Use of stemphylium lycopersici mycovirus capsid protein slav1-CP in improvement of plant defense capabilities

By using the SlAV1-CP capsid protein of the tomato creeping mold fungus to activate the plant's immune response, the problem of controlling tomato gray leaf spot, tomato bacterial spot, and tobacco mosaic virus in existing technologies has been solved, achieving highly efficient control of a variety of plant diseases.

WO2025261197A1PCT designated stage Publication Date: 2025-12-26HUNAN AGRI UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/099850
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-17
Filing Date
2025-06-09
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control tomato gray leaf spot, tomato bacterial spot, and tobacco mosaic virus. Chemical control methods suffer from resistance issues and are ineffective, while biological control methods, such as the application of fungi and viruses, pose risks.

Method used

The tomato creeping mold virus coat protein SlAV1-CP was used as a plant immune activator, and the plant immune response was activated by spraying the solution, thereby improving the plant's ability to defend against diseases.

Benefits of technology

It significantly improves the disease resistance of plants, reduces pathogen infection, and enables effective control of various plant diseases, providing research and development materials for novel plant immune inducers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025099850_26122025_PF_FP_ABST
    Figure CN2025099850_26122025_PF_FP_ABST
Patent Text Reader

Abstract

The use of Stemphylium lycopersici mycovirus capsid protein SlAV1-CP, a gene encoding SlAV1-CP or a biomaterial containing the gene encoding SlAV1-CP in the improvement of plant defense capabilities. The present invention can activate the immune response of plants and improve the expression level of defense-related genes in plants, thereby inducing the generation of disease resistance in the plants and reducing infections of pathogenic bacteria.
Need to check novelty before this filing date? Find Prior Art

Description

Application of tomato Stemphylium fungal virus coat protein SlAV1-CP in improving plant defense capability TECHNICAL FIELD

[0001] The present application relates to the field of biology, in particular to the application of tomato Stemphylium fungal virus coat protein SlAV1-CP in improving plant defense capability. BACKGROUND

[0002] Tomato gray leaf spot is a new fungal disease that has occurred and spread in recent years, and the incidence rate has increased year by year. The pathogen is a fungus in the phylum Deuteromycota, class Hyphomycetes, and the genus Stemphylium, mainly caused by Stemphylium solani and S. lycopersici. The disease occurs worldwide, especially in warm and humid areas. In recent years, it has occurred in the spring and summer in the south and north of China, especially in early spring in protected cultivation, causing quality decline and yield reduction of 20%-80% in tomato, and causing serious impact on tomato production.

[0003] Traditional tobacco mosaic virus (TMV) is the pathogen of tobacco mosaic disease, belonging to the Tobamovirus group. TMV has a wide host range and can infect more than 400 plants in 38 families. When TMV infects plants, its genetic material invades the cells of the infected plants and rapidly replicates. Since tobacco does not have complete defense capability and system against the virus, the infected plants remain in a diseased state. The destruction of chlorophyll in the diseased plants weakens the photosynthesis of the plants, making them unable to grow healthily, leading to deformity, dwarfing, and even death, and the tobacco leaves have no value, causing billions of dollars of loss worldwide every year.

[0004] Tomato bacterial spot is a disease caused by Pseudomonas syringae pv. tomato and occurs on tomatoes. It is one of the important diseases that harm tomato production worldwide. It mainly damages leaves, stems, flowers, petioles, and fruits, especially the leaf margins and immature fruits. The growth of diseased plants is slow, and the enlargement of fruits is hindered, seriously affecting fruit quality. After the disease occurs, the yield is reduced by 10-30%, and the yield in severe plots is reduced by more than 50%.

[0005] The reduction of crop yield caused by pathogenic organisms has become a serious challenge to global food security. The main method for preventing and treating tomato gray leaf spot, tomato bacterial spot, and tobacco mosaic virus disease is chemical control. Long-term and large-scale use of chemical pesticides can cause the pathogen to develop drug resistance and harm the environment and human health. Moreover, the main agents for preventing and treating bacterial diseases in production are antibiotics and copper preparations, and there are few effective anti-plant virus agents, and the prevention and treatment effect is not good. Therefore, biological control is increasingly valued.

[0006] Fungal viruses are a class of viruses that use fungi as hosts and are ubiquitous in fungi. A small number of viruses that infect plant pathogenic fungi can significantly reduce the pathogenicity of fungi. This type of fungal virus is called low-toxic fungal virus and has the potential for biological control of plant diseases. In China, fungal viruses have been applied to biological control of plant diseases and have entered the application stage. In 2023, Professor Jiang Daohong's team at Central China Agricultural University developed three kinds of microbial agents, "green oil treasure" (for rape), "green rice treasure" (for rice), and "green wheat treasure" (for wheat), by using fungal viruses to develop plant vaccines. By using them to treat seeds, sowing and disease prevention can be integrated to promote the healthy growth of crops. In recent years, with the in-depth study of molecular plant pathology, it has been found that many elicitors can activate plant immune responses and make plants produce strong and persistent resistance to pathogens. Based on this, the development of plant immune elicitors (plant immune activators) for plant diseases has also become a research hotspot. The development and use of plant immune elicitors (plant immune activators) is a green and environmentally friendly way to control plant diseases. The present application aims to develop the coat protein of fungal virus as a new elicitor to effectively control plant diseases. SUMMARY

[0007] The purpose of the present application is to provide the application of tomato Botrytis cinerea virus coat protein SlAV1-CP in improving the defense ability of plants to solve the problems existing in the prior art. The tomato Botrytis cinerea virus coat protein SlAV1-CP provided by the present application can effectively improve the defense ability of plants and ultimately achieve the prevention and control of diseases.

[0008] To achieve the above purpose, the present application provides the following scheme:

[0009] The present application provides the application of tomato Botrytis cinerea virus coat protein SlAV1-CP, coding gene SlAV1-CP or biological material containing coding gene SlAV1-CP in improving the defense ability of plants. The amino acid sequence of the tomato Botrytis cinerea virus coat protein SlAV1-CP is shown in SEQ ID NO. 1, or a sequence with more than 50% homology with the sequence shown in SEQ ID NO. 1. The nucleotide sequence of the coding gene SlAV1-CP is shown in SEQ ID NO. 2, or a sequence with more than 70% homology with the sequence shown in SEQ ID NO. 2.

[0010] Preferably, the defense ability includes but is not limited to disease resistance.

[0011] Preferably, the disease resistance includes but is not limited to the ability to resist fungal diseases, bacterial diseases, viral diseases or oomycete diseases.

[0012] Preferably, the plant includes but is not limited to tomato, tobacco or pepper.

[0013] Preferably, the biological material includes but is not limited to a recombinant vector, an expression cassette or a recombinant bacteria.

[0014] Preferably, the fungal disease is tomato gray leaf spot disease; the bacterial disease is tomato bacterial spot disease; and the viral disease is tobacco mosaic disease.

[0015] The application provides a method for improving the defense ability of a plant, comprising the step of spraying the plant with a solution containing tomato Slay fungus virus coat protein SlAV1-CP.

[0016] Further preferably, the concentration of the tomato Slay fungus virus coat protein SlAV1-CP in the solution is 0.03 mg / mL.

[0017] Preferably, the plant includes tomato, tobacco or pepper.

[0018] The application provides application of tomato Slay fungus virus coat protein SlAV1-CP, a coding gene SlAV1-CP or a biological material containing the coding gene SlAV1-CP in preparation of a plant immune activator, wherein the amino acid sequence of the tomato Slay fungus virus coat protein SlAV1-CP is shown in SEQ ID NO. 1, and the nucleotide sequence of the coding gene SlAV1-CP is shown in SEQ ID NO. 2.

[0019] The application provides a plant immune activator, wherein the effective component of the plant immune activator includes tomato Slay fungus virus coat protein SlAV1-CP, and the amino acid sequence of the tomato Slay fungus virus coat protein SlAV1-CP is shown in SEQ ID NO. 1.

[0020] The application discloses the following technical effects:

[0021] The tomato Slay fungus virus coat protein SlAV1-CP, the coding gene SlAV1-CP or the biological material containing the coding gene SlAV1-CP provided by the application can activate the immune response of a plant, improve the expression amount of defense-related genes (SlNPR1, SlPR1, NtPR1 and CaPR1) in the plant, induce the plant to produce disease resistance, reduce the invasion of pathogenic bacteria, provide a new way for improving the disease resistance of a plant, and provide a new material for research and development of a new plant immune inducer (plant immune activator). Moreover, the protein has been verified in a plurality of plants, and has the effect of improving the disease resistance of a plant, and thus can be applied to the prevention and treatment of a plurality of plant diseases. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description only need to be some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0023] Figure 1 is a SDS-PAGE detection chart of SlAV1-CP protein after purification (A) and a SDS-PAGE detection chart of empty vector protein EV after purification (B); wherein M is a protein maker, S is a precipitate after cell disruption, P is a supernatant after cell disruption, FT is a flow-through liquid of Ni column, E0-E300 is a 0-300 mM imidazole concentration gradient elution liquid; SlAV1-CP is SlAV1-CP protein, and EV is empty vector protein EV;

[0024] Figure 2 is a WB detection chart of SlAV1-CP protein and empty vector protein EV after purification; SlAV1-CP is SlAV1-CP protein, and EV is empty vector protein EV;

[0025] Figure 3 is a chart of expression of plant defense-related genes after different treatments; wherein A is a chart of expression of SlNPR1, B is a chart of expression of SlPR1a, C is a chart of expression of CaPR1, and D is a chart of expression of NtPR1; SlAV1-CP is SlAV1-CP protein, and EV is empty vector protein EV;

[0026] Figure 4 is a chart of results of resistance reaction of tomato to Peronophythora litchii after spraying different proteins on tomato leaves; wherein A is spraying 1×PBS, B is spraying empty vector protein EV, and C is spraying SlAV1-CP protein; SlAV1-CP is SlAV1-CP protein, and EV is empty vector protein EV;

[0027] Figure 5 is a chart of disease incidence (A) and disease index (B) of tomato under different treatments; SlAV1-CP is SlAV1-CP protein, and EV is empty vector protein EV;

[0028] Figure 6 is a chart of results of resistance reaction of Arabidopsis to Pseudomonas syringae PstDc3000 after spraying different proteins on Arabidopsis leaves; wherein A is spraying 1×PBS buffer, B is spraying empty vector protein EV, and C is spraying SlAV1-CP protein; SlAV1-CP is SlAV1-CP protein, and EV is empty vector protein EV;

[0029] Figure 7 is a graph showing the results of inducing resistance response of Nicotiana attenuata to tobacco mosaic virus after spraying different proteins on Nicotiana attenuata leaves; wherein A is spraying 1x PBS buffer, B is spraying empty protein EV, C is spraying SlAV1-CP protein; SlAV1-CP is SlAV1-CP protein, and EV is empty protein EV. DETAILED DESCRIPTION

[0030] The detailed description set forth below is intended as a description of various example embodiments of the application and is not intended to represent the only embodiments in which the application can be practiced. The detailed description is intended to be read with the understanding that both the comprehensive and careful presentation of the details as well as the careful presentation of the completely detailed description are not intended to limit the scope of the application but merely explain the certain aspects, features and embodiments of the application.

[0031] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, the use of the term “about” in relation to a value or a range of values is intended to include each and every value, intermediate value, and sub-range within the range of values. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application.

[0033] Many modifications and variations of this application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in scope by the specific embodiments described herein. The specific embodiments are provided for the purpose of example and illustration only and are not intended to limit the scope of the application.

[0034] As used herein, the terms “comprises”, “comprising”, “includes”, “including”, “has”, “having” and the like are open-ended terms that are intended to permit but not limit the inclusion of elements, integers, components, materials, steps, and the like.

[0035] The strain of Saccharopolyspora verticillioides SvHN-02 is isolated from the leaves of lettuce with leaf spot disease; the specific isolation method is described in detail in Chinese patent application 202011153985.3; the above-mentioned strain is preserved by Hunan Agricultural University and is committed to be open to the public for 20 years from the date of application of the present application.

[0036] A new low-toxic virus, SlAV1, was found in A. solani by our research group. It can cause the loss of pathogenicity of A. solani by interfering with the biosynthesis of the pathogenic related toxin Altersolanol A. The A. solani with SlAV1 virus or the A. solani with integrated SlAV1 virus coat protein gene sequence can be transformed from pathogenic bacteria to biocontrol bacteria, which can be used as "plant vaccine" to improve the resistance of plants to strong toxic A. solani strains. However, directly using virus-carrying fungi for biological control has the risk of fungi losing pathogenicity due to the loss of virus. The strain of the fungus with the virus gene lost pathogenicity involves the application of transgenic microorganisms, which needs to be safety evaluated and cannot be directly applied at present. With the deepening of the research, it is found that the activation of plant immune function is actually the coat protein of SlAV1 virus, which can be used as an elicitor to induce plant to produce disease resistance.

[0037] Example 1 Prokaryotic expression and purification of SlAV1-CP protein

[0038] 1. Construction of SlAV1-CP prokaryotic expression vector

[0039] The specific operation process is as follows:

[0040] (1) Extraction of tomato A. solani fungal virus SlAV1 dsRNA

[0041] The extraction of virus dsRNA adopts cellulose CF-11 affinity chromatography. The specific extraction method is as follows:

[0042] A. The mycelium after 5 days of oscillation culture was filtered and dried, then ground into powder with liquid nitrogen, 0.1 g of powder was loaded into a 2 mL centrifuge tube, 700 μL of STE buffer was immediately added, and oscillated for 3 min;

[0043] B. Add 700 μL of RNA extraction phenol, oscillate for 3 min, and centrifuge at 12000 rpm for 3 min at 4°C;

[0044] C. Take the supernatant, add 700 μL of chloroform and isoamyl alcohol mixture (the volume ratio of chloroform and isoamyl alcohol in the mixture is 24:1), oscillate for 3 min, and centrifuge at 12000 rpm, 4°C for 3 min;

[0045] D. Take the supernatant, combine two tubes into one tube with a total of 1 mL, add 0.1 g of cellulose powder, 200 μL of anhydrous ethanol, oscillate for 5 min, and precipitate on ice for 5 min, continue to oscillate for 5 min, and centrifuge at 12000 rpm, 4°C for 3 min;

[0046] E. Remove the supernatant, add 1 mL of TE buffer and 200 μL of anhydrous ethanol, oscillate for 2 min, and centrifuge at 12000 rpm, 4°C for 3 min;

[0047] F. Remove supernatant, add 420 μL TE buffer, shake well for 3 min, centrifuge at 12000 rpm, 4°C for 3 min;

[0048] G. Take 400 μL supernatant, add equal volume of isopropanol, precipitate at -20°C for 1 h, centrifuge at 12000 rpm, 4°C for 15 min;

[0049] H. Remove supernatant, add 1 mL 70% (volume percentage) ethanol, centrifuge at 12000 rpm, 4°C for 10 min, remove supernatant, repeat once;

[0050] I. After the precipitate is dried, add 50 μL DEPC water to dissolve, and add 1 / 5 volume of DNA buffer, 2 μL DNase I and 1 μL S1 Nuclease, incubate at 37°C water bath for 40 min to obtain dsRNA extract;

[0051] J. Take 5 μL dsRNA extract for electrophoresis in 1% agarose gel, observe dsRNA band, and take a photo for preservation.

[0052] (2) Synthesis of cDNA

[0053] Reverse transcription according to the instructions of MightyScript First-Strand cDNA Synthesis Master Mix Kit of Shanghai Bioengineering, the specific operation method is as follows:

[0054] A. Add RNA 3 μL, Oligo dT 1.5 μL, DMSO 2 μL in a PCR tube;

[0055] B. After denaturation at 99°C for 3 min, quickly take the PCR tube and cool on ice;

[0056] C. Add 5 μL gDNA digester Mix 3 μL in the PCR tube, and supplement ddH2O to 15 μL;

[0057] D. Centrifuge briefly and mix, incubate at 42°C for 15 min;

[0058] E. Add 4x III M-MLV RT Mix 5 μL in the above PCR tube;

[0059] F. Perform reverse transcription reaction at 25°C for 5 min, 55°C for 15 min, and 85°C for 5 min;

[0060] G. The cDNA obtained by the above reaction is stored at -20°C for standby

[0061] (3) PCR product ligation and cloning sequencing

[0062] According to the sequence of SlAV1-CP gene, specific primers SlAV1-CP-F and SlAV1-CP-R were designed, wherein the nucleotide sequence of SlAV1-CP-F is ATGGCGACGTTTGGAAGTG (SEQ ID NO. 3), and the nucleotide sequence of SlAV1-CP-R is GATGACACCAGAAGCCCTAC (SEQ ID NO. 4); the cDNA obtained above was used as a template, and PCR amplification was performed using SlAV1-CP-F and SlAV1-CP-R. After the PCR product was recovered and purified, it was connected to a pMD18-T vector to obtain a pMD18-T-SlAV1-CP plasmid, and the plasmid was transformed into E. coli DH5α competent cells. A single colony was picked and amplified using M13 vector universal primers for detection, and the sequence was verified by Sanger sequencing. Each viral fragment was ensured to have more than 3 repeats.

[0063] (4) Cloning of SlAV1-CP gene and construction of vector

[0064] The nucleic acid sequence of the SlAV1-CP gene is shown in SEQ ID NO. 2, and the sequence is synthesized by Shanghai Generay. The pMD18-T-SlAV1-CP plasmid was used as a template, and primers PET32a-SlAV1-CP-T-F / R (the underlined part is the sequence of the 5' end of the primer, which is added on both sides of the ECORI enzyme cutting site of the PET32a prokaryotic expression vector) were used to amplify the SlAV1-CP full sequence, which was sequenced.

[0065] The nucleotide sequence of the upstream primer PET32a-SlAV1-CP-F is shown in SEQ ID NO. 5, and is specifically 5'-TATCGGATCCGAATTCATGGCGACGTTTGGAAGTGC-3'; the underlined part is the homologous arm of the PET32a vector.

[0066] The nucleotide sequence of the downstream primer PET32a-SlAV1-CP-R is shown in SEQ ID NO. 6, and is specifically 5'-GACGGAGCTCGAATTCGATGACACCAGAAGCCCTACCAAC-3'; the underlined part is the homologous arm of the PET32a vector.

[0067] The PCR amplification reaction system (50 μL) was as follows: 2x Phanta Max Buffer 25 μL, dNTP Mix (10 Mm each) 1 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, template cDNA 80 ng, and water to 50 μL.

[0068] Amplification was performed under the following conditions: 5 minutes of pre-denaturation at 94°C, 30 seconds of denaturation at 94°C, 30 seconds of annealing at 55°C, 90 seconds of extension at 72°C, 35 cycles, and 10 minutes of final extension at 72°C.

[0069] wherein the full-length protein sequence of the SlAV1-CP protein is shown as SEQ ID NO. 1, specifically: MATFGSAEAYRAAQLAAIELMTRGDWGDFGGLGETSDVFAEHERFPEDPFDAPDHVDPGTAWASVATGSADDLSREVAPTAVDYVPRSEPYSVRGVDIVEPVTAFCSPADLGMANFPGNVLKGSATTLRRAGSAAANAGAILGTDMLMAPKASVQAIMARVIAALEMLQSGWDVGGPPDVGLDVRHAARDDFDVASARHPQHAWLYIPSDWTEEEVAALVSLMVEGGPAAYRWGYADGDPGGDEGVNGNPLPRDGVMPAGALWRWPGGWSNYLLIGERDRGWNVAFGGDALSVSSLSAVLRRMVEAYGQRVYLDAARAAAVANRAYCAPAYQGGGGERDIGTAFTSDRVSVRREDGTSGRLAVPARNVVKDHPGPLPDPAAGYDGGFGGVVPGGCGGRVWAAPVVPSPGDADLVGATLAPGIDDRGPGGAGRAPPHFRTADASPAGLLVVSNHGRQLFEWAWDPPAMEVDDPREAYAVANAWVRLASCFLRHGGQVREEMRDYSVRTRAGATRTVYGTVAHATSLIMPRLNLDGWWPALIGLSVLRHDRIVPKLDRRLLRPAFTKYAADVHLLTHRTLYESGNSLADLKDALVGAKVVSRFPPAYRAGVWPHVFSDTCMPYGNYECLESGVLLGGGNETEGVGFGVQGSWKWDGAQRRAAVDGAGAPAVRQSLRALDSVARKVYFLGGSFRLDATPDRRVYVVRPPGSRLYHPYFVPVRVLEDGLPSEVRYTAIGNGALLLASGRAAEVGRASGVI;

[0070]

[0071] The sequencing result is same as SEQ ID NO. 2, which indicates that the SlAV1-CP gene is cloned successfully.

[0072] (5) Activation of the vector and construction of the recombinant vector

[0073] The pET32a vector stored in glycerol was streaked on LB plate and incubated at 37℃ overnight, and a single colony was picked and cultured in LB liquid medium at 180 rpm and 37℃ for 14 h, and then used for plasmid extraction. The plasmid extraction step refers to the high-purity plasmid extraction kit (DP104) of Tiangen Biochemical Technology (Beijing) Co., Ltd. The PET32a plasmid digested by ECORI was purified and recovered, and then connected with the SlAV1-CP gene fragment (SEQ ID NO. 2) with a pET32A vector homologous arm for homologous recombination, and then transformed into E. coli DH5α. After sequencing verification, the recombinant prokaryotic expression vector PET32a-SlAV1-CP was obtained, and then transformed into E. coli prokaryotic expression strain BL21, and confirmed by PCR detection.

[0074] 2. SlAV1-CP protein induction and purification

[0075] (1) SlAV1-CP protein induction

[0076] The BL21 strain positive clone of PET32a-SlAV1-CP was cultured in LB medium containing 100 μg / mL ampicillin at 37℃ for 12 h. The bacterial liquid after shaking culture was transferred into 1 L of LB medium at a volume ratio of 1:100, and 0.01 M concentration IPTG was added to induce for 14 h at 16℃. The obtained culture was centrifuged at 8000 rpm for 10 min to obtain bacterial precipitate containing SlAV1-CP and empty protein EV, respectively. The bacterial precipitate was resuspended with 1×PBS buffer, broken under ultrasonic disrupter, and centrifuged to obtain supernatant containing recombinant protein SlAV1-CP.

[0077] (2) SlAV1-CP protein purification

[0078] The recombinant protein SlAV1-CP and empty protein EV were purified by using Ni-NTA purification resin pre-packed column (Qiagen) according to the instructions.

[0079] The elution step is as follows:

[0080] A. The 200 mL supernatant obtained by centrifugation was added to a 5 ml volume of Ni-NTA filler purification resin column and flowed through.

[0081] B. 1×PBS buffer solution was added to elute the impurity protein, which was 10 times the volume of the Ni-NTA filler.

[0082] C. Add 15 times Ni-NTA filler volume of 20 mM imidazole concentration of 1 x PBS eluent to elute the impure protein.

[0083] D. Add 2 times Ni-NTA filler volume of 300 mM imidazole concentration of 1 x PBS eluent to elute the target protein.

[0084] Collect the eluent of each component and perform SDS-PAGE and Western blot identification, the specific steps are as follows:

[0085] A. Mix the purified SlAV1-CP protein and the purified empty vector protein EV with the protein loading buffer uniformly, and then boil in water bath for 5 min to denature the protein.

[0086] B. Install the electrophoresis device and add appropriate amount of electrophoresis liquid. Then add 20 uL of protein sample and 5 uL of protein marker to the protein gel hole. When performing SDS-PAGE electrophoresis, first use a voltage of 80 V, and when the sample runs to the junction of the upper and lower gels, change the voltage to 120 V.

[0087] C. After electrophoresis, remove the upper gel and place it in the transfer membrane liquid, then correctly assemble the transfer membrane device in order. After assembly, place it in the electrophoresis tank, add transfer membrane liquid, and under ice bath conditions, 80 V, transfer membrane for 2.5 h (PVDF membrane is soaked in methanol for about 15 s before use).

[0088] D. After the transfer membrane ends, rinse the protein membrane with PBST solution for 1-2 min, then pour out the PBST, add PBST containing 4% skimmed milk powder, and slowly shake on the shaker at room temperature for 1 h.

[0089] E. Add primary antibody (purchased from: abmart Shanghai), incubate at room temperature for 1.5 h.

[0090] F. Add fluorescent secondary antibody (purchased from: abmart Shanghai), incubate at room temperature in the dark for 0.5 h.

[0091] G. Color development with color developing solution and take pictures.

[0092] The results show that the PET32a-SlAV1-CP plasmid is successfully constructed and transformed into E. coli, and positive transformants are obtained. After IPTG induction, SlAV1-CP pure protein is obtained by Ni strain purification, using empty vector protein EV as a control group, and the band size is correct after SDS-PAGE and WB detection (Figures 1-2).

[0093] Example 2 SlAV1-CP protein induces the expression of plant resistance-related genes

[0094] The purified SlAV1-CP was diluted to 0.03 mg / mL and sprayed on plants at a rate of 2 mL per plant. The empty vector protein EV was used as a control. Samples were taken at regular intervals, flash-frozen in liquid nitrogen, and plant RNA was extracted and reverse transcribed into cDNA before the change in resistance gene expression was measured.

[0095] The specific steps are as follows:

[0096] 1. SlAV1-CP protein inoculation

[0097] The SlAV1-CP protein and empty vector protein EV, purified by Ni column and detected by SDS-PAGE and WB, were inoculated into different plants (tomato, tobacco and pepper) by spraying. The concentration of SlAV1-CP protein was 0.03 mg / mL and the concentration of empty vector protein EV was 0.03 mg / mL. The spraying volume was 2 mL / plant. Samples were taken at fixed time intervals and flash-frozen in liquid nitrogen for subsequent RNA extraction.

[0098] 2. Extraction of plant RNA and preparation of cDNA

[0099] Plant RNA was extracted using a polysaccharide and polyphenol plant total RNA extraction kit (TIANGEN). RNA concentration and purity were determined by... Analysis was performed using an ND-2000 spectrophotometer (Thermo Fisher Scientific). Following the manufacturer's instructions, 1 μg of total RNA was used to synthesize complementary cDNA for subsequent qPCR experiments with the HiScript IIQ RT SuperMix.

[0100] 3. qPCR assay

[0101] qPCR experiments were performed using the SYBR Green Pro Taq HS premixed qPCR kit (Aikerui Biotechnology). An ABI Prism 7900 was used for assays. All qPCR experiments were performed in triplicate (biological replicates) and in triplicate (technical replicates). Plant resistance gene expression levels were normalized to 0-hour levels. Appropriate amounts of reverse transcription products were used to detect the expression of tomato defense-related genes (SlNPR1, SlPR1a), tobacco defense gene NtPR1, and pepper defense gene CaPR1 using RT-qPCR. The primer sequences for real-time quantitative PCR are shown in Table 1.

[0102] Table 1 qPCR primers

[0103] As shown in Figure 3, compared with the control (empty protein EV), the expression of resistance genes was upregulated within 24 hours when the leaves of tomatoes, tobacco and peppers sprayed with SlAV1-CP protein were sprayed, indicating that SlAV1-CP can activate the expression of plant disease resistance-related genes.

[0104] Example 3 Spraying SlAV1-CP protein to improve the resistance of plants to pathogenic fungi

[0105] To evaluate the induced resistance of SlAV1-CP, a test was carried out in a greenhouse to prevent tomato gray leaf spot using SlAV1-CP protein.

[0106] The specific operation is as follows:

[0107] 1 Protein spraying

[0108] Tomato plants with consistent growth of about 30 days were selected, and SlAV1-CP protein, empty protein EV and 1xPBS buffer were sprayed respectively; the concentration of SlAV1-CP protein was 0.03 mg / mL, the concentration of empty protein EV was 0.03 mg / mL, and the spraying amount was 2 mL / plant.

[0109] 2 Inoculation of Peronophythora litchii

[0110] After 24 hours of protein spraying, 20 mL of mycelium suspension of Peronophythora litchii strain SvHN-02 was sprayed and inoculated respectively, the OD 600 of the mycelium suspension was 2.0, the incidence and mortality of the plants were observed and recorded within 14 days, and the plants were photographed and recorded every day after 5 days of inoculation of Peronophythora litchii strain SvHN-02. All inoculated plants were placed in an inoculation box at 28°C and 100% relative humidity. All tests were repeated 3 times, and at least 6 plants were used for each treatment in each repetition.

[0111] Peronophythora litchii strain SvHN-02 was previously cultured in 40 mL of PDB liquid medium at 28°C, 180 rpm shaking for 5 days, then the mycelium was collected, washed with sterile water for 3 times, and then crushed into small mycelium fragments with a juicer, and then the concentration was adjusted to OD 600 = 2.0 with sterile water to obtain the mycelium suspension of Peronophythora litchii strain SvHN-02.

[0112] 3 Disease index and incidence rate statistics

[0113] After 1 day of spraying SlAV1-CP protein, empty protein EV or 1xPBS buffer, Peronophythora litchii strain SvHN-02 was inoculated, and the incidence of tomato was observed and recorded. According to the degree of leaf lesion of tomato, the disease degree of tomato was divided into the following five grades, 0: healthy, the whole leaf is green; 1: a small number of leaves have small lesions; 2: half of the leaves have lesions; 4: most of the leaves have lesions, and the whole tomato begins to wilt; 5: all leaves have lesions and fall off, and the tomato wilts. The incidence rate, disease index and control effect were calculated according to the following formula:

[0114] Incidence = (number of diseased plants / total number of plants) x 100%;

[0115] Disease index = ∑(number of diseased plants at each level x level number) / (total number of plants x highest level of disease) x 100;

[0116] Control effect (%) = (disease index of control-disease index of treatment) / disease index of control x 100%.

[0117] As shown in FIG. 4 and FIG. 5, compared with the plants sprayed with empty vector EV and 1x PBS buffer, the tomato plants sprayed with SlAV1-CP protein did not show obvious symptoms at 12 days, while the tomato plants sprayed with empty vector EV and 1x PBS buffer showed obvious symptoms. The incidence and disease index of the plants treated with SlAV1-CP protein were significantly reduced, and the control effect reached 76%. This indicates that spraying SlAV1-CP protein can improve the resistance of plants to fungi.

[0118] Example 4: SlAV1-CP protein induces improved resistance of plants to bacterial diseases

[0119] To evaluate the induced resistance of SlAV1-CP, a test was carried out in a greenhouse to prevent Pseudomonas syringae Pst Dc3000 using SlAV1-CP protein.

[0120] The specific operation is as follows:

[0121] 1. Culture of Pseudomonas syringae

[0122] The bacteria stored at -80°C were inoculated on a KB medium plate containing rifampicin by streaking method, and then inverted in a constant temperature incubator at 28°C for 48 h. When the colonies grew to an appropriate size, a single colony was picked and transferred to a liquid KB medium containing rifampicin, and then cultured in a 28°C shaker at 280 rpm for 48 h for standby.

[0123] 2. Protein spraying

[0124] Arabidopsis plants with consistent growth for about 20 days were selected, and an equal amount of SlAV1-CP protein, empty vector EV and 1x PBS buffer was sprayed, respectively. The concentration of SlAV1-CP protein was 0.03 mg / mL, the concentration of empty vector EV was 0.03 mg / mL, and the spraying amount was 2 mL / plant.

[0125] 3. Pseudomonas syringae infection

[0126] The bacterial suspension activated at 28°C for 48 h was transferred to a 1.5 mL centrifuge tube, centrifuged at 12000 x g for 1 min, the supernatant was removed, resuspended with sterile deionized water, repeated centrifugation once, removed the supernatant, and added 1 mL of sterile deionized water to blow the suspension evenly. The resuspended bacterial suspension was diluted to 10 7CFU / mL (OD 600 = 0.5, corresponding OD 600 value is calculated by making a standard curve after gradient dilution of the bacterial solution, measuring the OD value and counting the colonies on the medium). The Arabidopsis leaves are injected with a sterile syringe without a needle, and one leaf is selected for each Arabidopsis plant, and 20 μL of the bacterial suspension is injected. The leaves are marked after injection. Sampling is performed 3 days after inoculation. Infection and sampling are performed at 12:00 every day.

[0127] 4 Colony counting

[0128] The Arabidopsis leaves injected with the bacterial solution are cut, and small pieces are cut with a puncher, added with 1 mL of sterile deionized water, ground, diluted 10 times, and then plated. The medium plates are placed in a 28°C incubator for 48 h, and then taken out to observe the number of P. syringae colonies grown thereon.

[0129] The results are shown in Figure 6. The Arabidopsis leaves sprayed with SlAV1-CP protein have fewer P. syringae colonies than the Arabidopsis leaves sprayed with 1x PBS buffer and empty protein EV, and the control effect is 80.3%, indicating that spraying SlAV1-CP can improve the resistance of plants to bacteria.

[0130] Example 5 SlAV1-CP protein induces improved resistance of plants to viruses

[0131] To evaluate the induced resistance of SlAV1-CP protein, a test for preventing tobacco mosaic virus by using SlAV1-CP protein is performed in a greenhouse.

[0132] The control effect is calculated according to the following formula:

[0133] Control effect (%) = (number of lesions on control leaves - number of lesions on treated leaves) / number of lesions on control leaves x 100%.

[0134] The specific operation is as follows:

[0135] 1 Protein spraying

[0136] The tobacco plants with uniform growth and about 20 days old are selected, and equal amounts of SlAV1-CP protein, empty protein EV and 1x PBS buffer are sprayed, respectively. The concentration of SlAV1-CP protein is 0.03 mg / mL, the concentration of empty protein EV is 0.03 mg / mL, and the spraying amount is 2 mL / plant.

[0137] 2 Tobacco mosaic virus inoculation

[0138] After spraying SlAV1-CP protein, empty protein EV and 1xPBS buffer for 24h, the heart leaf of tobacco was coated with quartz sand, then tobacco mosaic virus was inoculated, the inoculation amount of tobacco mosaic virus was 2mL, the incidence and the rate of dry spot were observed and recorded within 5d. All inoculated plants were placed in an inoculation box with 28℃ and 100% relative humidity. All tests were repeated 3 times, and each treatment had at least 6 plants.

[0139] The tobacco mosaic virus for inoculation was extracted from tobacco infected with tobacco mosaic virus, and then diluted 10 times, with a concentration of 20mg / mL.

[0140] The results are shown in Figure 7, the heart leaf of tobacco sprayed with SlAV1-CP protein has less virus dry spot than the heart leaf of tobacco sprayed with empty protein EV and 1xPBS buffer, the control effect is 60.8%, which indicates that spraying SlAV1-CP can improve the resistance of plants to virus.

[0141] The above-described embodiments are only to describe the preferred modes of the present application, and are not intended to limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. Use of the tomato botrytis virus coat protein SlAVl-CP, of the encoding gene SlAVl-CP or of a biological material containing the encoding gene SlAVl-CP for increasing the defence capacity of a plant, characterized in that, The amino acid sequence of the tomato Slay fungus virus coat protein SlAV1-CP is shown as SEQ ID NO. 1; the nucleotide sequence of the coding gene SlAV1-CP is shown as SEQ ID NO.

2.

2. Use according to claim 1, characterized in that, The defense ability includes disease resistance.

3. Use according to claim 1, characterized in that, The disease resistance includes the ability to resist fungal diseases, bacterial diseases, viral diseases or oomycete diseases.

4. Use according to claim 1, characterized in that, The plant includes tomato, tobacco or pepper.

5. The use according to claim 1, characterized in that, The biological material includes a recombinant vector, an expression cassette or a recombinant bacteria.

6. Use according to claim 3, characterized in that, The fungal disease is tomato gray leaf spot disease; the bacterial disease is tomato bacterial spot disease; and the viral disease is tobacco mosaic disease.

7. A method of increasing the defense capacity of a plant, characterized by, The method includes the step of spraying the plant with a solution containing the tomato Slay fungus virus coat protein SlAV1-CP.

8. The method of claim 7, wherein, The plant includes tomato, tobacco or pepper.

9. Use of the tomato Sphaceloma virus coat protein SlAVl-CP, the encoding gene SlAVl-CP or a biological material containing the encoding gene SlAVl-CP for the preparation of a plant immune activator, characterized in that, The amino acid sequence of the tomato Slay fungus virus coat protein SlAV1-CP is shown as SEQ ID NO. 1; the nucleotide sequence of the coding gene SlAV1-CP is shown as SEQ ID NO.

2.

10. A plant immunity activator, characterized by, The effective component of the plant immune activator includes the tomato Slay fungus virus coat protein SlAV1-CP; the amino acid sequence of the tomato Slay fungus virus coat protein SlAV1-CP is shown as SEQ ID NO. 1.

Citation Information

Patent Citations

  • Fungal virus SlMV1, attenuated strain and application thereof

    CN112280751A

  • Plant immune activator protein PsAEP1 and application thereof

    CN113354720A

  • Plant immune induced resistance protein PsCAP1 and application thereof

    CN116003548A

  • Application of tomato Stemphylium fungal virus coat protein SlAV1-CP in improvement of plant defense capability

    CN118791577A

  • Plant immunity activation protein pmscr1 and use thereof

    WO2024037548A1