Oral composition

Abstract

The purpose of the present invention is to provide an oral composition capable of improving the basal metabolic rate. The present invention can improve the basal metabolic rate by combining bifidobacteria with water-soluble dietary fibers.

Description

Oral Composition

[0001] The present invention relates to an oral composition that can improve basal metabolic rate.

[0002] The amount of energy consumed by a person per day is determined by basal metabolic rate (REE, resting energy expenditure), physical activity, and diet-induced thermogenesis, of which basal metabolic rate accounts for approximately 60%. Therefore, in order to efficiently improve energy expenditure, it is desirable to increase basal metabolic rate. On the other hand, a low basal metabolic rate is prone to obesity and is a factor in inducing lifestyle-related diseases.

[0003] In recent years, the relationship between obesity and intestinal flora has become known, and it is known that the ingestion of probiotics such as bifidobacteria and lactic acid bacteria has an obesity-suppressing effect through the improvement of intestinal flora. Patent Document 1 discloses that the basal metabolic rate of mice was improved by ingestion of Bifidobacterium breve.

[0004] The mechanisms by which intestinal flora acts on obesity have been reported, including lipid absorption in the intestinal tract, inhibiting fat accumulation in adipose tissue, and the action of short-chain fatty acids produced by intestinal bacteria. Furthermore, Patent Document 2 discloses that basal metabolism can be increased by continuously taking lactic acid bacteria that increase TLR2 activity by a predetermined amount.

[0005] JP 2021-134156 A JP 2018-095569 A

[0006] Although it has been reported that the intake of probiotics can improve basal metabolic rate, the effect is still slow. To improve energy expenditure more efficiently, it is desirable to be able to further improve basal metabolic rate.

[0007] Therefore, an object of the present invention is to provide an oral composition that can improve basal metabolic rate.

[0008] As a result of extensive research, the present inventors have found that the basal metabolic rate can be improved by combining bifidobacteria with water-soluble dietary fiber. Based on this finding, the present invention was completed through further research.

[0009] That is, the present invention provides the following aspects of the invention. Item 1. An oral composition comprising bifidobacteria and water-soluble dietary fiber, wherein the intake or administration amount of the water-soluble dietary fiber is set to 4.5 g or more per day. Item 2. An oral composition comprising bifidobacteria and water-soluble dietary fiber, and used for improving basal metabolic rate. Item 3. An oral composition for improving basal metabolic rate, comprising bifidobacteria, to be ingested or administered in combination with water-soluble dietary fiber. Item 4. An oral composition for improving basal metabolic rate, comprising water-soluble dietary fiber, to be ingested or administered in combination with bifidobacteria. Item 5. The oral composition according to any one of Items 2 to 4, wherein the intake or administration amount of the water-soluble dietary fiber is set to 4.5 g or more per day. Item 6. A composition containing 1.0 x 10 bifidobacteria 10Item 10. The oral composition according to any one of Items 1 to 5, wherein the water-soluble dietary fiber is 4.5 g or more per cfu. Item 11. The oral composition according to any one of Items 1 to 6, wherein the water-soluble dietary fiber is inulin. Item 12. The oral composition according to any one of Items 1 to 6, wherein the bifidobacterium is Bifidobacterium lactis. Item 13. The oral composition according to any one of Items 1 to 8, wherein the water-soluble dietary fiber is inulin. Item 14. The oral composition according to any one of Items 1 to 6, wherein the bifidobacterium is Bifidobacterium lactis. Item 15. The oral composition according to any one of Items 1 to 8, wherein the water-soluble dietary fiber is inulin. Item 16. The oral composition according to any one of Items 1 to 6, wherein the bifidobacterium is Bifidobacterium lactis. Item 17. The oral composition according to any one of Items 1 to 6, wherein the water-soluble dietary fiber is inulin. Item 18. The oral composition according to any one of Items 1 to 6, wherein the bifidobacterium is Bifidobacterium lactis. Item 19. The oral composition according to any one of Items 1 to 8, wherein the water-soluble dietary fiber is in the form of a food or drink. Item 20. The oral composition according to Items 1 or 2, wherein the water-soluble dietary fiber is aliquoted into a container in units of a single dose, the water-soluble dietary fiber is ingested or administered n times per day (n is an integer), and the container contains the bifidobacterium and (4.5 / n) g or more of the water-soluble dietary fiber. Item 21. Item 11. A kit comprising an oral composition containing bifidobacteria and separately provided water-soluble dietary fiber, wherein the water-soluble dietary fiber is divided into single-dose containers, the water-soluble dietary fiber is ingested or administered n times per day (n is an integer), and (4.5 / n) g or more of the water-soluble dietary fiber is contained in the container. Item 12. A kit comprising an oral composition containing water-soluble dietary fiber and separately provided bifidobacteria, wherein the oral composition is divided into single-dose containers, the water-soluble dietary fiber is ingested or administered n times per day (n is an integer), and (4.5 / n) g or more of the water-soluble dietary fiber is contained in the container. Item 13. Use of a combination of bifidobacteria and a water-soluble food to produce an oral composition for improving basal metabolic rate. Item 14. Use of bifidobacteria to produce an oral composition for improving basal metabolic rate to be ingested or administered in combination with water-soluble dietary fiber. Item 15. Use of water-soluble dietary fiber for producing an oral composition for improving basal metabolic rate, to be ingested or administered in combination with bifidobacteria. Item 16. Non-therapeutic use of a combination of bifidobacteria and water-soluble dietary fiber for improving basal metabolic rate. Item 17. Non-therapeutic use of a combination of bifidobacteria for improving basal metabolic rate, to be ingested in combination with water-soluble dietary fiber. Item 18. Non-therapeutic use of water-soluble dietary fiber for improving basal metabolic rate, to be ingested in combination with bifidobacteria.Item 19. Use of a combination of bifidobacteria and water-soluble dietary fiber for use in treating a disease associated with low basal metabolic rate. Item 20. Use of bifidobacteria for use in treating a disease associated with low basal metabolic rate, by administering them in combination with water-soluble dietary fiber. Item 21. Use of water-soluble dietary fiber for use in treating a disease associated with low basal metabolic rate, by administering them in combination with bifidobacteria. Item 22. The use according to any one of Items 13 to 21, wherein the intake or administration amount of the water-soluble dietary fiber is set to 4.5 g or more per day. Item 23. The amount of bifidobacteria used is 1.0 x 10 10 Item 26. The use according to any one of Items 13 to 25, wherein the amount of water-soluble dietary fiber used is 4.5 g or more per cfu. Item 27. The use according to any one of Items 13 to 25, wherein the water-soluble dietary fiber is inulin. Item 28. The use according to any one of Items 13 to 25, wherein the bifidobacterium is Bifidobacterium lactis. Item 29. The use according to any one of Items 13 to 26, wherein the oral composition is a food or drink. Item 30. A method for administering or causing bifidobacteria and water-soluble dietary fiber to a subject in need of improving basal metabolic rate. Item 31. The method according to Item 30, wherein the amount of water-soluble dietary fiber ingested or administered is 4.5 g or more per day.

[0010] According to the present invention, the basal metabolic rate can be improved by combining bifidobacteria with water-soluble dietary fiber.

[0011] 1 shows the effect of ingestion of the oral composition of the present invention (milk drink) or a placebo on the number of bifidobacteria in feces.

[0012] The oral composition of the present invention is characterized by being configured to be ingested or administered in combination with bifidobacteria and water-soluble dietary fiber. The oral composition of the present invention encompasses oral compositions according to first to fourth embodiments. A first embodiment of the oral composition of the present invention comprises bifidobacteria and water-soluble dietary fiber, and the intake or administration amount of the water-soluble dietary fiber is set to 4.5 g or more per day. A second embodiment of the oral composition of the present invention comprises bifidobacteria and water-soluble dietary fiber and is used to improve basal metabolic rate. A third embodiment of the oral composition of the present invention is intended for improving basal metabolic rate, contains bifidobacteria, and is intended for ingestion or administration in combination with water-soluble dietary fiber. A fourth embodiment of the oral composition of the present invention is intended for improving basal metabolic rate, contains water-soluble dietary fiber, and is intended for ingestion or administration in combination with bifidobacteria. The oral compositions according to the first to fourth embodiments are also collectively referred to as the oral compositions of the present invention. The oral compositions of the present invention are described in detail below.

[0013] Bifidobacteria are not particularly limited as long as they belong to the genus Bifidobacterium. Specific examples of bifidobacteria include Bifidobacterium animalis (e.g., Bifidobacterium animalis subsp. Lactis, etc.), Bifidobacterium pseudocatenulatum, Bifidobacterium catenulatum (e.g., Bifidobacterium catenulatum subsp. Catenulatum, etc.), Bifidobacterium longum (e.g., Bifidobacterium longum subsp. Longum, Bifidobacterium longum subsp. Infantis, etc.), Bifidobacterium breve, and Bifidobacterium bifidum. bifidum), Bifidobacterium angulatum, Bifidobacterium kashiwanohense, Bifidobacterium dentium, Bifidobacterium faecale, Bifidobacterium adolescentis, and the like.

[0014] In the present invention, one of these bifidobacteria may be used alone, or two or more may be used in combination. Among these bifidobacteria, Bifidobacterium animalis is preferred, Bifidobacterium animalis subsp. lactis is more preferred, and Bifidobacterium animalis subsp. lactis GCL2505 (FERM P-21918) is particularly preferred.

[0015] In a typical embodiment of the present invention, live bifidobacteria are used.

[0016] The amount of bifidobacteria per 100 g of the oral composition of the present invention (cfu / 100 g) is not particularly limited, but may be, for example, 1.0 × 10 9 cfu / 100g or more, preferably 3.0 x 10 9 cfu / 100g or more, more preferably 5.0 x 10 9 cfu / 100g or more, more preferably 8.0 x 10 9 cfu / 100g or more, particularly preferably 1.0 x 10 10 The upper limit of the content of bifidobacteria is not particularly limited, but for example, 1.0 × 10 15 cfu / 100g or less, 1.0×10 13 cfu / 100g or less, 1.0×10 12 cfu / 100g or less, 1.0×10 11 A more specific range of the content of bifidobacteria can be set by arbitrarily combining the upper and lower limits described above, but preferably 1.0 × 10 9 ~1.0 x 10 12 cfu / 100g, more preferably 5.0 x 10 9 ~1.0 x 10 11 cfu / 100g.

[0017] Note that cfu stands for colony forming unit, and in this specification, the value is measured using MUP-added TOS propionic acid agar medium (ISO29981 / IDF220TOS), which is a propionic acid agar medium adopted as an international standard medium and is prepared by adding 5% of an aqueous solution of mupirocin (1 mg / ml), in accordance with the "Guidelines for fermented milk and lactic acid bacteria drinks using bifidobacteria" issued by the National Fermented Milk and Lactic Acid Bacteria Drinks Association in March 2014.

[0018] Water-soluble dietary fiber There are no particular limitations on the water-soluble dietary fiber, but any fiber that generally serves as a substrate for intestinal bacteria in the large intestine can be used. Specific examples of water-soluble dietary fiber include inulin, gums (thickening polysaccharides such as guar gum, locust bean gum, tara gum, carob gum, tamarind seed gum, and gum arabic), glucomannan, pectin, hemicellulose, lignin, alginic acid, polydextrose, resistant dextrin, resistant starch, fucoidan, pullulan, and psyllium.

[0019] In the oral composition of the present invention, one of these water-soluble dietary fibers may be used alone, or two or more may be used in combination. Among these water-soluble dietary fibers, inulin is preferred.

[0020] Furthermore, the inulin may be straight-chain inulin or branched-chain inulin. The origin of inulin is also not particularly limited. Examples of origins of inulin include chicory, agave, Jerusalem artichoke, onion, chive, garlic, burdock, sweet potato, banana, etc. When inulin is used as dietary fiber in the oral composition of the present invention, one of these inulins may be used alone, or two or more may be used in combination. The inulin preferably contains straight-chain inulin, and more preferably is inulin derived from chicory.

[0021] There are no particular restrictions on the content or ratio of bifidobacteria to water-soluble dietary fiber. For example, 10The amount of water-soluble dietary fiber per cfu is 4.5 g or more, preferably 4.6 g or more, more preferably 4.7 g or more, even more preferably 4.8 g or more, and even more preferably 4.9 g or more. 10 The upper limit of the amount of water-soluble dietary fiber per cfu is not particularly limited, but from the viewpoint of side effects such as abdominal discomfort caused by water-soluble dietary fiber, it is preferably 15 g or less, more preferably 10 g or less, even more preferably 8.0 g or less, even more preferably 6.0 g or less, and even more preferably 5.5 g or less. 10 A more specific range of the amount of water-soluble dietary fiber per cfu can be set by arbitrarily combining the above-mentioned upper and lower limits, and includes, for example, 4.5 g to 15 g, preferably 4.6 to 10 g, more preferably 4.7 to 8.0 g, even more preferably 4.8 to 6.0 g, still more preferably 4.9 to 5.5 g, and most preferably 5.0 g.

[0022] The content of water-soluble dietary fiber per 100 g of the oral composition of the present invention is not particularly limited, but may be, for example, 4.5 g to 15 g, preferably 4.6 to 10 g, more preferably 4.7 to 8.0 g, even more preferably 4.8 to 6.0 g, still more preferably 4.9 to 5.5 g, and most preferably 5.0 g.

[0023] Other Components The oral composition of the present invention may consist of bifidobacteria and / or water-soluble dietary fiber, and may further contain additives and / or bases depending on the formulation.

[0024] The additives and bases that may be contained in the oral composition of the present invention are not particularly limited as long as they are pharmaceutically acceptable, and examples thereof include excipients, binders, disintegrants, lubricants, isotonicity agents, plasticizers, dispersants, emulsifiers, solubilizers, wetting agents, stabilizers, suspending agents, adhesives, coating agents, glossing agents, water, oils and fats, waxes, hydrocarbons, fatty acids, higher alcohols, esters, water-soluble polymers, surfactants, metal soaps, lower alcohols, polyhydric alcohols, pH adjusters, buffers, antioxidants, UV protection agents, preservatives, corrigents, fragrances, powders, thickeners, pigments, and chelating agents. When the oral composition of the present invention contains an additive and / or base, these additives and / or bases may be used alone or in combination of two or more. The content of these additives and bases is appropriately determined depending on the type of additive and base used, the formulation form of the oral composition, and the like.

[0025] Furthermore, when the oral composition of the present invention is a food or beverage, it may further contain ingredients commonly used in foods and beverages in addition to bifidobacteria and / or water-soluble dietary fiber. Such ingredients include milk, dairy products, seaweed, fish, meat, eggs, beans, bean products, vegetables, fruits, oils and fats, grains, sugar, etc. The content of these ingredients is set appropriately depending on the type of ingredients used and the type of food or beverage.

[0026] Form / Product Classification The form of the oral composition of the present invention is not particularly limited as long as it can be orally ingested or administered, and examples thereof include solid preparations such as powders, fine granules, granules (including dry syrup), tablets, pills, capsules (soft capsules, hard capsules), etc.; semi-solid preparations such as jellies; and liquid preparations such as solutions, suspensions, syrups, etc. Product classifications of oral compositions include oral medicines, oral quasi-drugs, and foods and beverages.

[0027] When the oral composition of the present invention is in the form of a food or drink, it may be in any form, such as liquid, paste, gel, solid, or powder, and specific forms include tablet confectionery; liquid food; wheat flour products such as bread, macaroni, spaghetti, noodles, cake mix, fried chicken flour, and breadcrumbs; instant noodles, cup noodles, retort / prepared foods, canned foods, microwaveable foods, instant soup / stew, instant miso soup / cleaning liquid, canned soup, freeze-dried foods, and other foods. Instant foods and other instant foods; processed agricultural products such as canned agricultural products, canned fruit, jams and marmalades, pickles, boiled beans, dried agricultural products, and cereals (processed grain products); processed seafood products such as canned seafood, fish ham and sausages, fish paste products, seafood delicacies, and tsukudani (simmered fish dishes); processed livestock products such as canned livestock products and pastes, and livestock ham and sausages; processed milk, milk drinks, yogurt, lactic acid bacteria drinks, cheese, ice cream, infant formula, cream, and other milk products. basic seasonings such as soy sauce, miso, sauces, processed tomato seasonings, mirin, vinegars, spices, etc.; specialized seasonings such as cooking mixes, curry roux, sauces, dressings, noodle soup, and other compound seasonings; frozen foods such as frozen ingredients, semi-cooked frozen foods, and cooked frozen foods; sweets such as caramel, candy, chewing gum, chocolate, cookies, biscuits, cakes, pies, snacks, crackers, Japanese sweets, rice snacks, bean snacks, dessert sweets, jelly, and other sweets; beverages such as carbonated drinks, natural fruit juice, fruit juice drinks, soft drinks with fruit juice, fruit pulp drinks, fruit drinks with fruit particles, vegetable drinks, soy milk, soy milk drinks, coffee drinks, tea drinks, powdered drinks, concentrated drinks, sports drinks, nutritional drinks, alcoholic drinks, and other beverages; and other commercially available foods such as baby food, furikake, and ochazuke nori seaweed.

[0028] A preferred product category of food and beverages is functional food, which means food that has a certain functionality for the living body, and examples thereof include functional health foods such as foods for specified health uses (including conditionally designated foods for specified health uses [FOSHU]) and foods with nutrient function claims, foods with functional claims, foods for special dietary uses, nutritional supplements, health supplements, supplements (e.g., tablets, coated tablets, sugar-coated tablets, capsules, liquids, etc.), and beauty foods (e.g., diet foods and beverages).Functional foods may also be special-purpose foods and beverages such as foods and beverages for the sick, powdered milk for pregnant and nursing women, infant formula, foods and beverages for the elderly, and foods and beverages for caregivers.

[0029] The oral composition according to the first embodiment of the present invention may be divided into containers each containing a single dose of water-soluble dietary fiber. Specifically, when the oral composition according to the first embodiment is to be ingested or administered n times a day (n is an integer, for example, an integer from 1 to 3, an integer from 1 to 2, or 1), the oral composition may contain bifidobacteria and (4.5 / n) g or more of water-soluble dietary fiber and be contained in a container. Furthermore, when n>1, the oral composition contained in the container according to this embodiment can be provided as a set of n pieces.

[0030] Furthermore, the oral composition according to the third embodiment may be, for example, a form in which the oral composition containing bifidobacteria is accompanied by instructions to be ingested or administered in combination with water-soluble dietary fiber as an intake or administration method for improving basal metabolic rate, or may be a form in which the oral composition containing bifidobacteria is packaged as a kit together with separately provided water-soluble dietary fiber (the separately provided material may consist solely of water-soluble dietary fiber, or may contain water-soluble dietary fiber and the other components described above), accompanied by instructions to be ingested or administered in combination with water-soluble dietary fiber as an intake or administration method for improving basal metabolic rate. In this kit, the separately provided water-soluble dietary fiber may be divided into containers each containing a single dose of water-soluble dietary fiber. Specifically, when the oral composition according to the third embodiment is to be ingested or administered n times a day (n is an integer, for example, an integer from 1 to 3, an integer from 1 to 2, or 1), the water-soluble dietary fiber provided separately may be in a form in which the water-soluble dietary fiber is contained in a container in amounts of (4.5 / n) g or more, and further, when n>1, the water-soluble dietary fiber provided separately in a container in this form can be provided as a set of n pieces.

[0031] Similarly, the oral composition according to the fourth embodiment may be, for example, a form in which the oral composition containing water-soluble dietary fiber bacteria is accompanied by instructions to be taken or administered in combination with bifidobacteria as an intake or administration method for improving basal metabolic rate, or a form in which the oral composition containing water-soluble dietary fiber bacteria is packaged as a kit together with separately attached bifidobacteria (the separately attached material may consist solely of bifidobacteria, or may contain bifidobacteria and the other components described above), accompanied by instructions to be taken or administered in combination with bifidobacteria as an intake or administration method for improving basal metabolic rate. In this kit, the oral composition containing water-soluble dietary fiber bacteria may be divided into containers each containing a single dose of water-soluble dietary fiber. Specifically, when the oral composition according to the fourth embodiment is to be ingested or administered n times a day (n is an integer, for example, an integer from 1 to 3, an integer from 1 to 2, or 1), the oral composition may contain (4.5 / n) g or more of water-soluble dietary fiber and be housed in a container, and further, when n>1, the oral composition housed in a container according to the fourth embodiment can be provided as a set of n pieces.

[0032] The oral composition of the present invention can improve basal metabolic rate by taking or ingesting it. Therefore, the oral composition of the present invention can be used to improve basal metabolic rate. The basal metabolic rate is specifically resting energy expenditure (REE) and is calculated by the formula (1) described below.

[0033] The oral composition of the present invention is designed to be ingested or administered in combination with bifidobacteria and water-soluble dietary fiber, thereby improving basal metabolic rate. Therefore, the oral composition of the present invention can be used for various purposes related to improving basal metabolic rate, such as anti-obesity, weight loss, body fat reduction, and visceral fat reduction. The oral composition of the present invention can be applied not only to obese individuals (e.g., those with a BMI of 25 or more, preferably those with a BMI of 25 or more but less than 30) but also to non-obese individuals.

[0034] Since the oral composition of the present invention has an excellent effect of improving basal metabolic rate, it can effectively improve basal metabolic rate without concurrent exercise. Therefore, the oral composition of the present invention can be applied to subjects who do not engage in exercise to increase basal metabolic rate.

[0035] There are no particular limitations on the gender and age of the target of the oral composition of the present invention, but the target is preferably an adult (18 years or older), more preferably 25 to 61 years old.

[0036] Dosage and Administration The oral composition of the present invention effectively improves basal metabolic rate, so the intake or administration amount of bifidobacteria is, for example, 1.0 × 10 per day. 9 The intake or administration amount of the bifidobacteria can be set to 1.0 × 10 cfu / 100 g or more per day. 9 ~1.0 x 10 12 cfu / 100g, preferably 5.0 to 10 9 ~1.0 x 10 11 cfu / 100g. This intake or dosage is applicable to one human.

[0037] In order to enhance the effect of improving basal metabolic rate, it is particularly preferable that the intake or administration amount of water-soluble dietary fiber of the oral composition of the present invention be set to 4.5 g or more per day. More specific ranges for the intake or administration amount of the water-soluble dietary fiber include preferably 4.5 to 15 g, more preferably 4.6 to 10 g, even more preferably 4.7 to 8.0 g, and even more preferably 4.9 to 5.5 g per day. This intake or administration amount can be applied to one human.

[0038] Furthermore, the oral composition of the present invention has a daily intake or administration amount of water-soluble dietary fiber of, for example, 0.025 g / kg or more, preferably 0.030 to 0.223 g / kg, more preferably 0.045 to 0.148 g / kg, and even more preferably 0.056 g / kg to 0.095 g / kg.

[0039] The oral composition of the present invention can be taken, for example, 1 to 3 times, 1 to 2 times, or once a day so as to achieve the above-mentioned intake or dosage. The timing of administration is not particularly limited, and the composition may be taken before, during, or after meals, or between meals, but after meals is preferred.

[0040] Furthermore, it is preferable that the oral composition of the present invention be taken or ingested continuously, and the period of taking or ingesting the composition may be, for example, one week or more, preferably two weeks or more, more preferably three weeks or more, and even more preferably four weeks or more.

[0041] 1. Materials and Methods 1-1. Subject Selection This study was approved by the Ethics Committee of Takara Clinic, Seishinkai Medical Corporation, on September 20, 2023. Written informed consent was obtained from all subjects in accordance with the Declaration of Helsinki. Subjects were Japanese men and women aged 25 to 61 years at the time of consent, who met the inclusion criteria, did not fall under the exclusion criteria, and were deemed eligible by the principal investigator.

[0042] The inclusion criteria were: (1) healthy individuals, and (2) a BMI of 25 kg / m 2 More than 30kg / m 2 (3) those with a body fat percentage of 15% or more for men and 25% or more for women; and (4) those who met the inclusion criteria (1) to (3) but did not meet the exclusion criteria, and the top 44 individuals with the lowest resting energy metabolism were selected.

[0043] The exclusion criteria were: (1) those currently receiving treatment for or with a history of malignant tumors, heart failure, or myocardial infarction; (2) those with a pacemaker or implantable cardioverter defibrillator; (3) those currently receiving treatment for arrhythmia, liver damage, kidney damage, cerebrovascular disease, rheumatism, diabetes, dyslipidemia, hypertension, or other chronic diseases; (4) those taking a specified health food or a functional food; (5) those taking medicines (including herbal medicines) or supplements; (6) those with allergies (to medicines or foods related to the test food); (7) those who are pregnant, breastfeeding, or intend to become pregnant during the study period; (8) those who have participated in other clinical trials in the 28 days prior to obtaining the consent form, or those who plan to participate during the study period; (9) those who have taken antibiotics in the 28 days prior to obtaining the consent form; and (10) those who the principal investigator deemed to be unsuitable for this study.

[0044] 1-2. Subject Management (1) Subjects consumed the designated diet for breakfast and lunch the day before each test. Other than the designated diet, they were only allowed to consume water. (2) Subjects stayed at the designated accommodation facility from the evening before the test. Subjects consumed the designated dinner at the accommodation facility no later than 12 hours before the start of the test the next day. Other than the designated diet, they were only allowed to consume water. (3) Upon visiting the hospital, subjects' physical condition was ascertained through a medical interview. (4) During the study period, the subjects' intake of the test food and whether they were menstruating (females only) were recorded daily in a diary designated by the contracted clinical trial organization. (5) Subjects were required to strictly adhere to the following points during their study participation: (a) Intake of the test food according to the prescribed dosage and administration. Daily intake of inulin was 5 g (0.056 g / kg to 0.095 g / kg). (b) During the study period, subjects were to consume the test food continuously for a total of 80% or more of the total target intake days. (c) From the date of obtaining the consent form for the study until the final test (test 4 weeks after intake), avoid overeating and do not change your previous lifestyle habits. (d) Avoid drinking alcohol or excessive exercise from 3 days before each test until the end of the test on the day. (e) If any changes in your physical condition occur during the study period, immediately contact the contracted clinical trial organization and ask for instructions on how to proceed. (f) During the study period, avoid consuming foods for specified health uses, foods with functional claims, fermented foods such as yogurt, kimchi, and natto, or other foods / drinks that may have functional properties, as much as possible. (g) Refrain from consuming drinks with a high caffeine content (energy drinks, coffee, etc.) 3 days before the test, and refrain from consuming drinks containing caffeine the day before the test.

[0045] 1-3. Test Foods As test foods for the examples, a milk drink containing skim milk powder, high fructose corn syrup, sucrose, yeast extract, an acidulant, a stabilizer, and a flavoring was added to a milk drink containing Bifidobacterium animalis subsp. lactis GCL2505 (1.0 × 10 10 cfu / 100g) and chicory-derived inulin (Orafti (R)An oral composition containing Bifidobacterium animalis subsp. lactis GCL2505 and chicory-derived inulin (GR) (5.0 g / 100 g) was prepared. As a placebo, a milk drink was prepared that did not contain Bifidobacterium animalis subsp. lactis GCL2505 or chicory-derived inulin, but instead was adjusted by adding food-grade acetic acid and lactic acid so that the flavor and pH were equivalent to those of the test foods used in the above examples. Details of the ingredients and nutritional composition of these test foods are shown in Table 1.

[0046]

[0047] 1-4. Study design This study was conducted as a randomized, placebo-controlled, double-blind, parallel-group comparative study. The allocation ratio for each group was 1:1, and randomization was performed using a block randomization method with random block size.

[0048] Subjects in the Example group and placebo group ingested 100g of the test food (milk drink) once a day for four consecutive weeks. The daily inulin intake for the Example group was 5g. The double-blind study was performed by labeling the test food only with an identification number. The evaluation items were resting energy metabolism at weeks 2 and 4, body weight, BMI, body fat percentage, and muscle mass at weeks 2 and 4, and fecal bifidobacteria count at week 4.

[0049] 1-5. Indirect calorimetry In the morning of the test day, participants' oxygen intake (VO2) and carbon dioxide output (VCO2) were measured using a respiratory gas analyzer (AE310S, Minato Medical Science, Osaka). The subjects rested for at least 30 minutes while seated at a comfortable room temperature, and then measurements were taken for 15 minutes. Resting energy expenditure (REE) was calculated using the following formula (1):

[0050]

[0051] 1-6. Measurement of muscle mass Muscle mass was measured using a body composition analyzer.

[0052] 1-7. Measurement of Bifidobacteria in Fecal Samples Fecal samples were submitted at weeks 0 and 4. Bacterial DNA was extracted from the fecal samples. Specifically, 0.2 g of fecal sample, 700 μL of FE1 buffer, and 10 μL of RNase were added to the tube containing the beads. Cells were disrupted by running a FastPrep-24 instrument (MP Biomedicals) at a speed of 6 m / s for 1 minute. This process was repeated three times, during which the sample was kept at room temperature for 5 minutes. Next, 90 μL of FE2 buffer was added to the sample and centrifuged at 12,000 x g for 15 minutes. The supernatant (up to 500 μL) was collected, and 0.4 volumes of FB buffer and isopropanol were added. Finally, the sample was loaded onto a spin column and washed according to the manufacturer's instructions. The purified DNA was eluted from the column with 50 μL of Tris-EDTA buffer (pH 8.0). Real-time polymerase chain reaction (PCR) was performed using genus-specific primers capable of detecting Bifidobacteria, including GCL2505. The primer sequences were: sense primer GATTCTGGCTCAGGATGAACGC (SEQ ID NO: 1) and antisense primer CTGATAGGACGCGACCCCAT (SEQ ID NO: 2). Each PCR reaction mixture contained 20 pmol of each primer and 5 μL of SYBR 1000 in a total volume of 10 μL. (R) The premix contained Ex taq (Takara Bio) and 1 μL of DNA solution.

[0053] 1-8. Statistical Analysis All measurements were expressed as mean values ​​and standard deviations (SD). All statistical analyses were performed by IBM. (R) SPSS (R)Statistics were performed using Statistics 23 (IBM Corp., Armonk). A P value of <0.05 was used as the threshold for determining significance. Missing data were treated as missing values, and no surrogate values ​​were used. Unpaired t-tests were used to assess baseline bias at the start of the study between subjects in both groups. Subjects' indirect calorimetry and muscle mass during the study period were compared between groups using a mixed-effects model for repeated measures (MMRM) based on restricted maximum likelihood (REML). The mean structure of the model, except for BMI, included time, group (active or placebo), sex, baseline value, baseline BMI value, and interactions between time and group and between baseline value and time. A completely unstructured variance-covariance matrix was assumed for the error term. Fecal bifidobacterial counts were compared within groups using paired t-tests, and between-group comparisons were performed using covariate analysis with baseline (week 0) values ​​as covariates.

[0054] 2. Results 2-1. Subjects (Analysis Population) 81 participants were screened for this study. 44 participants were selected as subjects after screening. 22 were assigned to the placebo group and the example group, respectively. One subject from the placebo group withdrew for personal reasons before the end of the study. After the completion of the entire study, three subjects whose total number of days of test food intake was less than 80% of the target total number of days were excluded in accordance with the participant management criteria (5)(b) (n = 1 from the placebo group, n = 2 from the example group). Therefore, a total of 40 subjects, consisting of 20 from the placebo group and 20 from the example group, were set as the analysis population. There were no differences in the baseline characteristics of the analysis population (Table 2).

[0055]

[0056] 2-2. Indirect calorimetry The evaluation score for the improvement in basal metabolic rate due to the ingestion of the test food was calculated using the following formula. A higher evaluation score indicates a greater improvement in basal metabolic rate.

[0057] The obtained evaluation value and R T and R P The p-values ​​for the group comparisons with the RT0 -R P0 The actual value was 1.8 kcal / day.

[0058]

[0059] As shown in Table 3, a significant improvement in basal metabolic rate was observed from week 2 onwards by taking the food of the Example. Furthermore, it was also observed that the effect of improving REE in the Example group was significant compared to the placebo group.

[0060] 2-3. Fecal Bifidobacterial Count The quantified fecal bifidobacterial count was logarithmically transformed for analysis (Figure 1). Between-group comparison at week 4 revealed a significant increase in the total number of bifidobacteria in the experimental group (11.5±0.9 log cells / g feces) compared to the placebo group (11.3±1.2 log cells / g feces) (p=0.037). Within-group comparison, a statistically significant increase in the total number of bifidobacteria in the experimental group at week 4 compared to week 0 (10.5±2.0 log cells / g feces) was confirmed (p=0.013). Meanwhile, the fecal bifidobacterial count in the placebo group did not change during the study period (week 0: 11.3±1.0 log cells / g feces).

[0061] 2-4. Muscle mass Changes in muscle mass of the subjects are shown in Table 4.

[0062] As shown in Table 4, there was essentially no change in muscle mass.

[0063] 2-5. Summary The food products of the Examples were found to have an excellent effect of improving basal metabolic rate. Therefore, it can be reasonably inferred that by continuing to ingest the foods of the Examples in order to maintain the improved basal metabolic rate, a fat-reducing effect will be achieved. Furthermore, since there was no change in muscle mass, which affects basal metabolic rate, during the test period, it was found that the test foods of the Examples improved basal metabolic rate independently of exercise.

Claims

1. An oral composition comprising bifidobacteria and water-soluble dietary fiber, the intake or administration amount of the water-soluble dietary fiber being set to 4.5 g or more per day.

2. An oral composition containing bifidobacteria and water-soluble dietary fiber, which is used to improve basal metabolic rate.

3. An oral composition for improving basal metabolic rate, which contains bifidobacteria and is to be ingested or administered in combination with water-soluble dietary fiber.

4. An oral composition for improving basal metabolic rate, which contains water-soluble dietary fiber and is to be ingested or administered in combination with bifidobacteria.

5. An oral composition according to any one of claims 2 to 4, wherein the intake or administration amount of the water-soluble dietary fiber is set to 4.5 g or more per day.

6. 1.0 x 10 Bifidobacteria 10 5. The oral composition of claim 1, wherein the amount of water-soluble dietary fiber is 4.5 g or more per cfu.

7. An oral composition according to any one of claims 1 to 4, wherein the water-soluble dietary fiber is inulin.

8. An oral composition according to any one of claims 1 to 4, wherein the bifidobacterium is Bifidobacterium lactis.

9. An oral composition according to any one of claims 1 to 4, which is a food or beverage.

Images