilizer nanoparticles, and new fertilizer nanoparticles that allow sustained release of nitrogen and more efficient N delivery and utilization.

[0042] Accordingly, certain embodiments of the invention provide a nanoparticle, comprising Zn doped hydroxyapatite, or Fe (III) doped hydroxyapatite.

[0043] In certain embodiments, the nanoparticle comprises Fe (III) doped hydroxyapatite. In certain embodiments, the nanoparticle consists of Fe (III) doped hydroxyapatite. In certain embodiments, the nanoparticle consists essentially of Fe (III) doped hydroxyapatite.

[0044] In certain embodiments, the nanoparticle comprises Zn doped hydroxyapatite. In certain embodiments, the nanoparticle consists of Zn doped hydroxyapatite. In certain embodiments, the nanoparticle consists essentially of Zn doped hydroxyapatite.

[0045] The term “Hydroxyapatite” as used herein refers to calcium phosphate crystal having the chemical formula Caio(P04)e(OH)2 or CaslPCkMOH). Thus, hydroxyapatite has a calcium to phosphate molar ratio of 5:3.

[0046] The term “Zn or Fe (III) doped hydroxyapatite” as used herein refers to a form of hydroxyapatite that comprises Zn or Fe (III) ion within the hydroxyapatite crystal, wherein Calcium is partially replaced by Zinc or Iron (III) ion within the crystal. For example, Fe (III) ion is comprised within the basic crystal unit, lattice, or backbone of Fe (III) doped hydroxyapatite. As a result, the calcium to phosphate molar ratio in Fe (III) doped hydroxyapatite is lower than the 5:3 molar ratio of Hydroxyapatite due to the incorporation of Fe (III) within the crystal.

[0047] In certain embodiments, the doped hydroxyapatite has a Zn or Fe (III) doping percentage (mass) of about 0.5% to 10%. In certain embodiments, the doped hydroxyapatite has a Zn or Fe (III) doping percentage (mass) of about 1% to 8%. In certain embodiments, the doped hydroxyapatite has a Zn or Fe (III) doping percentage (mass) of about 2% to 6%. In certain embodiments, the doped hydroxyapatite has a Zn or Fe (III) doping percentage (mass) of about 2% to 4%. In certain embodiments, the doped hydroxyapatite has a Zn or Fe (III) doping percentage (mass) of about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. In certain embodiments, the doped hydroxyapatite has a Zn or Fe (III) doping percentage (mass) of about 2% to 3%.

[0048] The term “doping percentage” as used herein refers to the mass percentage of the element Zn or Fe (III) in the doped hydroxyapatite nanoparticle. For example, the Fe (III) doping percentage is calculated by dividing mass of ferric ion (Fe (III)) over the total mass of Fe (Ill)-doped hydroxyapatite nanoparticle.

[0049] In certain embodiments, the nanoparticle further comprises urea, wherein urea is bonded to the Zn or Fe (III) doped hydroxyapatite.

[0050] The term “Zn or Fe (Ill)-doped hydroxyapatite nanoparticle loaded with urea” (such as ZnHAU or FeHAU) refers to Zn or Fe (Ill)-doped hydroxyapatite nanoparticle wherein urea is bonded to the Zn or Fe (Ill)-doped hydroxyapatite. Without wanting to be bound by theory, in certain embodiments, urea may be bonded to Zn or Fe (Ill)-doped hydroxyapatite nanoparticle surface, 1) through hydrogen bonding (e.g., between phosphate group and urea), 2) through metal-ligand interaction (e.g., Calcium-urea, and / or Fe (Ill)-urea interaction, wherein N atoms of urea may have weak coordination interaction with Ca and / or Fe (III)), and / or 3) through electrostatic interaction.

[0051] The term “nitrogen loading” as used herein refers to the mass percentage of the element Nitrogen in a nanoparticle such as Zn or Fe (Ill)-doped hydroxyapatite urea loaded nanoparticle. For example, the nitrogen loading of urea loaded Fe (Ill)-doped hydroxyapatite nanoparticle is calculated by dividing mass of element Nitrogen over total mass of urea loaded Fe (Ill)-doped hydroxyapatite nanoparticle.

[0052] In certain embodiments, the nanoparticle comprises Fe (III) doped hydroxyapatite loaded with urea. In certain embodiments, the nanoparticle consists of Fe (III) doped hydroxyapatite loaded with urea. In certain embodiments, the nanoparticle consists essentially of Fe (III) doped hydroxyapatite loaded with urea.

[0053] In certain embodiments, the nanoparticle comprises Zn doped hydroxyapatite loaded with urea. In certain embodiments, the nanoparticle consists of Zn doped hydroxyapatite loaded with urea. In certain embodiments, the nanoparticle consists essentially of Zn doped hydroxyapatite loaded with urea.

[0054] In certain embodiments, the nanoparticle has a nitrogen (N) loading percentage (mass) of about 10%-40%. In certain embodiments, the nanoparticle has a nitrogen (N) loading percentage (mass) of about 15%-35%. In certain embodiments, the nanoparticle has a nitrogen (N) loading percentage (mass) of about 20%-30%. In certain embodiments, the nanoparticle has a nitrogen (N) loading percentage (mass) of about 22%-28%. In certain embodiments, the nanoparticle has a nitrogen (N) loading percentage (mass) of about 23%-27%. In certain embodiments, the nanoparticle has a nitrogen (N) loading percentage (mass) of about 23.5% or 26%.

[0055] The term “nanoparticle” refers to a particle that has the longest dimension that is greater than Inm but smaller than lOOOnm.

[0056] In certain embodiments, the nanoparticle has a hydrodynamic diameter of about 30- 600nm. In certain embodiments, the nanoparticle has a hydrodynamic diameter of about 100- 400nm. In certain embodiments, the nanoparticle has a hydrodynamic diameter of about 150- 350nm. In certain embodiments, the nanoparticle has a hydrodynamic diameter of about 160- 330nm. In certain embodiments, the nanoparticle has a hydrodynamic diameter of about 180- 300nm. In certain embodiments, the nanoparticle has a hydrodynamic diameter of about 200- 260nm.

[0057] In certain embodiments, the nanoparticle (e.g., FeHA or FeHAU) is an elongated nanoparticle (e.g., rod or spindle shaped). In certain embodiments, the elongated nanoparticle has an aspect ratio of about 5-12. In certain embodiments, the nanoparticle has an aspect ratio of about 6-11. In certain embodiments, the nanoparticle has an aspect ratio of about 7-10. In certain embodiments, the nanoparticle has an aspect ratio of about 8. In certain embodiments, the nanoparticle has an aspect ratio of about 6.

[0058] In certain embodiments, the nanoparticle has a length of about 120-250nm. In certain embodiments, the nanoparticle has a length of about 130-240nm. In certain embodiments, the nanoparticle has a length of about 140-230nm. In certain embodiments, the nanoparticle has a length of about 150-220nm. In certain embodiments, the nanoparticle has a length of about 160- 210nm. In certain embodiments, the nanoparticle has a length of about 170-200nm. In certain embodiments, the nanoparticle has a length of about 190nm.

[0059] In certain embodiments, the nanoparticle has a width of about 20-30nm. In certain embodiments, the nanoparticle has a width of about 22-28nm. In certain embodiments, the nanoparticle has a width of about 23-27nm.

[0060] In certain embodiments, the nanoparticle (e.g., FeHA or FeHAU) comprises doped hydroxyapatite having a crystallite size (based on 002 plane of XRD) of about 30-40nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 31 -39nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 30-33nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 3 Inm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 36-39nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 38nm.

[0061] In certain embodiments, the nanoparticle (e.g., ZnHA or ZnHAU) comprises doped hydroxyapatite having a crystallite size of about 20-29nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 20-28nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 20-23nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 20nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 25-28nm. In certain embodiments, the doped hydroxyapatite has a crystallite size of about 27nm.

[0062] In certain embodiments, the nanoparticle has a C, potential of about -1 to -15 mV. In certain embodiments, the nanoparticle has a C, potential of about -1 to -3 mV. In certain embodiments, the nanoparticle has a C, potential of about -1 to -2 mV. In certain embodiments, the nanoparticle has a C, potential of about -10 to -15 mV. In certain embodiments, the nanoparticle has a C, potential of about -12 to -15 mV. In certain embodiments, the nanoparticle has a C, potential of about -11 to -13 mV.

[0063] In certain embodiments, the Fe (III) doped hydroxyapatite has a calcium to Fe (III) molar ratio of about 4: 1 to 30: 1. In certain embodiments, the Fe (III) doped hydroxyapatite has a calcium to Fe (III) molar ratio of about 5: 1 to 27: 1. In certain embodiments, the Fe (III) doped hydroxyapatite has a calcium to Fe (III) molar ratio of about 10: 1 to 25: 1. In certain embodiments, the Fe (III) doped hydroxyapatite has a calcium to Fe (III) molar ratio of about 15: 1 to 20: 1. In certain embodiments, the Fe (III) doped hydroxyapatite has a calcium to Fe (III) molar ratio of about 16: 1 to 19: 1. In certain embodiments, the Fe (III) doped hydroxyapatite has a calcium to Fe (III) molar ratio of about 17: 1 to 18: 1.

[0064] In certain embodiments, the Zn doped hydroxyapatite has a calcium to Zn molar ratio of about 4: 1 to 30: 1. In certain embodiments, the Zn doped hydroxyapatite has a calcium to Zn molar ratio of about 5: 1 to 27: 1. In certain embodiments, the Zn doped hydroxyapatite has a calcium to Zn molar ratio of about 10: 1 to 25: 1. In certain embodiments, the Zn doped hydroxyapatite has a calcium to Zn molar ratio of about 15: 1 to 20: 1. In certain embodiments, the Zn doped hydroxyapatite has a calcium to Zn molar ratio of about 16: 1 to 19: 1. In certain embodiments, the Zn doped hydroxyapatite has a calcium to Zn molar ratio of about 17: 1 to 18: 1.

[0065] In certain embodiments, the Zn or Fe (III) doped hydroxyapatite has chemical formula Ca5-XMX(PO4)3(OH), wherein M is Zn or Fe (III), and x is a number that is 0.15 < x < 1. In certain embodiments, M is Fe (III). In certain embodiments, 0.15 < x < 0.6. In certain embodiments, 0.2 < x < 0.8. In certain embodiments, 0.2 < x < 0.5. In certain embodiments, 0.2 < x < 0.3.

[0066] One skilled in the art would understand that in addition to bonding with urea, the nanoparticles described herein (e.g., FeHA or FeHAU) may also be functionalized by additional agent(s). As a non-limiting example for illustration purpose, the nanoparticles comprising doped-hydroxyapatite as described herein may be modified with sialylation reaction (e.g., mediated by the interaction between phosphate and silane groups, such as using APTES (3- aminopropyltriethoxysilane)) for conjugation with other agent(s).

[0067] The nanoparticles described herein may be made according to the methods described herein (e.g., in Example 1). For example, in certain embodiments, about 0.08M-0.99M (e.g., 0.08M-0.099M or 0.09M-0.098M, such as 0.095M) calcium hydroxide and 0.001M-0.2M (e.g., 0.001M-0.02M or 0.002M-0.01M, such as 0.005M) iron (III) chloride is mixed, e.g., for two hours at a solution temperature of about 50 °C, and subsequently 0.03M-0.9M (e.g., 0.03M- 0.09M or 0.04M-0.08M, such as 0.06M) phosphoric acid is added dropwise to the solution. In certain embodiments, 0.08M calcium hydroxide and 0.02M iron (III) chloride is mixed. In certain embodiments, 0.085M calcium hydroxide and 0.015M iron (III) chloride is mixed. In certain embodiments, 0.09M calcium hydroxide and 0.01M iron (III) chloride is mixed. In certain embodiments, 0.095M calcium hydroxide and 0.005M iron (III) chloride is mixed. In certain embodiments, 0.098M calcium hydroxide and 0.002M iron (III) chloride is mixed. In certain embodiments, 0.099M calcium hydroxide and 0.001M iron (III) chloride is mixed. In certain embodiments, 0.80M calcium hydroxide and 0.2M iron (III) chloride is mixed. In certain embodiments, 0.85M calcium hydroxide and 0.15M iron (III) chloride is mixed. In certain embodiments, 0.90M calcium hydroxide and 0.10M iron (III) chloride is mixed. In certain embodiments, 0.95M calcium hydroxide and 0.05M iron (III) chloride is mixed. In certain embodiments, 0.98M calcium hydroxide and 0.02M iron (III) chloride is mixed. In certain embodiments, 0.99M calcium hydroxide and 0.01M iron (III) chloride is mixed. For urea loaded nanoparticles, 0.01M to 6M urea (e.g., 0.1M-4M, such as 3M urea) may be added into the mixture of calcium hydroxide and iron (III) chloride.

[0068] In certain embodiments, about 0.08M-0.99M (e.g., 0.08M-0.099M or 0.09M-0.098M, such as 0.095M) calcium hydroxide and 0.001M-0.2M (e.g., 0.001M-0.02M or 0.002M-0.01M, such as 0.005M) zinc sulfate is mixed, e.g., for two hours at a solution temperature of about 50 °C, and subsequently 0.03M-0.9M (e.g., 0.03M-0.09M or 0.04M-0.08M, such as 0.06M) phosphoric acid is added dropwise to the solution. In certain embodiments, 0.08M calcium hydroxide and 0.02M zinc sulfate is mixed. In certain embodiments, 0.085M calcium hydroxide and 0.015M zinc sulfate is mixed. In certain embodiments, 0.09M calcium hydroxide and 0.01M zinc sulfate is mixed. In certain embodiments, 0.095M calcium hydroxide and 0.005M zinc sulfate is mixed. In certain embodiments, 0.098M calcium hydroxide and 0.002M zinc sulfate is mixed. In certain embodiments, 0.099M calcium hydroxide and 0.00 IM zinc sulfate is mixed. In certain embodiments, 0.80M calcium hydroxide and 0.2M zinc sulfate is mixed. In certain embodiments, 0.85M calcium hydroxide and 0.15M zinc sulfate is mixed. In certain embodiments, 0.90M calcium hydroxide and 0.10M zinc sulfate is mixed. In certain embodiments, 0.95M calcium hydroxide and 0.05M zinc sulfate is mixed. In certain embodiments, 0.98M calcium hydroxide and 0.02M zinc sulfate is mixed. In certain embodiments, 0.99M calcium hydroxide and 0.01M zinc sulfate is mixed. For urea loaded nanoparticles, 0.01M to 6M urea (e.g., 0.1M-4M, such as 3M urea) may be added into the mixture of calcium hydroxide and zinc sulfate.

[0069] Compositions

[0070] Certain embodiments of the invention provide a composition comprising a nanoparticle described herein and a carrier, such as an agriculturally acceptable carrier (e.g., water for liquid composition, or cryoprotectant, lyoprotectant or bulking agent for freeze-dried composition). In certain embodiments, the composition further comprises a surfactant (e.g., nonionic surfactant such as Silwet® L-77).

[0071] In certain embodiments, the composition is a liquid. In certain embodiments, the composition is a solid (e.g., powder). In certain embodiments, the composition is in a lyophilized form and can be readily reconstituted into liquid form before use.

[0072] In certain embodiments, the composition is a liquid that has a pH of about 6-8. In certain embodiments, the composition is a liquid that has a pH of about 6.8-7.6. In certain embodiments, the composition is a liquid that has a pH of about 6.5-7.3.

[0073] In certain embodiments, the composition has a nanoparticle concentration of about 0.1 - 100 mg / mL. In certain embodiments, the composition has a nanoparticle concentration of about 0.5 - 50 mg / mL. In certain embodiments, the composition has a nanoparticle concentration of about 2 - 30 mg / mL. In certain embodiments, the composition has a nanoparticle concentration of about 4 - 21 mg / mL.

[0074] In certain embodiments, the composition further comprises one or more additional macronutrient (e.g., potassium, or sulfur) or micronutrient (e.g., boron, chlorine, molybdenum). For example, in certain embodiments, the composition further comprises potassium sulfate, or potassium chloride.

[0075] Methods

[0076] Certain embodiments of the invention provide a method of nutrient (e.g., including, but not limited to, Ca, P, N, Fe (III), and / or Zn) delivery to a plant, comprising introducing to the plant a nanoparticle as described herein. For example, in certain embodiments, the nanoparticle comprises Fe (III) doped hydroxyapatite. In certain embodiments, the nanoparticle comprises Zn doped hydroxyapatite. In certain embodiments, the nanoparticle is a urea loaded Fe (III) doped hydroxyapatite nanoparticle that comprises Fe (III) doped hydroxyapatite and urea that is bonded to the Fe (III) doped hydroxyapatite. In certain embodiments, the nanoparticle is a urea loaded Zn doped hydroxyapatite nanoparticle that comprises Zn doped hydroxyapatite and urea that is bonded to the Zn doped hydroxyapatite.

[0077] The terms "introduce" and "introduction" refers to contacting a plant, or a portion thereof, either directly or indirectly with an agent (e.g, a nanoparticle or composition described herein). For example, an agent may be directly applied to the plant, or a portion thereof (e.g, leaf) and / or indirectly applied to the surrounding ecosystem adjacent to the plant (e.g., air or soil).

[0078] In certain embodiments, the introducing comprises contacting the leaf of the plant with the fertilizer nanoparticle (for foliar delivery of the fertilizer nanoparticle) or a composition described herein. In certain embodiments, the nanoparticle is delivered to the leaf surface (e.g., spraying a liquid composition to the leaf). In certain embodiments, the nanoparticle is delivered to the leaf epidermis. In certain embodiments, the nanoparticle is delivered to the leaf epidermal cuticle. In certain embodiments, the nanoparticle is delivered to the apoplast of leaf epidermal cells. In certain embodiments, the nanoparticle is delivered to the cell membranes of leaf epidermal cells. In certain embodiments, the leaf has a higher concentration (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold higher) of nanoparticles in epidermal cells than in mesophyll cells.

[0079] In certain embodiments, the leaf of the plant is contacted with the nanoparticle, or a composition described herein at a time that is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks or more weeks after the seed germination of the plant (e.g., 2-week-old plant or older plant). In certain embodiments, the leaf of the plant is contacted with the nanoparticle, or a composition described herein at a time that is at least 5, 6, 7, 8, 9, 10, 11, or 12 weeks or more weeks after the seed germination of the plant (e.g., 5-week-old plant or older plant).

[0080] In certain embodiments, the urea from a urea loaded nanoparticle is released in the leaf epidermis. In certain embodiments, the urea is released in the acidic condition (e.g., pH 5.3-6, such as pH 5.8) of the apoplast.

[0081] Sustained release of urea may be achieved by the urea loaded nanoparticle and / or methods described herein. For example, at least 20%, 25%, 30%, or 35% of the delivered total urea is released in a sustained manner. In certain embodiments, the urea is released over a period of time greater than 6hrs, 12hrs, 24hrs, 48hrs, or 72hrs (e.g., 4, 5, 6, 7, 8, 9, 10 days, or longer). In certain embodiments, the urea is released over a period of time greater than 6hrs, 12hrs, 24hrs, or 48hrs. In certain embodiments, the urea is released over a period of time of about 6hrs, 12hrs, 24hrs, or 48hrs.

[0082] In certain embodiments, the nanoparticle adheres to the leaf surface. In certain embodiments, the nanoparticle adheres to the leaf epidermal cuticle, epidermal cell wall, and / or epidermal cell membrane.

[0083] In certain embodiments, more urea (e.g., after FeHAU nanoparticle foliar delivery) is retained in the leaf after rainfall by at least 10%, 20%, 30%, 40%, 50%, 60%, or more, as compared to a control urea delivery composition (e.g., free urea delivered at equivalent urea dose, or another urea loaded nanoparticle at equivalent urea dose). In certain embodiments, more urea (e.g., after FeHAU nanoparticle foliar delivery) is retained in the leaf after rainfall by at least 40%, 50%, or 60% as compared to a control urea delivery composition (e.g., free urea, or ZnHAU nanoparticle).

[0084] In certain embodiments, the plant produces fresh biomass (fresh weight) that is at least 10% (e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, or 210%) higher than a control plant contacted with free urea on leaf. In certain embodiments, the plant produces fresh biomass (fresh weight) that is at least 40%, 50%, or 60% higher than a control. In certain embodiments, the plant produces fresh biomass (fresh weight) that is at least 190%, 200%, or 210% higher than a control.

[0085] In certain embodiments, the plant produces dry biomass (dry weight) that is at least 10% (e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, or 160%) higher than a control plant contacted with free urea on leaf. In certain embodiments, the plant produces dry biomass (dry weight) that is at least 40%, 50%, or 60% higher than a control. In certain embodiments, the plant produces dry biomass (dry weight) that is at least 120%, 140%, or 160% higher than a control.

[0086] In certain embodiments, the height of the plant is increased by at least 3% (e.g., 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%) higher than a control plant contacted with free urea on leaf.

[0087] Nitrogen uptake by plant may be enhanced by nanoparticle and methods described herein. For example, as compared to foliar applied conventional urea fertilizer (e.g., free urea), such as under low N conditions, N uptake is enhanced by foliar application of urea loaded nanoparticle described herein. In certain embodiments, nitrogen uptake (N uptake) in plant leaf is increased by at least 10% (e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 110%) higher than that of a control plant contacted with free urea on leaf. In certain embodiments, nitrogen uptake (N uptake) in plant leaf is increased by at least 60%. In certain embodiments, nitrogen uptake (N uptake) in plant leaf is increased by at least 80%. In certain embodiments, nitrogen uptake (N uptake) in plant leaf is increased by at least 100%.

[0088] In certain embodiments, the nanoparticle is delivered to the plant leaf at a Nitrogen dose of about l%-6% (i.e., 10-60 mg / mL of nitrogen or 21.74 - 130.4 mg / ml urea). In certain embodiments, the nanoparticle is delivered to the plant leaf at a Nitrogen dose of about l%-5% (i.e., 10-50 mg / mL of nitrogen or 21.74 - 108.7 mg / ml urea). In certain embodiments, the nanoparticle is delivered to the plant leaf at a Nitrogen dose of about l%-4% (i.e., 10-40 mg / mL of nitrogen or 21.74 - 86.95 mg / ml urea). In certain embodiments, the nanoparticle is delivered to the plant leaf at a Nitrogen dose of about 2% (i.e., 20 mg / ml of N or 43.47 mg / ml Urea). In certain embodiments, the nanoparticle is delivered to the plant leaf at a Nitrogen dose of about 3% (i.e., 30 mg / ml N or 65.2 mg / ml Urea). In certain embodiments, the nanoparticle is delivered to the plant leaf at a Nitrogen dose of about 4%. In certain embodiments, the nanoparticle is delivered to the plant leaf at a Nitrogen dose of about 5%. In certain embodiments, the nanoparticle is delivered to the plant leaf at a Nitrogen dose of about 6%.

[0089] In certain embodiments, the method described herein (e.g., method of multi-nutrient delivery, including, but not limited to, Ca, P, N, Fe (III), and / or Zn) further comprises introducing one or more additional macronutrient (e.g., potassium, or sulfur) or micronutrient (e.g., boron, chlorine, molybdenum) to the plant. For example, in certain embodiments, the method further comprises introducing potassium sulfate or potassium chloride to the plant.

[0090] The invention will now be illustrated by the following non-limiting Examples.

[0091] Example 1. Controlled Nitrogen Release by Hydroxyapatite Nanoparticles in Leaves Enhances Plant Growth and Nitrogen uptake.

[0092] Nitrogen fertilizer delivery inefficiencies limit crop productivity and contribute to environmental pollution. Herein, we developed Zn and Fe-doped hydroxyapatite nanoparticles (ZnHAU, FeHAU) loaded with urea (-26% N) through hydrogen bonding and metal-ligand interactions. The nanoparticles attach to the leaf epidermal cuticle and localize in the apoplast of leaf epidermal cells triggering a slow N release at acidic conditions (pH 5.8) that promotes wheat (Triticum aestivum) growth and increased N uptake compared to conventional urea fertilizers. The ZnHAU and FeHAU exhibited prolonged N release compared to urea in model plant apoplast fluid pH in vitro (up to two days) and in leaf membranes in plants (up to ten days), with a high 32% and 52.8% N retention, respectively, under simulated high rainfall events (50 mm). Foliar N delivery doses up to 4% as ZnHAU and FeHAU did not induce toxicity in plant cells. The foliar applied ZnHAU and FeHAU enhanced fresh and dry biomass by -214% and -161%, and N uptake -108% compared to foliar applied urea under low soil N conditions in greenhouse experiments. Controlled N release by leaf-attached nanoparticles improves N delivery and use efficiency in crop plants, creating nanofertilizers with reduced environmental impacts of agriculture.

[0093] Introduction

[0094] Agriculture is the single largest cause of the dramatically distorted global nitrogen (N) cycle. Anthropogenic sources of reactive N for crop production in the U.S. are four times larger than natural sources from biological N fixation1>2. A key challenge of this century is to transition to more sustainable agricultural practices, particularly for N fertilizer delivery and use — an essential element for plant growth and productivity1>3. Inefficient N delivery causes environmental pollution, soil degradation, and greenhouse gas emissions4’5. Conventional practices of chemical fertilizers are inefficient where crop plants usually take up less than 50% of the applied N6, with a significant fraction released as gaseous N2O emissions, leached as NO3 to groundwater, or carried via drainage pipes to surface water7. The efficient application of these fertilizers not only affects the immediate agricultural ecosystem but also has far-reaching impacts on the ecosphere8 l 0. A mere 1% reduction in N use efficiency is estimated to increase the global cost of crop production by approximately $1.1 billion annuallyn. Standing at the crossroads of agricultural and environmental sustainability, it is imperative to develop innovative strategies for N delivery that can lower both the cost of food production and adverse effects of traditional fertilizer practices.

[0095] Conventional N fertilizers are typically applied to the soil, a practice often associated with poor use efficiency and N losses1>12. Foliar delivery may be an alternative to address nutrient deficiencies and provide additional nutrients during critical growth stages13,14Foliar application may offer a rapid means of nutrient absorption, circumventing potential soil barriers and enhancing nutrient use efficiency in crops. The integration of foliar delivery into a comprehensive soil fertility program presents an alternative strategy to plant nutrition14,15. Recently, the convergence of nanotechnology and agriculture has offered innovative solutions to address critical challenges in global food security and sustainable crop production16,17Nanomaterials may offer tunable physical and chemical properties that facilitate attachment, uptake, retention, and targeted release of nutrients in plant leaves18,19. Urea-N experiences rapid dissolution, transformation, and atmospheric loss, particularly in extreme weather conditions h The rapid absorption of excessive urea and transformation into ammonium ions can lead to toxicity in plant tissues20. Nanoparticles (NPs) have been explored as potential carriers for N, stabilizing and shielding it from environmental factors such as volatilization and denitrification21 23. N delivery directly near or at the site of assimilation in plants (i.e. chloroplasts in leaves) may enhance overall nutrient utilization efficiency. By improving foliar N uptake efficiency, nanomaterials may reduce the need for excessive fertilizer application in soil, thereby minimizing the environmental impacts associated with N runoff and leaching18,22.

[0096] Products marketed forN delivery as nano-nutrients or through a nano-carrier require more evidence to support their use in agriculture24The product 'Nano urea' was proclaimed to be the world's first government-approved nanofertilizer, launched by IFFCO, India in 202225. Nano urea or Nano N refers to a urea-based fertilizer formulated in nanoscale dimensions (20-50 nm), with spherical to rod-shaped particles produced when urea interacts with a 50-500 nm glucose polymer at elevated temperatures24 26. Nano urea was reported to be taken up by plant leaves, stored in vacuoles in plant cells, and subsequently reduce required N application rates by 50%, while increasing crop yield by 8%25,27,28. Similarly, 'NanoN+', a product of a US-based company AquaYield, has been described as porous silica NPs (50-100 nm) loaded with nutrients through ion exchange, and entering plant cells through endocytosis to deliver nutrients. However, there is a lack of peer-reviewed studies regarding N delivery efficacy in field trials, morphological or structural analyses, dissolution, foliar uptake mechanisms, nano-bio interaction chemistry, and the manufacturing cost of nano based N delivery products24,29. To our knowledge, there are no previous mechanistic studies of nanoparticle mediated improvement of N foliar delivery, plant growth and N use.

[0097] Reducing N inputs in agriculture has been a significant challenge, and to our knowledge, no study has demonstrated controlled foliar delivery of biocompatible nanofertilizers within leaf tissues. Our work provides a comprehensive examination of the rational design and development of N-loaded Fe- and Zn-doped hydroxyapatite nanomaterials as nanofertilizers for controlled foliar release. Hydroxyapatite (HA) NPs are made of the plant nutrients phosphorus and calcium in their backbone (Caio(P04)e(OH)2), making them a potential candidate for nutrient delivery into plants30. Hydroxyapatite-based NPs offer tailored surface-functionalization, controlled dissolution and reprecipitation, and can undergo ion exchange with surrounding fluids, leading to the release or uptake of ions31 33. These NPs may be doped to customize certain properties, such as nutrient loading and release rates, mechanical properties, and dissolution rate34,35. Our previous research on doped HA demonstrated their ability to load up to -40% N, sustain release in soil over 42 days, and improve N uptake, biomass, crop yield, and reduced ammonia volatilization when applied in the soil21,22,36. HA retained N in the soil for up to two consecutive crop cycles, reduced N leaching, and improved N use efficiency in crops in field trials21. This previous work focused on soil delivery of HANPs21,22,36without exploring their potential for controlled foliar release of plant nutrients.

[0098] In this Example, we demonstrate pH-controlled release of N within the acidic environment of leaf epidermis cell walls of wheat plants through the foliar application of N-loaded Zn or Fe- doped hydroxyapatite nanoparticles (Figure 1). We characterized the hydrogen bonding and metal-ligand interactions of urea molecules with the surface of Zn or Fe-doped HA NPs. We investigated the uptake and internalization of foliar-applied HA NPs in wheat leaf epidermal and mesophyll cells by confocal microscopy and ICP-MS. The pH triggered N release by the NPs was assessed in pH simulated apoplastic fluid and under foliar formulation conditions. We also examined the ability of HA NPs to adhere to the wheat leaf surface and retain N through rainfastness assays, simulating low, moderate, and high rainfall events. Rainfastness efficiency of foliar nano-fertilizers also ensures their optimal nutrient absorption, efficacy, environmental sustainability, and economic viability37,38. ZnHAU and FeHAU NPs can retain urea through electrostatic interactions allowing for extended release of N, helping to mitigate excessive absorption of urea and preventing damage to plant leaves. Biocompatibility of nano-fertilizers is also crucial as it determines the extent to which these nanomaterials can interact with living organisms, particularly plants and the surrounding environment, without causing adverse effects16,18The biocompatibility of NPs as nano-fertilizer was assessed by cell death, chlorophyll content assays, and gene expression analysis of N assimilation genes. Finally, we investigated the N delivery efficiency and use of foliar-applied HA NPs under N-deficient soil conditions and compared it with foliar-applied urea.

[0099] Aligning N availability with the wheat crop's peak demand is crucial for ensuring optimum crop yield39. ZnHAU and FeHAU can provide adequate nitrogen supply during periods of peak nitrogen demand in crops, as well as in situations with limited nitrogen availability40,41. Our novel nanomaterial design, incorporating iron (Fe3+) HA, introduced a more positive charge distribution, enhancing attachment to the negatively charged leaf cell surface, and the high aspect ratio of Fe- doped HA NPs facilitates delivery to the plant cell apoplast where pH-controls N release near the sites of N assimilation in leaf cell chloroplasts. In addition, the adherence of these NPs to plant leaf surfaces (cuticle) and membranes (cell wall) can reduce N loss under high rainfall conditions acting as agrochemical adjuvants for controlled N delivery in plants. By addressing the pitfalls of rapid N leaching and volatilization from urea, nano-enabled controlled delivery of N in crop plants has the potential to transform current agrochemical use practices, contributing to a more sustainable and resilient future.

[0100] Results and Discussion

[0101] Synthesis and characterization of nanoparticles

[0102] The hydroxyapatite nanoparticles were doped with Zn or Fe (ZnHA, FeHA) and loaded with urea as a source of N (ZnHAU, FeHAU) through a wet chemical synthesis approach21,22. Gadolinium (Gd)-doped hydroxyapatite NPs (GdHA) and FITC tagged NPs (ZnHA-FITC, GdHA-FITC, and FeHA-FITC) were also synthesized to probe the fundamental interactions of the NPs with plant leaf surfaces and cells through elemental analysis (ICP-MS) and confocal microscopy. The doping percentages of Zn, Gd, and Fe in ZnHA, GdHA, and FeHA NPs were 2.6 ± 0.06%, 4.8 ± 0.03%, and 3.0 ± 0.09%, respectively (Figure 6A). The ZnHAU and FeHAU NPs exhibited N loading of 26.9 ± 2.1% and 23.5 ± 1.3%, respectively (Figure 6B). Scanning transmission electron microscopy with elemental analysis by energy dispersive spectroscopy (STEM-EDS) confirmed the loading of N within the ZnHAU and FeHAU particles (Figure 7A- 7B). In the FeHA particles, STEM-EDS analysis also detected the presence of a small amount of iron rich particles (Figure 7C), corresponding to the presence of a red pellet when the particles are centrifuged. The hydrodynamic diameter of N (ZnHAU, FeHAU; 217 ± 29 nm, 233.8 ± 41.1 nm, respectively) and FITC-loaded (ZnHA-FITC, GdHA-FITC, FeHA-FITC; 247.7 ± 53.2 nm, 228.8 ± 34.4 nm, 214 ± 44 nm, respectively) NPs was similar to the bare NPs (ZnHA, GdHA, FeHA; 203.5 ± 38 nm, 261.3 ± 5.8 nm, 249 ± 33.2 nm, respectively) (p > 0.05) (Figure 2A). Transmission electron micrographs (TEM) of the NPs revealed a rod or spindle shape and crystalline structure (Figure 2B, Figure 8A). Because the STEM-EDS analysis (Figure 7) was performed at higher magnification and acceleration potential than TEM analysis (Figure 2B), and also shown in HAADF mode, the HA NP morphology may appear slightly different due to the lower contrast in STEM-EDS compared to TEM. Furthermore, only parts of individual HA NPs are observed within the field of view of STEM-EDS analysis compared to whole NPs in TEM. The FeHA NPs (189.9 ± 61.3 nm) were significantly longer than both ZnHA (151.2 ± 54.4 nm) (p < 0.0001) and GdHA NPs (101.6 ± 32.7 nm) (p < 0.0001) (Figure 8B). In terms of width, ZnHA (25.1 ± 4.3 nm), ZnHAU (23.6 ± 5.5 nm), FeHA (23.74 ± 5.1 nm), and FeHAU (25.2 ± 4.6 nm) NPs were significantly wider than GdHA NPs (8.3 ± 2.9 nm) (p < 0.0001) (Figure 8C). The N-loaded ZnHAU and FeHAU NPs exhibited similar lengths and widths. Additionally, FeHA NPs (8.3 ± 3.2) had a higher aspect ratio than ZnHA nanoparticles (6.1 ± 2.4) (p < 0.0001) (Figure 8D). Notably, GdHA nanoparticles exhibited the highest aspect ratio recorded (13.5 ± 5.9), surpassing all other nanoparticles significantly. The smaller ionic radius of homovalent (Zn2+, 0.074 nm) and heterovalent (Fe3+, 0.065 nm; Gd3+, 0.094 nm) ions replace the calcium ions (Ca2+, 0.099 nm) in the hydroxyapatite crystal lattice during growth. These dopants, with their smaller radii and different electronic configurations, induce strain and distort the hydroxyapatite crystal lattice constant, resulting in NPs with varying lengths and widths. The replacement of Ca2+ions with heterovalent ions such as Fe3+and Gd3+in the hydroxyapatite crystal lattice distorts the lattice constant, potentially resulting in a higher aspect ratio than homovalence Zn2+ions34, 83.

[0103] The ZnHA, FeHA, and GdHA displayed similar X-ray diffraction (XRD) patterns, indicating only crystalline phase HA NPs (Figure 9). Therefore it is likely that any other putative iron particles present in the FeHA suspension were amorphous. Moreover, the crystallite size of FeHA was larger than that of ZnHA, corresponding to the length of NPs along the C axis, as was shown by TEM images42,43(Table SI). For materials synthesized in the presence of urea, the distinctive peaks of HA retained their position indicating no significant modifications in the HA structure. However, peaks attributed to urea were observed as well. Notably, for both ZnHA and FeHA, the synthesis in the presence of urea increased the crystallite size compared to the bare NPs.

[0104] Table SI: Crystallite size of 002 plane from X-ray diffraction (XRD) spectra of the hydroxyapatite nanoparticles. FeHAU, FeHA, ZnHAU, ZnHA, and GdHA nanoparticles crystallite size based on 002 plane.

[0105] The magnitude of the C, potential of ZnHA (-1.81 ± 0.33 mV) and FeHA (-0.84 ± 0.48 mV) significantly increased after loading urea to ZnHAU (-12.7 ± 2.43 mV) (p < 0.0001) and FeHAU (-13.41 ± 1.25 mV) (p < 0.0001) (Figure 2C). The neutral C, potential of bare ZnHA and FeHA resulted in NPs aggregation due to the absence of electrostatic stabilization44,45. The interaction of urea molecules on the nanoparticle surface increased the magnitude of the C, potential, resulting in an improved dispersion of ZnHAU and FeHAU compared to ZnHA and FeHA NPs. The FITC- loaded NPs have a similar C, potential to urea loaded counterparts (ZnHA-FITC, GdHA-FITC, FeHA-FITC; -9.22 ± 1.99 mV, -8.85 ± 0.70 mV, -12.57 ± 1.10 mV, respectively). The slight negative charge of urea loaded and FITC labeled NPs weakens nanoparticle aggregation due to electrostatic repulsion, but it is not sufficient to maintain a colloidal suspension for more than a few hours. This required the re-dispersion of the NPs by vortex or sonication before performing the nanoparticle-plant interaction experiments.

[0106] The FTIR analysis of ZnHAU and FeHAU revealed characteristic peaks of urea, including C-N (1456-62 cm-1), N-H (1592-93 cm-1), and C=O (1676-78 cm-1), confirming the interaction of urea molecules on the nanoparticle surface22,46(Figure 2D). The peak broadening and reduced intensity of PO43' (1020 cm-1) and O-P-O (950 cm-1) functional groups suggested hydrogen bond formation21,22. This implies that urea molecules could interact with the hydroxyapatite NPs at negatively charged sites or P sites of the crystal structure through hydrogen bonds. X-ray photoelectron spectroscopy (XPS) analysis unveiled peak shifts in the P 2p, Zn 2p, Fe 2p, N Is, and Ca 2p core levels, indicating the involvement of both metal-ligand interactions and hydrogen bonding between urea and (ZnHA / FeHA) NPs (Figure 2E-2F, Figure 10A-10H). XPS peak shifts (up to ~0.2 eV) towards higher binding energy in the N 1 s spectral core level (Figure 10C, Figure 10G) suggest a decrease in electron density and the formation of a metal ligand bond between urea and NPs (ZnHA / FeHA) involving N atoms47Conversely, peak shifts in the Zn 2p (ZnHAU, -0.2 eV), Fe 2p (FeHAU, -1.0 eV), and Ca 2p (ZnHAU, -0.1 eV) core levels towards lower binding energy indicated changes in electron density around Zn, Fe, and Ca atoms supporting the role of metal-ligand interactions (Figure 10B-10H). The N atoms in urea may function as Lewis bases, while Ca, Zn, and Fe atoms on the NPs may act as Lewis acids, facilitating weak coordination interactions47,48. The spectral shifts in P 2p core levels (-0.1 eV) indicate increased electronic density and the formation of a hydrogen bond between urea and the phosphate group of NPs (ZnHA / FeHA). Overall, the analysis of FTIR and XPS data suggests that hydrogen bonding and metal-ligand interactions are dominant bonding modes between urea and Zn or Fe-doped hydroxyapatite NPs22.

[0107] FTIR, absorbance, and fluorescence spectrophotometry analyses of FITC dye-tagged ZnHA (ZnHA-FITC), FeHA (FeHA-FITC), and GdHA (GdHA-FITC) confirmed the labeling of FITC on these NPs through covalent bonds (Figure 11, Figure 12A-12B, Figure 13). In addition, these FITC-tagged NPs did not exhibit a significant release of FITC for up to 96 hours in the aqueous formulation used for the plant-nanoparticle interaction studies (Figure 14). Therefore, FITC fluorescence in confocal microscopy images can be attributed to the NPs. Similarly, GdHA NPs showed Gd release levels of ~2% and ~5% after 24 and 72 hours, respectively, indicating their suitability for nanoparticle uptake experiments (Figure 15).

[0108] In vivo imaging of nanoparticles in plant leaves

[0109] The Zn, Gd, or Fe-doped hydroxyapatite NPs, labeled with FITC dye, were used to determine their distribution in wheat leaves after topical application to the leaf surface in a formulation containing 0.05% Silwet L-77 in deionized water (Figures 3A-3C). Manders' colocalization coefficient analysis49between FITC and FM4-64, a lipophilic dye that stains plasma membranes, was significantly higher in the epidermis treated with ZnHA-FITC (0.56 ± 0.14, p < 0.005), GdHA-FITC (0.53 ± 0.05, p < 0.005), and FeHA-FITC (0.63 ± 0.15, p < 0.001) compared to FITC-only treatments (0.12 ± 0.05) (Figure 3D). Topically applied NPs do not reach the leaf mesophyll cells as indicated by weak FITC fluorescence signals in mesophyll tissue (Figure 16A). Control leaves treated with 0.05% Silwet L-77 in deionized water did not show FITC background fluorescence signal (Figure 16B). The total fluorescence intensity of ZnHA- FITC, GdHA-FITC, and FeHA-FITC NPs was an order of magnitude higher in the epidermal cells compared to mesophyll cells (Figure 16C). Confocal microscopy analysis indicates that all three NPs enter wheat leaves through the leaf surface and preferentially localize in the epidermal cell membranes50,51. Our results in this Example demonstrate that hydroxyapatite NPs with diameters up to ~25 nm and lengths up to -190 nm can traverse the plant cell wall in the epidermal cells. Plant cell wall is an extracellular matrix composed of pectin, hemicellulose, and cellulose, that has been reported to allow the translocation of NPs having the smallest dimension below to 50 nm52 54. To gain further insights into the uptake and interaction of hydroxyapatite NPs with plant leaves, we topically applied GdHA NPs and quantified the presence of Gd on the leaf surface, cuticle and inner leaf tissues using ion coupled plasma mass spectrometry (ICP-MS) (Figure 3E)55. Approximately 88.4 ± 1.7 % of the NPs were embedded in the wheat leaf cuticle, while around 8.4 ± 2.5% entered the wheat leaf, whereas the remaining 3.2 ± 3.0% were attached on the leaf surface. Scanning electron microscopy (SEM) analysis also revealed that a significant fraction of NPs embedded in the leaf cuticular surface (Figure 3F) possibly either due to electrostatic interactions or their larger size or aggregation that inhibits penetration through the cuticle56. Confocal and ICP-MS analysis revealed that topical application of hydroxyapatite NPs results in penetration through the plant cuticle and cell walls barriers. These findings underscore the potential of hydroxyapatite-based NPs as nanocarriers for the controlled release of nutrients (e.g. nitrogen) inside the plant cell epidermis.

[0110] Controlled nitrogen release from nanoparticles in vitro and in planta

[0111] To evaluate controlled N release of HAU NPs, we performed DAM (diacetyl monoxime) based analysis of urea in simulated DI water at foliar spray formulation pH (pH ~6.8) and leaf apoplast fluid pH conditions (pH ~5.8). Pure urea released all N within an hour in both pH environments (Figure 4A). Density functional theory (DFT) indicates that urea and water interactions lead to the instability of urea dimers, inducing dissociation with an abundance of water molecules57. The dissolution of urea molecules in water is facilitated by differences in hydrogen bond energies, enabling urea molecules to fit into the hydrogen-bonded water structure58. In contrast, ZnHAU and FeHAU exhibited prolonged N release controlled by pH, lasting up to 240 h at pH 6.8 and over 48 h at pH 5.8 (Figure 4A). The NPs released approximately 67.7% (p < 0.0001) and 64.1% (p < 0.0001) of N, respectively, within the first hour in the foliar spray pH conditions (pH 6.8). Subsequently, they continued to release the remaining N slowly over ten days. Higher levels of urea molecules on the NP surface led to faster release into water followed by a release rate reduction as urea levels decrease. The bonding between urea and NPs strengthens when fewer urea molecules are present on the NPs. The NPs may contribute to an overall increase in the free energy of urea dissolution, thereby hindering urea's dissolution in water57,59. In the apoplast fluid pH environment (pH 5.8), ZnHAU and FeHAU released approximately 77.2% (p < 0.0001) and 57.4% (p < 0.0001) of N, respectively, in the first hour (Figure 4A). The FeHAU NPs lower N release in the first hour compared to ZnHAU at apoplastic pH can be attributed to stronger interactions between Fe atoms in the FeHAU lattice and N atoms in urea molecules indicated by the XPS analysis above. However, this Fe and N interaction is not sustained over time, as the acidic environment disrupts the weak coordination bonds between urea and the NPs, resulting in release of almost all bound urea (98.7% for ZnHAU and 99.2% for FeHAU) within 48 hours at pH 5.848.

[0112] We investigated the rainfastness efficiency of bare NPs (ZnHA, FeHA), as well as N from foliar-applied ZnHAU and FeHAU NPs, under simulated rainfall conditions of 10 mm (low), 30 mm (medium), and 50 mm (high) rainfall events in the laboratory (Figure 4B-4C, Figure 17). Rainfastness efficiency of foliar nano-fertilizers ensures optimal nutrient absorption, efficacy, environmental sustainability, and economic viability37, 38. FeHA NPs exhibit higher rainfastness compared to ZnHANPs. During low, medium, and high rainfall events, FeHA nanoparticles were retained at rates of 87.8% (p < 0.005), 76.5% (p < 0.001), and 66.3% (p < 0.001), respectively (Figure 4B). In contrast, ZnHA NPs exhibited retention percentages of 78%, 59.3%, and 43.2%, respectively. ZnHA and FeHA NPs may interact with the plant cuticle via hydrophobic interactions with cuticle aromatic compounds, which function as an electron-7t donor and form a bond between aromatic ring and HA surface60. Alternatively, ZnHA and FeHA NPs, featuring positively charged calcium (Ca2+), zinc (Zn2+), and iron (Fe3+) atoms on their surface, can potentially interact with the cuticular waxes of wheat plant leaves. These waxes enriched with aromatic (phenylpropanoids, polyphenols) and aliphatic (primary alcohols, fatty acids, and alkanes) compounds, are typically negatively charged, with exposed -OH functionality and hydrophobic properties61. The distribution of Fe3+atoms (heterovalent ion doping) throughout the hydroxyapatite nanoparticle surface may promote stronger interactions with the negatively charged leaf cuticle than ZnHA NPs, which have Zn2+atoms (horn oval ent ion doping)62,63. Similarly, FeHAU NPs exhibited significantly higher N retention than ZnHAU, during rainfall events. During low, medium, and high rainfall, we observed N retention of 81.8%, 70.3% (p < 0.05), and 52.7% (p < 0.05), respectively, from FeHAU NPs, compared to 82.2%, 50.4%, and 31.9%, respectively, from ZnHAU (Figure 4C). Overall, the FeHAU and ZnHAU NPs exhibit a strong urea retention and attachment to the wheat leaf membranes even under high rainfall conditions (50 mm).

[0113] Foliar N controlled delivery by ZnHAU and FeHAU NPs can be more efficient, cost- effective, environmentally sustainable, and stable compared to the use of pure urea fertilizers. Foliar application of N fertilizers results in a significant portion either rapidly absorbed or washed away64The foliar-applied unused N on the crop leaves is released into the environment through rainfall, foliar wash off, falling during spraying, hydrolysis, and volatilization into ammonia leading to environmental pollution37In contrast, FeHAU and ZnHAU NPs affixed to the leaf cuticles and lipid membranes gradually release -35% of the N applied, providing a prolonged nutrient supply to plants in normal weather conditions. During rainfall, the wet leaf surface and high humidity conditions facilitates the slower uptake of urea in the leaf tissues and their movement inside the leaf65,66. HAU NPs are promising candidates for enhancing N use efficiency in wheat plants while mitigating soil N pollution.

[0114] Impact on plant growth and nitrogen uptake

[0115] We hypothesized that ZnHAU and FeHAU NPs attached to the leaf surface membranes, release N controlled by pH, ensuring prolonged N availability for plant growth under low N dose conditions. We assessed the effect of N release from foliar-applied ZnHAU and FeHAU (- 4 - 21 mg / mL) relative to foliar applied urea on above ground plant fresh and dry weight, height, and leaf N uptake at two N doses of 30 mg (low) and 140 mg (adequate)67(Figure 5A-5D). N was initially supplied as urea in the soil across all treatments for the first three weeks. In the fifth week, N was applied via foliar spray using ZnHAU, FeHAU, and urea. In the low 30 mg N treatments, we observed a notable enhancement in wheat plant fresh and dry weight of 214.8 % (p < 0.009) and 141.4% (p < 0.05) for ZnHAU, and 207.7% (p < 0.009) and 161.9% (p < 0.009) for FeHAU, respectively, relative to urea controls (Figure 5A-5B). In the 140 mg N (adequate) treatments, there was also an improvement in wheat fresh and dry weight of 51.4% (p < 0.009) and 49.3% (p < 0.009) in ZnHAU, and 68.5% (p < 0.0001) and 65.2% (p = 0.0005) in FeHAU treatments, respectively, compared to urea treatments (Figure 5A-B). These results indicate that the foliar application of ZnHAU and FeHAU efficiently supplies N by controlling the release of urea by pH from NPs attached to the leaf membranes. The plant height of wheat plants treated with 30 mg and 140 mg N was significantly enhanced by 16.1% (p < 0.0001) and 4.6% (p < 0.009), respectively, in ZnHAU, and 16.3% and 7.1% in FeHAU (p < 0.0001) treatments compared to urea treatments (Figure 5C). Importantly, the delivery of N through NPs (ZnHAU or FeHAU) resulted in the highest improvement in plant height under low N conditions (30 mg N treatments). Similarly, N uptake in wheat leaves treated with ZnHAU and FeHAU increased to 88.3% (p = 0.009) and 108. 4% (p < 0.0005), respectively, compared to urea treatments at low 30 mg N rates (Figure 5D). However, there was no significant difference in N uptake among ZnHAU, and FeHAU and urea treatments at the (adequate) 140 mg N dose. The extended delivery of N through ZnHAU and FeHAU significantly improved N use efficiency in N-starved wheat plants. In comparison, foliar-applied urea could not be efficiently utilized by wheat plants, resulting in significantly lower N uptake than ZnHAU and FeHAU. Furthermore, wheat plants treated with foliar-applied ZnHA and FeHA NPs (-1.6 - 10.3 mg / mL) showed no significant differences in fresh and dry weight and N uptake compared to ZnHAU, and FeHAU, and urea treatments at either 30 mg or 140 mg N levels (Figure 5A-5B). Bare NPs only influenced wheat plant height under low 30 mg N treatments, whereas the improvements in plant biomass and N uptake were attributed to the N delivered by ZnHAU and FeHAU. The plant height of wheat plants treated with low 30 mg N was significantly enhanced by 13.3% (p < 0.0001) and 14.9% (p < 0.0001), respectively, in ZnHA and FeHA treatments compared to urea treatments. The plant height improvement in the bare NPs treatments under low N conditions may be attributed to either the added nutrients (Zn, Fe, P) in the NPs backbone or the low N stress tolerance responses by wheat plants68,69. Intriguingly, the additional nutrients did not impact plant biomass or N uptake, and the mechanisms underlying the release of these elements from NPs and their subsequent absorption by wheat remain unknown. In summary, ZnHAU and FeHAU NPs surpassed conventional urea by extending nitrogen availability, enhancing leaf nitrogen uptake under low nitrogen conditions, and promoting above-ground biomass, underscoring their potential for enhancing crop yield70.

[0116] Ensuring the biocompatibility of NPs with plants is essential for the successful integration of nano-fertilizers in agriculture and to harness the benefits of nanotechnology while minimizing the potential risks to plant health16. We evaluated the biocompatibility of bare ZnHA, FeHA, and urea loaded (2-6% N) ZnHAU and FeHAU NPs in wheat leaf tissues at a range of concentrations used in this study (0.5 - 50 mg / mL) in comparison with urea alone through propidium iodide (PI) staining of leaf dead cell nuclei (Figures 18-19) and measurements of chlorophyll content (Figure 20). N doses of up to 4% as ZnHAU or FeHAU did not affect cell viability relative to controls, thus are biocompatible for foliar application based on PI assays. In contrast, urea exhibited 5% lower cell viability relative to controls (p < 0.05) at a 4% N dose. However, foliar N application at a rate of 6% is toxic to wheat cells either in NP or urea form, resulting in approximately 93% (ZnHAU, p < 0.0005), 90% (FeHAU, p < 0.0001), and 87% (urea, p < 0.0001) viable leaf cells compared to control treatments (Figure 19). Similar doses of NPs without urea ranging from 0.5 to 50 mg / mL of ZnHA or FeHA did not induce leaf cell damage. Chlorophyll content can also be an indicator of NP effects on plant's photosynthesis, health and productivity71. Bare or urea loaded NPs up to a concentration of 50 mg / mL and N up to 6%, did not cause changes in chlorophyll content of wheat plant leaves during the two week experimental timeframe (Figure 20). Plants can adapt to high N foliar exposure through several potential mechanisms including the activation of stress-responsive genes, upregulation of N transporters, metabolic adjustments, and processes such as nitrate storage and assimilation72-75. We investigated the effects of HA NPs on the expression of GS / GOGAT related genes in wheat leaves involved in crucial metabolic process that facilitate N assimilation, converting inorganic N into amino acids84,85. RT-qPCR analysis showed that the mRNA fold changes of TaGSl and TaFd-GOGAT\n HANM-treated wheat leaves did not differ significantly from those treated with urea alone under low N conditions for up to a week (Figure 21), indicating that HA NPs, without N or that slowly release N, do not modify GS / GOGAT N assimilation pathways. Overall, we observed large increases in plant biomass and N uptake using either Zn or Fe doped HAU at ~ 4 - 21 mg / mL concentrations. In this NP concentration range, we determined that there is no cell damage indicated by PI assays and no effect on chlorophyll content. Furthermore, hydroxyapatite NPs can degrade in the environment upon exposure to lower pH or microbial and plant enzymes, releasing essential plant nutrients such as P, Ca, Fe, or Zn in the soil, plant, or on the leaf surface86,87Several previous studies have reported the biosafety of HA NPs in animals and humans, likely supporting their safe use in agriculture88 91. ZnHAU and FeHAU NP biocompatibility and improved N foliar release enhances plant growth and N uptake making them promising nanofertilizers for agricultural applications with reduced environmental pollution.

[0117] Conclusions

[0118] We demonstrated that engineered hydroxyapatite NPs (ZnHAU and FeHAU), carrying N cargo in the form of urea are able to attach to the leaf cuticle, enter plant cell barriers, reach the apoplast and epidermal cell boundaries, extending the release of N in plants controlled by pH. The N release from ZnHAU and FeHAU can be stimulated by external water application on the leaf surface. These strategies allow the prolonged N availability for plants, leading to improved N uptake and plant growth under both low and adequate N conditions. In contrast, foliar-applied urea is rapidly absorbed by the plant leaves, resulting in the instantaneous release of all N from excess urea. The excess urea either volatilizes in the form of carbon dioxide and ammonia or accumulates as ammonium and nitrate ions, leading to necrosis or leaf burning76,77. Our findings indicate the high N delivery potential of foliar-applied ZnHAU and FeHAU NPs compared to urea fertilizers.

[0119] Controlled release fertilizers could potentially tune nutrient supply with plant N demand during slow or fast growth or N deficiency conditions. Towards this goal, we developed HAU NPs that can be applied foliarly to boost plant biomass up -214% and N uptake by -108% compared to urea under low soil N conditions or at crop life stages that need higher N supply. Future research will aim to develop nanocarriers that deliver N where the plant needs it (sites of N assimilation e.g. chloroplasts) at the rate needed (slow or fast release on demand). Furthermore, HAU and the novel FeHAU NPs are highly biocompatible, made through easily scalable and cost- effective synthesis, and highly efficient in delivering N. Fe and P are key limiting nutrients for crop growth and yield in agriculture. Hydroxyapatite NPs showcase also a significant potential as a multinutrient carrier that can be tailored according to crop demand22,34Our synthesized materials successfully address a major challenge in agricultural technology of balancing optimal nanofertilizer properties with low production costs, scalability, high performance, and biocompatibility. Rational design approaches may also improve the colloidal stability of HA NPs. Although the slight negative charge of urea-loaded HA NPs weakens aggregation due to electrostatic repulsion, this can only maintain the colloidal suspension for several hours. For long term storage, these nanofertilizers could be stored as a wet pellet and re-dispersed before use.

[0120] This Example elucidates nanomaterial -mediated N nutrient delivery, with the ultimate goal of having a transformative impact on global food production. Our research emphasizes the need for more in-depth mechanistic studies to harness the full potential of HA NPs in precision agriculture and sustainable nutrient delivery systems. We gained insights into the interactions among urea, NPs, and plant leaves, exploring their extended release behavior controlled by pH while developing foliar N delivery methods that improve plant growth and N uptake. Future research may explore N nutrient delivery by HA NPs under certain field conditions and their impact on crop yields and the environment. In a single first field season trial using winter wheat, the preliminary data did not confirm nanoparticles increasing N use efficiency (defined as yield per unit N applied) or decreasing nitrate leaching or N2O emissions (data not shown, also see Pacheco Inoue, L, et al., (2024), additional field trial analysis is ongoing). The field study was conducted in Lexington, Kentucky during the 2023-2024 wheat growing season. The study evaluated foliar-applied iron hydroxyapatite nanoparticles containing urea along with soil -applied and foliar-applied urea at two rates (56 and 112 kg N ha'1). Although hydroxyapatite NPs have been reported to be safe88'91, there is a need for an in-depth understanding of the potential human health risks associated with hydroxyapatite-based nano-fertilizers. Nutrient-based nanocarrier technologies have the potential to pave the way for a more sustainable agriculture with reduced environmental impact to meet the demands for food production and security of a growing human population.

[0121] Material and Methods

[0122] Nanomaterial synthesis and characterization

[0123] The N-loaded and bare zinc-doped HA NPs were synthesized following our previous report with modifications21,22. For the synthesis of N-loaded zinc, or iron, or gadolinium-doped HA NPs, a mixture of 0.095M calcium hydroxide, 3M urea, and 0.005M zinc sulfate heptahydrate, or iron (III) chloride hexahydrate, or gadolinium chloride aqueous solution was stirred at 400 rpm for two hours at a solution temperature of 50 °C. Subsequently, 0.06M phosphoric acid was added dropwise to the suspension, stirred for three hours, and harvested through centrifugation at 3000 rpm for 5 minutes. Bare zinc, or iron, or gadolinium-doped HA NPs were synthesized by mixing 0.095M calcium hydroxide, 0.005M zinc sulfate heptahydrate, or iron (III) chloride hexahydrate, or gadolinium chloride aqueous solution at 400 rpm for two hours while maintaining the solution temperature at 50 °C. Subsequently, 0.06M phosphoric acid was added dropwise to the suspension, stirred for three hours, and harvested through centrifugation at 3000 rpm for 10 minutes. Fluorescein isothiocyanate (FITC)-labeled NPs were synthesized in a two-step reaction50,78. Firstly, 20 mg of ZnHA, FeHA, or GdHA, 5 mL of APTES, and 20 mL of anhydrous alcohol were mixed and stirred at 74 °C for 3 hours. Secondly, 30 mg FITC was added to the reaction and allowed to stir for 6 hours at 74 °C. The resulting solution was repeatedly washed with water and 96% ethanol to remove unbound FITC.

[0124] The hydrodynamic diameter and zeta potential of all the nanomaterials (0.1% w / v) were measured in deionized water (pH 6.8) solution using a Malvern particle analyzer and analyzed by Smoluchowski model. The FTIR spectrum of all the nanomaterials was collected on a Nicolet i S50 FTIR Advanced KBr Gold Spectrometer instrument in the region of 4000 to 400 cm'1using the ATR method for sample preparation. TEM images of the samples were obtained on a TALOS electron microscope at an accelerating voltage of 120 kV. The samples were dispersed in MilliQ water, sonicated for 15 minutes, drop-cast on carbon-coated copper grids (300 mesh), and incubated overnight at room temperature. Scanning transmission electron microscopy with energy dispersive spectroscopy (STEM-EDS) was performed using a Thermo Talos F200X high resolution TEM (Waltham, MA, USA). Samples were prepared by drying diluted solutions on to lacey carbon grids (Ted Pella, Redding, CA, USA).

[0125] Powder XRD diffractions of ZnHA, ZnHAU, and GdHA were collected by Panalytical Empyrean XRD with Cu Ka radiation source ( = 0.154 nm) operating at 45 kV and 40 mA with a 0.05 29 step width and a scan speed of 2 deg / min. Powder samples of FeHA and FeHAU were collected by Panalytical X’Pert Pro XRD using Co radiation ( = 0.179 nm) under the same conditions. The spectra were converted to 29 of Cu and the spectra were assigned to reference minerals using X’pert high score plus software. Reference diffractions for HAP and Urea were 96-901-3628 and 00-028-2015, respectively.

[0126] UV-visible spectra of all the NPs were collected using a specific spectrophotometer. XPS spectra were collected using a Thermo Fisher Scientific K-a X-ray photoelectron spectrometer with an Al K source (1486.6 eV). Fluorescence intensity was calculated through the Horiba PTI QM-400 Fluorescence spectrophotometer. SEM images of the wheat leaves and NPs were obtained on a Hitachi TM4000 SEM microscope at an accelerating voltage of 15 kV.

[0127] Confocal microscopy imaging The abaxial and adaxial sides of two-week-old wheat plant leaves were exposed to 5 pl each of 1000 mg / L FITC-labeled NPs (ZnHA-FITC, FeHA-FITC, GdHA-FITC) or the equivalent concentration of pure / free FITC, and a control. All formulations were prepared in deionized water containing 0.05% Silwet surfactant. The wheat leaves were incubated for three hours in a growth chamber after treatments, and all treatments were performed in triplicate. FM4-64 dye was used to stain cell boundaries of epidermis and mesophyll cells in the leaf tissues79. The plant leaves were punched and incubated in a 20 pM FM4-64 aqueous solution for 30 minutes. The leaf tissue was placed on a glass slide (containing Carolina observation gel well), immersed with two drops of perfluorodecalin oil, and covered with a coverslip. For confocal imaging of the wheat leaves, FITC signal (green) was detected with Zex= 488 nm, kem= 510-550 nm, FM4-64 signal (red) was detected with kex= 488 nm, kem= 570-630 nm, chloroplast signal (magenta) was detected with Zex= 488 nm, kem= 700-780 nm. Z-stack section thickness was set to 1 pm. The images were captured using a Leica SP5 confocal laser scanning microscopy under 40x oil objective lens. The captured images were processed through Fiji software package (Image-J v 1.54j). The colocalization of FITC-labeled NPs with FM4-64 stained epidermis in equidistantly separated images in confocal image overlays was performed using the Coloc 2 function in Fiji software. The correlation between the fluorescent signals was analyzed using Manders’ overlap coefficient. The fluorescence intensities of FITC-labeled NPs (ZnHA-FITC, FeHA-FITC, GdHA-FITC) were normalized using the ratio of fluorescence intensity for these NPs (Figure 12) at a constant NP mass.

[0128] Gadolinium doped hydroxyapatite (GdHA) uptake in wheat leaves (ICP-MS Analysis)

[0129] Gd-doped hydroxyapatite NPs (4.8% Gd content) with 0.05 vol % Silwet L-77 surfactant applied to the 14-day-old wheat plant leaf surfaces. The NPs (19.26 ug / uL, total 27 uL) were applied as a 13.5 pL drop each on the abaxial and adaxial leaf surfaces (a total of 520 pg GdHAP). Each treatment was replicated on 5 different plants. The exposed wheat plant leaves were harvested after 48 hours, and the following fractions were collected to measure the movement of foliar-applied GdHAP NPs55: 1) Outer surface attached NPs rinsate obtained after 5 minutes incubation in DI water; 2) Cuticular leaf attached NPs fraction obtained after 15 minutes incubation in 35% w / v nitric acid; 3) Interior leaf accumulated NPs fraction obtained by digesting cuticle-free leaf in concentrated nitric acid for 24 hours. To estimate the total Gd content in all three fractions, the fractions were further digested overnight with a 1-mL mixture of 2: 1 v / v 70% HNO3 and 30% H2O2 at room temperature, followed by heating at 100 °C for 45 min. After digestion, samples were diluted to 5% HNO3 with Milli-Q water and filtered by a 0.45 pm PTFE syringe filter before being analyzed by ICP-MS.

[0130] Nitrogen release at apoplast and spray formulation pH conditions

[0131] Nitrogen release from Urea, ZnHAU, and FeHAU NPs in a dialysis bag (MWCO: 100 kDa) incubated in aqueous solutions with pH 5.8 and 6.8, was measured at different time intervals (1-240 hours). The pH 5.8 and 6.8 solution simulation aimed to replicate the leaf apoplast and foliar spray solution pH environment, respectively. The release of N from the samples was monitored over a period of 10 days using the DAM (diacetyl monoxime) method reported earlier 21,80

[0132] Rainfastness assays

[0133] To simulate the release of N from foliar-applied N-loaded NPs (ZnHAU, FeHAU) and bare NPs (ZnHA, FeHA) on wheat leaf surfaces under rainfall conditions, a rainfastness experiment was conducted81. Three levels of rainfall events, categorized as low (10 mm), medium (30 mm), and high (50 mm), were emulated using a spray bottle containing 160 mL, 480 mL, and 800 mL of rain water, respectively. Two to three-week-old wheat plant leaves were affixed to a square-shaped petri dish (100 x 16 cm) using sticky tape and positioned on a retort stand with a utility clamp at a 70° angle from the horizontal for support during NPs application (20 mg / ml) and rainfall simulation. The NPs were topically applied on the leaf surfaces. After air dry, rain water was applied using a spray bottle equipped with a trigger pump held at a distance of 0.5 meters from the stand and at a height of 0.3 meters from the bottom of the stand. The spraying bottle was calibrated to deliver approximately 160 mL of water in 200 strokes, equivalent to 10 mm of rainfall on the exposed surface of a square-shaped petri dish (160 square cm). The water sprayed was collected in a beaker. The total N / urea released from N-loaded NPs after each rainfall event was measured using the DAM method80, while the concentration of bare NPs was determined by harvesting them via centrifugation (3000 rpm, 25 °C, 10 minutes) followed by drying at 120 °C in a hot air oven. Each sample was triplicated for statistical robustness.

[0134] Biocompatibility assays

[0135] The potential toxicity of bare NPs and N-loaded NPs applied through foliar methods was assessed by estimating leaf cell death through a confocal -based propidium iodide (PI) assay and measuring leaf chlorophyll levels using a SPAD meter71,82. For the propidium iodide assay, two- week-old wheat plant leaves were treated with 0-60 mg / mL concentrations of N (0 - 6% N) as urea or N-loaded NPs (ZnHAU, FeHAU), and 0-50 mg / mL of bare NPs (ZnHA, FeHA). All formulations were prepared in deionized water containing 0.05% Silwet L-77 surfactant. Treated wheat leaves were incubated for three hours in a growth chamber, with all treatments performed in triplicates. After incubation, the leaves were punched and incubated with a propidium iodide solution (25 pg / mL, DI water) for 30 minutes. Confocal imaging of the wheat leaves was conducted, detecting PI signal (red) with Xex= 488 nm, kem= 550-630 nm, and chloroplast signal (magenta) with Xex= 488 nm, kem= 700-780 nm. The Leica SP5 Laser Scanning Confocal Microscopy under 40x oil objective magnification was used for image capture. The dark red spots (PI stain signal) observed in the confocal images were indicative of dead or near-death cells, and these were counted against the living cells (chloroplast signal) to calculate cell mortality. Chlorophyll degradation in plant leaves serves as an indicator of cell toxicity49,71. Two-week-old wheat plant leaves were treated with varying N concentrations (0 - 6% N) as urea or N-loaded NPs (ZnHAU, FeHAU), and 0-50 mg / mL of bare NPs (ZnHA, FeHA). All formulations were prepared in deionized water containing 0.05% Silwet surfactant. Treated wheat plants were grown in greenhouse conditions (temperature: 20-23°C, humidity: 50%, light: 250-400 PAR), and SPAD values were collected weekly. All treatments were performed in triplicates.

[0136] Plant growth and N uptake greenhouse experiments

[0137] The wheat seeds (Pembroke 2021; soft red winter wheat) were generously provided by David A. Van Sanford, University of Kentucky, USA. The seeds underwent surface sterilization with ultraviolet irradiation, followed by incubation with 4% sodium hypochlorite for 10 minutes and thorough washing with deionized water. Eight seeds were placed at a depth of 7-10 cm in soil -filled plastic pots (20 cm height, 25 cm top diameter, and 19 cm base diameter) with a mixture of plaster sand, bark, and peat moss in a ratio of 2: 1 : 1 (vol / vol / vol). The soil was supplemented with 94.49 mg / kg P, 47.24 mg / kg K, 3.96 mg / kg, 21.41 mg / kg S, 2.51 mg / kg Mg, 3.96 mg / kg Zn, 9.8 mg / kg Fe, 10.4 mg / kg Cu, and 3.57 mg / kg Mn and the pH was 7.5. The plants were cultivated in the PR1 greenhouse facility at the University of California Riverside, USA, under controlled conditions of 20-23°C temperature, 50-55% humidity, 250-400 PAR light intensity, and a photoperiod of 16 hours light and 8 hours dark. The soil before sowing the seeds was deficient in N. The foliar N delivery experiment involved three N sources (Urea, ZnHAU, and FeHAU) and two N doses, 30 mg (low N condition) and 140 mg (adequate N condition), applied per pot to wheat plants67. Additionally, ZnHA and FeHA NPs were foliarly applied to wheat leaves to assess their impact without N. N doses (as urea), 30 mg and 140 mg, were applied to the soil in all respective treatments for the first three continuous weeks and then discontinued. Subsequently, we allowed the plant- available N to be depleted over the next two weeks. In the fifth week, N was supplied as a foliar spray to the wheat plants in Urea, ZnHAU, and FeHAU treatments. The foliar spray formulation was prepared by adding 30 or 140 mg N equivalent in the form of Urea or ZnHAU or FeHAU w / v with 0.05% Silwet L-77 v / v surfactant, making up a final volume of 30 mL with deionized water. ZnHAU was administered at concentrations of 4 mg / mL for a low 30 mg nitrogen (N) dose and 18.6 mg / mL for an adequate 140 mg N dose. Similarly, FeHAU was applied at concentrations of 4.55 mg / mL for a low 30 mg N dose and 21.2 mg / mL for an adequate 140 mg N dose. A foliar spray formulation of bare nanoparticles (ZnHA, FeHA), containing an equivalent mass of NPs without N compared to their N-loaded counterparts (ZnHAU, FeHAU), was prepared. For the 30 mg dose, the formulations consisted of 1.65 mg / mL ZnHA and 2.22 mg / mL FeHA, while for the 140 mg dose, the concentrations were 7.7 mg / mL ZnHA and 10.35 mg / mL FeHA. These formulations included 0.05% Silwet L-77 v / v surfactant and were adjusted to a final volume of 30 mL with deionized water. The foliar formulation was applied to wheat plant leaves using a handheld water sprayer bottle (Delta FG0SPRKR2-200; Delta® Sprayer Wide Mouth Spray Bottle) with a removable tip, delivering approximately 0.8-1.2 mL of the solution per spray. After the foliar N spray, N release from leaf surface-attached NPs was stimulated through the application of foliar deionized water mist for 10 seconds per pot (at a rate of 25 mL / sec) every 24 hours for up to two weeks. Plant samples were collected to measure leaf N content, above-ground fresh and dry weight, and plant height.

[0138] RT-qPCR analysis

[0139] Leaves were collected 1, 3 and 7 days post foliar application with urea, ZnHA, ZnHAU, FeHA, and FeHAU treated wheat plants grown under low N condition. Total RNA was extracted using the Zymo Research Quick RNA Plant Miniprep Kit (Cat#R2024) with DNase treatment (Zymo Research DNase I Set (Cat#E1010). One-step RT-qPCR was performed to quantify glutamine synthetase (GS) and glutamine oxoglutarate aminotransferase (GOGAT) expression in wheat leaves using the NEB Luna Universal One-Step RT-qPCR Kit (Cat#E3005) with 10 ng total RNA and 0.25 nM primer templates. Primers were designed using NCBI Primer-BLAST (www.ncbi.nlm.nih.gov / tools / primer-blast / ). Primers were as follows: TaGSl : Forward: GGGTCGCTCGCTACCTTCTT, Reverse: CTTCTCCACGGCATCCACGA. TaFd-GOGAT Forward: TGAGGATCTGGCGCAGCTAA, Reverse CCAGTTCCACCATCATGCCC. UBIQUITIN Forward: GCGCCTGATCTTCGCTGGTA, Reverse: GGAGACGGAGCACCAAGTGA. Thermocycler conditions were as follows: 55°C for 10 minutes, 95°C for 5 minutes, and 35 cycles of 95°C for 10 seconds and 50°C for 30 seconds with a plate read. The melt curve was run from 65-95°C in 0.5°C increments. qPCR data was analyzed by the ddCt method92to obtain normalized GS and GOGAT mRNA fold change with respect to the UBIQUITIN housekeeping gene. Three technical replicates were performed and three biological replicates were collected for each treatment.

[0140] Statistical analysis

[0141] The numerical data are presented as means and error bars represent standard deviations. Normality of the data was calculated using Shapiro - Wilk test. Statistical significance was assessed using either one-way followed by Tukey’s (Figure 3D and 3E, Figure 4A, Figure 20) or Dunn ‘s (Figure 18B-18D) post-hoc test to compare all treatments with each other or Dunnett’s post-hoc test to compare on treatment (e.g. control) with other treatments (Figure 5A-D, Figure 19) or two-way ANOVA followed by Sidak’s post-hoc test (Figure 2C, Figure 4B and 4C, Figure 16C). The choice between one-way or two-way ANOVA depended on whether the comparison involved a single variable or multiple variables with independent group means.

[0142] Supporting Information

[0143] Zn, Gd, and Fe doping in hydroxyapatite NPs, N loading on the ZnHAU and FeHAU NPs, STEM-EDS and TEM characterization of NPs, XPS characterization of the NPs, schematic representation of FITC labeling on NPs, absorbance, fluorescence and FTIR spectrum of the FITC loaded NPs, FITC release characterization of NPs, Gd release from GdHA NPs, CLSM images of the control treatments, SEM images of NPs attachment on wheat leaf after rainfall events, biocompatibility assessment of NPs on wheat leaves through chlorophyll content measurement (SPAD meter), comparatives assessment of fresh and dry weight, plant height, and leaf N uptake in wheat leaves between urea and bare (ZnHA, FeHA) and N loaded hydroxyapatite NPs (ZnHAU, FeHAU).

[0144] Documents cited in Example 1:

[0145] (1) Zhang, X.; Davidson, E. A.; Mauzerall, D. L.; Searchinger, T. D.; Dumas, P.; Shen, Y. Managing Nitrogen for Sustainable Development. Nature 2015, 528 (7580), 51-59.

[0146] (2) Davidson, E. A.; David, M. B.; Galloway, J. N.; Goodale, C. L.; Haeuber, R.; Harrison, J. A.; Howarth, R. W .; Jaynes, D. B.; Lowrance, R. R.; Thomas, N. B.; Peel, J. L.; Pinder, R. W.; Porter, E.; Snyder, C. S.; Townsend, A. R.; Ward, M. H. Excess Nitrogen in the U.S. Environment: Trends, Risks, and Solutions. Issues EcoL 2011, No. 15.

[0147] (3) Zhang, P.; Guo, Z.; Ullah, S.; Melagraki, G.; Afantitis, A.; Lynch, I. Nanotechnology and Artificial Intelligence to Enable Sustainable and Precision Agriculture. Nat Plants 2021, 7

[0148] (7), 864-876.

[0149] (4) Gao, Y.; Cabrera Serrenho, A. Greenhouse Gas Emissions from Nitrogen Fertilizers Could Be Reduced by up to One-Fifth of Current Levels by 2050 with Combined Interventions. Nat Food 2023, 4 (2), 170-178.

[0150] (5) Kanter, D. R.; Chodos, O.; Nordland, O.; Rutigliano, M.; Winiwarter, W. Gaps and Opportunities in Nitrogen Pollution Policies around the World. Nature Sustainability 2020, 3 (11), 956-963.

[0151] (6) Kah, M.; Tufenkji, N.; White, J. C. Nano-Enabled Strategies to Enhance Crop Nutrition and Protection. Nat. NanotechnoL 2019, 14 (6), 532-540.

[0152] (7) Poffenbarger, H. J.; Sawyer, J. E.; Barker, D. W .; Oik, D. C.; Six, J.; Castellano, M. J. Legacy Effects of Long-Term Nitrogen Fertilizer Application on the Fate of Nitrogen Fertilizer Inputs in Continuous Maize. Agric. Ecosyst. Environ. 2018, 265, 544-555.

[0153] (8) Lu, X.; Ye, X.; Zhou, M.; Zhao, Y.; Weng, H.; Kong, H.; Li, K.; Gao, M.; Zheng, B.; Lin, J.; Zhou, F.; Zhang, Q.; Wu, D.; Zhang, L.; Zhang, Y. The Underappreciated Role of Agricultural Soil Nitrogen Oxide Emissions in Ozone Pollution Regulation in North China. Nat. Commun. 2021, 72 (1), 5021.

[0154] (9) Bai, Z.; Fan, X.; Jin, X.; Zhao, Z.; Wu, Y.; Oenema, O.; Velthof, G.; Hu, C.; Ma, L. Relocate 10 Billion Livestock to Reduce Harmful Nitrogen Pollution Exposure for 90% of China’s Population. Nat Food 2022, 3 (2), 152-160.

[0155] (10) Bogard, M. J.; Vogt, R. J.; Hayes, N. M.; Leavitt, P. R. Unabated Nitrogen Pollution Favors Growth of Toxic Cyanobacteria over Chiorophytes in Most Hypereutrophic Lakes. Environ. Sci. Technol. 2020, 54 (6), 3219-3227.

[0156] (11) Kant, S.; Bi, Y.-M.; Rothstein, S. J. Understanding Plant Response to Nitrogen Limitation for the Improvement of Crop Nitrogen Use Efficiency. J. Exp. Bot. 2011, 62 (4), 1499- 1509.

[0157] (12) Hussain, M. Z.; Robertson, G. P.; Basso, B.; Hamilton, S. K. Leaching Losses of Dissolved Organic Carbon and Nitrogen from Agricultural Soils in the Upper US Midwest. Sci. Total Environ. 2020, 734, 139379.

[0158] (13) McBeath, T. M.; Facelli, E.; Peirce, C. A. E.; Arachchige, V. K.; McLaughlin, M. J. Assessment of Foliar- Applied Phosphorus Fertiliser Formulations to Enhance Phosphorus Nutrition and Grain Production in Wheat. Crop Pasture Sci. 2020, 71 (9), 795-806.

[0159] (14) Husted, S.; Minutello, F.; Pinna, A.; Tougaard, S. L.; Mos, P.; Kopittke, P. M. What Is Missing to Advance Foliar Fertilization Using Nanotechnology? Trends Plant Sci. 2023, 28 (1), 90-105.

[0160] (15) Avellan, A.; Yun, J.; Morais, B. P.; Clement, E. T.; Rodrigues, S. M.; Lowry, G. V. Critical Review: Role of Inorganic Nanoparticle Properties on Their Foliar Uptake and in Planta Translocation. Environ. Sci. Technol. 2021, 55 (20), 13417-13431.

[0161] (16) Hofmann, T.; Lowry, G. V.; Ghoshal, S.; Tufenkji, N.; Brambilla, D.; Dutcher, J. R.; Gilbertson, L. M.; Giraldo, J. P.; Kinsella, J. M.; Landry, M. P.; Lovell, W .; Naccache, R.; Paret, M.; Pedersen, J. A.; Unrine, J. M.; White, J. C.; Wilkinson, K. J. Technology Readiness and Overcoming Barriers to Sustainably Implement Nanotechnology -Enabled Plant Agriculture. Nature Food 2020, 1 (7), 416-425.

[0162] (17) Wang, D.; Saleh, N. B.; Byro, A.; Zepp, R.; Sahle-Demessie, E.; Luxton, T. P.; Ho, K. T.; Burgess, R. M.; Flury, M.; White, J. C.; Su, C. Nano-Enabled Pesticides for Sustainable Agriculture and Global Food Security. Nat. Nanotechnol. 2022, 17 (4), 347-360.

[0163] (18) Kah, M.; Tufenkji, N.; White, J. C. Nano-Enabled Strategies to Enhance Crop Nutrition and Protection. Nat. Nanotechnol. 2019, 14 (6), 532-540.

[0164] (19) Gilbertson, L. M.; Pourzahedi, L.; Laughton, S.; Gao, X.; Zimmerman, J. B.; Theis, T. L.; Westerhoff, P.; Lowry, G. V. Guiding the Design Space for Nanotechnology to Advance Sustainable Crop Production. Nat. Nanotechnol. 2020, 15 (9), 801-810. (20) Li, S.-X.; Wang, Z.-H.; Stewart, B. A. Chapter Five - Responses of Crop Plants to Ammonium and Nitrate N. In Advances in Agronomy, Sparks, D. L., Ed.; Academic Press, 2013; Vol. 118, pp 205-397.

[0165] (21) Sharma, B.; Shrivastava, M.; Afonso, L. O. B.; Soni, U.; Cahill, D. M. Metal Doped Nitrogenous Hydroxyapatite Nanohybrids Slowly Release Nitrogen to Crops and Mitigate Ammonia Volatilization: An Impact Assessment. NanoImpact 2022, 28, 100424.

[0166] (22) Sharma, B.; Shrivastava, M.; Afonso, L. O. B.; Soni, U.; Cahill, D. M. Zinc- and Magnesium-Doped Hydroxyapatite Nanoparticles Modified with Urea as Smart Nitrogen Fertilizers. ACS Appl. Nano Mater. 2022, 5 (5), 7288-7299.

[0167] (23) Kottegoda, N.; Sandaruwan, C.; Priyadarshana, G.; Siriwardhana, A.; Rathnayake, U. A.; Berugoda Arachchige, D. M.; Kumarasinghe, A. R.; Dahanayake, D.; Karunaratne, V.; Amaratunga, G. A. J. Urea-Hydroxyapatite Nanohybrids for Slow Release of Nitrogen. ACS Nano 2017, 11 (2), 1214-1221.

[0168] (24) Frank, M.; Husted, S. Is India’s Largest Fertilizer Manufacturer Misleading Farmers and Society Using Dubious Plant and Soil Science? Plant Soil 2023. https: / / doi.org / 10.1007 / sl l l04-023-06191-4.

[0169] (25) IFFCO 2022. IFFCO Nano Urea. In: Indian Farmers Fertilizer Cooperative (IFFCO). IFFCO Nano Urea, https: / / nanourea.in / en / nano-urea (accessed 2024-01-02).

[0170] (26) Raliya, R. A Method of Manufacturing of Nano Nitrogen Using Urea for Slow Release, Enhanced Utilization by the Plants and Application Thereof. 2021130763 Al, July 1, 2021.

[0171] (27) Kumar, Y. Sales Promotion and Marketing Strategy of Nano Urea (liquid). https: / / www.researchgate.net / profile / Tarunendu-

[0172] Singh / publication / 354521903_Sales_Promotion_and_Marketing_Strategy_of_Nano_Urea_ liquid / links / 613c3cf3e4419c5e6ec2a49e / Sales-Promotion-and-Marketing-Strategy-of- Nano-Urea-liquid.pdf (accessed 2024-01-02).

[0173] (28) Chethan Babu, R.T, Praveen, B. R, Magan Singh. Nano Urea: A step towards India ’s self- reliance in Nitrogen fertilizer production. https: / / www.researchgate.net / profile / Chethan-R- T-2 / publication / 365323396_Food_and_Scientific_Reports_e-ISSN2582- 5437 / links / 636f85d354eb5f547cc86328 / Food-and-Scientific-Reports-e-ISSN2582- 5437.pdf (accessed 2024-01-02).

[0174] (29) Pettersen, T.; Aamlid, T. Testing of Nano-Gro on Established Turf at Fairway Mowing Height (15 Mm),' NIBIO, 2019.

[0175] (30) Tang, S.; Liang, J.; Li, O.; Shao, N.; Jin, Y.; Ni, J.; Fei, X.; Li, Z. Morphology-Tailored Hydroxyapatite Nanocarrier for Rhizosphere-Targeted Phosphorus Delivery. Small 2023, 19 (14), e2206954.

[0176] (31) Mondal, S.; Park, S.; Choi, J.; Vu, T. T. H.; Doan, V. H. M.; Vo, T. T.; Lee, B.; Oh, J. Hydroxyapatite: A Journey from Biomaterials to Advanced Functional Materials. Adv. Colloid Interface Sci. 2023, 321, 103013.

[0177] (32) Yook, H.; Hwang, J.; Yeo, W .; Bang, J.; Kim, J.; Kim, T. Y .; Choi, J.-S.; Han, J. W. Design Strategies for Hydroxyapatite-Based Materials to Enhance Their Catalytic Performance and Applicability. Adv. Mater. 2023, 35 (43), e2204938.

[0178] (33) Fang, X.; Zhu, S.; Ma, J.; Wang, F.; Xu, H.; Xia, M. The Facile Synthesis of Zoledronate Functionalized Hydroxyapatite Amorphous Hybrid Nanobiomaterial and Its Excellent Removal Performance on Pb2+ and Cu2. J. Hazard. Mater. 2020, 392, 122291.

[0179] (34) Sharma, B.; Soni, U.; Afonso, L. O. B.; Cahill, D. M. Nanomaterial Doping: Chemistry and Strategies for Agricultural Applications. ACS Agric. Sci. TechnoL 2022, 2 (2), 240-257.

[0180] (35) Thomas, C. R.; George, S.; Horst, A. M.; Ji, Z.; Miller, R. J.; Peralta- Videa, J. R.; Xia, T.; Pokhrel, S.; Madler, L.; Gardea-Torresdey, J. L.; Holden, P. A.; Keller, A. A.; Lenihan, H. S.; Nel, A. E.; Zink, J. I. Nanomaterials in the Environment: From Materials to High- Throughput Screening to Organisms. ACS Nano 2011, 5 (1), 13-20.

[0181] (36) Sharma, B.; Afonso, L. O. B.; Singh, M. P.; Soni, U.; Cahill, D. M. Zinc- and Magnesium- Doped Hydroxyapatite-Urea Nanohybrids Enhance Wheat Growth and Nitrogen Uptake. Sci. Rep. 2022, 12 (1), 19506.

[0182] (37) Wang, M.; Sun, X.; Zhong, N.; Cai, D.; Wu, Z. Promising Approach for Improving Adhesion Capacity of Foliar Nitrogen Fertilizer. ACS Sustainable Chem. Eng. 2015, 3 (3), 499-506.

[0183] (38) Li, W .; Zhang, X.; Zhou, H.; Zou, Z.; Shen, Y.; Wang, G. In Situ Construction of a Magnesium Foliar Fertilizer with pH-Controlled Release and High Adhesion Capacity. Environ. Sci.: Nano 2023, 10 (1), 115-128.

[0184] (39) Yang, X.; Lu, Y.; Ding, Y.; Yin, X.; Raza, S.; Tong, Y. ’an. Optimising Nitrogen Fertilisation: A Key to Improving Nitrogen-Use Efficiency and Minimising Nitrate Leaching Losses in an Intensive Wheat / maize Rotation (2008-2014). Field Crops Res. 2017, 206, 1-10.

[0185] (40) Presterl, T.; Groh, S.; Landbeck, M.; Seitz, G.; Schmidt, W .; Geiger, H. H. Nitrogen Uptake and Utilization Efficiency of European Maize Hybrids Developed under Conditions of Low and High Nitrogen Input. Plant Breed. 2002, 121 (6), 480-486.

[0186] (41) Ma, Q.; Wang, M.; Zheng, G.; Yao, Y.; Tao, R.; Zhu, M.; Ding, J.; Li, C.; Guo, W.; Zhu, X. Twice-Split Application of Controlled-Release Nitrogen Fertilizer Met the Nitrogen Demand of Winter Wheat. Field Crops Res. 2021, 267, 108163.

[0187] (42) Tank, K. P.; Sharma, P.; Kanchan, D. K.; Joshi, M. J. FTIR, Powder XRD, TEM and Dielectric Studies of Pure and Zinc Doped Nano-hydroxyapatite. Cryst. Res. Technol. 2011, 46 (12), 1309-1316.

[0188] (43) In, Y .; Amomkitbamrung, U.; Hong, M.-H.; Shin, H. On the Crystallization of Hydroxyapatite under Hydrothermal Conditions: Role of Sebacic Acid as an Additive. ACS Omega 2020, 5 (42), 27204-27210.

[0189] (44) Sun, Z.; Chen, J.; Ding, Z.; Fan, Y.; Han, Y. Spindle-like-Aggregating Behavior of Hydroxyapatite Nanorods in Polyacrylic Acid Aqueous System. Colloids Surf. A Physicochem. Eng. Asp. 2022, 634, 127933.

[0190] (45) Ohshima, H. Chapter 1 - Interaction of Colloidal Particles. In Colloid and Interface Science in Pharmaceutical Research and Development, Ohshima, H., Makino, K., Eds.; Elsevier: Amsterdam, 2014; pp 1-28.

[0191] (46) Sagle, L. B.; Zhang, Y.; Litosh, V. A.; Chen, X.; Cho, Y.; Cremer, P. S. Investigating the Hydrogen-Bonding Model of Urea Denaturation. J. Am. Chem. Soc. 2009, 131 (26), 9304- 9310.

[0192] (47) Lau, V. W.-H.; Yu, V. W.-Z.; Ehrat, F.; Botari, T.; Moudrakovski, I.; Simon, T.; Duppel, V.; Medina, E.; Stolarczyk, J. K.; Feldmann, J.; Blum, V.; Lotsch, B. V. Urea-modified Carbon Nitrides: Enhancing Photocatalytic Hydrogen Evolution by Rational Defect Engineering. Adv. Energy Mater. 2017, 7 (12), 1602251.

[0193] (48) Yang, C.-X.; Liu, C.; Cao, Y.-M.; Yan, X.-P. Metal-organic Framework MIL-lOO(Fe) for Artificial Kidney Application. RSC Adv. 2014, 4 (77), 40824-40827.

[0194] (49) Santana, I.; Jeon, S.-J.; Kim, H.-L; Islam, M. R.; Castillo, C.; Garcia, G. F. H.; Newkirk, G. M.; Giraldo, J. P. Targeted Carbon Nanostructures for Chemical and Gene Delivery to Plant Chloroplasts. ACS Nano 2022, 16 (8), 12156-12173.

[0195] (50) Zhu, J.; Li, J.; Shen, Y.; Liu, S.; Zeng, N.; Zhan, X.; White, J. C.; Gardea-Torresdey, J.; Xing, B. Mechanism of Zinc Oxide Nanoparticle Entry into Wheat Seedling Leaves. Environ. Sci.: Nano 2020, 7 (12), 3901-3913.

[0196] (51) Uzu, G.; Sobanska, S.; Sarret, G.; Munoz, M.; Dumat, C. Foliar Lead Uptake by Lettuce Exposed to Atmospheric Fallouts. Environ. Sci. Technol. 2010, 44 (3), 1036-1042.

[0197] (52) Wang, P.; Lombi, E.; Zhao, F.-J.; Kopittke, P. M. Nanotechnology: A New Opportunity in Plant Sciences. Trends Plant Sci. 2016, 21 (8), 699-712.

[0198] (53) Avellan, A.; Yun, J.; Zhang, Y .; Spielman-Sun, E.; Unrine, J. M.; Thieme, J.; Li, J.; Lombi, E.; Bland, G.; Lowry, G. V. Nanoparticle Size and Coating Chemistry Control Foliar Uptake Pathways, Translocation, and Leaf-to-Rhizosphere Transport in Wheat. ACS Nano 2019, 13 (5), 5291-5305.

[0199] (54) Schwab, F.; Zhai, G.; Kern, M.; Turner, A.; Schnoor, J. L.; Wiesner, M. R. Barriers, Pathways and Processes for Uptake, Translocation and Accumulation of Nanomaterials in Plants - Critical Review. Nanotoxicology 2016, 10 (3), 257-278.

[0200] (55) Shen, Y.; Borgatta, J.; Ma, C.; Elmer, W.; Hamers, R. J.; White, J. C. Copper Nanomaterial Morphology and Composition Control Foliar Transfer through the Cuticle and Mediate Resistance to Root Fungal Disease in Tomato (Solanum Lycopersicum). J. Agric. Food Chem. 2020, 65 (41), 11327-11338.

[0201] (56) Zhu, J.; Wang, J.; Chen, R.; Feng, Q.; Zhan, X. Cellular Process of Polystyrene Nanoparticles Entry into Wheat Roots. Environ. Sci. Technol. 2022, 56 (10), 6436-6444.

[0202] (57) Ramondo, F.; Bencivenni, L.; Caminiti, R.; Pieretti, A.; Gontrani, L. Dimerisation of Urea in Water Solution: A Quantum Mechanical Investigation. Phys. Chem. Chem. Phys. 2007, 9 (18), 2206-2215.

[0203] (58) Lee, C.; Stahlberg, E. A.; Fitzgerald, G. Chemical Structure of Urea in Water. J. Phys. Chem. 1995, 99 (50), 17737-17741.

[0204] (59) Godawat, R.; Jamadagni, S. N.; Garde, S. Characterizing Hydrophobicity of Interfaces by Using Cavity Formation, Solute Binding, and Water Correlations. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (36), 15119-15124.

[0205] (60) Koutsopoulos, S.; Dalas, E. Inhibition of Hydroxyapatite Formation in Aqueous Solutions by Amino Acids with Hydrophobic Side Groups. Langmuir 2000, 16 (16), 6739-6744.

[0206] (61) Borgatta, J.; Shen, Y.; Tamez, C.; Green, C.; Hedlund Orbeck, J. K.; Cahill, M. S.; Protter, C.; Deng, C.; Wang, Y.; Elmer, W .; White, J. C.; Hamers, R. J. Influence of CuO Nanoparticle Aspect Ratio and Surface Charge on Disease Suppression in Tomato (Solanum Lycopersicum). J. Agric. Food Chem. 2023, 71 (25), 9644-9655.

[0207] (62) Meurer, R. A.; Kemper, S.; Knopp, S.; Eichert, T.; Jakob, F.; Goldbach, H. E.;

[0208] Schwaneberg, U.; Pich, A. Biofunctional Microgel -Based Fertilizers for Controlled Foliar Delivery of Nutrients to Plants. Angew. Chem. Int. Ed Engl. 2017, 56 (26), 7380-7386.

[0209] (63) Yu, M.; Yao, J.; Liang, J.; Zeng, Z.; Cui, B.; Zhao, X.; Sun, C.; Wang, Y.; Liu, G.; Cui, H. Development of Functionalized Abamectin Poly(lactic Acid) Nanoparticles with Regulatable Adhesion to Enhance Foliar Retention. RSC Adv. 2017, 7 (19), 11271-11280.

[0210] (64) Li, W.; Fan, R.; Zhou, H.; Zhu, Y.; Zheng, X.; Tang, M.; Wu, X.; Yu, C.; Wang, G. Improving the Utilization Rate of Foliar Nitrogen Fertilizers by Surface Roughness Engineering of Silica Spheres. Environ. Sci.: Nano 2020, 7 (11), 3526-3535.

[0211] (65) Ha, N.; Seo, E.; Kim, S.; Lee, S. J. Adsorption of Nanoparticles Suspended in a Drop on a Leaf Surface of Perilla Frutescens and Their Infiltration through Stomatai Pathway. Sci. Rep. 2021, 11 (1), 11556.

[0212] (66) Liu, B.; Fan, Y.; Li, H.; Zhao, W .; Luo, S.; Wang, H.; Guan, B.; Li, Q.; Yue, J.; Dong, Z.; Wang, Y.; Jiang, L. Control the Entire Journey of Pesticide Application on Superhydrophobic Plant Surface by Dynamic Covalent Trimeric Surfactant Coacervation. Adv. Funct. Mater. 2021, 31 (5), 2006606.

[0213] (67) Kutman, U. B.; Yildiz, B.; Ozturk, L.; Cakmak, I. Biofortification of Durum Wheat with Zinc through Soil and Foliar Applications of Nitrogen. Cereal Chem. 2010, 57 (1), 1-9.

[0214] (68) Liu, C.; Gong, X.; Wang, H.; Dang, K.; Deng, X.; Feng, B. Low-Nitrogen Tolerance Comprehensive Evaluation and Physiological Response to Nitrogen Stress in Broomcorn Millet (Panicum Miliaceum L.) Seedling. Plant Physiol. Biochem. 2020, 757, 233-242.

[0215] (69) Liu, X.; Wang, S.; Deng, X.; Zhang, Z.; Yin, L. Comprehensive Evaluation of Physiological Traits under Nitrogen Stress and Participation of Linolenic Acid in Nitrogen- Deficiency Response in Wheat Seedlings. BMC Plant Biol. 2020, 20 (1), 501.

[0216] (70) Li, H.; Shao, L.; Liu, X.; Sun, H.; Chen, S.; Zhang, X. What Matters More, Biomass Accumulation or Allocation, in Yield and Water Productivity Improvement for Winter Wheat during the Past Two Decades ? . Eur. J. Agron. 2023, 149 (126910), 126910.

[0217] (71) Agathokleous, E.; Feng, Z.; Penuelas, J. Chlorophyll Hormesis: Are Chlorophylls Major Components of Stress Biology in Higher Plants? Sci. Total Environ. 2020, 726, 138637.

[0218] (72) Larners, J.; van der Meer, T.; Testerink, C. How Plants Sense and Respond to Stressful Environments. Plant Physiol. 2020, 182 (4), 1624-1635.

[0219] (73) Poucet, T.; Gonzalez-Moro, M. B.; Cabasson, C.; Beauvoit, B.; Gibon, Y.; Dieuaide- Noubhani, M.; Marino, D. Ammonium Supply Induces Differential Metabolic Adaptive Responses in Tomato according to Leaf Phenol ogi cal Stage. J. Exp. Bot. 2021, 72 (8), 3185-3199.

[0220] (74) Tegeder, M.; Masclaux-Daubresse, C. Source and Sink Mechanisms of Nitrogen Transport and Use. New Phytol. 2018, 217 (1), 35-53.

[0221] (75) Wang, Y.-Y.; Cheng, Y.-H.; Chen, K.-E.; Tsay, Y.-F. Nitrate Transport, Signaling, and Use Efficiency. Annu. Rev. Plant Biol. 2018, 69, 85-122.

[0222] (76) Castro, S. A. Q. de; Kichey, T.; Persson, D. P.; Schjoerring, J. K. Leaf Scorching Following Foliar Fertilization of Wheat with Urea or Urea-Ammonium Nitrate Is Caused by Ammonium Toxicity. Agronomy 2022, 12 (6), 1405.

[0223] (77) Rubio-Asensio, J. S.; Bloom, A. J. Inorganic Nitrogen Form: A Major Player in Wheat and Arabidopsis Responses to Elevated CO2. J. Exp. Bot. 2017, 68 (10), 2611-2625.

[0224] (78) Liu, H.; Chen, F.; Xi, P.; Chen, B.; Huang, L.; Cheng, J.; Shao, C.; Wang, J.; Bai, D.; Zeng, Z. Biocompatible Fluorescent Hydroxyapatite: Synthesis and Live Cell Imaging Applications. J. Phys. Chem. C 2011, 115 (38), 18538-18544.

[0225] (79) Bolte, S.; Talbot, C.; Boutte, Y.; Catrice, O.; Read, N. D.; Satiat-Jeunemaitre, B. FM-Dyes as Experimental Probes for Dissecting Vesicle Trafficking in Living Plant Cells. J. Microsc. 2004, 214 (Pt 2), 159-173.

[0226] (80) Mulvaney, R. L.; Bremner, J. M. A Modified Diacetyl Monoxime Method for Colorimetric Determination of Urea in Soil extracts 1. Commun. Soil Sci. Plant Anal. 1979, 10 (8), 1163— 1170.

[0227] (81) Zhang, J.; Brown, G.; Fu, J.; James, P.; Mukandiwa, L.; Huang, X.; Yu, C. Nanobiopesticides : Silica Nanoparticles with Spiky Surfaces Enable Dual Adhesion and Enhanced Performance. EcoMat 2020, 2 (2). https: / / doi.org / 10.1002 / eom2.12028.

[0228] (82) Truernit, E.; Haseloff, J. A Simple Way to Identify Non- Viable Cells within Living Plant Tissue Using Confocal Microscopy. Plant Methods 2008, 4. 15.

[0229] (83) Pawar, R. A.; Patange, S. M.; Shitre, A. R.; Gore, S. K.; Jadhav, S. S.; Shirsath, S. E. Crystal Chemistry and Single-Phase Synthesis of Gd 3+ Substituted Co-Zn Ferrite Nanoparticles for Enhanced Magnetic Properties. RSC Adv. 2018, 8 (44), 25258-25267.

[0230] (84) Masclaux-Daubresse, C.; Reisdorf-Cren, M.; Pageau, K.; Lelandais, M.; Grandjean, O.; Kronenberger, J.; Valadier, M.-H.; Feraud, M.; Jouglet, T.; Suzuki, A. Glutamine Synthetase- Glutamate Synthase Pathway and Glutamate Dehydrogenase Play Distinct Roles in the Sink- Source Nitrogen Cycle in Tobacco. Plant Physiol. 2006, 140 (2), 444-456.

[0231] (85) Moison, M.; Marmagne, A.; Dinant, S.; Soulay, F.; Azzopardi, M.; Lothier, J.; Citerne, S.; Morin, H.; Legay, N.; Chardon, F.; Avice, J.-C.; Reisdorf-Cren, M.; Masclaux-Daubresse, C. Three Cytosolic Glutamine Synthetase Isoforms Localized in Different-Order Veins Act Together for N Remobilization and Seed Filling in Arabidopsis. J. Exp. Bot. 2018, 69 (18), 4379-4393.

[0232] (86) Wang, L.; Nancollas, G. H. Calcium Orthophosphates: Crystallization and Dissolution. Chem. Rev. 2008, 108 (11), 4628-4669.

[0233] (87) Zhang, P.; Ryan, J. A. Formation of Pyromorphite in Anglesite-Hydroxyapatite Suspensions under Varying pH Conditions. Environ. Sci. Technol. 1998, 32 (21), 3318-3324.

[0234] (88) Remya, N. S.; Syama, S.; Sabareeswaran, A.; Mohanan, P. V. Investigation of Chronic Toxicity of Hydroxyapatite Nanoparticles Administered Orally for One Year in Wistar Rats. Mater. Sci. Eng. C Mater. Biol. Appl. 2017, 76, 518-527.

[0235] (89) Ramis, J. M.; Coelho, C. C.; Cordoba, A.; Quadros, P. A.; Monjo, M. Safety Assessment of Nano-Hydroxyapatite as an Oral Care Ingredient according to the EU Cosmetics Regulation. Cosmet. Toiletries 2018, 5 (3), 53.

[0236] (90) Xu, Y.; Zhang, Z.; Wang, H.; Zhong, W.; Sun, C.; Sun, W.; Wu, H. Zoledronic Acid- Loaded Hybrid Hyaluronic Acid / Polyethylene Glycol / Nano-Hydroxyapatite Nanoparticle: Novel Fabrication and Safety Verification. Front Bioeng Biotechnol 2021, 9, 629928.

[0237] (91) Epple, M. Review of Potential Health Risks Associated with Nanoscopic Calcium Phosphate. Acta Biomater. 2018, 77, 1-14.

[0238] (92) Schmittgen, T. D.; Livak, K. J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3 (6), 1101-1108.

[0239] (93) Pacheco Inoue, L., Unrine, J. M., Tsyusko, O., Sharma, B., Giraldo, J. P., & Poffenbarger, H. (2024) Evaluation of Foliar- Applied Nitrogen Nano-Fertilizers on Wheat Yield and Environmental Nitrogen Losses [Abstract], ASA, CSSA, SSSA International Annual Meeting, San Antonio, TX. scisoc.confex.com / scisoc / 2024am / meetingapp.cgi / Paper / 158227

[0240] Example 2. Toxicity of Hydroxyapatite Nanoparticles on Caenorhabditis elegans: a Safety-by Design Approach for Assessing Nitrogen Delivery

[0241] Fertilizers play a crucial role in enhancing crop yield and supporting the increasing global population. However, the use of nitrogen fertilizers such as urea can lead to soil accumulation, release of nitrous oxide into the atmosphere, and contamination of water bodies. To address the inefficiency and mitigate environmental impact of bulk chemical fertilizers, researchers are developing nano-enabled fertilizers for precise, slow-release nitrogen delivery. This study adopts a safety -by-design approach to assess the potential toxicity of candidate nanomaterials, Zn- and Fe-doped Hydroxyapatite (ZnHAP and FeHAP, respectively), using the soil nematode, Caenorhabditis elegans, as a model organism. These nanoparticles (NP) come in two forms: bare Zn- or Fe- doped hydroxyapatite NP and with urea adsorbed to said NP. Additionally, surfactants, such as Silwet L-77, are incorporated to facilitate nanomaterial uptake through plant stomata by reducing surface tension. To evaluate the potential toxicity of Zn- and FeHAP, both with and without Silwet L-77 surfactant, mortality, reproduction, and growth were used as biological endpoints. ZnHAP exhibits moderate toxicity, with mortality rates ranging from 24% to 34% at concentrations of 100 mg / L to 275 mg / L, possibly due to Zn dissolution post-uptake, while FeHAP demonstrates lower toxicity, causing mortality rates exceeding 10% only at 700 mg / L. However, when urea was adsorbed to the NP, mortality decreased to zero, regardless of concentration. Reproductive capacity remains unaffected at lower tested concentrations of both materials without urea. With adsorbed urea, ZnHAP showed a concentration dependent decrease in reproduction while FeHAP with urea did not inhibit reproduction. Finally, the addition of Silwet L-77 at 0.1% and 0.2% induces significant toxicity in C. elegans alone and when combined with either Zn- or FeHAP. These findings show that FeHAP are a less toxic NP for nitrogen delivery, and thus a promising option for nitrogen- enabled fertilizers.

[0242] Example 3. Toxicity assessment of iron-doped hydroxyapatites with and without urea in soil invertebrate, earthworm Eisenia fetida

[0243] Potential toxicity of Fe(III)-doped hydroxyapatites with and without urea was evaluated in earthworms, Eisenia fetida, after exposing them to the soils from the field winter wheat trial. The field trial included three foliar applications during wheat growing cycle of urea, FeHAP, and FeHAU, each at N rate of 0, 56, and 112 kg N / ha. The FeHAP applications only contain nanomaterials without urea and were matched with FeHAU treatments, where urea constituted 50%, by mass. At the end of the field experiment, the soil samples along with the respective plant biomass were collected from the total of 36 plots with 4 plots (replicates) per treatment. Earthworm mortality, reproduction and avoidance were assessed following the standard OECD toxicity testing protocol (OECD, 2016), which was successfully used in previous study with silver nanomaterials (Shouts-Wilson et al. 2011).

[0244] Briefly, the soil samples were air-dried, and 500 g of soil was placed into each plastic container followed by water added to at the rate of their 60% water holding capacity. The ground wheat straw without kernels from each plot was supplemented weekly at 2.5 g / container. Ten worms with developed clitella in the weight range of 300-600 mg were placed into each container. For mortality, the exposure continued for 28 days at 20°C with 8-hour light and 16-hour dark cycle. After 28 days, the adult worms were removed, weighted, counted and preserved by freezing at -80°C for trace-element analyses. For reproduction, the ground wheat straw was added at 2.5 g / container and the containers with the soils containing juveniles and cocoons were maintained for additional 28 days to allow cocoons to hatch and juveniles to grow while supplementing to 60% water holding capacity every 7 days. At the end of the experiment, the juveniles and cocoons were counted. For avoidance, 250 g (wet) of the soil from one treatment was placed on one side of a container, and 250 g of the soil from the 2ndtreatment on the other side, separated by a divider. After removing the divider, each worm was placed in the middle soil-free area and was allowed to select a side during 15 min. The initial preference was recorded, and next worm was introduced with the total of 10 worms / container. The containers were maintained at 20 °C and the final avoidance was recorded after 48 hours. The treatments selected for avoidance testing included urea, FeHAP, and FeHAU at 56 and 112 kg N / ha. The worms preserved for the trace-element analyses (4 worms per replicate) were freeze- dried, digested in nitric acid following U.S. EPA method 3052, and the tissue concentrations of 21 trace-elements were measured in individual worms via ICP-MS using Agilent 7850 in accordance with U.S. EPA method 6020 A.

[0245] Toxicity Results

[0246] There was no significant effect of treatments on mortality. For reproduction, the average number of juveniles was slightly higher in FeHAP and FeHAU treatments at 112 kg N / ha, however those increases were not statistically significant compared to Control (Fig. 22; p > 0.05 based on ANOVA and post-hoc Tukey’s). For avoidance, based on the results from repeated G- test of goodness-of-fit statistics, there was no treatment that was consistently avoided by the earthworms; however, earthworms consistently showed a preference for the soils treated with FeHAP without urea (Table 1). No significant differences for avoidance were observed at the highest N rate of 112 kg N / ha between Urea and FeHAU treatments. Significant heterogeneity among replicates was detected for the treatment comparisons with the significant total p-value. Principle components analysis concentrations of 23 trace-elements measured in earthworm tissues by inductively coupled plasma mass spectrometry (ICP-MS) showed no clear treatment effects (Fig. 23). Overall, there were no observed adverse effects in E. fetida exposed to soils from the field trial where FeHAP nanomaterials were applied.

[0247] Table 1. Avoidance results with the preferred treatments, where higher average numbers of worms were observed, are shown in bold. p-value p-Value

[0248] .... .. (Heterogeneity)

[0249] Comparisons (Total)

[0250] UF 56 vs FeHAU 56 0.0058* 0.0024*

[0251] UF 56 vs FeHAP 56 0.0149* 0.0085*

[0252] UF 112 vs FeHAU 112 0.3931 0.2962

[0253] UF 112 vs FeHAP 112 0.0120* 0.0159*

[0254] Documents cited in Example 3:

[0255] OECD (2016), Test No. 222: Earthworm Reproduction Test (Eisenia fetida / Eisenia andrei), OECD Guidelines for the Testing of Chemicals, Section 2, OECD Publishing, Paris.

[0256] Shoults-Wilson Aaron, Oksana Zhurbich, David McNear, Olga Tsyusko, Paul Bertsch and Jason Unrine. 2011. Evidence for avoidance of Ag nanoparticles by earthworms (Eisenia fetida). 20: 385-396.

[0257] All publications, patents, and patent documents are incorporated by reference herein, as though individually incorporated by reference. The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention.

Claims

CLAIMSWhat is claimed is:

1. A nanoparticle, comprising Fe (III) doped hydroxyapatite.

2. The nanoparticle of claim 1, further comprising urea, wherein urea is bonded to the Fe (III) doped hydroxyapatite.

3. The nanoparticle of any one of claims 1-2, wherein the Fe (III) doped hydroxyapatite has a Fe (III) doping percentage (mass) of about 0.5% to 10%.

4. The nanoparticle of any one of claims 1-3, wherein the Fe (III) doped hydroxyapatite has a Fe (III) doping percentage (mass) of about 2% to 4% e.g., 3%).

5. The nanoparticle of any one of claims 2-4, wherein the nanoparticle has a nitrogen (N) loading percentage (mass) of about 10%-40%.

6. The nanoparticle of any one of claims 2-5, wherein the nanoparticle has a nitrogen (N) loading percentage (mass) of about 15%-35%.

7. The nanoparticle of any one of claims 2-6, wherein the nanoparticle has a nitrogen (N) loading percentage (mass) of about 20%-30% (e.g., 23.5%).

8. The nanoparticle of any one of claims 2-7, wherein urea is bonded to the Fe (III) doped hydroxyapatite through hydrogen bonding, and / or metal-ligand bonding.

9. The nanoparticle of any one of claims 1-8, wherein the nanoparticle is an elongated nanoparticle (e.g., rod or spindle shaped).

10. The nanoparticle of claim 9, wherein the elongated nanoparticle has an aspect ratio of about 5-12.

11. The nanoparticle of any one of claims 1-10, wherein the nanoparticle has a length of about 120-250nm.

12. The nanoparticle of any one of claims 1-11, wherein the nanoparticle has a width of about 20-30nm.

13. The nanoparticle of any one of claims 1-12, wherein the Fe (III) doped hydroxyapatite has a Calcium to Fe (III) molar ratio of about 4:1 to 30: 1.

14. The nanoparticle of any one of claims 1-13, wherein the Fe (III) doped hydroxyapatite has a crystallite size of about 30-40nm.

15. A method of nutrient delivery to a plant, comprising introducing to the plant a nanoparticle according to any one of claims 1-14.

16. The method of claim 15, wherein the introducing comprises contacting the leaf of the plant with the nanoparticle.

17. A method of nutrient delivery to a plant, comprising contacting the leaf of the plant with a nanoparticle comprising Zn doped hydroxyapatite.

18. The method of claim 17, wherein the nanoparticle further comprises urea, wherein urea is bonded to the Zn doped hydroxyapatite.

19. The method of any one of claims 15-18, wherein the nanoparticle is delivered to the leaf epidermis.

20. The method of any one of claims 15-19, further comprising introducing one or more additional macronutrient or micronutrient to the plant.

21. A composition, comprising a nanoparticle according to any one of claims 1-14, and a carrier.

22. The composition of claim 21, further comprising one or more additional macronutrient (e.g., potassium and sulfur, such as potassium sulfate) or micronutrient.

Images