Dihydro benzoxazine derivatives
Dihydro benzoxazine derivatives serve as effective MET receptor tyrosine kinase inhibitors, addressing resistance issues in NSCLC treatments by enhancing therapeutic outcomes for MET-mediated diseases.
Patent Information
- Application Number
- PCT/EP2025/066816
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-19
- Filing Date
- 2025-06-17
- Publication Date
- 2025-12-26
AI Technical Summary
Current therapies targeting MET receptor tyrosine kinase, such as MET TKIs, face challenges with intrinsic or acquired resistance in treating non-small-cell lung cancer (NSCLC) patients with MET exon 14 skipping alterations, necessitating the development of new MET inhibitors.
Development of dihydro benzoxazine derivatives that act as selective MET receptor tyrosine kinase inhibitors to overcome resistance and effectively treat MET-mediated diseases, particularly NSCLC.
The dihydro benzoxazine derivatives provide a promising therapeutic strategy by inhibiting MET kinase activity, potentially enhancing treatment efficacy against NSCLC and other MET-mediated disorders.
Smart Images

Figure EP2025066816_26122025_PF_FP_ABST
Abstract
Description
[0001] P39231 DIHYDRO BENZOXAZINE DERIVATIVES Field of the Invention The present invention relates to organic compounds useful for the treatment and / or prophylaxis in a human, in particular to selected dihydro benzoxazine derivatives as inhibitors of the MET receptor tyrosine kinase for the treatment and / or prophylaxis of MET mediated disease or disorder, in particular cancer. Background of the Invention MET is a transmembrane receptor tyrosine kinase. Binding of the hepatocyte growth factor (HGF) induces MET receptor dimerization and activation of the receptor. While HGF is mainly expressed and secreted by mesenchymal cells, such as fibroblasts, MET is wider expressed by epithelial cells of a variety of tissues, but also found on endothelial cells, neurons, hepatocytes, and hematopoietic cells, and has been demonstrated to be involved in a variety of physiological processes during embryonic development and in tissues repair in adults. In particular, MET activates multiple signal transduction pathways, including the RAS-mitogen-activated protein kinase (MAPK) cascade, the PI3K-AKT pathway, the Signal Transducer and Activator of Transcription (STAT) and NF-κB pathway, involved in cell proliferation, differentiation, cell motility, invasion and survival. Moreover, by regulating cell-matrix adhesion and promoting cytoskeletal changes and cell migration, MET plays a key role in epithelial to mesenchymal transition (EMT). The pleiotropic biological effects of MET activation also rely on crosstalk and signaling cooperation with various surface membrane proteins, including the MET homologue RON, and other TKs, such as EGFR, ERBB3, ROR1, CD44, integrins and plexin B1. MET constitutive activation is a common event in several cancer types and can be the result of various mechanisms, including excessive autocrine or paracrine production of HGF, MET overexpression or genetic abnormalities of MET, such as gene copy-number amplification and point mutations. Other mechanisms include inadequate internalization and degradation and receptor crosstalk. Accordingly, several therapeutic strategies have been developed to target MET signaling, including anti-HGF or anti-MET antibodies and small molecule TKIs. Lung cancer is the leading cause of cancer-related mortality worldwide, and non-small-cell lung cancer (NSCLC) represents the major histological subtypes of the disease. Approximately 3% of NSCLC patients harbor MET exon 14 skipping alterations (METex14), resulting in decreased MET turnover and extended oncogenic downstream signaling pathways. Today, there are a few highly selective and potent MET TKIs approved for the treatment of NSCLC patients harboring MET exon 14 skipping alterations (METex14). However, intrinsic or acquired resistance to TKIs has been a major challenge for these targeted therapies that impairs their clinical efficacies. In conclusion, suppressing the action of MET receptor is a promising new therapeutic strategy for the treatment or prevention of various diseases and disorders, and there continues to be a high unmet medical need for new MET inhibitors. Summary of the Invention In a first aspect, the present invention provides a compound of formula (I) wherein R1, R2, R3, R4, R5, R6, R7, R8and R9are as described herein. In further aspects, the present invention provides processes for manufacturing the compounds of formula (I), pharmaceutical compositions comprising the compounds of formula (I), as well as methods of using the compounds of formula (I) in the treatment or prophylaxis of disease or disorder mediated by MET kinase, in particular cancer. Detailed Description of the Invention Definitions Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed. The term “acid” refers to a compound capable of giving proton of Broensted's definition, dissociating into proton and counter ion in water at 25°C and giving a solution having neutral pH or below. Concrete examples of the acid are phosphoric acid (orthophosphoric acid), sulfuric acid, nitric acid, phosphinic acid, phosphonic acid, diphosphonic acid, hydrochloric acid, pyrophosphoric acid, metaphosphoric acid and nitrous acid. These acids may be used in the form of metal salts, ammonium salts or the like; particularly acid means hydrochloric acid. The term “amino” alone or in combination with other groups, refers to -NH2. The term “alkenyl” refers to a monovalent linear or branched hydrocarbon group of 2 to 6 carbon atoms, in particular 2 to 4 carbon atoms, with at least one double bond, having the number of carbon atoms designated. Particular “C2-6-alkenyl” refers to alkenyl having 2 to 6 carbon atoms. Examples of alkenyl include ethenyl, propenyl, prop-2-enyl, isopropenyl, n‑butenyl, and i‑butenyl. More particularly, alkenyl refers to ethenyl. The term “alkynyl” refers to a monovalent linear or branched hydrocarbon group of 2 to 6 carbon atoms, in particular 2 to 4 carbon atoms, with at least one triple bond, having the number of carbon atoms designated. Particular “C2-6-alkynyl” refers to alkynyl having 2 to 6 carbon atoms. Examples of alkynyl include ethynyl, propynyl, butynyl. Particularly, alkynyl refers to ethynyl. The term “alkyl” refers to a monovalent linear or branched saturated hydrocarbon group of 1 to 6 carbon atoms, e.g., 1, 2, 3, 4, 5, or 6 carbon atoms, having the number of carbon atoms designated (“C1-6-alkyl”). In some embodiments, the alkyl group contains 1 to 3 carbon atoms (“C1-3-alkyl”). Some non-limiting examples of alkyl include methyl, ethyl, n-propyl, isopropyl, n-butyl, iso-butyl, sec-butyl, tert-butyl, homologs and isomers of, for example, n-penthyl, n- hexyl, and the like. Particular, yet non-limiting examples of alkyl include methyl, ethyl, n- propyl, isopropyl, n-butyl. More particularly alkyl refers to methyl. The term “C1-6-alkoxy” refers to an alkyl group, as previously defined, attached to the parent molecular moiety via an oxygen atom. Some non-limiting examples of alkoxy groups include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy and tert-butoxy. A particular, yet non-limiting example of alkoxy is methoxy. The term “aryl” refers to a monovalent, monocyclic or bicyclic carbocyclic ring system of 6 to 10 ring members (“C6-10-aryl”), wherein at least one ring in the system is aromatic. Some non- limiting examples of aryl include phenyl or naphtyl. A particular, yet non-limiting example of aryl is phenyl. The term “cancer” refers to a generic name of malignant tumor (or malignant neoplasma), including not only solid tumors such as tumors developed on epithelial tissues or sarcomas developed on connective tissues (bone, muscle, cartilage, sinew, ligament, adipose, and blood vessel), but also all non-solid tumors such as leukemia that are malignant tumors in the blood system and lymphomas. Thus, target diseases to which a pharmaceutical composition for treatment of cancers of the present invention can be applied include, but are not limited to, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, liver cancer, lung cancer, parotid cancer, salivary gland cancer, colon cancer, breast cancer, renal cancer, prostate cancer, brain cancer, skin cancer, adrenal cancer, oral cancer, rectal cancer, endometrial cancer, thyroid cancer, ovarian cancer, laryngeal cancer, leukemia, and malignant lymphoma. In particular cancer refers to lung cancer or non-small cell lung cancer (NSCLC). The term “cycloalkyl” refers to a saturated monocyclic hydrocarbon group of 3 to 6 ring carbon atoms, having the number of carbon atoms designated. Particular, “C3-6-cycloalkyl” refers to cycloalkyl having 3 to 6 carbon atoms; “C3-4-cycloalkyl” refers to cycloalkyl having 3 to 4 carbon atoms. Examples of cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl. Particular, yet non-limiting examples of cycloalkyl include cyclopropyl and cyclobutyl. More particularly cycloalkyl refers to cyclopropyl. The term “aminocycloalkyl” refers to a cycloalkyl group as defined herein, having the number of carbon atoms designated (“amino-C3-6-cycloalkyl”), wherein at least one of the hydrogen atoms of the cycloalkyl group has been replaced by an amino group (-NH2). Preferably, “aminocycloalkyl” refers to an alkyl group wherein one hydrogen atom of the alkyl group have been replaced by the amino group. Particular, yet non-limiting example of aminocycloalkyl is 1- aminocyclopropyl. The term “halo” or “halogen” refers to fluoro, chloro, bromo or iodo, particularly chloro or fluoro. The term “haloalkyl” refers to an alkyl group, having the number of carbon atoms designated (“halo-C1-6-alkyl”), wherein at least one of the hydrogen atoms of the alkyl group has been replaced by same or different halogen atoms, particularly fluoro atoms. Examples of haloalkyl include monofluoro-, difluoro- or trifluoro-methyl, -ethyl or -propyl, for example 3,3,3- trifluoropropyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, fluoromethyl, or trifluoromethyl. A particular, yet non-limiting example of haloalkyl is trifluoromethyl. The term “hydroxy”, alone or in combination with other groups, refers to -OH. The term “heteroaryl” refers to a monovalent, mono- or bicyclic ring system of 5 to 10 ring atoms, comprising 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining ring atoms being carbon, wherein at least one ring in the ring system is aromatic and contains one or more heteroatoms. Preferably, the heteroaryl is a 5- to 6-membered monocyclic heteroaryl or a 9- to 10-membered fused bicyclic heteroaryl comprising 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. More preferably, the heteroaryl is a 5- to 6-membered monocyclic heteroaryl or a 9- to 10-membered fused bicyclic heteroaryl comprising sulfur. Some particular, yet non-limiting examples of heteroaryl include thienyl (e.g.3-thienyl), benzothienyl, 2,3- dihydrothieno[3,4-b][1,4]dioxinyl, thiazolyl, pyrrolyl, furanyl, oxazolyl, pyridyl, piperidyl, imidazolyl. A particular, yet non-limiting example of heteroaryl is thienyl (e.g.3-thienyl). The terms “heterocyclyl” and “heterocycloalkyl” are used herein interchangeably and refer to a saturated mono- or bicyclic, preferably monocyclic ring system of 3 to 9 ring atoms, preferably 3 to 8 ring atoms, wherein 1, 2, or 3 of said ring atoms are heteroatoms selected from N, O and S, the remaining ring atoms being carbon. Preferably, 1 to 2 of said ring atoms are selected from N and O, the remaining ring atoms being carbon. “Bicyclic heterocyclyl” refers to heterocyclic moieties consisting of two cycles having two ring atoms in common, i.e., the bridge separating the two rings is either a single bond or a chain of one or two ring atoms, and to spirocyclic moieties, i.e., the two rings are connected via one common ring atom. Some non-limiting examples of heterocyclyl groups include pyrrolidinyl (e.g.1-pyrrolidinyl), morpholino, morpholinyl, piperazinyl (e.g.1-piperazinyl), piperidyl (e.g.1-piperidyl, 3-piperidyl), 2,5- diazabicyclo[2.2.1]heptanyl (e.g.2,5-diazabicyclo[2.2.1]heptan-2-yl). The terms “MET”, “MET kinase”, and “MET receptor” are used herein interchangeably and refer to a MET receptor tyrosine kinase. “MET TKI” refers to a MET tyrosine kinase inhibitor. The term “optionally substituted” means unsubstituted or substituted. Generally these substituents can be the same or different. The term “oxo”, alone or in combination with other groups, refers to =O. The term “pharmaceutically acceptable salt” refers to those salts which retain the biological effectiveness and properties of the free bases or free acids, which are not biologically or otherwise undesirable. The salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, in particular hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p- toluenesulfonic acid, salicylic acid, N-acetylcystein and the like. In addition, these salts may be prepared by addition of an inorganic base or an organic base to the free acid. Salts derived from an inorganic base include, but are not limited to, the sodium, potassium, lithium, ammonium, calcium, magnesium salts and the like. Salts derived from organic bases include, but are not limited to salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, polyimine resins and the like. Particular pharmaceutically acceptable salts of compounds of formula (I) are the salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid. More particularly, pharmaceutically acceptable salts of compounds of formula (I) are the salts of hydrochloric acid. The term “protecting group” refers to the group, which selectively blocks a reactive site in a multifunctional compound such that a chemical reaction can be carried out selectively at another unprotected reactive site in the meaning conventionally associated with it in synthetic chemistry. Protective groups can be removed at the appropriate point. Exemplary protective groups are Amino-protective groups, carboxy-protective groups or hydroxy- protective groups. Particular protective groups are the tert-butoxycarbonyl (Boc), benzyloxycarbonyl (Cbz), fluorenylmethoxycarbonyl (Fmoc) and benzyl (Bn). Further particular protective groups are the tert-butoxycarbonyl (Boc) and the fluorenylmethoxycarbonyl (Fmoc). More particular protective group is the tert- butoxycarbonyl (Boc). Exemplary protective groups and their application in organic synthesis are described, for example, in “Protective Groups in Organic Chemistry” by T. W.Greene and P. G. M. Wutts, 5th Ed., 2014, John Wiley & Sons, N.Y.The term “prophylaxis” as used herein includes: preventing or delaying the appearance of clinical symptoms of the state, disorder or condition developing in a human that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition. The term “therapeutically effective amount” refers to an amount of a compound or molecule of the present invention that, when administered to a subject, (i) treats or prevents the particular disease, condition or disorder, (ii) attenuates, ameliorates or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of the particular disease, condition or disorder described herein. The therapeutically effective amount will vary depending on the compound, the disease state being treated, the severity of the disease treated, the age and relative health of the subject, the route and form of administration, the judgement of the attending medical or veterinary practitioner, and other factors. By the term “treatment” or “treating” and grammatical variations thereof as used herein, is meant therapeutic therapy. In reference to a particular condition, treating means: (1) toameliorate the condition or one or more of the biological manifestations of the condi tion,(2) to interfere with (a) one or more points in the biological cascade that leads to or is responsible for the condition or (b) one or more of the biological manifestations of the condition, (3) to alleviate one or more of the symptoms, effects or side effects associated with the condition or treatment thereof, or (4) to slow the progression of the condition or one or more of the biological manifestations of the condition. Prophylactic therapy using the methods and / or compositions of the invention is also contemplated. The skilled artisan will appreciate that “prevention” is not an absolute term. In medicine, “prevention” is understood to refer to the prophylactic administration of a drug to substantially diminish the likelihood or severity of a condition or biological manifestation thereof, or to delay the onset of such condition or biological manifestation thereof. Prophylactic therapy is appropriate, for example, when a subject is considered at high risk for developing cancer,such as when a subject has a strong family history of cancer.The compounds of formula (I) can contain several asymmetric centers and can be present in the form of optically pure enantiomers, mixtures of enantiomers such as, for example, racemates, optically pure diastereioisomers, mixtures of diastereoisomers, diastereoisomeric racemates or mixtures of diastereoisomeric racemates. According to the Cahn-Ingold-Prelog Convention, the asymmetric carbon atom can be of the “R” or “S” configuration. The term “treatment” as used herein includes: (1) inhibiting the state, disorder or condition (e.g. arresting, reducing or delaying the development of the disease, or a relapse thereof in case of maintenance treatment, of at least one clinical or subclinical symptom thereof); and / or (2) relieving the condition (i.e., causing regression of the state, disorder or condition or at least one of its clinical or subclinical symptoms). The benefit to a patient to be treated is either statistically significant or at least perceptible to the patient or to the physician. However, it will be appreciated that when a medicament is administered to a patient to treat a disease, the outcome may not always be effective treatment. The following abbreviations are used in the present text: °C = degrees Celsius, µl = microliter, µm = micrometer, µmol = micromoles,1H = proton, Å = ångström, c = concentration, BOC = tert-butoxycarbonyl, CAS = Chemical Abstracts Service registry number, CH3CN = acetonitrile, CO2= carbon dioxide, DIPEA = N,N- Diisopropylethylamine, DMF = N,N-Dimethylformamide, DMSO = dimethylsulfoxide, DMSO-d6 = hexadeuterodimethylsulfoxide, EC50 = half maximal effective concentration, EDC = 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide, EGTA = Ethylene glycol-bis(β- aminoethyl ether)-N,N,N',N'-tetraacetic acid, EMEM = Eagle's Minimum Essential Medium, eq = equivalent, ESI = electron spray ionization, Int. = Intermediate, Ex. = Example, g = gram, g / L = gram per liter, h = hour, HATU = hexafluorophosphate azabenzotriazole tetramethyl uranium, HEPES = 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid, HCOOH = formic acid, HPLC = high performance liquid chromatography, IC50 = half maximal inhibitory concentration, J = coupling constant, JCRB = Japanese Collection of Research Bioresources, kg = kilogram, LiOH.H2O = Lithium hydroxide monohydrate, M = molar, µM = micromolar, m / z = mass-to-charge ratio, MeOH = methanol, meth. = method, mg = milligram, MgSO4 = magnesium sulfate, MHz = megahertz, min = minute, ml = milliliter, mm = millimeter, mmol = millimole, MS = mass spectrometry, N2= Nitrogen, Na2CO3= Sodium carbonate, Na2SO4sodium sulfate, NaHCO3 = sodium bicarbonate, NaOH = Sodium hydroxide, neg. = negative, NH4Cl = ammonium chloride, NGS = Next-Generation Sequencing, NH3= Ammonia, nm = nanometer, NMR = nuclear magnetic resonance spectroscopy, NP40 = Nonyl Phenol 40, NSCLC = non-small-cell lung cancer, Pd2(dba)3 = Tris(dibenzylideneacetone)dipalladium(0), PET = Positron Emission Topography, pos. = positive, Promega G7572 = CellTiter-Glo® Luminescent Cell Viability Assay, Kit, psi = pounds per square inch, RH = Relative humidity, RP = reverse phase, RT = room temperature, s = second, SFC = supercritical fluid chromatography, sgRNA = single guide RNA, ssODN = single-stranded oligodeoxynucleotide, STR = short tandem repeat, TFA = trifluoroacetic acid, THF = Tetrahydrofuran, TLC = thin layer chromatography, TR-FRET = Time-resolved fluorescence energy transfer, Xantphos = (9,9-Dimethyl-9H-xanthene-4,5- diyl)bis(diphenylphosphane), WT = Wild-type, δ = chemical shift in parts per million. Compounds of the Invention In a first aspect, the present invention provides a compound of formula (I)
[0002] or a pharmaceutically acceptable salt thereof, wherein: R1is C6-C10-aryl or 5- to 10-membered heteroaryl, wherein said C6-C10-aryl or 5- to 10-membered heteroaryl is optionally substituted with one to three R1a; R1ais at each occurrence independently halogen, C1-6-alkyl, hydroxy, cyano, C1-6- alkoxy, halo-C1-6-alkyl, 3- to 9-membered heterocyclyl, C2-6-alkenyl, or C2-6- alkynyl, wherein said C1-6-alkyl and 3- to 9-membered heterocyclyl is optionally substituted with one to three C1-6-alkyl, halogen, amino, or C1-6-alkoxy; R2is -C(O)NHR2aor -CH2OH; R2ais hydrogen, C1-6-alkyl, C3-6-cycloalkyl, wherein C1-6-alkyl or C3-6-cycloalkyl is optionally substituted with one to three R2b; R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, or C3-6- cycloalkyl, wherein C3-6-cycloalkyl is optionally substituted with amino, hydroxy, or halogen; R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy or halogen; and R4is hydrogen or C1-6-alkyl; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl optionally substituted with hydroxy or halogen; R5is hydrogen or halogen; R6is hydrogen, halogen, or C1-6-alkyl; R7is halogen, halo-C1-6-alkyl, or C1-6-alkyl; R8is halogen or halo-C1-6-alkyl; R9is hydrogen, halogen, or C1-6-alkoxy. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is C6-C10-aryl or 5- to 10- membered heteroaryl comprising 1 to 3 heteroatoms independently selected from N, O, S and the remaining atoms being carbon, and wherein said C6-C10-aryl or 5- to 10-membered heteroaryl is optionally substituted with one to three R1a. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is C6-C10-aryl or 5- to 6-membered heteroaryl comprising 1 to 3 heteroatoms independently selected from N, O, S and the remaining atoms being carbon, and wherein said C6-C10-aryl or 5- to 10-membered heteroaryl is optionally substituted with one to three R1a. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is C6-C10-aryl optionally substituted with one to three R1a. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is substituted with one, two, or three substituents R1a, wherein R1and R1aare as defined herein. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is substituted with one or two substituents R1a, wherein R1and R1aare as defined herein. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is C6-C10-aryl substituted with one or two R1a, and wherein R1ais as defined herein. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is phenyl or thienyl, wherein phenyl or thienyl is substituted with one or two R1a, and wherein R1ais as defined herein. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is phenyl substituted with one R1a. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently halogen, C1-6-alkyl, hydroxy, cyano, C1-6-alkoxy, halo-C1-6-alkyl, C2-6-alkenyl, or C2-6-alkynyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently halogen, C1-6-alkyl, or C2-6-alkynyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently C1-6-alkyl or C2-6-alkynyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently fluoro, chloro, bromo, methyl, or ethynyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently methyl or ethynyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1C6-C10-aryl substituted with one or two R1a; R1ais at each occurrence independently halogen, C1-6-alkyl, or C2-6-alkynyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1C6-C10-aryl substituted with one or two R1a; R1ais at each occurrence independently C1-6-alkyl or C2-6-alkynyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1is phenyl or thienyl, wherein phenyl or thienyl is substituted with one or two R1a; R1ais at each occurrence independently fluoro, chloro, bromo, methyl, or ethynyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1is phenyl substituted with one R1a; R1ais methyl or ethynyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is tolyl, ethynylphenyl, chlorophenyl, bromophenyl, fluorophenyl, fluoro-methyl-phenyl, dimethylphenyl, or methyl-thienyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is tolyl or ethynylphenyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R1is 3-tolyl or 3- ethynylphenyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2is -C(O)NHR2a, wherein R2ais as defined herein. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2ais hydrogen or C1-6-alkyl optionally substituted with one to three R2b, wherein R2bis as defined herein. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2ais C1-6-alkyl substituted with one to three R2b, wherein R2bis as defined herein. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2ais hydrogen or C1-4-alkyl optionally substituted with one to three R2b, wherein R2bis as defined herein. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2ais ethyl or propyl, wherein ethyl or propyl is substituted with one to three R2b, wherein R2bis as defined herein. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis independently hydroxy, halogen, amino, C2-6-alkynyl, C3-6-cycloalkyl, or amino-C3-6-cycloalkyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, C3-6-cycloalkyl, or amino-C3-6-cycloalkyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis independently hydroxy, halogen, amino, C2-6-alkynyl, or amino-C3-6-cycloalkyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis independently hydroxy, halogen, or amino. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, halogen, or amino. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, halogen, amino, ethynyl, or amino-cyclopropyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis independently hydroxy, fluoro, amino, ethynyl, or amino-cyclopropyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, fluoro, amino, ethynyl, or amino-cyclopropyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis independently hydroxy, fluoro, amino. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, fluoro, amino. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais hydrogen or C1-6-alkyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, or amino- C3-6-cycloalkyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais C1-6-alkyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, halogen, or amino. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais hydrogen or C1-4-alkyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, halogen, amino, ethynyl, or amino-cyclopropyl.In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais hydrogen or C1-4-alkyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, fluoro, amino, ethynyl, or amino- cyclopropyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais propyl or ethyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, fluoro, or amino. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2ais hydrogen, (aminocyclopropyl)ethyl, hydroxy-methyl-propyl, aminoethyl, amino-hydroxy-propyl, aminopropyl, butynyl, difluoroethyl, difluoro-hydroxy-propyl, hydroxybutyl, hydroxypropyl, or methyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2ais (aminocyclopropyl)ethyl, hydroxy-methyl-propyl, aminoethyl, amino-hydroxy-propyl, aminopropyl, butynyl, difluoroethyl, difluoro-hydroxy-propyl, hydroxybutyl, hydroxypropyl, or methyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2ais difluoro-hydroxy- propyl, aminopropyl, difluoroethyl, or hydroxypropyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R2ais 2-aminopropyl, 2,2-difluoroethyl, 2,2-difluoro-3-hydroxy-propyl, or 2-hydroxypropyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy and R4is hydrogen; or R3and R4together with the carbon to which they are attached form a C3-4-cycloalkyl optionally substituted with halogen. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen, methyl or hydroxymethyl and R4is hydrogen; or R3and R4together with the carbon to which they are attached form a cyclopropyl or a fluorocyclopropyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen or methyl and R4is hydrogen; or R3and R4together with the carbon to which they are attached form a cyclopropyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R5is hydrogen or fluoro. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R6is hydrogen or C1-6-alkyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R6is hydrogen or methyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R7is halogen or C1-6-alkyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R7is chloro or methyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R7is chloro. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R8is chloro or -CF3. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R8is -CF3. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein R9is hydrogen. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R5is hydrogen or fluoro; and R9is hydrogen. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R7is chloro or methyl; and R8is chloro or -CF3. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R7is chloro; and R8is -CF3. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais hydrogen or C1-6-alkyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, or amino- C3-6-cycloalkyl; R6is hydrogen or C1-6-alkyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais C1-6-alkyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, halogen, or amino; R6is hydrogen or C1-6-alkyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais hydrogen or C1-4-alkyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, halogen, amino, ethynyl, or amino- cyclopropyl; R6is hydrogen or methyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais hydrogen or C1-4-alkyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, fluoro, amino, ethynyl, or amino- cyclopropyl; R6is hydrogen or methyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R2is -C(O)NHR2a; R2ais propyl or ethyl optionally substituted with one to three R2b; and R2bis at each occurrence independently hydroxy, fluoro, or amino; R6is hydrogen or methyl. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1ais at each occurrence independently halogen, C1-6-alkyl or C2-6-alkynyl; R2ais hydrogen or C1-6-alkyl optionally substituted with one to three R2b; R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, or C3-6- cycloalkyl, or amino-C3-6-cycloalkyl; R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl optionally substituted with halogen; R6is hydrogen or C1-6-alkyl; R7is halogen or C1-6-alkyl; R9is hydrogen. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1is C6-C10-aryl substituted with one or two R1a; R1ais at each occurrence independently C1-6-alkyl or C2-6-alkynyl; R2is -C(O)NHR2a; R2ais C1-6-alkyl optionally substituted with one, two or three R2b; R2bis at each occurrence independently hydroxy, halogen, or amino; R3is hydrogen or C1-6-alkyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl; R7is halogen; R8is halo-C1-6-alkyl. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1is C6-C10-aryl substituted with one or two R1a; R1ais C1-6-alkyl or C2-6-alkynyl; R2is -C(O)NHR2a; R2ais at each occurrence independently C1-6-alkyl optionally substituted with one, two or three R2b; R2bis at each occurrence independently hydroxy, fluoro, or amino; R3is hydrogen or C1-6-alkyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl; R7is halogen; R8is halo-C1-6-alkyl; In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1is phenyl or thienyl, wherein phenyl or thienyl is substituted with one or two R1a; R1ais at each occurrence independently fluoro, chloro, bromo, methyl, or ethynyl; R1ais -C(O)NHR2aor -CH2OH; R2ais hydrogen or C1-4-alkyl; R2bis at each occurrence independently hydroxy, fluoro, amino, ethynyl, or amino- cyclopropyl; R3is hydrogen, methyl, or hydroxymethyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl or fluorocyclopropyl; R5is hydrogen or fluoro; R6is hydrogen or methyl; R7is chloro or methyl; R8is chloro or –CF3. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein: R1is phenyl substituted with one R1a; R1ais methyl or ethyl; R2ais ethyl or propyl; R2bis hydroxy, fluoro, or amino; R3is hydrogen or methyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl; R5is hydrogen or fluoro; R6is hydrogen or methyl; R7is chloro; R8is–CF3. In one embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein said compound of formula (I) is: N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]- 4-(4-fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]- 4-(3,5-dimethylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-[2-(1-aminocyclopropyl)ethylamino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamid; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]- 4-(3-fluoro-5-methyl-phenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-[[(2S)-2-amino-3-hydroxy-propyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-[[(2R)-2-amino-3-hydroxy-propyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(3-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-[(5-methyl-3- thienyl)sulfonyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminoethylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-bromophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3- hydroxypropylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-2'-fluoro-4-(m- tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxamide; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]- 4-(3-chlorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]- 4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4-(3- bromophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-hydroxy-propyl]-4-(m-tolylsulfonyl)-2,3- dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-Chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo-propyl]-4- (m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(but-3-ynylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxybutyl]amino]-3-oxo-propyl]- 4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2S)-2-hydroxybutyl]amino]-3-oxo-propyl]- 4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2S)-3-hydroxy-2-methyl-propyl]amino]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-3-hydroxy-2-methyl-propyl]amino]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-2-methyl-3-(methylamino)-3-oxo-propyl]-4- (m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxypropyl]amino]-2-methyl- 3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-8-fluoro-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2- difluoroethylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2-difluoro-3- hydroxy-propyl)amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2- hydroxybutylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(3-hydroxy-2- methyl-propyl)amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2- hydroxypropyl]amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-bromophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2- difluoroethylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo-propyl]-4-(3- fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo-propyl]-4-(3- fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-3-(2,2-difluoroethylamino)-1-[2-methyl-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2-difluoro-3-hydroxy-propyl)amino]-3- oxo-propyl]-4-(3-ethynylphenyl)sulfonyl-spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(m- tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3- oxo-propyl]spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3- hydroxypropylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-8-fluoro-4-(m- tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxamide; N-[(1S)-1-(2,5-dichlorophenyl)-3-[[(2R)-2-hydroxypropyl]amino]-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2S)-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-2- (hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2R)-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-8-fluoro- 2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2R)-N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-8-fluoro-2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; or N-[(1S)-3-amino-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3- dihydro-1,4-benzoxazine-6-carboxamide. In a particular embodiment, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein said compound of formula (I) is: N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxypropyl]amino]-2- methyl-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo-propyl]- 4-(3-ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2-difluoro-3-hydroxy-propyl)amino]- 3-oxo-propyl]-4-(3-ethynylphenyl)sulfonyl-spiro[3H-1,4-benzoxazine-2,1'- cyclopropane]-6-carboxamide; or (2R)-N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-8-fluoro-2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide. In a particular embodiment, the present invention provides pharmaceutically acceptable salts of the compounds according to formula (I) as described herein. In a further particular embodiment, the present invention provides compounds according to formula (I) as described herein. In some embodiments, the compounds of formula (I) are isotopically-labeled by having one or more atoms therein replaced by an atom having a different atomic mass or mass number. Such isotopically-labeled (i.e., radiolabeled) compounds of formula (I) are considered to be within the scope of this disclosure. Examples of isotopes that can be incorporated into the compounds of formula (I) include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, sulfur, fluorine, chlorine, and iodine, such as, but not limited to,2H,3H,11C,13C,14C,13N,15N,15O,17O,18O,31P,32P,35S,18F,36Cl,123I, and125I, respectively. Certain isotopically-labeled compounds of formula (I), for example, those incorporating a radioactive isotope, are useful in drug and / or substrate tissue distribution studies. The radioactive isotopes tritium, i.e.3H, and carbon-14, i.e.,14C, are particularly useful for this purpose in view of their ease of incorporation and ready means of detection. For example, a compound of formula (I) can be enriched with 1, 2, 5, 10, 25, 50, 75, 90, 95, or 99 percent of a given isotope. Substitution with heavier isotopes such as deuterium, i.e.2H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements. Thus, the present invention encompasses compounds of formula (I) wherein one or more hydrogen atoms have been replaced by deuterium. Substitution with positron emitting isotopes, such as11C,18F,15O and13N, can be useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds of formula (I) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described in the Examples as set out below using an appropriate isotopically-labeled reagent in place of the non- labeled reagent previously employed. Processes of Manufacturing Processes for the manufacture of compounds of formula (I), or pharmaceutically acceptable salt thereof, as described herein are also an object of the invention. The preparation of compounds of formula (I) of the present invention may be carried out in sequential or convergent synthetic routes. Syntheses of the invention are shown in the following general schemes. The skills required for carrying out the reaction and purification of the resulting products are known to those persons skilled in the art. The substituents and indices used in the following description of the processes have the significance given herein, unless indicated to the contrary. If one of the starting materials, intermediates or compounds of formula (I) contain one or more functional groups which are not stable or are reactive under the reaction conditions of one or more reaction steps, appropriate protective groups (as described e.g., in “Protective Groups in Organic Chemistry” by T. W. Greene and P. G. M. Wutts, 5th Ed., 2014, John Wiley & Sons, N.Y.) can be introduced before the critical step applying methods well known in the art. Such protective groups can be removed at a later stage of the synthesis using standard methods described in the literature. If starting materials or intermediates contain stereogenic centers, compounds of formula (I) can be obtained as mixtures of diastereomers or enantiomers, which can be separated by methods well known in the art e.g., chiral HPLC, chiral SFC or chiral crystallization. Racemic compounds can e.g., be separated into their antipodes via diastereomeric salts by crystallization with optically pure acids or by separation of the antipodes by specific chromatographic methods using either a chiral adsorbent or a chiral eluent. It is equally possible to separate starting materials and intermediates containing stereogenic centers to afford diastereomerically / enantiomerically enriched starting materials and intermediates. Using such diastereomerically / enantiomerically enriched starting materials and intermediates in the synthesis of compounds of formula (I) will typically lead to the respective diastereomerically / enantiomerically enriched compounds of formula (I). A person skilled in the art will acknowledge that in the synthesis of compounds of formula (I) - insofar not desired otherwise - an “orthogonal protection group strategy” will be applied, allowing the cleavage of several protective groups one at a time each without affecting other protective groups in the molecule. The principle of orthogonal protection is well known in the art and has also been described in literature (e.g. Barany and R. B. Merrifield, J. Am. Chem. Soc. 1977, 99, 7363; H. Waldmann et al., Angew. Chem. Int. Ed. Engl.1996, 35, 2056). A person skilled in the art will acknowledge that the sequence of reactions may be varied depending on reactivity and nature of the intermediates. In more detail, the compounds of formula (I) can be manufactured by the methods given below, by the methods given in the examples or by analogous methods. Appropriate reaction conditions for the individual reaction steps are known to a person skilled in the art. Also, for reaction conditions described in literature affecting the described reactions see for example: Comprehensive Organic Transformations: A Guide to Functional Group Preparations, 2nd Edition, Richard C. Larock. John Wiley & Sons, New York, NY.1999). It was found convenient to carry out the reactions in the presence or absence of a solvent. There is no particular restriction on the nature of the solvent to be employed, provided that it has no adverse effect on the reaction or the reagents involved and that it can dissolve the reagents, at least to some extent. The described reactions can take place over a wide range of temperatures, and the precise reaction temperature is not critical to the invention. It is convenient to carry out the described reactions in a temperature range between -78 °C to reflux. The time required for the reaction may also vary widely, depending on many factors, notably the reaction temperature and the nature of the reagents. However, a period of from 0.5 hours to several days will usually suffice to yield the described intermediates and compounds. The reaction sequence is not limited to the one displayed in the schemes, however, depending on the starting materials and their respective reactivity, the sequence of reaction steps can be freely altered. If starting materials or intermediates are not commercially available or their synthesis not described in literature, they can be prepared in analogy to existing procedures for close analogues or as outlined in the experimental section. All possible stereoisomers are envisioned within the scope of the invention. In the discussion below variables have the meaning indicated above unless otherwise indicated. All final compounds have been characterized using for example LC-MS, NMR and / or Specific Optical Rotation. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The nomenclature used in this application is based on IUPAC systematic nomenclature, unless indicated otherwise. Any open valency appearing on a carbon, oxygen or nitrogen atom in the structures herein indicates the presence of a hydrogen atom. Chemical names are IUPAC names. If a chemical compound is referred to using both a chemical structure and a chemical name, and an ambiguity exists between the structure and the name, the structure predominates. The compounds described herein, including compounds of general Formula (I), can be readily prepared according to the following reaction schemes and Examples, or modifications thereof, using readily available starting materials, reagents, and conventional synthesis procedures. Many of the reactions can also be carried out under microwave conditions or using conventional heating or utilizing other technologies such as solid phase reagents / scavengers or flow chemistry. In these reactions, it is also possible to make use of variants which are themselves known to those skilled in the art but are not mentioned in greater detail. For Example, where specific acids, bases, reagents, coupling agents, solvents, etc. are mentioned, it is understood that other suitable acids, bases, reagents, coupling agents, solvents etc. may be used and are included within the scope of the present invention. Furthermore, other methods for preparing compounds of the invention will be readily apparent to a person of ordinary skill in the art in light of the following reaction schemes and Examples. In cases where synthetic intermediates and final products contain potentially reactive functional groups, for Example Amino, hydroxyl, thiol and carboxylic acid groups that may interfere with the desired reaction, it may be advantageous to employ protected forms of the intermediate. Methods for the selection, introduction, and subsequent removal of protecting groups are well known to those skilled in the art. The compounds obtained by using the general reaction sequences may be of insufficient purity. The compounds can be purified by using any of the methods of purification of organic compounds, for Example, crystallization or silica gel, alumina or C18 column chromatography, using different solvents in suitable ratios. All possible stereoisomers are envisioned within the scope of the invention. In the discussion below variables have the meaning indicated above unless otherwise indicated. Compounds of general formula I can be prepared as described in Scheme 1 by reacting intermediate II with a sulfonyl chloride III in presence of an organic base like triethylamine, pyridine or the like in an organic solvent such as dichloromethane, tetrahydrofuran or 1,4- dioxane to form compound IV. This intermediate can be treated with an aqueous solution of an inorganic base such as lithium hydroxide or sodium hydroxide in a mixture of a polar protic solvents such as methanol or ethanol and a polar aprotic solvent, for example tetrahydrofuran, followed by reaction of the formed acid with benzylamine V using amide coupling reagents such as HATU, HBTU, EDC in presence of a base like N,N-diisopropyl ethylamine, triethylamine or pyridine in a dipolar aprotic solvent such as N,N-dimethylformamide or acetonitrile. Scheme 1: In one aspect, the present invention provides a process of manufacturing a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein said process is as described in Scheme 1. Accordingly, a compound of formula (II), wherein R3, R4, R5, and R9, are as defined herein, (II) Is reacted with a compound of formula (III), wherein R1is as defined herein, in the presence of an organic base to form a compound of formula (IV), wherein R1, R3, R4, R5, and R9are as defined herein, followed by hydrolyzing the methyl ester moiety in said compound of formula (IV) with an aqueous solution of an inorganic base, followed by reacting the resulting carboxylic acid with a compound of formula (V), wherein R2, R6, R7, and R8are as defined herein, to form said compound of formula (I). In a further aspect, the present invention provides a compound of formula (I) as described herein, when manufactured according to any one of the processes described herein. Using the Compounds of the Invention In one aspect, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, for use as therapeutically active substance. In a further aspect, the present invention provides the use of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, for the treatment and / or prophylaxis of disease or disorder mediated by MET kinase. In a further aspect, the present invention provides the use of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, for the preparation of a medicament for the treatment and / or prophylaxis of disease or disorder mediated by MET kinase. In a further aspect, the present invention provides a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, for use in the treatment and / or prophylaxis of disease or disorder mediated by MET kinase. In a further aspect, the present invention provides a method for the treatment and / or prophylaxis of disease or disorder mediated by MET kinase, which method comprises administering a therapeutically effective amount of a compound of formula (I) as described herein to a human. In some embodiments, said disease or disorder that is mediated by MET kinase is cancer. In some embodiments, said cancer is lung cancer. In some embodiments, said lung cancer is non-small-cell lung cancer (NSCLC). Pharmaceutical Compositions and Administration In one aspect, the present invention provides a pharmaceutical composition comprising a compound of formula (I), or a pharmaceutically acceptable salt thereof, as described herein and a pharmaceutically acceptable excipient. In one embodiment, said pharmaceutical composition further comprises an additional therapeutic agent. The compounds of formula (I) and their pharmaceutically acceptable salts and esters can be used as medicaments (e.g. in the form of pharmaceutical preparations). The pharmaceutical preparations can be administered internally, such as orally (e.g. in the form of tablets, coated tablets, dragées, hard and soft gelatin capsules, solutions, emulsions or suspensions), nasally (e.g. in the form of nasal sprays) or rectally (e.g. in the form of suppositories). However, the administration can also be effected parentally, such as intramuscularly or intravenously (e.g. in the form of injection solutions). The compounds of formula (I) and their pharmaceutically acceptable salts and esters can be processed with pharmaceutically inert, inorganic or organic adjuvants for the production of tablets, coated tablets, dragées and hard gelatin capsules. Lactose, corn starch or derivatives thereof, talc, stearic acid or its salts etc. can be used, for example, as such adjuvants for tablets, dragées and hard gelatin capsules. Suitable adjuvants for soft gelatin capsules are, for example, vegetable oils, waxes, fats, semi- solid substances and liquid polyols, etc. Suitable adjuvants for the production of solutions and syrups are, for example, water, polyols, saccharose, invert sugar, glucose, etc. Suitable adjuvants for injection solutions are, for example, water, alcohols, polyols, glycerol, vegetable oils, etc. Suitable adjuvants for suppositories are, for example, natural or hardened oils, waxes, fats, semi- solid or liquid polyols, etc. Moreover, the pharmaceutical preparations can contain preservatives, solubilizers, viscosity- increasing substances, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, flavorants, salts for varying the osmotic pressure, buffers, masking agents or antioxidants. They can also contain still other therapeutically valuable substances. The dosage can vary in wide limits and will, of course, be fitted to the individual requirements in each particular case. In general, in the case of oral administration a daily dosage of about 0.1 mg to 20 mg per kg body weight, preferably about 0.5 mg to 4 mg per kg body weight (e.g. about 300 mg per person), divided into preferably 1-3 individual doses, which can consist, for example, of the same amounts, should be appropriate. It will, however, be clear that the upper limit given herein can be exceeded when this is shown to be indicated. Tablet Formulation (Wet Granulation) Item Ingredients mg / tablet 1. Compound of formula (I) 5 25 100 500 2. Lactose Anhydrous DTG 125 105 30 150 3. Sta-Rx 1500 6 6 6 30 4. Microcrystalline Cellulose 30 30 30 150 5. Magnesium Stearate 1 1 1 1 Total 167 167 167 831 Manufacturing Procedure 1. Mix items 1, 2, 3 and 4 and granulate with purified water. 2. Dry the granules at 50°C. 3. Pass the granules through suitable milling equipment. 4. Add item 5 and mix for three minutes; compress on a suitable press. Capsule Formulation Item Ingredients mg / capsule 1. Compound of formula (I) 5 25 100 500 2. Hydrous Lactose 159 123 148 --- 3. Corn Starch 25 35 40 70 4. Talc 10 15 10 25 5. Magnesium Stearate 1 2 2 5 Total 200 200 300 600 Manufacturing Procedure 1. Mix items 1, 2 and 3 in a suitable mixer for 30 minutes. 2. Add items 4 and 5 and mix for 3 minutes. 3. Fill into a suitable capsule. Examples The invention will be more fully understood by reference to the following examples. The claims should not, however, be construed as limited to the scope of the examples. In case the preparative examples are obtained as a mixture of enantiomers, the pure enantiomers can be separated by methods described herein or by methods known to the person skilled in the art, such as e.g., chiral chromatography (e.g., chiral SFC) or crystallization. All reaction examples and intermediates were prepared under an argon atmosphere if not specified otherwise. The compounds disclosed and described herein have been named using the IUPAC naming function of Biovia Draw 22.1. If there is a discrepancy between a depicted structure and a name given to that structure, then the depicted structure controls. As depicted in the Examples below, in certain exemplary embodiments, compounds are prepared according to the following general procedures. It will be appreciated that, althoughthe general methods depict the synthesis of certain compounds of the invention, thefollowing general methods, and other methods known to one skilled in the art, can be applied to all compounds and subclasses and species of each of these compounds, as described herein. INTERMEDIATES SYNTHESIS OF INTERMEDIATES A Intermediate A1: Methyl 3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate Methyl 3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate (CAS 758684-29-6) is commercially available. Intermediate A2: Methyl spiro[3,4-dihydro-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxylate Step 1: Methyl 4-(1-methoxycarbonylcyclopropoxy)-3-nitro-benzoate To a stirred solution of methyl 1-hydroxy-1-cyclopropane carboxylate (CAS 33689-29-1, 7 g, 50.2 mmol) in N,N-dimethylformamide (100 ml), was added sodium hydride (2.41 g, 60.3 mmol) at 0°C under N2 atmosphere. The reaction mixture was stirred at 0 °C for 30 minutes and then methyl 4-fluoro-3-nitrobenzoate (CAS 329-59-9, 10.0 g, 502 mmol) was added. After stirring at 25 °C for 16 hours under a nitrogen atmosphere, the reaction mixture was slowly poured into saturated aqueous NH4Cl (500 ml) and stirred at 0 °C for 10 minutes, after which the mixture was extracted with ethyl acetate three times. The organic layer was washed twice with brine, dried over Na2SO4, and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 1-30%) to afford methyl 4-(1- methoxycarbonylcyclopropoxy)-3-nitro-benzoate (13.0 g, 88% yield) as an orange oil.1H NMR (400 MHz, CHLOROFORM-d) δ = 8.50 (d, J = 2.0 Hz, 1H), 8.16 (dd, J = 2.0, 8.8 Hz, 1H), 7.18 (d, J = 8.8 Hz, 1H), 3.93 (s, 3H), 3.73 (s, 3H), 1.77 - 1.69 (m, 2H), 1.49 - 1.41 (m, 2H) Step 2: Methyl 3-oxospiro[4H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxylate To a solution of methyl 4-(1-methoxycarbonylcyclopropoxy)-3-nitro-benzoate (13.0 g, 44 mmol) in acetic acid (100 ml) was added iron (7.4 g, 132 mmol). The resulting mixture was stirred at 90 °C for 2 hours. The mixture was filtered through celite and washed with ethyl acetate. The filtrate was poured into water and the mixture was extracted with ethyl acetate three times. The combined organic phase was washed with brine three times, dried over Na2SO4 and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, methanol in dichloromethane, 10-20%) to afford methyl 3-oxospiro[4H-1,4-benzoxazine-2,1'-cyclopropane]- 6-carboxylate (56.0 g, 79% yield) as a yellow solid. MS m / z: 234.0 [M+H]+, ESI pos. Intermediate A3: Methyl (2R)-2-methyl-3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate Step 1: Methyl 4-[(1R)-2-methoxy-1-methyl-2-oxo-ethoxy]-3-nitro-benzoate To a solution of methyl (R)-(+)-lactate (CAS 17392-83-5, 2.35 g, 22.6 mmol) in tetrahydrofuran (40 ml), was added in portions sodium hydride (903 mg, 22.6 mmol) at 0-10 °C. The mixture was stirred at 0-10 °C for 30 minutes. Methyl 4-fluoro-3-nitrobenzoate (CAS 329-59-9, 3.0 g, 15.1 mmol) was added to the mixture at 0-10 °C in portions, and the mixture was stirred at 40 °C for 16 hours. The reaction mixture was added to a saturated solution of NH4Cl and extracted twice with ethyl acetate. The combined organic phase was washed twice with brine, dried over Na2SO4, filtered and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 0-50%) to afford methyl 4-[(1R)-2-methoxy-1- methyl-2-oxo-ethoxy]-3-nitro-benzoate (3.4 g, 80% yield) as a yellow oil.1H NMR (400 MHz, CHLOROFORM-d) δ = 8.49 (d, J = 2.0 Hz, 1H), 8.15 (dd, J = 2.0, 8.8 Hz, 1H), 6.95 (d, J = 8.8 Hz, 1H), 4.94 (q, J = 6.8 Hz, 1H), 3.93 (s, 3H), 3.77 (s, 3H), 1.72 (d, J = 6.8 Hz, 3H). Step 2: Methyl (2R)-2-methyl-3-oxo-4H-1,4-benzoxazine-6-carboxylate To a solution of methyl 4-[(1R)-2-methoxy-1-methyl-2-oxo-ethoxy]-3-nitro-benzoate (4 g, 14.1 mmol) in acetic acid (60 ml) was added iron (2.37g, 42.4 mmol). The resulting suspension was stirred at 90 °C for 2 hours. The reaction mixture was concentrated in vacuo. The crude was diluted with ethyl acetate, filtered, and washed with water. The filtrate was then washed with a saturated aqueous solution of sodium bicarbonate and brine twice each, dried over Na2SO4, and concentrated in vacuo to afford methyl (2R)-2-methyl-3-oxo-4H-1,4-benzoxazine-6-carboxylate (3.1 g, 99% yield) as a white solid. MS m / z: 222.2 [M+H]+, ESI pos. Step 3: Methyl (2R)-2-methyl-3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate To a solution of methyl (2R)-2-methyl-3-oxo-4H-1,4-benzoxazine-6-carboxylate (1.6 g, 7.23 mmol) in tetrahydrofuran (30 ml), was added dropwise a 10 M solution of borane dimethyl sulfide complex in tetrahydrofuran (3.62 ml, 36.2 mmol) at 20 °C. After stirring at 20 °C for 16 hours, the reaction mixture was added to a saturated solution of NH4Cl and extracted twice with ethyl acetate. The combined organic phase was washed with brine twice, dried over Na2SO4, and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 0-50%) to afford methyl (2R)-2-methyl-3,4-dihydro-2H-1,4-benzoxazine-6- carboxylate (1.0 g, 62% yield) as a white solid. MS m / z: 208.2 [M+H]+, ESI pos. Intermediate A4: Methyl 8-fluoro-3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate Step 1: Methyl 3-fluoro-4-hydroxy-5-nitro-benzoate To a cooled solution of methyl 3-fluoro-4-hydroxybenzoate (CAS 403-01-0, 5 g, 29.4 mmol) in a mixture of acetic acid (33 ml) and acetic anhydride (17 ml) was added at 0℃, a solution of fuming nitric acid (1.35 ml, 32.3 mmol) in acetic acid (20 ml) over 1 minute. The temperature of the light brown solution was allowed to rise to 22 °C and stirred for 15 minutes. The reaction mixture was diluted with water and left to settle for 30 minutes. The mixture was then filtered, and the filter cake was washed with water. The filtrate was extracted with ethyl acetate twice, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 0-50%) to afford methyl 3-fluoro-4-hydroxy-5-nitro-benzoate (5.2 g, 82% yield) as a yellow solid. MS m / z: 214.1 [M-H]-, ESI neg. Step 2: Methyl 3-amino-5-fluoro-4-hydroxy-benzoate To a solution of methyl 3-fluoro-4-hydroxy-5-nitro-benzoate (1.0 g, 4.65 mmol) in ethanol (20 ml) and water (4 ml) were added iron (1.3 g, 23.2 mmol) and NH4Cl (1.23 g, 23.3 mmol). After stirring at 80 °C for 2 hours, the mixture was concentrated in vacuo, filtered, and extracted with ethyl acetate three times. The combined organic phase was washed with water twice, dried over Na2SO4, filtered and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 0-50%) to afford methyl 3-amino-5-fluoro-4- hydroxy-benzoate (600 mg, 66% yield) as a yellow solid. MS m / z: 184 [M-H]-, ESI neg. Step 3: Methyl 8-fluoro-3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate To a solution of methyl 3-amino-5-fluoro-4-hydroxy-benzoate (500 mg, 2.7 mmol) in N,N- dimethylformamide (10 ml) was added potassium carbonate (745 mg, 5.4 mmol). After stirring at 20 °C for 15 minutes, 1,2-dibromoethane (CAS 106-93-4, 558 mg, 2.97 mmol) was added and the reaction mixture was stirred at 120 °C for 16 hours. The mixture was then concentrated in vacuo, filtered, and purified by reverse phase flash chromatography (Flash Spherical C18, 20- 35μm; 100 Å; 20 g, water-acetonitrile) to afford methyl 8-fluoro-3,4-dihydro-2H-1,4- benzoxazine-6-carboxylate (130.0 mg, 22.3% yield) as a white solid. MS m / z: 212.1 [M+H]+, ESI pos. Intermediate A5: Methyl (2R)-8-fluoro-2-methyl-3,4-dihydro-2H-1,4-benzoxazine-6- carboxylate Step 1: Methyl 3-fluoro-4-hydroxy-5-nitro-benzoate To a cooled solution of methyl 3-fluoro-4-hydroxybenzoate (CAS 403-01-0, 5 g, 29.4 mmol) in a mixture of acetic acid (33 ml) and acetic anhydride (17 ml) was added a mixture of fuming nitric acid (1.35 ml, 32.3 mmol) in acetic acid (20 ml) over 1 minute at 0 °C. Upon completing the addition, the temperature of the light brown solution was allowed to rise to 22 °C and stirred for 15 minutes. The reaction mixture was diluted with water and allowed to settle for 30 minutes, after which it was filtered. The filter cake was washed with water and the filtrate was extracted with ethyl acetate twice, washed with brine, dried over sodium sulfate, and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 0-100%) and concentrated in vacuo to afford the methyl 3-fluoro-4-hydroxy- 5-nitro-benzoate (5.2 g, 82% yield) as a yellow solid. MS m / z: 214.1 [M-H]-, ESI neg. Step 2: Methyl 3-fluoro-4-[(1R)-2-methoxy-1-methyl-2-oxo-ethoxy]-5-nitro-benzoate To a solution of methyl 3-fluoro-4-hydroxy-5-nitro-benzoate (1g, 4.6 mmol) and methyl (S)-(-)- lactate (CAS 27871-49-4, 726 mg, 7 mmol) in tetrahydrofuran (20 ml) was added triphenylphosphine (2.44g, 9.3 mmol) and diethyl azodicarboxylate (1.46 ml, 9.3 mmol) at 0 °C, under inert atmosphere. The mixture was stirred at 20 °C for 1 hour, then diluted with water and extracted with ethyl acetate three times. The combined organic phase was washed twice with brine, dried over sodium sulfate and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 0-50%) to afford methyl 3-fluoro-4- [(1R)-2-methoxy-1-methyl-2-oxo-ethoxy]-5-nitro-benzoate (1.6 g , >100% yield) as a colorless oil.1H NMR (400 MHz, DMSO-d6) δ = 8.25 (t, J = 1.6 Hz, 1H), 8.10 (dd, J = 2.0, 12.0 Hz, 1H), 5.22 (dq, J = 1.2, 6.8 Hz, 1H), 4.10 - 3.96 (m, 1H), 3.89 (s, 3H), 3.66 (s, 3H), 1.55 (d, J = 6.8 Hz, 3H) Step 3: Methyl (2R)-8-fluoro-2-methyl-3-oxo-4H-1,4-benzoxazine-6-carboxylate To a solution of methyl 3-fluoro-4-[(1R)-2-methoxy-1-methyl-2-oxo-ethoxy]-5-nitro-benzoate (1.3 g, 4.32 mmol) in acetic acid (30 ml), was added iron (725 mg, 13.0 mmol) at 25 °C. After stirring at 90 °C for 2 hours, the mixture was concentrated in vacuo, filtered, and extracted with ethyl acetate three times. The pH of the combined organic phase was adjusted to pH=7 by addition of aqueous sodium hydrogen carbonate solution, then was washed with water twice, dried over Na2SO4, filtered, and concentrated in vacuo to give crude methyl (2R)-8-fluoro-2- methyl-3-oxo-4H-1,4-benzoxazine-6-carboxylate (1g, 96% yield) as a white solid. MS m / z: 240.0 [M+H]+, ESI pos. Step 4: Methyl (2R)-8-fluoro-2-methyl-3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate To a solution of methyl (2R)-8-fluoro-2-methyl-3-oxo-4H-1,4-benzoxazine-6-carboxylate (1.0 g, 4.18 mmol) in tetrahydrofuran (20 ml) was added dropwise under inert atmosphere a 10M solution of borane dimethyl sulfide complex in tetrahydrofuran (4.18 ml, 41.8 mmol). After stirring at 20 °C for 18 hours, the reaction mixture was quenched by dropwise addition of methanol (20 ml) at 0 °C, followed by stirring at 20 °C for 30 minutes and at 50 °C for another 30 minutes. The solution was finally concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether,0-50%) to afford methyl (2R)-8- fluoro-2-methyl-3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate (1.0 g, >100% yield) as a white solid. MS m / z: 225.9 [M+H]+, ESI pos. Intermediate A6: Methyl 8-fluoro-3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate To a solution of 5-bromo-1,2-difluoro-3-nitro-benzene (CAS 1261988-16-2, 10.0 g, 42.02 mmol) in N-methyl-2-pyrrolidone (100 ml), was added copper(I) cyanide (3.76 g, 42.0 mmol). After stirring at 140 °C for 4 hours, the cooled reaction mixture was diluted with water and extracted with ethyl acetate three times. The combined organic phase was washed with brine twice, dried over sodium sulfate and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 0-20%) and concentrated in vacuo to afford 3,4-difluoro-5-nitro-benzonitrile (1.3 g, 16% yield) as a yellow solid. Step 2: 3,4-Difluoro-5-nitro-benzoic acid A solution of 3,4-difluoro-5-nitro-benzonitrile (1.3 g, 7.06 mmol) in sulfuric acid (26.0 ml) was stirred at 110 °C for 16 hours. After cooling, the reaction mixture was carefully poured into water and extracted with ethyl acetate three times. The combined organic phase was washed with brine twice, dried over sodium sulfate and concentrated in vacuo to give 3,4-difluoro-5- nitro-benzoic acid (1.3 g, 79% yield) as a yellow oil. MS m / z: 201.9 [M-H]-, ESI neg. Step 3: Methyl 3,4-difluoro-5-nitro-benzoate To a solution of 3,4-difluoro-5-nitro-benzoic acid (1.3 g, 6.4 mmol) in methanol (30 ml) was added thionyl chloride (5.78 ml, 79.6 mmol) at 0 °C, then the mixture was stirred at 20 °C for 30 minutes, after which it was heated to 70 °C for 1 hour and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 20-30%) and concentrated in vacuo to afford methyl 3,4-difluoro-5-nitro-benzoate (1.3 g, 92% yield) as a yellow oil.1H NMR (400 MHz, DMSO-d6) δ = 8.44 - 8.40 (m, 1H), 8.40 - 8.35 (m, 1H), 3.92 (s, 3H) Step 4: Methyl 3-fluoro-4-(1-methoxycarbonylcyclopropoxy)-5-nitro-benzoate To a solution of 1-hydroxy-cyclopropanecarboxylic acid methyl ester (1.04 g, 8.98 mmol) in N,N-dimethylformamide (26 ml) was added sodium hydride (359 mg, 8.98 mmol) in batches at 0-10 °C. The mixture was stirred at 0-10 °C for 30 minutes, after which methyl 3,4-difluoro-5- nitro-benzoate (1.3 g, 5.99 mmol) was added and the reaction mixture was stirred at 20 °C for 16 hours. The reaction mixture was poured slowly into saturated aqueous ammonium chloride and stirred at 0 °C for 10 minutes, then the mixture was extracted with ethyl acetate three times. The organic layer was washed with brine twice, dried over sodium sulfate, and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 0-10%) and concentrated in vacuo to afford methyl 3-fluoro-4-(1- methoxycarbonylcyclopropoxy)-5-nitro-benzoate (1.6 g, 81% yield) as an orange oil. MS m / z: 314.1 [M+H]+, ESI pos. Step 5: Methyl 8-fluoro-3-oxo-spiro[4H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxylate To a solution of methyl 3-fluoro-4-(1-methoxycarbonylcyclopropoxy)-5-nitro-benzoate (1.6 g, 5.11 mmol), in acetic acid (30 ml) was added iron (0.86 g, 15.3 mmol) at 25 °C. After the mixture was stirred at 90 °C for 2 hours, it was concentrated in vacuo, filtered, and washed with ethyl acetate three times. To the combined organic layer was added a solution of 5% sodium bicarbonate (20 ml) until pH=7. The phases were separated and the organic layer was washed with water three times, dried over Na2SO4, filtered and concentrated in vacuo to afford methyl 8- fluoro-3-oxo-spiro[4H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxylate (1.3 g, 100% yield) as an off-white solid. MS m / z: 252.1 [M+H]+, ESI pos. Step 6: Methyl 8-fluorospiro[3,4-dihydro-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxylate To a solution of methyl 8-fluoro-3-oxo-spiro[4H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxylate (1.2 g, 4.78 mmol) in tetrahydrofuran (24 ml) was added a solution of borane dimethyl sulfide complex in tetrahydrofuran (4.78 ml, 47.8 mmol) under N2 at 0 °C, after which the mixture was stirred at 25 °C for 16 hours. The reaction mixture was quenched by slow addition of methanol at 0 °C, followed by stirring at 20 °C for 30 minutes and at 50 °C for another 30 minutes. The mixture was concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 20-40%) to afford methyl 8- fluorospiro[3,4-dihydro-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxylate (1.1 g, 97% yield) as a yellow solid. MS m / z: 238.1 [M+H]+, ESI pos. SYNTHESIS OF INTERMEDIATES B Intermediate B1: Ethyl (3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]propanoate -2-methyl-propane-2- sulfonamide To a clear solution of 2-chloro-5-(trifluoromethyl)benzaldehyde (CAS 82386-89-8, 30.6 g, 147 mmol) in dry tetrahydrofuran (306 ml) was added (R)-2-methylpropane-2-sulfinamide (+) (CAS 196929-78-9, 17.8 g, 146 mmol,). The solution was cooled down to 0 °C, then titanium (IV) ethoxide (CAS 3087-36-3, 100 g, 93 ml, 440 mmol) was added dropwise maintaining the temperature below 5 °C. The mixture was allowed to warm to room temperature and was stirred for 1.5 hours. For the work-up, about 10 g of dicalite were added and the mixture was stirred for 5 minutes. The solution was poured into a stirred mixture of brine and ice. More dicalite was added and the suspension was stirred for 30 minutes at room temperature. The solids were filtered, washed with tetrahydrofuran and water. The solvent was removed under vacuo and the residue was extracted with ethyl acetate three times. The combined organic layer was washed with water and brine, dried over MgSO4, filtered and evaporated. The crude was purified by flash chromatography (silica gel, ethyl acetate in heptane, 5-50%) to afford (NZ)-N-[[2-chloro-5- (trifluoromethyl)phenyl]methylene]-2-methyl-propane-2-sulfonamide (36.7 g, 80%) as a white waxy solid. MS m / z: 312.0 [M+H]+, ESI pos. Step 2: Ethyl (3S)- -3-[2-chloro-5-(trifluoromethyl)phenyl]propanoate To a suspension of activated zinc (31.4 g, 480 mmol) in dry tetrahydrofuran (200 ml) was added cuprous chloride (CAS 7758-89-6, 9.55 g, 96.5 mmol) under nitrogen. The resulting suspension was stirred at 65 °C for 45 minutes then was cooled to 45 °C before ethyl bromoacetate (CAS 105-36-2, 17.9 ml, 160 mmol) was added dropwise within 35 minutes, so that the mixture started to reflux again and the temperature was maintained between 49°C-53°C. The reaction mixture was stirred at 50°C for 15 minutes. The dark reaction mixture was cooled down to 0 °C before a solution of (NZ)-N-[[2-chloro-5-(trifluoromethyl)phenyl]methylene]-2-methyl-propane-2- sulfonamide (25 g, 80.2 mmol) in dry tetrahydrofuran (150 ml) was added within 25 minutes. Stirring at 0 °C was continued for 2 hours then the mixture was poured into water. The suspension was stirred for 10 minutes, the solid was filtered off. The filtrate was evaporated and the residue was extracted with three times ethyl acetate. The combined organic layer was washed with sodium bicarbonate and brine, dried over MgSO4 and evaporated. The crude was purified by flash chromatography (silica gel, tert-butyl methyl ether in heptane, 10-60%) to afford ethyl (3S)-3-(tert-butylsulfonylamino)-3-[2-chloro-5-(trifluoromethyl)phenyl]propanoate (27.3 g, 81% yield) as a light yellow viscous oil. MS m / z: 400.1 [M+H]+, ESI pos. Step 3: Ethyl (3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]propanoate To a cooled solution of ethyl (3S)-3-(tert-butylsulfonylamino)-3-[2-chloro-5- (trifluoromethyl)phenyl]propanoate (15.2 g, 38 mmol) in tetrahydrofuran (180 ml) was added dropwise over 30 minutes at 0 °C a solution of 4 M hydrogen chloride in 1,4-dioxane (38 ml, 152 mmol). The reaction mixture was stirred for 2 hours at room temperature. The solvents were removed in vacuo and the residue was diluted with ethyl acetate and washed with a solution of saturated Na2CO3. The aqueous phase was then extracted twice with ethyl acetate and the combined organic layer was successively washed with water and brine, dried over MgSO4, filtered and evaporated. The crude was purified by flash chromatography (silica gel, tert-butyl methyl ether in heptane, 0-40%) to afford ethyl (3S)-3-amino-3-[2-chloro-5- (trifluoromethyl)phenyl]propanoate (9.2 g, 78% yield) as a colorless liquid. MS m / z: 297.1 [M+H]+, ESI pos. Intermediate B2: Ethyl (3S)-3-amino-3-[2-methyl-5-(trifluoromethyl)phenyl]propanoate The title compound was prepared in analogy to Intermediate B1 starting from 2-methyl-5- (trifluoromethyl)benzaldehyde (CAS 886498-85-7) instead of 2-chloro-5- (trifluoromethyl)benzaldehyde in step 1. Light yellow liquid, MS m / z: 276.2 [M+H]+, ESI pos. Intermediate B3: Ethyl (2R,3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]-2-methyl- propanoate Step 1: (2R,3S)-3-(tert-Butylsulfinylamino)-3-[2-chloro-5-(trifluoromethyl)phenyl]-2-methyl- propionic acid ethyl ester The title compound was prepared in analogy to Intermediate B1, step2 using (NZ)-N-[[2- chloro-5-(trifluoromethyl)phenyl]methylene]-2-methyl-propane-2-sulfonamide instead of (NZ)- N-[[2-chloro-5-(trifluoromethyl)phenyl]methylene]-2-methyl-propane-2-sulfonamide and 2- bromopropionic acid ethyl ester instead of ethyl bromoacetate. The diastereomers were separated by chiral SFC (column: chiral OZ-H, 5 µm, 250 x 20 mm, co- solvent 5%EtOH / Heptane 1 / 1) First eluting diastereomer: (2R,3S)-3-(tert-butylsulfinylamino)-3-[2-chloro-5- (trifluoromethyl)phenyl]-2-methyl-propionic acid ethyl ester. Colorless oil. MS m / z: 414.1 [M+H]+, ESI pos. Final absolute assignment was made by later analysis of derivatives. Second eluting diastereomer: (2S,3S)-3-(tert-butylsulfinylamino)-3-[2-chloro-5- (trifluoromethyl)phenyl]-2-methyl-propionic acid ethyl ester. Colorless oil. MS m / z: 414.2 [M+H]+, ESI pos., final absolute assignment was made by later analysis of derivatives. Step 2: Ethyl (2R,3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]-2-methyl-propanoate The title compound was prepared in analogy to Intermediate B1, step 3 starting from (2R,3S)- 3-(tert-butylsulfinylamino)-3-[2-chloro-5-(trifluoromethyl)phenyl]-2-methyl-propionic acid ethyl ester instead of (3S)-3-[[(R)-tert-butylsulfinyl]amino]-3-[2-chloro-5- (trifluoromethyl)phenyl]propionic acid ethyl ester. Colorless oil. MS m / z: 309.6 [M+H]+, ESI pos. Intermediate B4: (3S)-3-Amino-3-[2-chloro-5-(trifluoromethyl)phenyl]-N-methyl-propanamide Step1: (3S)-3-(tert-Butylsulfinylamino)-3-[2-chloro-5-(trifluoromethyl)phenyl]propionic acid To a mixture of (3S)-3-[[(R)-tert-butylsulfinyl]amino]-3-[2-chloro-5- (trifluoromethyl)phenyl]propionic acid ethyl ester (5.15 g, 12.9 mmol ) in a mixture of methanol (15 ml), tetrahydrofuran (15 ml) and water (51 ml) at room temperature was added a solution of 1 M lithium hydroxide (28.2 ml, 28.2 mmol). The reaction mixture was stirred at 30 °C for 2 hours. The organic solvents were removed by evaporation and the residue was diluted with water and washed with a solution of 0.1M HCl followed by water twice. The aqueous phase was extracted three times with ethyl acetate. The combined organic layer was dried over MgSO4, filtered, evaporated and dried under vacuo to afford (3S)-3-(tert-butylsulfinylamino)-3-[2- chloro-5-(trifluoromethyl)phenyl]propionic acid (4.71 g, 95% yield) as a white crystalline solid. MS m / z: 370.1 [M-H]-, ESI pos. Step 2: (3S)-3-(tert-Butylsulfinylamino)-3-[2-chloro-5-(trifluoromethyl)phenyl]-N-methyl- propionamide To a cold solution of (3S)-3-[[(R)-tert-butylsulfinyl]amino]-3-[2-chloro-5- (trifluoromethyl)phenyl]propionic acid (4.7 g, 12.6 mmol) in N,N-dimethylformamide (100 ml) were added HATU (5.3 g, 14 mmol), methylamine hydrochloride (CAS 593-51-1, 1.2 g, 17.8 mmol) and DIPEA (7 ml, 40.2 mmol). The reaction mixture was stirred at 15 °C for 2 hours. The solvent was evaporated under high vacuo, the residue was dissolved with ethyl acetate and was washed with water and brine. The organic layer was dried over MgSO4, filtered and evaporated to give (3S)-3-(tert-butylsulfinylamino)-3-[2-chloro-5-(trifluoromethyl)phenyl]-N-methyl- propionamide (6.59 g, 99% yield) as a light brown gum. MS m / z: 385.0 [M+H]+, ESI pos Step 3: (3S)-3-Amino-3-[2-chloro-5-(trifluoromethyl)phenyl]-N-methyl-propionamide To a solution of (3S)-3-[[(R)-tert-butylsulfinyl]amino]-3-[2-chloro-5-(trifluoromethyl)phenyl]- N-methyl-propionamide (6.59 g, 17.1 mmol) in tetrahydrofuran (90 ml) cooled to 0 °C was added dropwise a solution of 4 M hydrogen chloride in 1,4-dioxane (17.1 ml, 68.5 mmol). The reaction mixture was stirred at room temperature for 2 hours then was poured to a cold solution of 25% ammonium hydroxide (120 ml) and stirred for 20 minutes. The mixture was extracted three times with ethyl acetate, the organic layer was washed successively with water and brine, dried over MgSO4, filtered and evaporated. The crude was purified by flash chromatography (silica gel, methanol in tert-butyl methyl ether 9:1 containing 1% of trimethylamine and heptane, 0-40%). The fractions containing the product were evaporated and the residue obtained was crystallised using a mixture of ethyl acetate, tert-butyl methyl ether and heptane to give (3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]-N-methyl-propionamide (3.71g, 67% yield) as an off-white solid. MS m / z : 280.9 [M+H]+, ESI pos Intermediate B5: (3S)-3-Amino-3-[2-chloro-5-(trifluoromethyl)phenyl]-N-methyl-propanamide hydrochloride
[0003] To a solution of (3S)-3-[[(R)-tert-butylsulfinyl]amino]-3-[2-chloro-5-(trifluoromethyl)phenyl]- N-methyl-propionamide (50 mg, 0.13 mmol) in dichloromethane (1ml) cooled to 0 °C was added dropwise a solution of 4 M hydrogen chloride in 1,4-dioxane (1 ml, 4 mmol). The reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated to give (3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]-N-methyl-propionamide hydrochloride salt (50 mg, 96% yield) as a light yellow oil. MS m / z: 281.1 [M+H]+, ESI pos Intermediate B6: 3-Amino-3-[2-chloro-5-(trifluoromethyl)phenyl]propanoic acid To a stirred solution of 2-chloro-5-(trifluoromethyl)benzaldehyde (1.5 g, 7.19 mmol) and malonic acid (1.5 g, 14.38 mmol) in ethanol (10.1 ml) at room temperature was added ammonium ethanoate (CAS 631-61-8, 1.21 g, 15.74 mmol) and the mixture was refluxed for 20 hours. The mixture was slowly cooled to room temperature and a precipitate formed. The white crystals were collected by filtration, washed with methanol and dried under vacuo to give methyl 3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]propanoate (888 mg, 46% yield) as a white crystalline solid. MS m / z: 268.1 [M+H]+, ESI pos. Intermediate B7: Ethyl (3S)-3-amino-3-(2,5-dichlorophenyl)propanoate
[0004] The title compound was prepared in analogy to Intermediate B1 starting from 2,5- dichlorobenzaldehyde (CAS 6361-23-5) instead of 2-chloro-5-(trifluoromethyl)benzaldehyde in step 1, colorless oil, MS m / z: 263.1 [M+H]+, ESI pos. SYNTHESIS OF INTERMEDIATES C The intermediates C1 to C10, C15 and C16 were obtained in two steps starting from Intermediates B. The intermediates C11 to C14 were obtained differently, see following procedures. General procedure for intermediates C Step 1: Sulfonamide formation Method a1: To a solution of Intermediate C in dichloromethane (0.2-0.3 M) were added triethylamine (3 eq) and N,N-dimethylpyridin-4-amine (0.1 eq). The appropriate benzenesulfonyl chloride (1.5 eq) dissolved in dichloromethane (0.2-0.3 M) was added dropwise at room temperature over 5 minutes. The reaction mixture was stirred for 2-16 hours then was quenched by addition of water, and extracted twice with dichloromethane. The combined organic phase was washed with a solution of 1M HCl and with brine, dried over MgSO4or Na2SO4, filtered and concentrated in vacuo. The crude was purified by flash chromatography using silica gel with a gradient of ethyl acetate / heptane (usually ethyl acetate in heptane 0-50%) to yield the targeted compound. Method a2: To a solution of Intermediate C in dichloromethane (0.1-0.2M) and pyridine (10 eq) was added dropwise the appropriate benzenesulfonyl chloride (1.5 eq) at 0 °C. The mixture was stirred with cooling for 2-16 hours then was quenched by addition of water, and extracted with dichloromethane. The organic phase was washed with saturated aqueous sodium bicarbonate. The solution was dried over Na2SO4, and concentrated in vacuo. When needed, the crude was purified by flash chromatography using silica gel with a gradient of ethyl acetate / heptane (usually ethyl acetate in heptane 0-50%) to yield the targeted compound. Step 2: Saponification Method b1: To a solution of the ester in methanol:THF 1:2 (0.05-0.2 M) or ethanol:THF (0.05- 0.2 M) was added dropwise a solution of sodium hydroxide (1M or 4M ,1 to 3 eq) or a solution of lithium hydroxide (1M, 1-3 eq) at room temperature. The reaction mixture was stirred at room temperature or at 40-50 °C for 30 minutes to 72 hours. After cooling, the pH of the mixture was set to pH=2-3 by addition of a solution of 2M HCl and the mixture was extracted with dichloromethane or ethyl acetate twice. The combined organic phase was washed with water and brine, dried over MgSO4 or Na2SO4, filtered and concentrated in vacuo. When needed, the crude was purified by flash chromatography using silica gel with a gradient of ethyl acetate / heptane (usually ethyl acetate in heptane 40-100 %) to yield the targeted compound. Method b2: To a solution of the ester in methanol:THF 1:2 (0.05-0.2 M) or ethanol:THF 1:2 (0.05-0.2 M) was added a solution of lithium hydroxide (1M, 1-3 eq) at room temperature. The reaction was stirred at room temperature or at 50 °C for 30 minutes to 72 hours. The organic solvents were removed by evaporation, the white suspension obtained was diluted with water and a solution of 1M HCl was added dropwise to reach pH 1-2. After stirring for 30 minutes to 16 hours, the free acid was filtered, washed with water, dried under high vacuum and used without further purification in the subsequent step. Intermediate C1: 4-(m-Tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid Step1: Methyl 4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylate The title intermediate was prepared using Method a1 starting with methyl 3,4-dihydro-2H-1,4- benzoxazine-6-carboxylate (Intermediate A1, 1.5 g, 7.76 mmol) and 3-methylbenzenesulfonyl chloride (CAS 1899-93-0, 2.22 g, 11.7 mmol) to give methyl 4-(m-tolylsulfonyl)-2,3-dihydro- 1,4-benzoxazine-6-carboxylate (2.78g, 100% yield) as a light yellow viscous oil. MS m / z: 348.0 [M+H]+, ESI pos. Step2: 4-(m-Tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid The title intermediate was prepared using saponification method b2 starting with methyl 4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylate (2.7 g, 7.74 mmol) to give ethyl (3S)- 3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]propanoate (2.46 g, 94% yield) as a colorless liquid. MS m / z: 334.0 [M+H]+, ESI pos. Int. Name Structure Reactant 1 Reactant 2 Methods C2 8-fluoro-4-(m- A4 3- a2,b1 tolylsulfonyl)-2,3- methylbenzene dihydro-1,4- sulfonyl benzoxazine-6- chloride (CAS carboxylic acid 1899-93-0) C3 4-(m- A1 3- a1,b2 tolylsulfonyl)-2,3- chlorobenzene dihydro-1,4- sulfonyl benzoxazine-6- chloride (CAS carboxylic acid 2888-06-4) 4-(3- A1 3- a1,b2 bromophenyl)sulfo bromobenzene nyl-2,3-dihydro- sulfonyl 1,4-benzoxazine-6- chloride (CAS carboxylic acid 2905-24-0) 4-(3- A1 3- a1,b2 fluorophenyl)sulfo fluorobenzenes nyl-2,3-dihydro- ulfonyl 1,4-benzoxazine-6- chloride (CAS carboxylic acid 701-27-9) 4-(m- A2 3- a2,b1 tolylsulfonyl)spiro[ methylbenzene 3H-1,4- sulfonyl benzoxazine-2,1'- chloride (CAS cyclopropane]-6- 1899-93-0) carboxylic acid 4-(3- A2 3- a1,b2 chlorophenyl)sulfo chlorobenzene nylspiro[3H-1,4- sulfonyl benzoxazine-2,1'- chloride (CAS cyclopropane]-6- 2888-06-4) carboxylic acid C8 4-(3- A2 3- a2,b2 bromophenyl)sulfo bromobenzene nylspiro[3H-1,4- sulfonyl benzoxazine-2,1'- chloride (CAS cyclopropane]-6- 2905-24-0) carboxylic acid C9 (2R)-8-fluoro-2- A5 3- a2,b1 methyl-4-(m- methylbenzene tolylsulfonyl)-2,3- sulfonyl dihydro-1,4- chloride (CAS benzoxazine-6- 1899-93-0) carboxylic acid C10 8-fluoro-4-(m- A6 3- a2,b1 tolylsulfonyl)spiro[ methylbenzene 3H-1,4- sulfonyl benzoxazine-2,1'- chloride (CAS cyclopropane]-6- 1899-93-0) carboxylic acid C15 4-(3-fluoro-5- A1 3-Fluoro-5- a2,b2 methyl- methyl- phenyl)sulfonyl- benzenesulfon 2,3-dihydro-1,4- yl chloride benzoxazine-6- (CAS1214350- carboxylic acid 72-7) C16 4-(3,5- A1 3,5- a2,b2 dimethylphenyl)sul dimethylbenze fonyl-2,3-dihydro- ne-1-sulfonyl 1,4-benzoxazine-6- chloride (CAS carboxylic acid 2905-27-3) C17 4-(4- A1 4- a2,b2 fluorophenyl)sulfo fluorobenzenes nyl-2,3-dihydro- ulfonyl 1,4-benzoxazine-6- chloride (CAS carboxylic acid 349-88-2) Intermediate C11: 4-(3-Ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid Step 1: 4-[3-(2-Trimethylsilylethynyl)phenyl]sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxylic acid methyl ester To a solution of 4-(3-bromophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid methyl ester (Intermediate C4, step 1, 500 mg, 1.21 mmol) in dry 1,4-dioxane (2.75 ml), were added cuprous iodide (46.2 mg, 8.2 µl, 242 µmol), DIPEA (864 µl, 4.85 mmol), bis(triphenylphosphine)palladium(II) dichloride (85.13 mg, 121 µmol) and trimethylsilylacetylene (357 mg, 510 µl, 3.64 mmol). The reaction mixture was stirred at 100 °C for two hours. After cooling, the mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in heptane, 40%) to afford 4-[3-(2-trimethylsilylethynyl)phenyl]sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxylic acid methyl ester (436 mg, 84% yield) as a light brown solid. MS m / z: 430.2 [M+H]+, ESI pos. Step 2: 4-(3-Ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxylic To a solution of 4-[3-(2-trimethylsilylethynyl)phenyl]sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxylic acid methyl ester (436 mg, 1.01 mmol) in methanol (5 ml) and tetrahydrofuran (5 ml), a solution of 1 M NaOH (3.04 ml, 3.04 mmol) was added. The reaction mixture was stirred at room temperature for three hours. Additional solution of 1M NaOH (2.03 ml, 2.03 mmol) was added and stirring was continued for 16 hours. The mixture was concentrated in vacuo. The residue was acidified with a solution of 2M HCl to precipitate the acid. The solid was filtered and dried to yield 4-(3-ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid (343 mg, 95%) as a light yellow solid. MS m / z: 344.2 [M+H]+, ESI pos. Intermediate C12: 4-(3-Ethynylphenyl)sulfonylspiro[3H-1,4-benzoxazine-2,1'-cyclopropane]- 6-carboxylic acid The title compound was prepared in analogy to Intermediate C11 starting from 4-(3- bromophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid methyl ester ( Intermediate C8, step 1) instead of 4-(3-bromophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxylic acid methyl ester (Intermediate C4, step1). Colorless oil. MS m / z: 309.6 [M+H]+, ESI pos. Intermediate C13: 2'-Fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]- 6-carboxylic acid 2-ynylamino)benzoate To a solution of methyl 3-amino-4-hydroxybenzoate (CAS 536-25-4, 5.0 g, 29.9 mmol) in N,N- dimethylformamide (100 ml) were added propargyl bromide (CAS 106-96-7, 4.45 g, 29.9 mmol), potassium carbonate (8.25 g, 59.8 mmol) and potassium iodide (0.25 g, 1.5 mmol). The reaction mixture was stirred at 20 °C for 16 hours. The mixture was diluted with water and extracted with ethyl acetate three times. The combined organic phase was washed with brine twice, dried over Na2SO4, and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 50%) to afford methyl 4-hydroxy-3- (prop-2-ynylamino)benzoate (2.5 g, 38% yield) as a yellow solid. MS m / z: 206.1 [M+H]+, ESI pos. The title compound was prepared using general method a1 starting with methyl 4-hydroxy-3- (prop-2-ynylamino)benzoate and 3-methylbenzenesulfonyl chloride (CAS 1899-93-0). Pink solid. MS m / z: 206.1 [M+H]+, ESI pos. 3: Methyl 2-methylene-4-(m-tolylsulfonyl)-3H-1,4-benzoxazine-6-carboxylate To a solution of methyl 4-hydroxy-3-[m-tolylsulfonyl(prop-2-ynyl)amino]benzoate (3.0 g, 8.35 mmol) in triethylamine (60.0 ml), was added copper (I) iodide (318 mg, 1.67 mmol). The reaction mixture was stirred at 20°C for 30 minutes and then at 100 °C for 2.5 hours, under inert atmosphere. The reaction mixture was diluted with water and extracted with ethyl acetate three times. The combined organic phase was washed twice with brine, dried over Na2SO4, filtered and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 30%) to afford methyl 2-methylene-4-(m-tolylsulfonyl)-3H-1,4- benzoxazine-6-carboxylate (3.2 g, >100% yield) as a yellow solid. MS m / z: 360.1 [M+H]+, ESI pos. Step 4: Methyl 1'-bromo-1'-fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,2'- cyclopropane]-6-carboxylate To a solution of methyl 2-methylene-4-(m-tolylsulfonyl)-3H-1,4-benzoxazine-6-carboxylate (1.0 g, 2.78 mmol) in dichloromethane (20 ml), were added benzyltriethylammonium chloride (155 mg, 0.56 mmol), dibromofluoromethane (CAS1868-53-7, 1.33 g, 6.96 mmol), sodium hydroxide (1.34 g, 16.7 mmol) and the reaction was stirred at 25 °C for 16 hours. The mixture was diluted with water and extracted with ethyl acetate three times. The combined organic phase was washed with brine twice, dried over Na2SO4, and concentrated in vacuo. The crude was purified by reverse phase chromatography (column: Phenomenex luna C18150 x 25mm x 10 um, water (1‰TFA)-ACN) to afford methyl 1'-bromo-1'-fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4- benzoxazine-2,2'-cyclopropane]-6-carboxylate (550 mg, 42% yield) as a yellow solid. MS m / z: 472.1 [M+H]+, ESI pos. Step 5: Methyl 2'-fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxylate To a solution of methyl 1'-bromo-1'-fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,2'- cyclopropane]-6-carboxylate (400 mg, 0.85 mmol) in methanol (8 ml), were added ammonium chloride (90.2 mg, 1.7 mmol) and zinc (397 mg, 6.21 mmol) and the reaction was stirred at 25 °C for 16 hours. After the reaction mixture was filtered and rinsed with ethyl acetate, the filtrate was diluted with water, and the pH was adjusted to pH >7. The mixture was stirred at 20 °C for 10 minutes and then extracted with ethyl acetate three times. The combined organic phase was washed with brine twice, dried over Na2SO4, and concentrated in vacuo. The crude was purified by flash chromatography (silica gel, ethyl acetate in petroleum ether, 30%) to afford methyl 2'- fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxylate (300 mg, 90% yield) as a yellow solid. MS m / z: 392.1 [M+H]+, ESI pos. Intermediate C14: (2S)-2-(Hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine- 6-carboxylic acid Step 1: Methyl 4-fluoro-3-(m-tolylsulfonylamino)benzoate The title intermediate was prepared using Method a2 starting with methyl 3-amino-4-fluoro- benzoate and 3-methylbenzenesulfonyl chloride (CAS 1899-93-0). White solid. MS m / z: 324.1 [M+H]+, ESI pos. Step 2: Methyl (2S)-2-(hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxylate To a solution of methyl 4-fluoro-3-(m-tolylsulfonylamino)benzoate (750.0 mg, 2.32 mmol) in N-methyl pyrrolidone (16 mL) were added (R)-(+)-glycidol (CAS 57044-25-4, 413 mg, 5.57 mmol) eq) and potassium carbonate (481 mg, 3.48 mmol) . The reaction mixture was stirred at 140 °C for 2 hours The mixture was poured into water and extracted three times with ethyl acetate. The combined organic layer was dried with Na2SO4, filtered and evaporated. The crude was purified via flash chromatography (silica gel, ethyl acetate / petroleum ether, 20-60%) to give (methyl (2S)-2-(hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylate (340 mg, 38% yield) as a colorless oil. MS m / z: 400 [M+Na]+, ESI pos. Step 3: (2S)-2-(Hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid To a solution of methyl (2S)-2-(hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6-carboxylate (50.0 mg, 0.13 mmol) in a mixture of tetrahydrofuran (0.5 ml), methanol (0.5 ml) and water (0.5 ml) was added LiOH·H2O (16.7 mg, 0.4 mmol). The reaction mixture was stirred at 25 °C for 2 hours. The pH of the mixture was adjusted to 4 with a solution of 1N HCl. The mixture was poured into water and extracted three times with ethyl acetate. The combined organic layer was dried with Na2SO4, filtered and evaporated to give ((2S)-2- (hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid (40.0 mg, 81% yield) as a yellow solid. General procedure for intermediate D The intermediates D were obtained in two steps starting from Intermediates C. Step 1: Amide coupling Method c1 To a solution of the acid in N,N-dimethylformamide (0.01-0.3 M) were added the appropriate amine (1.1-2.1 eq.), DIPEA (2.0-4.0 eq.), and HATU (1.0-2.5 eq.). The reaction mixture was stirred for 1-24 h usually at room temperature but in some cases, an additional heating at 55°C for 1 hour was needed. General work-up and purification methods: Method s1: The reaction mixture was extracted twice with ethyl acetate. The combined organic layer was washed with brine, dried over Na2SO4, vacuum-filtered, concentrated in vacuo and was purified via flash chromatography, silica gel, gradient of ethyl acetate / heptane (usually 0 to 50%) Method s2: The reaction mixture was extracted twice with ethyl acetate. The combined organic layer was washed with brine, dried over Na2SO4, vacuum-filtered, concentrated in vacuo and was purified by precipitation. The crude was dissolved in acetonitrile (0.1M-0.2M), water was added and after stirring for 15 minutes, the solid was filtered, washed with water and dried on high vacuo. Method s3: The reaction mixture was extracted twice with ethyl acetate. The combined organic layer was washed with brine, dried over Na2SO4, vacuum-filtered, and concentrated in vacuo and was purified by preparative HPLC (column Phenomenex Gemini C18, 110 mm A Axia, 5 µm, acetonitrile / water + 0.1% formic acid). Method s4: Preparative HPLC (column Phenomenex Luna C18, 150x25mm, 10 µm, acetonitrile / water + 0.1% formic acid) Method s5: the reaction mixture was directly purified by preparative HPLC, (column Phenomenex Gemini C18, 110 mm A Axia, 5 µm, acetonitrile / water + 0.1% formic acid) The method chosen is the saponificationmethod b2 used for the synthesis of Intermediates C, step 2. Intermediate D1: (3S)-3-[2-Chloro-5-(trifluoromethyl)phenyl]-3-[[4-(m-tolylsulfonyl)-2,3- dihydro-1,4-benzoxazine-6-carbonyl]amino]propanoic acid Step 1: Ethyl (3S)-3-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[4-(m-tolylsulfonyl)-2,3-dihydro- 1,4-benzoxazine-6-carbonyl]amino]propanoate The title intermediate was prepared using amide coupling method c1 starting with 4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid (Intermediate C1, 500 mg, 1.5 mmol) and ethyl (3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]propanoate (Intermediate B1, 510 mg, 1.73 mmol) followed by purification method s1 to give ethyl (3S)-3-[2-chloro-5- (trifluoromethyl)phenyl]-3-[[4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoate (914 mg, 100% yield). Light yellow waxy solid. MS m / z: 611.1 [M+H]+, ESI pos. Step 2: (3S)-3-[2-Chloro-5-(trifluoromethyl)phenyl]-3-[[4-(m-tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6-carbonyl]amino]propanoic acid The title intermediate was prepared using saponification method b1 starting with ethyl (3S)-3- [2-chloro-5-(trifluoromethyl)phenyl]-3-[[4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoate (565mg, 925 mmol) to give (3S)-3-[2-chloro-5- (trifluoromethyl)phenyl]-3-[[4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid (441 mg, 82% yield) as a white powder. MS m / z: 583.2 [M+H]+, ESI pos. Int. Name Structure Reactant Reactant 1 2 D2 (3S)-3-[2-chloro-5- C11 B1 (trifluoromethyl)phenyl]-3-[[4- (3-ethynylphenyl)sulfonyl-2,3- dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid D3 (3S)-3-[[4-(3- C3 B1 chlorophenyl)sulfonyl-2,3- dihydro-1,4-benzoxazine-6- carbonyl]amino]-3-[2-methyl-5- (trifluoromethyl)phenyl]propano ic acid D4 (3S)-3-[[4-(3- C3 B2 chlorophenyl)sulfonyl-2,3- dihydro-1,4-benzoxazine-6- carbonyl]amino]-3-[2-methyl-5- (trifluoromethyl)phenyl]propano ic acid D5 (3S)-3-[[4-(3- C4 B1 bromophenyl)sulfonyl-2,3- dihydro-1,4-benzoxazine-6- carbonyl]amino]-3-[2-chloro-5- (trifluoromethyl)phenyl]propano ic acid D6 (3S)-3-[2-chloro-5- C5 B1 (trifluoromethyl)phenyl]-3-[[4- (3-fluorophenyl)sulfonyl-2,3- dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid D7 (3S)-3-[2-chloro-5- C6 B1 (trifluoromethyl)phenyl]-3-[[4- (m-tolylsulfonyl)spiro[3H-1,4- benzoxazine-2,1'-cyclopropane]- 6-carbonyl]amino]propanoic acid D8 (3S)-3-[2-chloro-5- C12 B1 (trifluoromethyl)phenyl]-3-[[4- (3- ethynylphenyl)sulfonylspiro[3H- 1,4-benzoxazine-2,1'- cyclopropane]-6- carbonyl]amino]propanoic acid D9 (3S)-3-[2-chloro-5- C13 B1 (trifluoromethyl)phenyl]-3-[[2'- fluoro-4-(m- tolylsulfonyl)spiro[3H-1,4- benzoxazine-2,1'-cyclopropane]- 6-carbonyl]amino]propanoic acid D10 (3S)-3-[2-chloro-5- C2 B1 (trifluoromethyl)phenyl]-3-[[8- fluoro-4-(m-tolylsulfonyl)-2,3- dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid D11 (3S)-3-[2-chloro-5- C9 B1 (trifluoromethyl)phenyl]-3- [[(2R)-8-fluoro-2-methyl-4-(m- tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6- carbonyl]amino]propanoic acid D12 (3S)-3-[2-chloro-5- C10 B1 (trifluoromethyl)phenyl]-3-[[8- fluoro-4-(m- tolylsulfonyl)spiro[3H-1,4- benzoxazine-2,1'-cyclopropane]- 6-carbonyl]amino]propanoic acid D13 (3S)-3-[[4-(3- C7 B1 chlorophenyl)sulfonylspiro[3H- 1,4-benzoxazine-2,1'- cyclopropane]-6- carbonyl]amino]-3-[2-chloro-5- (trifluoromethyl)phenyl]propano ic acid D14 (3S)-3-(2,5-dichlorophenyl)-3- [[4-(m-tolylsulfonyl)-2,3- C1 B7 dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid D15 (3S)-3-[2-chloro-5- C14 B1 (trifluoromethyl)phenyl]-3- [[(2S)-2-(hydroxymethyl)-4-(m- tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6- carbonyl]amino]propanoic acid D16 (3S)-3-[2-chloro-5- C15 B1 (trifluoromethyl)phenyl]-3-[[4- (3-fluoro-5-methyl- phenyl)sulfonyl-2,3-dihydro-1,4- benzoxazine-6- carbonyl]amino]propanoic acid D17 (3S)-3-[2-chloro-5- C16 B1 (trifluoromethyl)phenyl]-3-[[4- (3,5-dimethylphenyl)sulfonyl- 2,3-dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid D18 (2R,3S)-3-[2-chloro-5- C1 B3 (trifluoromethyl)phenyl]-2- methyl-3-[[4-(m-tolylsulfonyl)- 2,3-dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid D19 (3S)-3-[2-chloro-5- C19 B1 (trifluoromethyl)phenyl]-3-[[4- (4-fluorophenyl)sulfonyl-2,3- dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid D20 3-[2-chloro-5- C11 B6 (trifluoromethyl)phenyl]-3-[[4- (3-ethynylphenyl)sulfonyl-2,3- dihydro-1,4-benzoxazine-6- carbonyl]amino]propanoic acid EXAMPLES Example 1: N-[(1S)-1-[2-Chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide The title compound was prepared using amide coupling procedure c1 starting with Intermediate D1 (23.3 mg, 0.04 mmol) and 2,2-difluoroethylamine ( CAS 430-67-1, 4.2 mg, 0.048 mmol). The purification of the crude was done via preparative HPLC (column: Phenomenex Gemini C18110 A Axia, 100x 30 mm, 5 micron, H2O with 0.1% formic acid / acetonitrile) to afford N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2- difluoroethylamino)-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide (14.6 mg, 57 % yield) as a white solid. MS m / z: 646.2 [M+H]+, ESI pos. The following examples were synthesised according to the same procedure using the appropriate starting materials listed in the table below. For Example 4 and 5, the mixture of diastereomers obtained after were separated by chiral SFC (column: chiral Whelk01, 5 µm, 250 x 20 mm, 35% 2-propanol), Example 4 first eluting isomer. The stereochemistry was arbitrarily assigned. For Example 6 and 7, the mixture of diastereomers obtained were separated by chiral SFC (column: chiral IC, 5 µm, 250 x 20 mm, 30% ethanol), Example 6 first eluting compound. The stereochemistry was arbitrarily assigned. MS, Reactant Reactant Ex. Name Structure ESI: 1 2 m / z N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(methylamino)-3-oxo- methylamine 596.2 2 propyl]-4-(m- D1 (CAS 74-89- [M+H]+tolylsulfonyl)-2,3-dihydro- 5) 1,4-benzoxazine-6- carboxamide N-[(1S)-3-(but-3- ynylamino)-1-[2-chloro-5- but-3- (trifluoromethyl)phenyl]- ynylamine 634.1 3-oxo-propyl]-4-(m- D1 (CAS 14044- [M+H]+tolylsulfonyl)-2,3-dihydro- 63-4) 1,4-benzoxazine-6- carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 1-amino-2- 3-[[(2R)-2- butanol hydroxybutyl]amino]-3- (CAS 13552- 654.1 D1 oxo-propyl]-4-(m- 21-1) [M+H]+tolylsulfonyl)-2,3-dihydro- and chiral 1,4-benzoxazine-6- separation carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 1-amino-2- 3-[[(2S)-2- butanol hydroxybutyl]amino]-3- (CAS 13552- 654.1 D1 oxo-propyl]-4-(m- 21-1) [M+H]+tolylsulfonyl)-2,3-dihydro- and chiral 1,4-benzoxazine-6- separation carboxamide 3-amino-2- N-[(1S)-1-[2-chloro-5- methyl-1- (trifluoromethyl)phenyl]- 654.2 D1 propanol 3-[[(2S)-3-hydroxy-2- [M+H]+(CAS 15518- methyl-propyl]amino]-3- 10-2) oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro- 1,4-benzoxazine-6- and chiral carboxamide separation N-[(1S)-1-[2-chloro-5- 3-amino-2- (trifluoromethyl)phenyl]- methyl-1- 3-[[(2R)-3-hydroxy-2- propanol methyl-propyl]amino]-3- (CAS 654.2 D1 15518- oxo-propyl]-4-(m-+10-2) [M+H] tolylsulfonyl)-2,3-dihydro- 1,4-benzoxazine-6- and chiral carboxamide separation N-[(1S,2R)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 2-methyl-3- methylamine (methylamino)-3-oxo- hydrochloride 610.0 D18 propyl]-4-(m- (CAS 593- [M+H]+tolylsulfonyl)-2,3-dihydro- 51-1) 1,4-benzoxazine-6- carboxamide N-[(1S,2R)-1-[2-chloro-5- (trifluoromethyl)phenyl]- (2R)-1- 3-[[(2R)-2- aminopropan- hydroxypropyl]amino]-2- 654.1 D1 2-ol methyl-3-oxo-propyl]-4- [M+H]+(CAS 2799- (m-tolylsulfonyl)-2,3- 16-8) dihydro-1,4-benzoxazine- 6-carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(methylamino)-3-oxo- 614.2 propyl]-8-fluoro-4-(m- C2 B5 [M+H]+tolylsulfonyl)-2,3-dihydro- 1,4-benzoxazine-6- carboxamide N-[1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(methylamino)-3-oxo- methylamine propyl]-4-(3- 606.2 D20 (CAS 74-89- ethynylphenyl)sulfonyl- [M+H]+5) 2,3-dihydro-1,4- benzoxazine-6- carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(methylamino)-3-oxo- propyl]-4-(3- 606.0 C11 B4 ethynylphenyl)sulfonyl- [M+H]+2,3-dihydro-1,4- benzoxazine-6- carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 2,2- 3-(2,2- difluoroethyla 656.1 difluoroethylamino)-3- D2 mine ( CAS [M+H]+oxo-propyl]-4-(3- 430-67-1) ethynylphenyl)sulfonyl- 2,3-dihydro-1,4- benzoxazine-6- carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(3- 3- hydroxypropylamino)-3- aminopropan- 650.2 oxo-propyl]-4-(3- D2 1-ol (CAS [M+H]+ethynylphenyl)sulfonyl- 156-87-6) 2,3-dihydro-1,4- benzoxazine-6- carboxamide 4-(3- chlorophenyl)sulfonyl-N- [(1S)-1-[2-chloro-5- 2,2- (trifluoromethyl)phenyl]- difluoroethyla 666.1 3-(2,2- D3 mine ( CAS [M+H]+difluoroethylamino)-3- 430-67-1) oxo-propyl]-2,3-dihydro- 1,4-benzoxazine-6- carboxamide 4-(3- chlorophenyl)sulfonyl-N- 3-amino-2,2- [(1S)-1-[2-chloro-5- difluoro- (trifluoromethyl)phenyl]- propan-1-ol 696.2 3-[(2,2-difluoro-3- D3 (CAS [M+H]+hydroxy-propyl)amino]-3- 155310-11-5) oxo-propyl]-2,3-dihydro- 1,4-benzoxazine-6- carboxamide 4-(3- chlorophenyl)sulfonyl-N- [(1S)-1-[2-chloro-5- 1- (trifluoromethyl)phenyl]- aminobutan- roxybutylamino)- D3 2 674.2 3-(2-hyd -ol [M+H]+3-oxo-propyl]-2,3-dihydro- (CAS 13552- 1,4-benzoxazine-6- 21-1) carboxamide, mixture of epimers 4-(3- chlorophenyl)sulfonyl-N- [(1S)-1-[2-chloro-5- 3-amino-2- (trifluoromethyl)phenyl]- methyl- 3-[(3-hydroxy-2-methyl- 674.2 D3 propan-1-ol propyl)amino]-3-oxo- [M+H]+(CAS 15518- propyl]-2,3-dihydro-1,4- 10-2) benzoxazine-6- carboxamide, mixture of epimers 4-(3- chlorophenyl)sulfonyl-N- [(1S)-1-[2-chloro-5- (2R)-1- (trifluoromethyl)phenyl]- aminopropan- 660.1 3-[[(2R)-2- D3 2-ol (-) (CAS [M+H]+hydroxypropyl]amino]-3- 2799-16-8) oxo-propyl]-2,3-dihydro- 1,4-benzoxazine-6- carboxamide 4-(3- chlorophenyl)sulfonyl-N- [(1S)-1-[2-chloro-5- 3- (trifluoromethyl)phenyl]- aminopropan- 660.2 3-(3- D3 1-ol (CAS [M+H]+hydroxypropylamino)-3- 156-87-6) oxo-propyl]-2,3-dihydro- 1,4-benzoxazine-6- carboxamide 4-(3- bromophenyl)sulfonyl-N- [(1S)-1-[2-chloro-5- 2,2- (trifluoromethyl)phenyl]- difluoroethyla 710.1 3-(2,2- D5 mine ( CAS [M+H]+difluoroethylamino)-3- 430-67-1) oxo-propyl]-2,3-dihydro- 1,4-benzoxazine-6- carboxamide 4-(3- bromophenyl)sulfonyl-N- [(1S)-1-[2-chloro-5- 3- (trifluoromethyl)phenyl]- aminopropan- 704.1 3-(3- D5 1-ol (CAS [M+H]+hydroxypropylamino)-3- 156-87-6) oxo-propyl]-2,3-dihydro- 1,4-benzoxazine-6- carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(3- 3- hydroxypropylamino)-3- aminopropan- 644.2 D6 oxo-propyl]-4-(3- 1-ol (CAS [M+H]+fluorophenyl)sulfonyl-2,3- 156-87-6) dihydro-1,4-benzoxazine- 6-carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(2,2- 2,2- difluoroethylamino)-3- difluoroethyla 650.2 D6 oxo-propyl]-4-(3- mine ( CAS [M+H]+fluorophenyl)sulfonyl-2,3- 430-67-1) dihydro-1,4-benzoxazine- 6-carboxamide 4-(3- chlorophenyl)sulfonyl-N- [(1S)-3-(2,2- 2,2- difluoroethylamino)-1-[2- difluoroethyla 664.2 methyl-5- D4 mine ( CAS [M+H]+(trifluoromethyl)phenyl]- 430-67-1) 3-oxo-propyl]-2,3-dihydro- 1,4-benzoxazine-6- carboxamide N-[(1S)-1-[2-chloro-5- 3-amino-2,2- (trifluoromethyl)phenyl]- difluoropropa 712.3 3-[(2,2-difluoro-3- D8 n-1-ol ( CAS [M+H]+hydroxy-propyl)amino]-3- 155310-11-5) oxo-propyl]-4-(3- ethynylphenyl)sulfonyl- spiro[3H-1,4-benzoxazine- 2,1'-cyclopropane]-6- carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(methylamino)-3-oxo- propyl]-4-(m- 622.3 C6 B5 tolylsulfonyl)spiro[3H-1,4- [M+H]+benzoxazine-2,1'- cyclopropane]-6- carboxamide 4-(3- chlorophenyl)sulfonyl-N- [(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 642.1 3-(methylamino)-3-oxo- C7 B4 [M+H]+propyl]spiro[3H-1,4- benzoxazine-2,1'- cyclopropane]-6- carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(3- 3- hydroxypropylamino)-3- aminopropan- 676.1 oxo-propyl]-4-(3- D8 1-ol (CAS [M+H]+ethynylphenyl)sulfonyl- 156-87-6) spiro[3H-1,4-benzoxazine- 2,1'-cyclopropane]-6- carboxamide N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(methylamino)-3-oxo- methylamine propyl]-2'-fluoro-4-(m- hydrochloride 640.1 tolylsulfonyl)spiro[3H-1,4- D9 (CAS 593- [M+H]+benzoxazine-2,1'- 51-1) cyclopropane]-6- carboxamide (mixture of 2 CIS diastereomers) N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]- 3-(methylamino)-3-oxo- methylamine propyl]-8-fluoro-4-(m- hydrochloride 640.1 D12 tolylsulfonyl)spiro[3H-1,4- (CAS 593- [M+H]+benzoxazine-2,1'- 51-1) cyclopropane]-6- carboxamide N-[(1S)-1-(2,5- dichlorophenyl)-3-[[(2R)- (2R)-1- 2-hydroxypropyl]amino]- aminopropan- 606.3 3-oxo-propyl]-4-(m- D14 2-ol (CAS [M+H]+tolylsulfonyl)-2,3-dihydro- 2799-16-8) 1,4-benzoxazine-6- carboxamide (2S)-N-[(1S)-1-[2-chloro- 5- (trifluoromethyl)phenyl]- 626.1 C14 B5 3-(methylamino)-3-oxo- [M+H]+propyl]-2- (hydroxymethyl)-4-(m- tolylsulfonyl)-2,3-dihydro- 1,4-benzoxazine-6- carboxamide (2R)-N-[(1S)-1-[2-chloro- 5- methylamine (trifluoromethyl)phenyl]- hydrochloride 3-(methylamino)-3-oxo- (CAS 593- propyl]-8-fluoro-2-methy 628.3 43 l- D11 51-1) -(m-tolylsulfonyl)-2,3- [+4 M+H] dihydro-1,4-benzoxazine- SFC 6-carboxamide separation N-[(1S)-3-amino-1-[2- chloro-5- (trifluoromethyl)phenyl]- 3-oxo-propyl]-4-(m- 1 M NH3in 582.0 50 tolylsulfonyl)-2,3-dihydro- D1 2-propanol [M+H]+1,4-benzoxazine-6- carboxamide Example 8: N-[(1S)-3-(2-Aminoethylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide hydrochloride salt
[0005] Step1: N-[2-[[(3S)-3-[2-Chloro-5-(trifluoromethyl)phenyl]-3-[[4-(m-tolylsulfonyl)-2,3-dihydro- 1,4-benzoxazine-6-carbonyl]amino]propanoyl]amino]ethyl]carbamic acid tert-butyl ester The title compound was prepared using general procedure c1 starting with Intermediate D1 (40 mg, 0.07 mmol) and N-(2-aminoethyl)carbamic acid tert-butyl ester (CAS 57620-73-8, 13.9 mg, 0.08 mmol) instead of 4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxylic acid (Intermediate C1) and ethyl (3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]propanoate (Intermediate B1). The purification of the crude was done by preparative HPLC with Method s1 to afford the title compound (40.1 mg, 81% yield) as a white solid (MS m / z: 725.2 [M+H]+, ESI pos. Step 2: N-[(1S)-3-(2-Aminoethylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]- 4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide hydrochloride salt To a stirred solution of N-[2-[[(3S)-3-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carbonyl]amino]propanoyl]amino]ethyl]carbamic acid tert-butyl ester (40.1 mg 0.055 mmol) in dichloromethane (3 ml) and methanol (500 µl) was added a solution of 4 M hydrogen chloride in 1,4-dioxane (100 µl, 0.4 mmol).The clear solution was stirred for 48 h at room temperature, afterwards the dichloromethane was removed. To the residual clear solution, diethylether (8 ml) was added dropwise and the suspension formed was placed at 5°C for 2 hours. The white crystals were collected by filtration, washed with diethylether and dried under vacuum to afford N-[(1S)-3-(2-aminoethylamino)-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide hydrochloride salt (31.3 mg, 69% yield) as a white crystalline solid (MS m / z: 625.2 [M+H]+, ESI pos.) General procedure for BOC deprotection Method d1: To a solution of the BOC protected amine in dichloromethane / methanol 10:1 (0.005-0.01 M) and methanol was added a solution of 4 M hydrogen chloride in 1,4-dioxane (4-7 eq) and the reaction mixture was stirred at room temperature for 2-48 hours. To the solution was added dropwise diethylether and the suspension was cooled to 5°C for 1-2 hours and filtered, or the solvents were evaporated to give the desired compound as a hydrochloride salt. Method d2: To a solution of the BOC protected amine in dichloromethane (0.03-013 M) was added trifluoroacetic acid (1.0 eq.) and the reaction mixture was stirred at room temperature for 1 hour. The solution was concentrated in vacuo. Water and acetonitrile were added to the residue and the solution was lyophilized to give the desired compound as a TFA salt (white powder) The following examples were synthesised according to the same procedures using the appropriate starting materials listed in the following table. For Example 44 and 45, the mixture of diastereomers obtained in step 1 (BOC-protected diastereomers) were separated by chiral SFC (column: column chiral W(r,r), 5 µm, 250 x 20 mm, 35% MeOH / EtOH / Isopropanol 1:1:1 + 0.2% diethylamine), BOC-protected Example 44 first eluting isomer. The stereochemistry was arbitrarily assigned. BOC MS, Reactant Reactant deprotec Ex. Name Structure ESI: 1 2 meth. m / z N-[(1S)-3-(3- aminopropylamino)-1- N-(3- [2-chloro-5- aminoprop (trifl 739.2 9 uoromethyl)phenyl] D1 yl)carbami d1 -3-oxo-propyl]-4-(m- c acid tert- [M+H]+tolylsulfonyl)-2,3- butyl ester dihydro-1,4- (CAS benzoxazine-6- carboxamide 127346- hydrochloride salt 48-9) N-[(1S)-3-(2- aminopropylamino)-1- tert-butyl [2-chloro-5- (2-amino- (trifluoromethyl)phenyl] 1- -3-oxo-propyl]-4-(m- methyleth 639.4 D1 d1 tolylsulfonyl)-2,3- yl)carbam [M+H]+dihydro-1,4- ate (CAS benzoxazine-6- 149632- carboxamide 73-5) hydrochloride salt N-[(1S)-3-[[(2R)-2- (R)-tert- aminopropyl]amino]-1- butyl (1- [2-chloro-5- aminoprop (trifluoromethyl)phenyl] an-2- -3-oxo-propyl]-4-(m- 639.3 D1 yl)carbam d1 tolylsulfonyl)-2,3- [M+H]+ate HCl dihydro-1,4- (CAS benzoxazine-6- 100927- carboxamide 10-4) hydrochloride salt 4-(3- tert-butyl chlorophenyl)sulfonyl- (2-amino- N-[(1S)-3-(2- 1- aminopropylamino)-1- methyleth 659.1 D3 [2-chloro-5- yl)carbam [M+H]+(trifluoromethyl)phenyl] ate (CAS -3-oxo-propyl]-2,3- 149632- dihydro-1,4- 73-5) benzoxazine-6- carboxamide hydrochloride salt, mixture of epimers N-[(1S)-3-[[(2R)-2- (R)-tert- aminopropyl]amino]-1- butyl (1- [2-chloro-5- aminoprop (trifluoromethyl)phenyl] an-2- -3-oxo-propyl]-4-(3- 659.2 D3 yl)carbam d1 chlorophenyl)sulfonyl- [M+H]+ate HCl 2,3-dihydro-1,4- (CAS benzoxazine-6- 100927- carboxamide 10-4) hydrochloride salt N-[(1S)-3-(2- tert-butyl aminopropylamino)-1- (2-amino- [2-chloro-5- 1- (trifluoromethyl)phenyl] methyleth -3-oxo-propyl]-4-(3- 703. 5 yl)c 1 D arbam d1 bromophenyl)sulfonyl-+ate (CAS [M+H] 2,3-dihydro-1,4- 149632- benzoxazine-6- 73-5) carboxamide hydrochloride salt (2R)-N-[(1S)-3-[[(2R)-2- (R)-tert- aminopropyl]amino]-1- butyl (1- [2-chloro-5- 671.3 D11 aminoprop d2 (trifluoromethyl)phenyl] an-2- [M+H]+-3-oxo-propyl]-8-fluoro- yl)carbam 2-methyl-4-(m- ate HCl tolylsulfonyl)-2,3- (CAS dihydro-1,4- 100927- benzoxazine-6- 10-4) carboxamide 2,2,2- trifluoroacetic acid salt N-[(1S)-3-[2-(1- N-[1-(2- aminocyclopropyl)ethyl aminoethy amino]-1-[2-chloro-5- l)cyclopro (trifluoromethyl)phenyl] pyl]carba -3-oxo-propyl]-4-(m- 665.5 D1 mic acid d1, s5 tolylsulfonyl)-2,3- [M+H]+tert-butyl dihydro-1,4- ester (CAS benzoxazine-6- 753023- carboxamide 60-8) hydrochloride salt N-[1- N-[(1S)-3-[[(2S)-2- (aminomet amino-3-hydroxy- hyl)-2- propyl]amino]-1-[2- hydroxy- chloro-5- ethyl]carb (trifluoromethyl)phenyl] amic acid 655.5 -3-oxo-propyl]-4-(m- D1 tert-butyl d1 [M+H]+tolylsulfonyl)-2,3- ester dihydro-1,4- (1429913- benzoxazine-6- 75-6) carboxamide hydrochloride salt and chiral separation N-[1- N-[(1S)-3-[[(2R)-2- (aminomet amino-3-hydroxy- hyl)-2- propyl]amino]-1-[2- hydroxy- chloro-5- ethyl]carb (trifluoromethyl)phenyl] amic acid 655.5 -3-oxo-propyl]-4-(m- tert-butyl d1 [M+H]+tolylsulfonyl)-2,3- ester dihydro-1,4- (1429913- benzoxazine-6- 75-6) carboxamide hydrochloride salt and chiral separation N-[(1S)-3-[[(2R)-2- aminopropyl]amino]-1- (R)-tert- [2-chloro-5- butyl (1- (trifluoromethyl)phenyl] aminoprop -3-oxo-propyl]-4-(3- an-2- 657.1 fluoro-5-methyl- D16 yl)carbam d2 [M+H]+phenyl)sulfonyl-2,3- ate HCl dihydro-1,4- (CAS benzoxazine-6- 100927- carboxamide 2,2,2- 10-4) trifluoroacetic acid salt N-[(1S)-3-[[(2R)-2- (R)-tert- aminopropyl]amino]-1- butyl (1- [2-chloro-5- aminoprop 653.5 (trifluoromethyl)phenyl] D17 an-2- d1 [M+H]+-3-oxo-propyl]-4-(3,5- yl)carbam dimethylphenyl)sulfonyl ate HCl -2,3-dihydro-1,4- (CAS benzoxazine-6- 100927- carboxamide 10-4) hydrochloride salt N-[(1S)-3-[[(2R)-2- (R)-tert- aminopropyl]amino]-1- butyl (1- [2-chloro-5- aminoprop (trifluoromethyl)phenyl] an-2- -3-oxo-propyl]-4-(4- 643.1 51 D19 yl)carbam d2 fluorophenyl)sulfonyl- [M+H]+ate HCl 2,3-dihydro-1,4- (CAS benzoxazine-6- 100927- carboxamide 2,2,2- 10-4) trifluoroacetic acid salt Example 48: N-[(1S)-1-[2-Chloro-5-(trifluoromethyl)phenyl]-3-hydroxy-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide To a solution of (3S)-3-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[4-(m-tolylsulfonyl)-2,3- dihydro-1,4-benzoxazine-6-carbonyl]amino]propionic acid ethyl ester (Intermediate D1, step 1, 310 mg, 492 µmol) in dry tetrahydrofuran (5.35 ml) was added dropwise carefully at 0 °C, a solution of 2 M lithium borohydride (492 µl, 984 µmol).The reaction was stirred at 0 °C for 1 hour then more 2 M lithium borohydride solution (492µl, 984 µmol) was added at 0 °C. The reaction mixture was allowed to stir at room temperature for 2 hours. Additional 2 M lithium borohydride (123 µl, 246 µmol ) were added at room temperature to ensure full conversion.The reaction mixture was cooled to 0 °C and was quenched by addition of methanol (4 ml), followed by a carefully addition of a solution of 1M HCl (12 ml). Water was added and the mixture was extracted with ethyl acetate. The organic layer was washed with brine, dried with Na2SO4, filtered and evaporated. The crude was purified via flash chromatography (silica gel, ethyl acetate / heptane, 0-70%) to give N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-hydroxy- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide (240 mg, 86%) as a white solid. MS m / z: 569.1 [M+H]+, ESI pos. Example 49: N-[(1S)-1-[2-Chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo- propyl]-4-[(5-methyl-3-thienyl)sulfonyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide To a solution of 4-bromo-2-methylthiophene (3.3 g, 18.6 mmol), benzyl mercaptan (3.28 mL, 28 mmol), DIPEA (6.49 mL, 37.3 mmol) in 1,4-dioxane (50 mL) were added Pd2(dba)3 (0.85 g, 0.93 mmol) and Xantphos (1.08 g, 1.86 mmol). The reaction mixture was stirred at 100 °C for 16 hours under nitrogen. The reaction mixture was concentrated. The residue was purified was purified by flash chromatography (silica gel, ethyl acetate / petroleum ether, 0-5%) to give (4- benzylsulfanyl-2-methyl-thiophene (4.0 g, 95% yield) as a white solid. MS m / z: 221.1 [M+H]+, ESI pos. 2: 5-Methylthiophene-3-sulfonyl chloride To a solution of 4-benzylsulfanyl-2-methyl-thiophene (1.0 g, 4.54 mmol) in acetic acid (16 ml) and water (4 ml) was added dropwise sulfuryl chloride (1225 mg, 9.08 mmol) at 0 °C. After stirring for 30 min at the same temperature, the reaction mixture was allowed to reach 20 °C and to stir for 2 hours. The mixture was poured into water and extracted three times with ethyl acetate. The combined organic layer was dried with Na2SO4, filtered and evaporated. The crude was purified via flash chromatography (silica gel, ethyl acetate / petroleum ether, 0-20%) to give 5-methylthiophene-3-sulfonyl chloride (470 mg, 53% yield) as a white oil.1H NMR (400 MHz, CHLOROFORM-d) δ = 7.91 (d, J = 1.4 Hz, 1H), 7.10 (s, 1H), 2.45 (d, J = 1.0 Hz, 3H) Step 3: 3,4-Dihydro-2H-1,4-benzoxazine-6-carboxylic acid To a solution of methyl 3,4-dihydro-2H-1,4-benzoxazine-6-carboxylate (200 mg, 1.04 mmol) in a mixture of methanol (2 mL), THF (2 mL) and water (2 mL) was added LiOH.H2O (130 mg, 3.11 mmol). The mixture was stirred at 20 °C for 16 hours then at 50 °C for 1 hour. After cooling, the pH of the mixture was set to pH=4 by addition of a solution of 1M HCl and the mixture was purified by reverse phase flash chromatography (Flash Spherical C18, 20-35μm; 100Å; gradient water with 0.05% HCl and acetonitrile) and lyophilized to give 3,4-dihydro-2H- 1,4-benzoxazine-6-carboxylic acid (170 mg, 0.95 mmol, 92% yield) as an off-white solid. MS m / z: Step 4: 1-[2-Chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-3,4- benzoxazine-6-carboxamide To a solution of 3,4-dihydro-2H-1,4-benzoxazine-6-carboxylic acid (170 mg, 0.95 mmol) and (3S)-3-amino-3-[2-chloro-5-(trifluoromethyl)phenyl]-N-methyl-propanamide (Intermediate B4, 266 mg, 0.95 mmol) in DMF (10 mL) were added DIPEA (368 mg, 2.85 mmol) and HATU (268 mg, 1.14 mmol). The reaction mixture was stirred at 20 °C for 2 hours. The mixture was poured into water and extracted three times with ethyl acetate. The combined organic layer was dried with Na2SO4, filtered and evaporated. The crude was purified via flash chromatography (silica gel, ethyl acetate / petroleum ether, 20-50%) to give N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-3,4-dihydro-2H-1,4-benzoxazine-6- carboxamide (187 mg, 44% yield) as a white solid. MS m / z: 442.1 [M+H]+, ESI pos. Step 5: N-[ 1-[2-Chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-[(5- methyl-3-thienyl)sulfonyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide To a solution of 5-methylthiophene-3-sulfonyl chloride (50.0 mg, 0.25 mmol) in dichloromethane (1 ml) was added N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- (methylamino)-3-oxo-propyl]-3,4-dihydro-2H-1,4-benzoxazine-6-carboxamide (25 mg, 0.06 mmol) and pyridine (0.02 mL, 0.28 mmol). The reaction mixture was stirred at 20 °C for 2 hours. To ensure full conversion, additional 5-methylthiophene-3-sulfonyl chloride (11.1 mg, 0.06 mmol) was added at room temperature and the reaction mixture was stirred again for 1 hour. The solution was concentrated and purified by prep-HPLC (Phenomenex Luna C18150 x 25mm x 10 µm, gradient water with 0.5‰ ammonium hydroxide and acetonitrile). The purified solution was concentrated and lyophilized to give (N-[(1S)-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-[(5-methyl-3-thienyl)sulfonyl]-2,3- dihydro-1,4-benzoxazine-6-carboxamide (4.0 mg, 12% yield) as a white solid. MS m / z: 602.1 [M+H]+, ESI pos. MET Inhibitory Activity CellTiter-Glo® 2500 cells per well of EBC-1 and 2000 cells per well of Ba / F3 were seeded in a 384-well plate and let attach overnight. Cells were treated with MET inhibitors. Compound dilution was prepared using the Tecan D300e dispenser with T8+ dispense cassette (10 µM highest concentration, 8-times 1:3 dilution). Normalization to ≤ 1 % DMSO final concentration was applied. Cells were incubated for 3 days at 37°C RT, 100% RH, and 5% CO2. CellTiter-Glo® Luminescent Cell Viability Assay (Promega G7572) was performed to access cell viability. IC50 values were calculated using GraphPad Prism software. Cell line work The EBC-1 cell line, derived from human lung tissue, is associated with squamous cell lung carcinoma. This epithelial cell line, known to harbor MET gene amplifications, is typically grown in Eagle's Minimum Essential Medium (EMEM) supplemented with 10% fetal bovine serum at 37°C in a 5% CO2 atmosphere. It has been authenticated via short tandem repeat (STR) profiling and is deposited in the Japanese Collection of Research Bioresources (JCRB) Cell Bank (accession number JCRB0126). Nucleofection The optimization of nucleofection conditions was crucial to maximize transfection efficiency, ensure reproducibility and specificity of results, and promote cost-effectiveness by minimizing reagent usage. This optimization involved adjusting the nucleofection solution, pulse code, and the ratio between Cas9, sgRNA, and ssODN. The nucleofection was performed according to the manufacturer’s protocol using a 4D-Nucleofector and Amaxa 96-well shuttle Device (Lonza). Cells were nucleofected with TrueCut™ Cas9 Protein v2 (ThermoFisher A36499), a guide RNA specific to the insertion site (sgRNA 5’-ttctttatcatacatgtctc-3’) and single-stranded oligodeoxynucleotides with homology arms to the insertion site (ssODN2SNPMUT 5’- TTGTCCTTTCTGTAGGCTGGATGAAAAATTCACAGTCAAGGTTGCTGATTTTGGTCT CGCGAGAGTCATGTATGA TAAAGAATACTATAGTGTACACAACAAAACAGGTGCAAAGCTGCCAGTGAAGTGGA TGGCTTTGG-3’) adapted from Collie et al1. The ssODN2SNPMUT harbors the desired D1228V mutation, a mutation in the PAM site, as well as a silent mutation. Eight days post nucleofection, EBC-1 cells were grown for ten days in the presence of Capmatinib (10 - 30 nM). Capmatinib is designed to bind to the ATP-binding pocket of the MET receptor tyrosine kinase, inhibiting the kinase activity of the MET protein and preventing the downstream signaling that promotes cell growth and division. Since D1228V impairs capmatinib binding, MET D1228V mutant cell lines can grow under capmatinib pressure, while all non- transfected MET wild-type cells will be eliminated. Following the growth period, the pool of nucleofected wells was singularized via serial dilution to obtain single-cell clones, following the protocol from Corning2. The cells were then subjected to single-cell sorting New Generation Sequencing Following the generation of the D1228V cell line as described above, the mutation was to be confirmed using Next-Generation Sequencing (NGS). The NGS was to be performed by an external vendor, MicroSynth, who would utilize deep allele sequencing. Prior to sending the samples for sequencing, DNA extraction was performed on all the cell lines, including EBC-1 WT (MET-WT), EBC-1 D1228V (MET-Mutant)). The extraction was conducted using the DNeasy Kit by Qiagen, following the manufacturer's protocol. The extracted DNA samples were then sent to MicroSynth for deep allele sequencing, a method chosen for its ability to detect even low-frequency variants, making it suitable for confirming the presence of the D1228V mutation. MET D1228H Biochemical TR-FRET IC50 Assay Reaction reagents were prepared in 25mM HEPES pH 7.5, 10mM MgCl2, 1mM EGTA, 0.005% BSA and 0.01% NP40. Enzymatic reactions were ran for 60 minutes in an 8µL volume consisting of 10nM human dephosphorylated MET D1228H (aa1048-1348), 30µM ATP (at KM) and 1µM biotin gastrin peptide. After 60mins reactions were terminated by the addition of 4µL of Stop and Detect reagents (25mM HEPES pH7.5, 60mM EDTA, 900mM KF, 0.005% BSA, 1.5nM Europium labeled anti-phosphotyrosine antibody and 75nM streptavidin conjugated allophycocyanin). Time-resolved fluorescence energy transfer (TR-FRET) then determined the amount of phosphorylated biotin gastrin. To determine compound IC50’s reactions were incubated for 60minutes at room temperature in the presence of a 12-point concentration response curve of compound (starting concentration 50µM; 1 in 3 dilution between each point; 2% DMSO). TR-FRET was then plotted against the compound concentration to obtain an IC50as fitted via non-linear regression. Results of the MET D1228H Biochemical TR-FRET IC50 assay are provided for compounds of formula (I) in Table 1. Compounds of the present invention are MET inhibitors. Thus, in one aspect, the present invention provides the use of compounds of formula (I) as described herein for inhibiting MET kinase in a human. In a further aspect, the present invention provides compounds of formula (I) as described herein for use in a method of inhibiting MET kinase in a human. In a further aspect, the present invention provides the use of compounds of formula (I) as described herein for the preparation of a medicament for inhibiting MET kinase in a human. In a further aspect, the present invention provides a method for inhibiting MET kinase in a human, which method comprises administering an effective amount of a compound of formula (I) as described herein to the human. Table 1 MET D1228H MET D1228V EBC-1 MET EBC-1 TR-FRET biochemical CellTiter-Glo® CellTiter-Glo® Example assay, cell viability assay, cell viability assay, No. IC50 (µM) IC50 (µM) IC50 (µM) 1 0.124 >100.000 1.615 2 0.099 8.895 4.378 3 0.127 8.043 5.527 4 0.048 1.171 0.856 5 0.109 9.290 1.715 6 0.060 2.813 0.984 7 0.129 4.479 1.316 8 0.138 4.030 1.750 9 0.149 4.989 1.285 10 0.082 1.579 0.497 11 0.070 4.158 0.585 12 0.098 2.823 1.037 13 0.014 0.611 0.189 14 0.101 - 1.335 15 0.146 46.990 6.988 16 0.070 19.360 3.334 0.039 - 0.369 0.112 1.199 0.583 0.109 0.915 2.103 0.148 1.094 1.111 0.054 1.056 1.016 0.058 1.017 0.892 0.037 1.399 0.867 0.141 0.609 1.524 0.068 2.904 0.692 0.062 3.665 1.451 0.133 - - 0.135 0.362 1.880 0.053 1.802 0.651 0.148 2.163 1.273 0.078 0.582 0.891 0.150 >100.000 1.093 0.059 0.927 0.404 0.058 19.900 1.177 0.038 24.740 0.591 0.028 1.698 0.576 0.052 0.370 0.393 0.056 >10.000 >10.000 0.032 1.370 0.414 0.078 - - 41 0.178 - - 42 0.165 - - 43 0.157 - - 44 0.110 - - 45 0.161 - - 46 0.052 - - 47 0.094 - - 48 0.150 10.396 4.168 49 0.190 - - 50 0.158 - - 51 0.089 - - In one aspect, the present invention provides compounds of formula (I) and their pharmaceutically acceptable salts or esters as described herein, wherein said compounds of formula (I) and their pharmaceutically acceptable salts or esters have IC50’s for MET inhibition below 25 µM, preferably below 10 µM, more preferably below 5 µM as measured in the MET inhibitory assay described herein. In one embodiment, compounds of formula (I) and their pharmaceutically acceptable salts or esters as described herein have IC50 (MET inhibition) values between 0.000001 µM and 25 µM, particular compounds have IC50 values between 0.000005 µM and 10 µM, further particular compounds have IC50values between 0.00005 µM and 5 µM, as measured in the MET assay described herein. Aspects 1. A compound of formula (I)
[0006] or a pharmaceutically acceptable salt thereof, wherein: R1is C6-C10-aryl or 5- to 10-membered heteroaryl, wherein said C6-C10-aryl or 5- to 10-membered heteroaryl is optionally substituted with one to three R1a; R1ais at each occurence independently halogen, C1-6-alkyl, hydroxy, cyano, C1-6-alkoxy, halo-C1-6-alkyl, 3- to 9-membered heterocyclyl, C2-6-alkenyl, or C2-6-alkynyl, wherein said C1-6-alkyl or 3- to 9-membered heterocyclyl is optionally substituted with one to three C1-6-alkyl, halogen, amino, or C1-6-alkoxy; R2is -C(O)NHR2aor -CH2OH; R2ais hydrogen, C1-6-alkyl, C3-6-cycloalkyl, wherein C1-6-alkyl or C3-6-cycloalkyl is optionally substituted with one to three R2b; R2bis at each occurence independently hydroxy, halogen, amino, C2-6-alkynyl, or C3-6- cycloalkyl, wherein C3-6-cycloalkyl is optionally substituted with amino, hydroxy, or halogen; R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy or halogen; and R4is hydrogen or C1-6-alkyl; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl optionally substituted with hydroxy or halogen; R5is hydrogen or halogen; R6is hydrogen, halogen, or C1-6-alkyl; R7is halogen, halo-C1-6-alkyl, or C1-6-alkyl; R8is halogen or halo-C1-6-alkyl; R9is hydrogen, halogen, or C1-6-alkoxy. The compound of formula (I) according to aspect 1, or a pharmaceutically acceptable salt thereof, wherein R1is C6-C10-aryl substituted with one or two R1a. 3. The compound of formula (I) according to aspect 1, or a pharmaceutically acceptable salt thereof, wherein R1is phenyl or thienyl, wherein phenyl or thienyl is substituted with one or two R1a. 4. The compound of formula (I) according to aspects 1 to 3, or a pharmaceutically acceptable salt thereof, wherein R1is phenyl substituted with one R1a. 5. The compound of formula (I) according to any one of aspects 1 to 4, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently halogen, C1-6- alkyl, or C2-6-alkynyl. 6. The compound of formula (I) according to any one of aspects 1 to 5, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently C1-6-alkyl or C2-6- alkynyl. 7. The compound of formula (I) according to any one of aspects 1 to 6, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently fluoro, chloro, bromo, methyl, or ethynyl. 8. The compound of formula (I) according to any one of aspects 1 to 7, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently methyl or ethynyl. 9. The compound of formula (I) according to any one of aspects 1 to 8, or a pharmaceutically acceptable salt thereof, wherein R2is -C(O)NHR2a. 10. The compound of formula (I) according to any one of aspects 1 to 9, or a pharmaceutically acceptable salt thereof, wherein R2ais hydrogen or C1-6-alkyl optionally substituted with one to three R2b. 11. The compound of formula (I) according to any one of aspects 1 to 10, or a pharmaceutically acceptable salt thereof, wherein R2ais C1-6-alkyl substituted with one to three R2b. 12. The compound of formula (I) according to any one of aspects 1 to 11, or a pharmaceutically acceptable salt thereof, wherein R2ais ethyl or propyl, wherein ethyl or propyl is substituted with one to three R2b. 13. The compound of formula (I) according to any one of aspects 1 to 12, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, C3-6-cycloalkyl, or amino-C3-6-cycloalkyl. 14. The compound of formula (I) according to any one of aspects 1 to 13, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, halogen, or amino. 15. The compound of formula (I) according to any one of aspects 1 to 14, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, fluoro, amino, ethynyl, or amino-cyclopropyl. 16. The compound of formula (I) according to any one of aspects 1 to 15, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, fluoro, or amino. 17. The compound of formula (I) according to any one of aspects 1 to 16, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy and R4is hydrogen; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl optionally substituted with halogen. 18. The compound of formula (I) according to any one of aspects 1 to 17, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen, methyl or hydroxymethyl and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl or fluorocyclopropyl. 19. The compound of formula (I) according to any one of aspects 1 to 18, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen or methyl and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl. 20. The compound of formula (I) according to any one of aspects 1 to 19, or a pharmaceutically acceptable salt thereof, wherein R5is hydrogen or fluoro. 21. The compound of formula (I) according to any one of aspects 1 to 20, or a pharmaceutically acceptable salt thereof, wherein R6is hydrogen or C1-6-alkyl. 22. The compound of formula (I) according to any one of aspects 1 to 21, or a pharmaceutically acceptable salt thereof, wherein R6is hydrogen or methyl. 23. The compound of formula (I) according to any one of aspects 1 to 22, or a pharmaceutically acceptable salt thereof, wherein R7is halogen or C1-6-alkyl. 24. The compound of formula (I) according to any one of aspects 1 to 23, or a pharmaceutically acceptable salt thereof, wherein R7is chloro or methyl. 25. The compound of formula (I) according to any one of aspects 1 to 24, or a pharmaceutically acceptable salt thereof, wherein R7is chloro. 26. The compound of formula (I) according to any one of aspects 1 to 25, or a pharmaceutically acceptable salt thereof, wherein R8is chloro or -CF3.27. The compound of formula (I) according to any one of aspects 1 to 26, or a pharmaceutically acceptable salt thereof, wherein R8is -CF3. 28. The compound of formula (I) according to any one of aspects 1 to 27, or a pharmaceutically acceptable salt thereof, wherein R9is hydrogen. 29. The compound of formula (I) according to aspect 1, or a pharmaceutically acceptable salt thereof, wherein: R1ais at each occurence independently halogen, C1-6-alkyl, or C2-6-alkynyl; R2ais hydrogen or C1-6-alkyl optionally substituted with one to three R2b; R2bis at each occurence independently hydroxy, halogen, amino, C2-6-alkynyl, C3-6- cycloalkyl, or amino-C3-6-cycloalkyl; R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl optionally substituted with halogen; R6is hydrogen or C1-6-alkyl; R7is halogen or C1-6-alkyl; R9is hydrogen. The compound of formula (I) according to aspect 29, or a pharmaceutically acceptable salt thereof, wherein: R1is C6-C10-aryl substituted with one or two R1a; R1ais at each occurence independently C1-6-alkyl or C2-6-alkynyl; R2is -C(O)NHR2a; R2ais C1-6-alkyl optionally substituted with one, two or three R2b; R2bis at each occurence independently hydroxy, halogen, or amino; R3is hydrogen or C1-6-alkyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl; R7is halogen; R8is halo-C1-6-alkyl. The compound of formula (I) according to aspect 29, or a pharmaceutically acceptable salt thereof, wherein: R1is phenyl or thienyl, wherein phenyl or thienyl is substituted with one or two R1a; R1ais at each occurrence independently fluoro, chloro, bromo, methyl, or ethynyl; R1ais -C(O)NHR2aor -CH2OH; R2ais hydorgen or C1-4-alkyl; R2bis at each occurrence independently hydroxy, fluoro, amino, ethynyl, or amino- cyclopropyl; R3is hydrogen, methyl, or hydroxymethyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl or fluorocyclopropyl; R5is hydrogen or fluoro; R6is hydrogen or methyl; R7is chloro or methyl; R8is chloro or –CF3. The compound of formula (I) according to aspect 30, or a pharmaceutically acceptable salt thereof, wherein: R1is phenyl substituted with one R1a; R1ais methyl or ethynyl; R2ais ethyl or propyl; R2bis hydroxy, fluoro, or amino; R3is hydrogen or methyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl; R5is hydrogen or fluoro; R6is hydrogen or methyl; R7is chloro; R8is–CF3. The compound of formula (I) according to aspect 1, or a pharmaceutically acceptable salt thereof, wherein said compound of formula (I) is: N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(4-fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(3,5-dimethylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-3-[2-(1-aminocyclopropyl)ethylamino]-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6-carboxamid; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(3-fluoro-5-methyl-phenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-3-[[(2S)-2-amino-3-hydroxy-propyl]amino]-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6-carboxamide; N-[(1S)-3-[[(2R)-2-amino-3-hydroxy-propyl]amino]-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide hydrochloride salt; N-[(1S)-3-(3-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-[(5- methyl-3-thienyl)sulfonyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminoethylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-bromophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3- hydroxypropylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-2'- fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxamide N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(3-chlorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(3-bromophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-hydroxy-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-Chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(but-3-ynylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4- (m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxybutyl]amino]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2S)-2-hydroxybutyl]amino]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2S)-3-hydroxy-2-methyl- propyl]amino]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-3-hydroxy-2-methyl- propyl]amino]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-2-methyl-3-(methylamino)-3-oxo- pro pyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxypropyl]amino]- 2-methyl-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-8- fluoro-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo- propyl]-4-(3-ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo- propyl]-4-(3-ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2- difluoroethylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2- difluoro-3-hydroxy-propyl)amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6- carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2- hydroxybutylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(3- hydroxy-2-methyl-propyl)amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6- carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)- 2-hydroxypropyl]amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6- carboxamide; 4-(3-bromophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2- difluoroethylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo- propyl]-4-(3-fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo- propyl]-4-(3-fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-3-(2,2-difluoroethylamino)-1-[2-methyl-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2-difluoro-3-hydroxy- propyl)amino]-3-oxo-propyl]-4-(3-ethynylphenyl)sulfonyl-spiro[3H-1,4- benzoxazine-2,1'-cyclopropane]-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(m- tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- (methylamino)-3-oxo-propyl]spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo- propyl]-4-(3-ethynylphenyl)sulfonyl-spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]- 6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3- hydroxypropylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-8- fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxamide; N-[(1S)-1-(2,5-dichlorophenyl)-3-[[(2R)-2-hydroxypropyl]amino]-3-oxo-propyl]-4- (m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2S)-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]- 2-(hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2R)-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]- 8-fluoro-2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2R)-N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]- 3-oxo-propyl]-8-fluoro-2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine- 6-carboxamide; or N-[(1S)-3-amino-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide. 34. The compound of formula (I) according to aspect 1, or a pharmaceutically acceptable salt thereof, wherein said compound of formula (I) is: N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxypropyl]amino]- 2-methyl-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo- propyl]-4-(3-ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2-difluoro-3-hydroxy- propyl)amino]-3-oxo-propyl]-4-(3-ethynylphenyl)sulfonyl-spiro[3H-1,4- benzoxazine-2,1'-cyclopropane]-6-carboxamide; or (2R)-N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]- 3-oxo-propyl]-8-fluoro-2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine- 6-carboxamide. 35. A process of preparation of a compound of formula (I) according to any one of aspects 1 to 34, or a pharmaceutically acceptable salt thereof, comprising: (a) reacting a compound of formula (II), wherein R3, R4, R5, and R9, are as defined in any one of aspects 1 to 34
[0007] with a compound of formula (III), wherein R1is as defined in any one of aspects 1 to 34, in the presence of an organic base to form a compound of formula (IV), wherein R1, R3, R4, R5, and R9are as defined in any one of aspects 1 to 34 followed by (b) hydrolyzing the methyl ester moiety in said compound of formula (IV) with an aqueous solution of an inorganic base, followed by reacting the resulting carboxylic acid with a compound of formula (V), wherein R2, R6, R7, and R8are as defined in any one of aspects 1 to 34
[0008] to form said compound of formula (I). A compound of formula (I) according to any one of aspects 1 to 34, or a pharmaceutically acceptable salt thereof, when manufactured according to aspect 35 A compound of formula (I) according to any one of aspects 1 to 34, or a pharmaceutically acceptable salt thereof, for use as a therapeutically active substance. A pharmaceutical composition comprising a compound of formula (I) according to any one of aspects 1 to 34, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient The use of a compound of formula (I) according to any one of aspects 1 to 34, or a pharmaceutically acceptable salt thereof, for the treatment and / or prophylaxis of disease or disorder mediated by MET kinase. The use according to aspect 39, wherein said disease or disorder mediated by MET kinase is cancer. The use according to aspect 40, wherein said cancer is lung cancer. The use according to aspect 41, wherein said lung cancer is non-small-cell lung cancer (NSCLC). The use of a compound of formula (I) according to any one of aspects 1 to 34, or a pharmaceutically acceptable salt thereof, for the preparation of a medicament for the treatment and / or prophylaxis of disease or disorder mediated by MET kinase. 44. The use according to aspect 43, wherein said disease or disorder mediated by MET kinase is cancer. 45. The use according to aspect 44, wherein said cancer is lung cancer. 46. The use according to aspect 45, wherein said lung cancer is non-small-cell lung cancer (NSCLC). 47. A compound of formula (I) according to any one of aspects 1 to 34, or a pharmaceutically acceptable salt thereof, for use in the treatment and / or prophylaxis of disease or disorder mediated by MET kinase. 48. The compound for use according to aspect 47, wherein said disease or disorder mediated by MET kinase is cancer. 49. The compound for use according to aspect 48, wherein said cancer is lung cancer. 50. The compound for use according to aspect 49, wherein said lung cancer is non-small-cell lung cancer (NSCLC). 51. A method for the treatment or prophylaxis of disease or disorder mediated by MET kinase, which method comprises administering a therapeutically effective amount of a compound of formula (I) according to any one of aspects 1 to 34, or a pharmaceutically acceptable salt thereof, to a human. 52. A method according to aspect 51, wherein said disease or disorder mediated by MET kinase is cancer. 53. A method according to aspect 52, wherein said cancer is lung cancer. 54. A method according to aspect 53, wherein said lung cancer is non-small-cell lung cancer (NSCLC). 55. The invention as described hereinbefore.
Claims
P39231 CLAIMS 1. A compound of formula (I)or a pharmaceutically acceptable salt thereof, wherein: R1is C6-C10-aryl or 5- to 10-membered heteroaryl, wherein said C6-C10-aryl or 5- to 10-membered heteroaryl is optionally substituted with one to three R1a; R1ais at each occurrence independently halogen, C1-6-alkyl, hydroxy, cyano, C1-6- alkoxy, halo-C1-6-alkyl, 3- to 9-membered heterocyclyl, C2-6-alkenyl, or C2-6- alkynyl, wherein said C1-6-alkyl or 3- to 9-membered heterocyclyl is optionally substituted with one to three C1-6-alkyl, halogen, amino, or C1-6-alkoxy; R2is -C(O)NHR2aor -CH2OH; R2ais hydrogen, C1-6-alkyl, C3-6-cycloalkyl, wherein C1-6-alkyl or C3-6-cycloalkyl is optionally substituted with one to three R2b; R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, or C3-6- cycloalkyl, wherein C3-6-cycloalkyl is optionally substituted with amino, hydroxy, or halogen; R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy or halogen; and R4is hydrogen or C1-6-alkyl; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl optionally substituted with hydroxy or halogen; R5is hydrogen or halogen; R6is hydrogen, halogen, or C1-6-alkyl; R7is halogen, halo-C1-6-alkyl, or C1-6-alkyl; R8is halogen or halo-C1-6-alkyl; R9is hydrogen, halogen, or C1-6-alkoxy.
2. The compound of formula (I) according to claim 1, or a pharmaceutically acceptable salt thereof, wherein R1is C6-C10-aryl substituted with one or two R1a.
3. The compound of formula (I) according to claim 1, or a pharmaceutically acceptable salt thereof, wherein R1is phenyl or thienyl, wherein phenyl or thienyl is substituted with one or two R1a.
4. The compound of formula (I) according to claims 1 to 3, or a pharmaceutically acceptable salt thereof, wherein R1is phenyl substituted with one R1a.
5. The compound of formula (I) according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently halogen, C1-6- alkyl, or C2-6-alkynyl.
6. The compound of formula (I) according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently C1-6-alkyl or C2-6- alkynyl.
7. The compound of formula (I) according to any one of claims 1 to 6, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently fluoro, chloro, bromo, methyl, or ethynyl.
8. The compound of formula (I) according to any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, wherein R1ais at each occurrence independently methyl or ethynyl.
9. The compound of formula (I) according to any one of claims 1 to 8, or a pharmaceutically acceptable salt thereof, wherein R2is -C(O)NHR2a.
10. The compound of formula (I) according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof, wherein R2ais hydrogen or C1-6-alkyl optionally substituted with one to three R2b.
11. The compound of formula (I) according to any one of claims 1 to 10, or a pharmaceutically acceptable salt thereof, wherein R2ais C1-6-alkyl substituted with one to three R2b.
12. The compound of formula (I) according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, wherein R2ais ethyl or propyl, wherein ethyl or propyl is substituted with one to three R2b.
13. The compound of formula (I) according to any one of claims 1 to 12, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, C3-6-cycloalkyl, or amino-C3-6-cycloalkyl.
14. The compound of formula (I) according to any one of claims 1 to 13, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, halogen, or amino, ethynyl, or amino-cyclopropyl.
15. The compound of formula (I) according to any one of claims 1 to 14, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, halogen, amino.
16. The compound of formula (I) according to any one of claims 1 to 15, or a pharmaceutically acceptable salt thereof, wherein R2bis at each occurrence independently hydroxy, fluoro, or amino.
17. The compound of formula (I) according to any one of claims 1 to 16, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy and R4is hydrogen; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl optionally substituted with halogen.
18. The compound of formula (I) according to any one of claims 1 to 17, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen, methyl or hydroxymethyl and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl or fluorocyclopropyl.
19. The compound of formula (I) according to any one of claims 1 to 18, or a pharmaceutically acceptable salt thereof, wherein R3is hydrogen or methyl and R4is hydrogen; or R3and R4together with the carbon to which they are attached form a cyclopropyl.
20. The compound of formula (I) according to any one of claims 1 to 19, or a pharmaceutically acceptable salt thereof, wherein R5is hydrogen or fluoro.
21. The compound of formula (I) according to any one of claims 1 to 20, or a pharmaceutically acceptable salt thereof, wherein R6is hydrogen or C1-6-alkyl.
22. The compound of formula (I) according to any one of claims 1 to 21, or a pharmaceutically acceptable salt thereof, wherein R6is hydrogen or methyl.
23. The compound of formula (I) according to any one of claims 1 to 22, or a pharmaceutically acceptable salt thereof, wherein R7is halogen or C1-6-alkyl.
24. The compound of formula (I) according to any one of claims 1 to 23, or a pharmaceutically acceptable salt thereof, wherein R7is chloro or methyl.
25. The compound of formula (I) according to any one of claims 1 to 24, or a pharmaceutically acceptable salt thereof, wherein R7is chloro.
26. The compound of formula (I) according to any one of claims 1 to 25, or a pharmaceutically acceptable salt thereof, wherein R8is chloro or -CF3.
27. The compound of formula (I) according to any one of claims 1 to 26, or a pharmaceutically acceptable salt thereof, wherein R8is -CF3.
28. The compound of formula (I) according to any one of claims 1 to 27, or a pharmaceutically acceptable salt thereof, wherein R9is hydrogen.
29. The compound of formula (I) according to claim 1, or a pharmaceutically acceptable salt thereof, wherein: R1ais at each occurrence independently halogen, C1-6-alkyl, or C2-6-alkynyl; R2ais hydrogen or C1-6-alkyl optionally substituted with one to three R2b; R2bis at each occurrence independently hydroxy, halogen, amino, C2-6-alkynyl, C3-6- cycloalkyl, or amino-C3-6-cycloalkyl; R3is hydrogen or C1-6-alkyl optionally substituted with hydroxy; and R4is hydrogen; orR3and R4together with the carbon to which they are attached form C3-4-cycloalkyl optionally substituted with halogen; R6is hydrogen or C1-6-alkyl; R7is halogen or C1-6-alkyl; R9is hydrogen.
30. The compound of formula (I) according to claim 29, or a pharmaceutically acceptable salt thereof, wherein: R1is C6-C10-aryl substituted with one or two R1a; R1ais at each occurrence independently C1-6-alkyl or C2-6-alkynyl; R2is -C(O)NHR2a; R2ais C1-6-alkyl optionally substituted with one, two or three R2b; R2bis at each occurrence independently hydroxy, halogen, or amino; R3is hydrogen or C1-6-alkyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form C3-4-cycloalkyl; R7is halogen; R8is halo-C1-6-alkyl.
31. The compound of formula (I) according to claim 29, or a pharmaceutically acceptable salt thereof, wherein: R1is phenyl or thienyl, wherein phenyl or thienyl is substituted with one or two R1a; R1ais at each occurrence independently fluoro, chloro, bromo, methyl, or ethynyl; R1ais -C(O)NHR2aor -CH2OH; R2ais hydorgen or C1-4-alkyl; R2bis at each occurrence independently hydroxy, fluoro, amino, ethynyl, or amino- cyclopropyl; R3is hydrogen, methyl, or hydroxymethyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl or fluorocyclopropyl; R5is hydrogen or fluoro; R6is hydrogen or methyl;R7is chloro or methyl; R8is chloro or –CF3.
32. The compound of formula (I) according to claim 30, or a pharmaceutically acceptable salt thereof, wherein: R1is phenyl substituted with one R1a; R1ais methyl or ethynyl; R2ais ethyl or propyl; R2bis hydroxy, fluoro, or amino; R3is hydrogen or methyl; and R4is hydrogen; or R3and R4together with the carbon to which they are attached form cyclopropyl; R5is hydrogen or fluoro; R6is hydrogen or methyl; R7is chloro; R8is–CF3.
33. The compound of formula (I) according to claim 1, or a pharmaceutically acceptable salt thereof, wherein said compound of formula (I) is: N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(4-fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(3,5-dimethylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-3-[2-(1-aminocyclopropyl)ethylamino]-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6-carboxamid; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(3-fluoro-5-methyl-phenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxamide;N-[(1S)-3-[[(2S)-2-amino-3-hydroxy-propyl]amino]-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6-carboxamide; N-[(1S)-3-[[(2R)-2-amino-3-hydroxy-propyl]amino]-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4- benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide hydrochloride salt; N-[(1S)-3-(3-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-[(5- methyl-3-thienyl)sulfonyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminoethylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-bromophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3- hydroxypropylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-2'- fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxamide N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(3-chlorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(3-bromophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(2-aminopropylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-hydroxy-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide;N-[(1S)-1-[2-Chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo- propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-3-(but-3-ynylamino)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4- (m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxybutyl]amino]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2S)-2-hydroxybutyl]amino]-3- oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2S)-3-hydroxy-2-methyl- propyl]amino]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-3-hydroxy-2-methyl- propyl]amino]-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-2-methyl-3-(methylamino)-3-oxo- pro pyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxypropyl]amino]- 2-methyl-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-8- fluoro-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(3- ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo- propyl]-4-(3-ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo- propyl]-4-(3-ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide;4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2- difluoroethylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2- difluoro-3-hydroxy-propyl)amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6- carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2- hydroxybutylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(3- hydroxy-2-methyl-propyl)amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6- carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)- 2-hydroxypropyl]amino]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6- carboxamide; 4-(3-bromophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2- difluoroethylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo- propyl]-4-(3-fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo- propyl]-4-(3-fluorophenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-3-(2,2-difluoroethylamino)-1-[2-methyl-5- (trifluoromethyl)phenyl]-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2-difluoro-3-hydroxy- propyl)amino]-3-oxo-propyl]-4-(3-ethynylphenyl)sulfonyl-spiro[3H-1,4- benzoxazine-2,1'-cyclopropane]-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-4-(m- tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3- (methylamino)-3-oxo-propyl]spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxamide;N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3-hydroxypropylamino)-3-oxo- propyl]-4-(3-ethynylphenyl)sulfonyl-spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]- 6-carboxamide; 4-(3-chlorophenyl)sulfonyl-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(3- hydroxypropylamino)-3-oxo-propyl]-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]-8- fluoro-4-(m-tolylsulfonyl)spiro[3H-1,4-benzoxazine-2,1'-cyclopropane]-6- carboxamide; N-[(1S)-1-(2,5-dichlorophenyl)-3-[[(2R)-2-hydroxypropyl]amino]-3-oxo-propyl]-4- (m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2S)-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]- 2-(hydroxymethyl)-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2R)-N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(methylamino)-3-oxo-propyl]- 8-fluoro-2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide; (2R)-N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]- 3-oxo-propyl]-8-fluoro-2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine- 6-carboxamide; or N-[(1S)-3-amino-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-oxo-propyl]-4-(m- tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6-carboxamide.
34. The compound of formula (I) according to claim 1, or a pharmaceutically acceptable salt thereof, wherein said compound of formula (I) is: N-[(1S,2R)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[[(2R)-2-hydroxypropyl]amino]- 2-methyl-3-oxo-propyl]-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine-6- carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-(2,2-difluoroethylamino)-3-oxo- propyl]-4-(3-ethynylphenyl)sulfonyl-2,3-dihydro-1,4-benzoxazine-6-carboxamide; N-[(1S)-1-[2-chloro-5-(trifluoromethyl)phenyl]-3-[(2,2-difluoro-3-hydroxy- propyl)amino]-3-oxo-propyl]-4-(3-ethynylphenyl)sulfonyl-spiro[3H-1,4- benzoxazine-2,1'-cyclopropane]-6-carboxamide; or (2R)-N-[(1S)-3-[[(2R)-2-aminopropyl]amino]-1-[2-chloro-5-(trifluoromethyl)phenyl]- 3-oxo-propyl]-8-fluoro-2-methyl-4-(m-tolylsulfonyl)-2,3-dihydro-1,4-benzoxazine- 6-carboxamide.
5. A process of preparation of a compound of formula (I) according to any one of claims 1 to 34, or a pharmaceutically acceptable salt thereof, comprising: (a) reacting a compound of formula (II), wherein R3, R4, R5, and R9, are as defined in any one of claims 1 to 34with a compound of formula (III), wherein R1is as defined in any one of claims 1 to 34, in the presence of an organic baseto form a compound of formula (IV), wherein R1, R3, R4, R5, and R9are as defined in any one of claims 1 to 34followed by (b) hydrolyzing the methyl ester moiety in said compound of formula (IV) with an aqueous solution of an inorganic base, followed by reacting the resultingcarboxylic acid with a compound of formula (V), wherein R2, R6, R7, and R8are as defined in any one of claims 1 to 34to form said compound of formula (I).
36. A compound of formula (I) according to any one of claims 1 to 34, or a pharmaceutically acceptable salt thereof, when manufactured according to claim 35 37. A compound of formula (I) according to any one of claims 1 to 34, or a pharmaceutically acceptable salt thereof, for use as a therapeutically active substance.
38. A pharmaceutical composition comprising a compound of formula (I) according to any one of claims 1 to 34, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.
39. The pharmaceutical composition of claim 38, further comprising an additional therapeutic agent.
40. The use of a compound of formula (I) according to any one of claims 1 to 34, or a pharmaceutically acceptable salt thereof, for the treatment and / or prophylaxis of disease or disorder mediated by MET kinase.
41. The use according to claim 40, wherein said disease or disorder mediated by MET kinase is cancer.
42. The use according to claim 41, wherein said cancer is lung cancer.
43. The use according to claim 42, wherein said lung cancer is non-small-cell lung cancer (NSCLC).
44. The use of a compound of formula (I) according to any one of claims 1 to 34, or a pharmaceutically acceptable salt thereof, for the preparation of a medicament for the treatment and / or prophylaxis of disease or disorder mediated by MET kinase.
45. The use according to claim 44, wherein said disease or disorder mediated by MET kinase is cancer.
46. The use according to claim 45, wherein said cancer is lung cancer.
47. The use according to claim 46, wherein said lung cancer is non-small-cell lung cancer (NSCLC).
48. A compound of formula (I) according to any one of claims 1 to 34, or a pharmaceutically acceptable salt thereof, for use in the treatment and / or prophylaxis of disease or disorder mediated by MET kinase.
49. The compound for use according to claim 48, wherein said disease or disorder mediated by MET kinase is cancer.
50. The compound for use according to claim 49, wherein said cancer is lung cancer.
51. The compound for use according to claim 50, wherein said lung cancer is non-small-cell lung cancer (NSCLC).
52. A method for the treatment or prophylaxis of disease or disorder mediated by MET kinase, which method comprises administering a therapeutically effective amount of a compound of formula (I) according to any one of claims 1 to 34, or a pharmaceutically acceptable salt thereof, to a human.
53. A method according to claim 52, wherein said disease or disorder mediated by MET kinase is cancer.
54. A method according to claim 53, wherein said cancer is lung cancer.
55. A method according to claim 54, wherein said lung cancer is non-small-cell lung cancer (NSCLC).
56. The invention as described hereinbefore.
Citation Information
Patent Citations
Compounds and methods of use
WO2005070891A2
Tetrahydroquinoline sulfonamide and related compounds for use as agonists of rory and the treatment of disease
WO2015171610A2
Aryl dihydro-2h-benzo[b][1,4]oxazine sulfonamide and related compounds for use as agonists of rory and the treatment of disease
WO2016201225A1