Helianthus plant with resistance to broomrape

Abstract

The present invention relates to the development and identification of new sunflowers (Helianthus annuus) with resistance to broomrape (Orobanche cumana) and their uses.

Description

[0001] 1

[0002] HELIANTHUS PLANT WITH RESISTANCE TO BROOMRAPEThe field of the invention is related to plant breeding, particularly the development of new sunflowers (Helianthus annuus) with resistance to broomrape (Orobanche cumana). 5BACKGROUND OF THE INVENTIONBroomrape (Orobanche cumana Wallr.) is a holoparasitic plant that causes severeeconomic losses in sunflower crops in many countries. Upon germination of the seeds present in the soil, the parasite penetrates the roots and connects to the host’s vascular tissue absorbing water and nutrients and causing 50% and up to 100% yield losses in highly infected field10 (Alcántara E et al. (2006); Domínguez J (1996)). Several strategies for the control of broomrapeare available such as the use of herbicides like imidazolinone in combination with herbicide resistant sunflower (Tan et al. (2005); Demurin et al. (2010)), rotation schemes including trap crops (Ma et al. (2013); Ye et al. (2020)) and biological control options (Louarn et al. (2016);Shabana et al. (2003)). However, the most promising and efficient strategy relies on the breeding15 of sunflower for genetic resistance to broomrape infections (Fernandez-Martinez et al. (2012);Velasco et al. (2016); Kaya Y (2014); Cvejić et al. (2020)). The host-parasite system of O. cumana and sunflower is characterized by a gene-for-gene interaction (Fernandez-Martinez et al. (2012); Cvejić et al. (2020)). Since the breeding of resistant cultivars to race A in Russia in the 1920s ((Fernandez-Martinez et al. (2015)), the 20 intensive use of sunflower varieties carrying monogenic resistance genes increased the selection pressure on the parasite, resulting in the emergence of new highly virulent races. By virtue of their high reproductive potential and dispersal rate, broomrape populations have rapidly evolved into 5 physiological races described as race A to E corresponding to the resistance genes Or1, Or2, Or3, Or4 and Or5 (Imerovski et al. (2016); Calderón-González et al. (2023); Pérez-Vich et al.25 (2004)). Since 1990 broomrape populations classified as race F that overcome all known resistance genes have been observed in many countries impacted by the parasite, for example in Spain (Alonso et al. (1996)) and France (Bellone et al. (2023)). The dominant resistance loci Or6 on chromosome 3 (Pacureanu et al. (2004)) and Or7 on chromosome 7 (Duriez et al. (2019))were discovered in Romania and Spain respectively and confer resistance to race F. The most 30 virulent races known to date and classified as race G and H appeared in East-Europe and Spain (Louarn et al. (2016); Cvejić et al. (2020); Imerovski et al. (2019)). Recent publications described novel sources of resistance against race G such as OrSII (Martín-Sanz et al. (2020)) and OrDeb2 (Fernández-Aparicio et al. (2022)) both mapping to chromosome 4; the latter being introgressed 2 from H. debilis subsp. tardiflorus. In addition to dominant monogenic resistance genes, instancesof resistance sources associated to recessive alleles (Imerovski et al. (2016); Akhtouch et al. (2002); Cvejić et al. (2018)) or polygenic inheritance have been reported. To date, the only clonedresistance gene for Orobanche control is Or7 encoding for a Leucine-Rich-Repeat Receptor-Like 5 Kinase (Duriez et al. (2019)). The broomrape life cycle distinguishes 4 stages as described by Louarn et al. (2016). Thegermination of orobanche seeds is induced by root exudates such as strigolactones (Louarn etal. (2012); Auger et al. (2012) and sesquiterpene lactones (Galindo et al. (2002); Pérez de Luqueet al. (2000). Germination is followed by the growth of the radicle that attaches to the roots and10 subsequently penetrates the cortex to establish a vascular connection through a haustorium.Hereafter the radicle evolves into a nutrient storage organ, called tubercule which eventuallydevelops into a single stem that emerges from the ground around the stem of its host plant tofinish the life cycle by flowering and producing seeds. Resistance strategies to broomrapeinterfere at the different stage of the parasite cycle life. Different mechanisms of resistance have15 been described as pre-attachment, post-attachment and post-haustorium mechanisms asreported in several studies such as describes in Sisou et al. (2021); Imerovski et al. (2019).As illustrated by Or7 and OrDeb2 that both originate from wild introgressions, it is evidentthat wild Helianthus spp. serve as an important reservoir of resistance genes (Cvejić et al. (2016).Several studies have underscored the value of both perennial and annual species of wild20 Helianthus, as well as the derived interspecific materials to control broomrape (Ruso et al. (1996);Jocković et al. (2018); Chabaud et al. (2022); Labrousse (2001).Resistance to broomrape represents a major breeding target for the main sunflower markets since many years. However, there is still a need to provide novel sources of resistanceto broomrape so as to deliver durable solutions, as well as methods for identifying and obtaining25 such plants resistant to broomrape. There is also a need to identify a resistant plant comprisingseveral loci of resistance. The invention is herein based on the mapping and characterization of a novel source of resistance to control broomrape located at the bottom of chromosome 14 and that was derived from an interspecific cross between cultivated sunflower and wild Helianthus. 30 One objective of the invention is therefore to provide a Helianthus plant or plant partcomprising a locus for broomrape resistance (QTL interval for broomrape resistance). Another objective is to provide a transgenic plant exhibiting broomrape resistance, such as a plant comprising at least one resistance gene as a transgenic element. 3

[0003] Another objective of the invention is to identify a novel source of resistance to broomrapethat can be used in Helianthus breeding activities.Another objective is to provide new methods for identifying a Helianthus plant exhibitingbroomrape resistance. 5Another objective is to provide new methods for producing a Helianthus plant exhibitingbroomrape resistance and obtaining such plant. Another object of the invention is to obtain seeds, hybrid plants and progeny of saidHelianthus plants. In particular, said progeny comprises a transgene corresponding to abroomrape resistance allele.10 The invention aims also to provide methods for identifying the presence of broomraperesistance allele in Helianthus plants and suitable markers associated to said resistance.The invention also provides nucleic acid sequences of gene(s) conferring resistance tobroomrape. 15 SUMMARY It is therefore disclosed herein a Helianthus plant or plant part comprising a locus forbroomrape resistance (QTL interval for broomrape resistance), wherein said locus is locatedwithin the chromosomal interval between markers HS249258 of SEQ ID NO:15 and HS405261of SEQ ID NO:1. Specifically these markers are located on the chromosome 14.20 It is also disclosed a Helianthus plant or plant part which is resistant to broomrape andwhich comprises a chromosomal region including the markers HS249258 of SEQ ID NO:15 andHS405261 of SEQ ID NO:1, or markers linked by 20, 10, 5 or 1cM to these markers.It is also disclosed herein a transgenic Helianthus plant or plant part comprising at leastone the following nucleic acids as transgenic element(s): SEQ ID NO: 70 or a nucleic acid having25 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 70; SEQID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 71; SEQ ID NO: 72 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 72; SEQ ID NO: 73 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 73; SEQ30 ID NO: 74 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 74; SEQ ID NO: 75 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 75; SEQ ID NO: 76 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 76; SEQID NO: 77 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% 4 identity to SEQ ID NO: 77; SEQ ID NO: 78 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 78; SEQ ID NO: 79 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 79; SEQID NO: 80 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%5 identity to SEQ ID NO: 80; SEQ ID NO: 81 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 81; SEQ ID NO: 82 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 82; SEQID NO: 83 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 83; SEQ ID NO: 84 or a nucleic acid having at least 95% identity, preferably10 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 84; SEQ ID NO: 85 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 85; SEQID NO: 86 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 86; SEQ ID NO: 87 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 87; SEQ ID NO: 88 or a nucleic acid having15 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 88; SEQID NO: 89 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 89; SEQ ID NO: 90 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 90; SEQ ID NO: 91 or a nucleic acidhaving at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 91;20 SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or100% identity to SEQ ID NO: 92; SEQ ID NO: 93 or a nucleic acid having at least 95% identity,preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 93; SEQ ID NO: 94 or a nucleicacid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ IDNO: 94; SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%,25 99% or 100% identity to SEQ ID NO: 95; SEQ ID NO: 96 or a nucleic acid having at least 95%identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 96; SEQ ID NO: 97 ora nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity toSEQ ID NO: 97; SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably 96%,97%, 98%, 99% or 100% identity to SEQ ID NO: 98; SEQ ID NO: 99 or a nucleic acid having at30 least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 99; SEQ IDNO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 100; SEQ ID NO: 101 or a nucleic acid having at least 95% identity,preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 101; SEQ ID NO: 102 or anucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to 5

[0004] SEQ ID NO: 102; and / or SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 103.It is further disclosed a method of identifying a Helianthus plant or plant part comprising alocus for broomrape resistance, as mentioned above, wherein said Helianthus plant or plant part5 is identified by genotyping one or more nucleotide polymorphisms (SNPs) associated to aresistance allele within the chromosomal interval between markers HS249258 of SEQ ID NO:15and HS405261 of SEQ ID NO:1.It is further disclosed a method of identifying a Helianthus plant or plant part havingbroomrape resistance as mentioned above, wherein said plant or plant part is identified by10 detecting the presence of one or more of the following nucleic acids: SEQ ID NO: 70 or a nucleicacid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ IDNO: 70; SEQ ID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%,99% or 100% identity to SEQ ID NO: 71; SEQ ID NO: 72 or a nucleic acid having at least 95%identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 72; SEQ ID NO: 73 or15 a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity toSEQ ID NO: 73; SEQ ID NO: 74 or a nucleic acid having at least 95% identity, preferably 96%,97%, 98%, 99% or 100% identity to SEQ ID NO: 74; SEQ ID NO: 75 or a nucleic acid having atleast 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 75; SEQ IDNO: 76 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%20 identity to SEQ ID NO: 76; SEQ ID NO: 77 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 77; SEQ ID NO: 78 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 78; SEQID NO: 79 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 79; SEQ ID NO: 80 or a nucleic acid having at least 95% identity, preferably25 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 80; SEQ ID NO: 81 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 81; SEQID NO: 82 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 82; SEQ ID NO: 83 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 83; SEQ ID NO: 84 or a nucleic acid having30 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 84; SEQID NO: 85 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 85; SEQ ID NO: 86 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 86; SEQ ID NO: 87 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 87; SEQ 6

[0005] ID NO: 88 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 88; SEQ ID NO: 89 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 89; SEQ ID NO: 90 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 90; SEQ5 ID NO: 91 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 91; SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 92; SEQ ID NO: 93 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 93; SEQID NO: 94 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%10 identity to SEQ ID NO: 94; SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 95; SEQ ID NO: 96 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 96; SEQID NO: 97 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 97; SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably15 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 98; SEQ ID NO: 99 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 99; SEQID NO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or100% identity to SEQ ID NO: 100; SEQ ID NO: 101 or a nucleic acid having at least 95% identity,preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 101; SEQ ID NO: 102 or a20 nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity toSEQ ID NO: 102; and / or SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 103.It is further disclosed a method for producing a Helianthus hybrid plant or plant partcomprising the steps of:25 a. crossing a first Helianthus plant with a second Helianthus plant as mentionedabove, comprising a locus for broomrape resistance (QTL interval for broomrape resistance),wherein said locus is located within the chromosomal interval between markers HS249258 ofSEQ ID NO:15 and HS405261 of SEQ ID NO:1;b. collecting the hybrid seed;30 c. optionally detecting the resistance level of the hybrid seed.It is further disclosed a method for producing a Helianthus plant or plant part comprisingthe steps of:a. crossing a first Helianthus plant as mentioned above, comprising a locus forbroomrape resistance (QTL interval for broomrape resistance), wherein said locus is located 7 within the chromosomal interval between markers HS249258 of SEQ ID NO:15 and HS405261of SEQ ID NO:1 with a second Helianthus plant as mentioned above, comprising a locus forbroomrape resistance (QTL interval for broomrape resistance), wherein said locus is locatedwithin the chromosomal interval between markers HS249258 of SEQ ID NO:15 and HS4052615 of SEQ ID NO:1;b. collecting the seed;c. optionally detecting the resistance level of the seed.It is further disclosed a method for producing a Helianthus plant or plant part as mentionedabove, said method comprising the following steps:10 a. providing a first Helianthus plant comprising one or more nucleotidepolymorphisms associated to a resistance allele within the chromosomal interval betweenmarkers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1;b. crossing said first Helianthus plant with a second Helianthus plant comprising oneor more nucleotide polymorphisms associated to a resistance allele within the chromosomal15 interval between markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1;c. collecting the F1 hybrid seed;d. obtaining homozygous plants or plant part from the F1 plants;e. genotyping of said one or more nucleotide polymorphisms associated to aresistance allele within the chromosomal interval between markers HS249258 of SEQ ID NO:1520 and HS405261 of SEQ ID NO:1 in the hybrid seed and / or at each generation.It is further disclosed a method for producing a Helianthus plant or plant part resistant tobroomrape, said method comprising the following step:a. genotyping a Helianthus plant using markers located within the chromosomalinterval between markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1;25 b. selecting a Helianthus plant comprising one or more nucleotide polymorphismsassociated to a resistance allele within said chromosomal interval;c. crossing said first Helianthus plant with a second Helianthus plant;d. collecting the F1 hybrid seed;e. obtaining homozygous plants or plant part from the F1 plants;30 f. genotyping one or more nucleotide polymorphisms associated to a resistanceallele within the chromosomal interval between markers HS249258 of SEQ ID NO:15 andHS405261 of SEQ ID NO:1 in the hybrid seed and / or at each generation.It is further disclosed a method for producing a Helianthus plant or plant part resistant tobroomrape, said method comprising the following step: 8 a. providing a first Helianthus plant comprising one or more nucleotidepolymorphisms associated to a resistance allele within the chromosomal interval betweenmarkers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1;b. crossing said first Helianthus plant with a second Helianthus plant;5 c. collecting the F1 hybrid seed;d. obtaining homozygous plants from the F1 plants;e. genotyping said one or more nucleotide polymorphisms associated to a resistanceallele within the chromosomal interval between markers HS249258 of SEQ ID NO:15 andHS405261 of SEQ ID NO:1 in the hybrid seed and / or at each generation.10 It is further disclosed a method for producing a Helianthus plant or plant part resistant tobroomrape, said method comprising the following steps:a. crossing a first Helianthus plant comprising one or more nucleotide polymorphismsassociated to a resistance allele within the chromosomal interval between markers HS249258 ofSEQ ID NO:15 and HS405261 of SEQ ID NO:1 with a second Helianthus plant; thereby obtaining15 a F1 hybrid plant;b. backcrossing said F1 hybrid with the second Helianthus plant;c. selecting the Helianthus plant resistant to broomrape among the Helianthus plantobtained in step b) by genotyping one or more nucleotide polymorphisms associated to aresistance allele within the chromosomal interval between markers HS249258 of SEQ ID NO:1520 and HS405261 of SEQ ID NO:1.It is further disclosed a Helianthus plant or plant part or progeny of the plant as obtainedby the method described above. Seeds, hybrid plants and progeny of plant obtained as mentionedabove, as well as seeds, hybrid plants and progeny of plant obtained from representative sampleof the seeds as deposited at NCIMB collection under the number NCIMB 44327 are also25 disclosed. In particular, said progeny comprises a transgene corresponding to a broomraperesistance allele as above described.The disclosure further discloses means or methods for detecting (genotyping) one ormore nucleotide polymorphisms (SNPs) associated to broomrape resistance in a Helianthus plant30 or plant part using one or more of the following markers: SEQ ID NO: 1 to SEQ ID NO: 15. Moreparticularly the disclosure also provides a kit for detecting these nucleotide polymorphisms(SNPs), the kit comprising SEQ ID NO: 16 to SEQ ID NO: 69. 9

[0006] The disclosure also relates to the use of a Helianthus plant or plant part as describedabove, identified as describes herein, or obtained by the method of as described herein for foodapplication, for feed application or for breeding application.The disclosure also relates to isolated nucleic acids corresponding to a resistance gene5 against broomrape, wherein said gene is chosen among: SEQ ID NO: 70 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 70; SEQID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 71; SEQ ID NO: 72 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 72; SEQ ID NO: 73 or a nucleic acid having10 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 73; SEQID NO: 74 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 74; SEQ ID NO: 75 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 75; SEQ ID NO: 76 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 76; SEQ15 ID NO: 77 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 77; SEQ ID NO: 78 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 78; SEQ ID NO: 79 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 79; SEQID NO: 80 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%20 identity to SEQ ID NO: 80; SEQ ID NO: 81 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 81; SEQ ID NO: 82 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 82; SEQID NO: 83 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 83; SEQ ID NO: 84 or a nucleic acid having at least 95% identity, preferably25 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 84; SEQ ID NO: 85 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 85; SEQID NO: 86 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 86; SEQ ID NO: 87 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 87; SEQ ID NO: 88 or a nucleic acid having30 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 88; SEQID NO: 89 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 89; SEQ ID NO: 90 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 90. SEQ ID NO: 91 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 91; SEQ 10 ID NO: 92 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 92; SEQ ID NO: 93 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 93; SEQ ID NO: 94 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 94; SEQ5 ID NO: 95 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 95; SEQ ID NO: 96 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 96; SEQ ID NO: 97 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 97; SEQID NO: 98 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%10 identity to SEQ ID NO: 98; SEQ ID NO: 99 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 99 ; SEQ ID NO: 100 or a nucleic acidhaving at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:100; SEQ ID NO: 101 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%,99% or 100% identity to SEQ ID NO: 101; SEQ ID NO: 102 or a nucleic acid having at least 95%15 identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 102; and / or SEQ IDNO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 103.BRIEF DESCRIPTION OF THE FIGURES20 Figure 1. Characterization of the virulence profile of Orobanche populations using adifferential set of proprietary sunflower lines carrying known resistance genes. LT_S is a fullysusceptible control line, LT_IS carries the Or5 resistance gene that confers resistance to race E;LT_Or7 carries Or7 conferring resistance to race E and F and LT_32 carries both Or5 and Or7and is resistant to races E, F and G.25 Figure 2. Different developmental stages of broomrape infection on sunflower roots undercontrolled conditions at the Oroscreen® platform (WO2015 / 075131). The 0 to 5 scale was usedfor the notation of the broomrape infection at 5 weeks after infestation.Figure 3. Description of the major phenotypic traits used to describe the resistancephenotype of the F2 population derived from 2603 x LT_98MOL_MLG_010_43 upon infestation30 with broomrape (race F) for the purpose of QTL detection. (A) Photogragh of a broomrape healthy(HT) and a necrotic tubercule (NT); (B) Boxplot of the number of HT and NT observed on the rootsof the control lines (LT-S, LT-IS, LT-32) and the F2 population; (C) Distribution of the number ofHT and NT observed in the F2 population. HT and NT were counted on individual roots at 5 weeks 11 after infestation with Br0075 (O. cumana classified as race F and originating from Spain,Colorado). Figure 4. Quantitative trait loci (QTL) associated to broomrape resistance in the F2population 2603 x LT_98MOL. (A) Visualisation of the QTLs on the genetic map consisting of 175 linkage groups (1655 cM and 2232 loci). QTLs with a minimal LOD score of 3,6 are displayed atthe left of each linkage group; (B) Boxplot of the number of healthy tubercules counted on theroots of the F2 plants according to the genotype of marker HS405261 at the peak of the QTL. A:plants carrying the resistant LT_98MOL allele, B: plants carrying the susceptible 2603 allele andH: heterozygous plants10 Figure 5. Mapping of the QTL interval on LG14. (A) Mapping of the QTL interval forbroomrape resistance on the genome sequence of chromosome 14 in LT_98MOL. (B) Close upof the QTL interval after fine-mapping. Black dashes represent the marker positions of the geneticmap of LG14. The confidence interval of the QTL region is delimited by markers HS249258 andHS405261 (the flanking markers). The marker at the peak of the QTL is HS405341.15 Figure 6. Candidate genes predicted in the final confidence interval of the QTL LG14 afterfine-mapping. Mapping of the candidate genes (black markers) associated to broomraperesistance against race F on LT_98MOL_MLG_010_43 and XRQv2 reference genomes.Figure 7. Major phenotypic traits describing the resistance phenotype of the NILs carryingthe QTL on LG14 upon infestation with broomrape (race F). (A) 1- Estimated number of healthy20 tubercules (HT) and 2- percentage of necrotic tubercules (pcNT) as assessed on the proprietaryOroscreen® platform. (B) Percentage of plants showing emerged broomrapes at their stem atmaturity in rows comprising 25 plants in a field in the region of Cordoba, Spain. Near isogeniclines (BC3S2) carry the favorable allele of the QTL on LG14 derived from LT_98MOL (FAV printedin grey) or the susceptible allele from 2603 (DEFAV printed in black). Controls consist of25 LT_98MOL, a susceptible line (LT-S), and lines carrying respectively Or5 (LT_IS and LT_Or5) orOr7 (LT_Or7) and are represented by dotted horizontal lines on the plots. The p-valuerepresenting the effect of the genotype on the trait variability is indicated at the top of the plots.Letters above the bars portray the pairwise difference between NILs using Tukey’s HSD method.Figure 8. Complementation for resistance to broomrape race G in hybrids obtained by30 crossing LT-MOL98 and the NILs for the QTL LG14 to tester lines carrying different resistancegenes. Percentage of plants showing emerged broomrapes at their stem at maturity in rowscomprising 25 plants in a field in the region of Rostov, Russia. (A) Hybrids derived fromLT_98MOL. (B) Hybrids derived from the NILs carrying the QTL on LG14. Tester lines consistedof susceptible line LT_S and resistant lines LT_Or7 and LT_DEB02 carrying the corresponding 12 resistance genes. Checks consisted of hybrids obtained from the tester lines and are representedby dotted horizontal lines. The p-value representing the effect of the genotype on the traitvariability is indicated above the plots. Letters above the bars portray the pairwise differencesusing Tukey’s HSD method.5 Figure 9. Characterization of the mechanism of resistance associated to the QTL onLG14. Individual sunflower plants were inoculated with broomrape seeds in rhizotrons and theirroots observed for the presence of attachments and tubercules at 14, 21, 28, 35 and 42 d.a.i.LT_S and LT_DEB2 were used as susceptible and resistant control respectively. (A) A healthyand a necrotic tubercule at 35 dai, (B) Compatible (red arrow) and incompatible (black arrow)10 attachments. Visible browning indicates incompatible attachments. Photographs A and B wereobtained on NIL_5_FAV upon infection with race F. (C) Evaluation of 1: the number ofattachments to the roots (TA), 2: the percentage of incompatible attachments (PcIA), 3: thenumber of tubercules attached to the roots (TT) 4: the percentage on necrotic tubercules (NT) at35 and 42 dai.15 Figure 10. Cluster plots of the two Kaspar assays diagnostic for the broomrape resistancederived from LT_98MOL allowing for the positive identification of plants homozygous orheterozygous for the resistance allele. Allele specific primers are reported by FAM (465 to 510nm) and VIC (533 to 580 nm) florescence on the X the Y axis respectively. Dots representindividual plants or accessions that were genotyped using the two Kaspar assays; datapoints20 corresponding to plant individuals homozygous or heterozygous for the resistance allele areindicated. DETAILED DESCRIPTIONThe Helianthus plant25 As used herein, the term “Helianthus plant” includes a plant of the Helianthus genus,including H. annuus ssp. annuus, Helianthus mollis, Helianthus argophyllus and many otherspecies. As used herein, the term “quantitative trait locus” (QTL) refers to a polymorphic geneticlocus with at least two alleles that differentially affect the expression of a genetic trait. In the30 present invention, said genetic trait is the resistance to broomrape. In a specific embodiment, saidQTL is located between markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1on the chromosome 14 of the Helianthus genome.As used herein, the term "chromosomal interval" designates a contiguous linear span ofgenomic DNA that resides in planta on a single chromosome. The genetic elements or genes 13 located on a single chromosomal interval are physically linked. The size of a chromosomal intervalis not particularly limited. In some aspects, the genetic elements located within a singlechromosomal interval are genetically linked, typically with a genetic recombination distance of, forexample, less than or equal to 20 cM, or alternatively, less than or equal to 10 cM. That is, two5 genetic elements within a single chromosomal interval undergo recombination at a frequency ofless than or equal to 20% or 10%. In a specific embodiment, it is herein disclosed a Helianthusplant or plant part comprising locus for broomrape resistance, wherein said locus is located in achromosomal region which includes the markers HS249258 of SEQ ID NO:15 and HS405261 ofSEQ ID NO:1, or markers linked by 20, 10, 5 or 1cM to these markers.10 As used herein, the term “centimorgan” ("cM") is a unit of measure of recombinationfrequency. One cM is equal to a 1 % chance that a marker at one genetic locus will be separatedfrom a marker at a second locus due to crossing over in a single generation.As used herein, the term “broomrape resistance” refers to the resistance to parasiticannual or perennial herbs belonging to the family Orobanchaceae, more specifically to the genus15 Orobanche. In a specific embodiment, the term “broomrape resistance” or “orobanche resistance”refers to the resistance to Orobanche cumana, more specifically Orobanche cumana Wallr. Asmentioned above, physiological races described as race A to E corresponding to the resistancegenes Or1, Or2, Or3, Or4 and Or5 are known, and in a specific embodiment, said term“broomrape resistance” means a resistance that enables control over race F or higher. In a20 specific embodiment, the Helianthus plant of the invention is resistant against broomrapepopulations Br0075 and / or Br0080 originating from Southern Spain. The virulence of bothpopulations has been classified using a differential set of host genotypes carrying knownresistance genes. The panel is composed of the fully susceptible control line LT_S, line LT_IScarrying the Or5 resistance gene that confers resistance to race E, line LT_Or7 carrying Or725 conferring resistance to race E and F and line LT_32 carrying Or5 in combination with Or7 that isresistant to race E, F and G (Figure 1). Based on their virulence profiles displayed on thedifferential set, broomrape populations Br0075 and Br0080 have both been classified as race F.In a specific embodiment of the Helianthus plant of the invention, said locus (QTL interval)for broomrape resistance is characterized by the genotype of one or more of the following SNPs30 associated to the resistance allele in Table 1 below. 14 Table 1: SNP associated with broomrape resistance allele In a specific embodiment of said Helianthus plant, said locus (QTL interval) for broomraperesistance is characterized by the genotype “G” of SNP1, “A” of SNP2, “G” of SNP3, “C” of SNP4,5 “G” of SNP5, “G” of SNP6, “G” of SNP7, “G” of SNP8, “A” of SNP9, “T” of SNP10, “C” of SNP11,“A” of SNP12, “C” of SNP13, “T” of SNP14 and “C” of SNP15, as described in Table 1.In a specific embodiment of said Helianthus plant, said locus (QTL interval) for broomraperesistance is characterized by the presence of at least one of the following nucleic acids of: SEQID NO: 70 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%10 identity to SEQ ID NO: 70; SEQ ID NO: 71 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 71; SEQ ID NO: 72 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 72; SEQID NO: 73 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 73; SEQ ID NO: 74 or a nucleic acid having at least 95% identity, preferably15 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 74; SEQ ID NO: 75 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 75; SEQID NO: 76 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 76; SEQ ID NO: 77 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 77; SEQ ID NO: 78 or a nucleic acid having 15 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 78; SEQID NO: 79 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 79; SEQ ID NO: 80 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 80; SEQ ID NO: 81 or a nucleic acid having5 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 81; SEQID NO: 82 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 82; SEQ ID NO: 83 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 83; SEQ ID NO: 84 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 84; SEQ10 ID NO: 85 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 85; SEQ ID NO: 86 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 86; SEQ ID NO: 87 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 87; SEQID NO: 88 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%15 identity to SEQ ID NO: 88; SEQ ID NO: 89 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 89; SEQ ID NO: 90 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 90; SEQID NO: 91 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 91; SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably20 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 92; SEQ ID NO: 93 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 93; SEQID NO: 94 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 94; SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 95; SEQ ID NO: 96 or a nucleic acid having25 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 96; SEQID NO: 97 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 97; SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 98; SEQ ID NO: 99 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 99; SEQ30 ID NO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or100% identity to SEQ ID NO: 100; SEQ ID NO: 101 or a nucleic acid having at least 95% identity,preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 101; SEQ ID NO: 102 or anucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to 16 SEQ ID NO: 102; and / or SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 103.As used herein, said Helianthus plants showing less than 3 healthy tubercules at theOroscreen® platform after five weeks of infection or showing an incidence of infection (percentage5 of infected plants showing at least one broomrape) inferior to 20 percent under field conditionsare defined as broomrape resistant. The Oroscreen® platform is defined in WO2015 / 075131.As used herein, the term “allele(s)” means any of one or more alternative forms of a geneat a particular locus. In a diploid (or amphidiploidic cell of an organism), alleles of a given geneare located at a specific location or locus on a chromosome. One allele is present on each10 chromosome of the pair of homologous chromosomes.Whenever reference to a “plant” or “plants” is made, it is understood that also plant parts(cells, tissues or organs, seed pods, seeds, severed parts such as roots, leaves, flowers, pollen,etc.), progeny of the plants which retain the distinguishing characteristics of the parents(especially, broomrape resistance), such as seed obtained by selfing or crossing, e.g. hybrid15 seeds (obtained by crossing two inbred parent plants), hybrid plants and plant parts derived therefrom are encompassed herein, unless otherwise indicated.As used herein, the term “introgression” refers to a DNA fragment of a particular species,in the present example, from a wild Helianthus plant, and transferred into another Helianthusspecies, in the present example a cultivated Helianthus plant.20 As used herein a “marker” refers to a specific DNA sequence or fragment identified withinthe genome of a plant and which can be used to determine whether a plant has inherited aparticular trait or allele of interest from a parent plant. Said marker may include coding or non-coding sequences. In particular, said marker may include one or more Single NucleotidePolymorphisms or SNPs identified between the genomes of resistant and non-resistant25 Helianthus plant.In a specific embodiment, a marker according to the invention is chosen among themarkers HS405261 defined by the context sequence of SEQ ID NO: 1; HS405260 defined by thecontext sequence of SEQ ID NO: 2; HS405268 defined by the context sequence of SEQ ID NO:3; HS234124 defined by the context sequence of SEQ ID NO: 4; HS222744 defined by the context30 sequence of SEQ ID NO: 5; HS000974 defined by the context sequence of SEQ ID NO: 6;HS405333 defined by the context sequence of SEQ ID NO: 7; HS405334 defined by the contextsequence of SEQ ID NO: 8; HS126119 defined by the context sequence of SEQ ID NO: 9;HS405335 defined by the context sequence of SEQ ID NO: 10; HS405337 defined by the contextsequence of SEQ ID NO: 11; HS405338 defined by the context sequence of SEQ ID NO: 12; 17 HS405341 defined by the context sequence of SEQ ID NO: 13; HS405344 defined by the contextsequence of SEQ ID NO: 14; HS249258 defined by the context sequence of SEQ ID NO: 15.In a specific embodiment, the locus (QTL interval) for broomrape resistance ischaracterized by the genotype “G” of SNP1, “A” of SNP2, “G” of SNP3, “C” of SNP4, “G” of SNP5,5 “G” of SNP6, “G” of SNP7, “G” of SNP8, “A” of SNP9, “T” of SNP10, “C” of SNP11, “A” of SNP12,“C” of SNP13, “T” of SNP14 and “C” of SNP15, as described in the markers of SEQ ID NO:1 toSEQ ID NO:15.As used herein, the term “nucleotide polymorphisms (SNPs) associated to the resistanceallele” corresponds to a nucleotide present in the genome of a resistant Helianthus plant10 compared to the nucleotide present at the same position in the genome of non-resistantHelianthus plant. In a specific embodiment, said SNP associated to the resistance allelecorresponds to a nucleotide as indicated in Table 1 within at least one marker chosen from SEQID NO:1 to SEQ ID NO:15.In a specific embodiment, said locus (QTL interval) for broomrape resistance is15 characterized by the presence of one or more of the following SNPs associated to the resistanceallele as defined in Table 1. As used herein, “one or more of the following SNPs” means one, two,three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen SNPs asrecited in Table 1. Further SNPs can also be present and identified by comparing the resistantallele to any other susceptible allele of the QTL region.20 According to the disclosure, genes conferring resistance to broomrape (or “resistancegene”) were identified. Consequently, the locus (QTL interval) for broomrape resistance can becharacterized by the presence of at least one of the resistance genes. Thus, in a specificembodiment of the invention, said locus (QTL interval) for broomrape resistance is characterizedby the presence of at least one of the following nucleic acids of: SEQ ID NO: 70 or a nucleic acid25 having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 70;SEQ ID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or100% identity to SEQ ID NO: 71; SEQ ID NO: 72 or a nucleic acid having at least 95% identity,preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 72; SEQ ID NO: 73 or a nucleicacid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID30 NO: 73; SEQ ID NO: 74 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%,99% or 100% identity to SEQ ID NO: 74; SEQ ID NO: 75 or a nucleic acid having at least 95%identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 75; SEQ ID NO: 76 ora nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity toSEQ ID NO: 76; SEQ ID NO: 77 or a nucleic acid having at least 95% identity, preferably 96%, 18 97%, 98%, 99% or 100% identity to SEQ ID NO: 77; SEQ ID NO: 78 or a nucleic acid having atleast 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 78; SEQ IDNO: 79 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 79; SEQ ID NO: 80 or a nucleic acid having at least 95% identity, preferably5 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 80; SEQ ID NO: 81 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 81; SEQID NO: 82 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 82; SEQ ID NO: 83 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 83; SEQ ID NO: 84 or a nucleic acid having10 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 84; SEQID NO: 85 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 85; SEQ ID NO: 86 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 86; SEQ ID NO: 87 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 87; SEQ15 ID NO: 88 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 88; SEQ ID NO: 89 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 89; SEQ ID NO: 90 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 90; SEQID NO: 91 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%20 identity to SEQ ID NO: 91; SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 92; SEQ ID NO: 93 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 93; SEQID NO: 94 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 94; SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably25 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 95; SEQ ID NO: 96 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 96; SEQID NO: 97 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 97; SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 98; SEQ ID NO: 99 or a nucleic acid having30 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 99; SEQID NO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or100% identity to SEQ ID NO: 100; SEQ ID NO: 101 or a nucleic acid having at least 95% identity,preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 101; SEQ ID NO: 102 or anucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to 19 SEQ ID NO: 102; and / or SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 103.As used herein, “at least one of the following nucleic acids” means one, two, three, four,five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen,5 eighteen, nineteen, twenty, … up to thirty-three nucleic acids chosen among SEQ ID NO: 70-SEQID NO: 103.Percentage of sequence identity as used herein is determined by calculating the numberof matched positions in aligned nucleic acid sequences, dividing the number of matched positionsby the total number of aligned nucleotides, and multiplying by 100. A matched position refers to10 a position in which identical nucleotides occur at the same position in aligned nucleic acidsequences. For example, nucleic acid sequences may be aligned using the BLAST 2 sequences(Bl2seq) using BLASTN algorithms (www.ncbi.nlm.nih.gov).The present disclosure also pertains to a transgenic Helianthus plant or plant partcomprising at least one the following nucleic acids as transgenic element(s): SEQ ID NO: 70 or a15 nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity toSEQ ID NO: 70; SEQ ID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%,97%, 98%, 99% or 100% identity to SEQ ID NO: 71 ; SEQ ID NO: 72 or a nucleic acid having atleast 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 72; SEQ IDNO: 73 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%20 identity to SEQ ID NO: 73; SEQ ID NO: 74 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 74; SEQ ID NO: 75 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 75; SEQID NO: 76 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 76; SEQ ID NO: 77 or a nucleic acid having at least 95% identity, preferably25 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 77; SEQ ID NO: 78 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 78; SEQID NO: 79 or a nucleic acid having at 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 79; SEQ ID NO: 80 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 80; SEQ ID NO: 81 or a nucleic acid having30 at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 81; SEQID NO: 82 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 82; SEQ ID NO: 83 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 83; SEQ ID NO: 84 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 84; SEQ 20 ID NO: 85 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 85; SEQ ID NO: 86 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 86; SEQ ID NO: 87 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 87; SEQ5 ID NO: 88 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 88; SEQ ID NO: 89 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 89; SEQ ID NO: 90 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 90, SEQID NO: 91 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%10 identity to SEQ ID NO: 91; SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 92; SEQ ID NO: 93 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 93; SEQID NO: 94 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 94; SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably15 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 95; SEQ ID NO: 96 or a nucleic acid havingat least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 96; SEQID NO: 97 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 97; SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 98; SEQ ID NO: 99 or a nucleic acid having20 at least 99% identity, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 99; SEQID NO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or100% identity to SEQ ID NO: 100; SEQ ID NO: 101 or a nucleic acid having at least 95%,preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 101; SEQ ID NO: 102 or anucleic acid having at least 95%, preferably 96%, 97%, 98%, 99% or 100% identity to SEQ ID25 NO: 102; and / or SEQ ID NO: 103 or a nucleic acid having at least 95%, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 103.Methods of identifying a plant comprising a locus for broomrape resistanceThe present disclosure further includes and provides for methods of identifying a30 Helianthus plant as disclosed above, and more generally methods of selecting or breedingHelianthus plants for the presence of at least one desirable allele(s). Such methods of identifying,selecting or breeding Helianthus plants comprise obtaining one or more Helianthus plants andassessing their DNA to determine the presence or absence of the desirable allele(s) or marker(s)associated with the resistance to broomrape. Such methods may be used, for example, to 21 determine which progeny resulting from a cross carry the broomrape resistance allele andaccordingly to guide the selection of plants having this allele in combination with the presence orabsence of other desirable traits.The present disclosure relates to a method of identifying a Helianthus plant or plant part5 comprising a locus for broomrape resistance, as mentioned above, wherein said Helianthus plantor plant part is identified by genotyping one or more nucleotide polymorphisms (SNPs) associatedto the resistance allele within the chromosomal interval between markers HS249258 of SEQ IDNO:15 and HS405261 of SEQ ID NO:1. In a specific embodiment, said SNPs associated to theresistance allele as located within the chromosomal interval between markers HS249258 of SEQ10 ID NO:15 and HS405261 of SEQ ID NO:1 consist of one or more of SNPs as described in Table1 or Table 2, for example all the SNPs as described in Table 1 or Table 2.Table 2: SNP associated to broomrape resistance allele (the identified SNP allele associated toresistance is highlighted in bold font in the context sequence) 22 N°7 TGTCTCTTGGTCTACATGACATTGATTTGTTCTTGCCATGGCCCTTTCTAAGGTTTTGGAGGTATTCTTGCAAATATCTTGTAACATAGTTAAGCTAATT[G / C]GTTTTTGAAAGACAAATATCATAAACATGTTAT TGCTTCATAAATTAAAATTAATGTCCACATGTTACATTGGTCTCAAATAATGACCATAGACCACAAC N°8 TCCCATCATCACCACTTTCCATGTAAATCCGCTCTCCTCCTCATCTACATCGCCTTCAGGTTGTGGTTTCCGTAGATGCTCACTGCACATTTTGGGCAAC[G / T]GAAGCCCACAGAGTTTTGGGTTCCCACCAA AAGCATATCCATCGAATGTGTTGAATTGTTTTCCTTGTGGAATGTGGCCCATAAGATGGTTTTGTGA TAG N°9 CAGTTCAGTACAAAAGGACATTATAGCAGATAACGTACACTCGaacaacatCGACCAAAAGATCGTCTATCTGTCTGACCAGATTAATTCAGGTGTACTC[A / G]CATGCGTAGAACAGGGGAAATTTCCTAGTGAA 2t5 ca 23 or plant part having broomrape resistance, wherein said plant or plant part is identified bydetecting the presence of at least this QTL.Nucleic acids of broomrape resistance genes have also been identified, consequently, thedisclosure also relates to methods of identifying a Helianthus plant or plant part having broomrape5 resistance, wherein said plant or plant part is identified by detecting the presence of one or moreof the nucleic acids corresponding to broomrape resistance genes, e.g. gene represented by SEQID NO:70 to SEQ ID NO:103 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to said SEQ ID NO:70 to SEQ ID NO:103.Sequences of said genes are indicated in Table 3 below.10 Table 3: Candidate genes IJĴ IJĵ IJĶ 27 28 29 30 31 4 4 32 33 ijĴ ijĵ ijĶ 37 38 4 6 ijĹ 40 41 42 43 44 4 7 45 46 Ĵķ 48 49 50 51 0 4 4 9 52 53 54 55 ĵĶ ĵķ ĵĸ 59 60 61 62 63 64 65 66 Ķķ 68 69 70 71 72 73 Nucleic acids corresponding to the candidate resistance genesThe present disclosure also provides nucleic acids and their recombinant forms of genes5 conferring resistance against broomrape.As used herein, a "recombinant nucleic acid" is a nucleic acid molecule, preferably a DNAmolecule, comprising a combination of nucleic acid molecules that would not naturally occurtogether and is the result of human intervention, e.g., a DNA molecule that is comprised of acombination of at least two DNA molecules heterologous to each other, and / or a DNA molecule10 that is artificially synthesized and comprises a polynucleotide sequence that deviates from thepolynucleotide sequence that would normally exist in nature.Such nucleic acids corresponding to candidate resistance genes have been isolated asdescribed in the Examples below. Accordingly, an aspect of the disclosure relates to isolatednucleic acids corresponding to a broomrape resistance gene, wherein said gene is chosen15 among: SEQ ID NO: 70 to SEQ ID NO: 103 or a nucleic acid having at least 95% identity,preferably 96%, 97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO: 103.The above candidate nucleic acids can further be assessed for their capacity to confer aresistance against broomrape, as described below.It is therefore disclosed herein a method for assessing the capacity of a nucleic acid to20 confer a resistance against broomrape, wherein the method comprises the steps of: 74 a. introducing one or more candidate genes, such as a gene represented by SEQ IDNO: 70 to SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably96%, 97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO: 103,into a parent Helianthus plant,5 b. selecting the transgenic plant bearing one or more nucleic acid as transgene(s),and c. evaluating the broomrape resistance of the transgenic plants as compared to theparent plant based on a broomrape resistance assay,wherein an improvement in the broomrape resistance is indicative that said nucleic acid has the10 capacity to confer a resistance against broomrape.In a further specific embodiment, where appropriate, the nucleic acid sequence may beoptimized for increased expression in the transformed plant. There are a number of optimizationsthat can be performed at the DNA level, without changing the protein sequence, by conservative15 codon exchanges which replace one codon by another codon encoding the same amino acid.Besides, the nucleic acid sequence can be modified for cloning purposes. Like for optimization,such modification is achieved without changing the protein sequence.The present disclosure more specifically relates to DNA molecules including one or moreof the nucleic acids of the candidate resistance genes, e.g. genes represented by SEQ ID NO: 7020 to SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%,99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO: 103. In particular, the disclosure relatesto any DNA molecule resulting from the insertion of a transgene in the Helianthus plant, saidtransgene including one or more of the above-described broomrape resistance genes, and whichinsertion results in the expression of corresponding RNA and / or protein in the Helianthus plant.25 Also part of the present disclosure is a nucleic acid that has been extracted from cells, ortissues, or homogenate from a plant or seed or plant tissue; or can be produced as an ampliconfrom extracted DNA or RNA from cells, or tissues, or homogenate from a plant or seed or planttissue, any of which is derived from such materials derived from a plant comprising such nucleicacid as disclosed above.30 As used herein, the term "transgene" or “transgenic element” refers to the nucleic acid(e.g. DNA molecule) incorporated into a host cell's genome. The term "transgene" or ‘transgenicelement” refers in particular to a sequence that is not normally present in a given host genome inthe genetic context in which the sequence is currently found. In this respect, the sequence maybe native to the host genome, but be rearranged with respect to other genetic sequences within 75 the host genomic sequence. For example, the transgene is rearranged at a different locus ascompared to the native gene.Said one or more transgenic element(s) enable the expression of polypeptides whichconfer resistance against broomrape to the plant, as compared to the parent plant which does not5 comprise the transgenic element.A particular transgenic element is the recombinant nucleic acid as defined above, forexample a gene represented by SEQ ID NO: 70 to SEQ ID NO: 103 or a nucleic acid having atleast 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQID NO: 103, as defined above. In specific embodiments, a transgenic element includes a nucleic10 acid comprising at least one of the above-mentioned resistance genes under the control of aconstitutive promoter, such as the ZmUbi or AtUbi promoter.Recombinant nucleic acids for use in transforming Helianthus plantsSuch nucleic acids corresponding to the candidate resistance gene as defined above are15 also useful to transform or genetically modify Helianthus plants, in particular a Helianthus plantwhich does not have one or more of resistance gene for broomrape control in its genome.Another aspect of the present disclosure relates to a vector for use in transforming aHelianthus plant, comprising one or more of the nucleic acids corresponding to the candidateresistance gene as described above. In a specific embodiment, the present disclosure relates to20 a vector comprising at least a nucleic acid chosen among SEQ ID NO: 70 to SEQ ID NO: 103 ora nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity tosaid SEQ ID NO: 70 to SEQ ID NO: 103.Vectors for use in transforming Helianthus plant include at least the coding sequence ofthe corresponding protein (either naturally occurring coding sequence, or improved sequence,25 such as codon optimized sequence), such coding sequence being operably linked to a regulatoryelement such as a promoter.The term “promoter” as used herein refers to a region of DNA upstream of the codingsequence (upstream of start codon) and including DNA regions for recognition and binding ofRNA polymerase and other proteins to initiate transcription at the start codon. Examples of30 constitutive promoters useful for expression include the 35S promoter or the 19S promoter (Kayet al, 1987), the rice actin promoter (McElroy et al, 1990), the pCRV promoter (Depigny-This etal, 1992), the CsVMV promoter (Verdaguer et al. 1996), the ubiquitin 1 promoter of maize(Christensen and Quail, 1996), the regulatory sequences of the T-DNA of Agrobacteriumtumefaciens, including mannopine synthase, nopaline synthase, octopine synthase. 76 Promoters may be « tissue-preferred », i.e. initiating transcription in certain tissues or“tissue-specific”, i.e. initiating transcription only in certain tissues. Examples of such promotersare DHN12, LTR1, LTP1 that are specific for the embryo, SS1 for the phloem, OSG6B for thetapetum (Gotz et al 2011 and Jones 2015).5 Other suitable promoters could be used, such as an inducible promoter or adevelopmentally regulated promoter. An “inducible” promoter initiates transcription under some environmental control or any stress-induced like for example the abiotic stress-induced RD29, COR14b (Gotz et al, 2011). In specific embodiments, the nucleic acids corresponding to the candidate resistance10 genes as defined above are operably linked to heterologous promoters, i.e. a promoter which isnot the natural promoter of the corresponding nucleic acids as found in Helianthus plant. The vector may further comprise additional elements including a selectable marker gene,operably linked to regulatory element, that allows to select the transformed plant cells containing the vector, comprising the nucleic acids of the present disclosure as transgene. 15 In a specific embodiment, the vector according to the present disclosure may be a vector suitable for Agrobacterium-mediated transformation, in particular Agrobacterium tumefaciens or Agrobacterium rhizogenes mediated transformation, as described in the section below.Methods for producing a Helianthus plant, including a transgenic plant20 The present disclosure also relates to new methods to produce Helianthus plants withresistance to broomrape as herein described.In one embodiment, said method for producing a Helianthus hybrid plant or plant partcomprises the steps of:a. crossing a first Helianthus plant with a second Helianthus plant according to the25 present disclosure, e.g. Helianthus plant or plant part comprising a locus forbroomrape resistance (QTL interval for broomrape resistance), wherein said locusis located within the chromosomal interval between markers HS249258 of SEQ IDNO:15 and HS405261 of SEQ ID NO:1.b. collecting the hybrid seed;30 c. optionally detecting the resistance level of the hybrid seed.In a specific embodiment of said method, the second Helianthus plant has a locus (QTLinterval) for broomrape resistance characterized by the presence of one or more of the nucleotidepolymorphisms (SNPs) associated to the resistance allele as depicted in Table 1. 77 In a specific embodiment of said method, the first plant comprises at least one locus ofresistance to others race of orobanche (such as Or5, Or7 or OrDeb2).Any Helianthus plant can be used as the first Helianthus plant. Said first plant can beresistant against broomrape or can be tolerant against broomrape.5 In a specific embodiment, said method for producing a Helianthus hybrid plant or plantpart comprises the steps of:a. crossing a first Helianthus plant according to the present disclosure, e.g.Helianthus plant or plant part comprising a locus for broomrape resistance (QTLinterval for broomrape resistance), wherein said locus is located within the10 chromosomal interval between markers HS249258 of SEQ ID NO:15 andHS405261 of SEQ ID NO:1 with a second Helianthus plant according to thepresent disclosure, e.g. Helianthus plant or plant part comprising a locus forbroomrape resistance (QTL interval for broomrape resistance), wherein said locusis located within the chromosomal interval between markers HS249258 of SEQ ID15 NO:15 and HS405261 of SEQ ID NO:1.b. collecting the hybrid seed;c. optionally detecting the resistance level of the hybrid seed.The above-mentioned methods can also comprise, after step b), a step of obtaininghomozygous plants or plant parts.20 In a specific embodiment, the above-mentioned methods can further comprise a step ofgenotyping one or more nucleotide polymorphisms (SNPs) associated to the resistance allelewithin the chromosomal interval between markers HS249258 of SEQ ID NO:15 and HS405261of SEQ ID NO:1 in the seed or progeny plants. Preferably, the step of genotyping comprises thedetermination of the genotype of one or more of the SNPs as described in Table 1 in the hybrid25 seed or progeny plants, for example all the SNPs as described in Table 1.In another embodiment, a method for producing a Helianthus plant or plant part accordingto the disclosure comprises the following steps:a. providing a first Helianthus plant comprising one or more nucleotidepolymorphisms (SNPs) associated to the resistance allele within the chromosomal30 interval between markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ IDNO:1; b. crossing said first Helianthus plant with a second Helianthus plant comprising oneor more nucleotide polymorphism (SNPs) associated to the resistance allele within 78 the chromosomal interval between markers HS249258 of SEQ ID NO:15 andHS405261 of SEQ ID NO:1;c. collecting the F1 hybrid seed;d. obtaining homozygous plants or plant part from the F1 plants;5 e. genotyping said one or more nucleotide polymorphisms (SNPs) associated to theresistance allele within the chromosomal interval between markers HS249258 ofSEQ ID NO:15 and HS405261 of SEQ ID NO:1 in the hybrid seed and / or at eachgeneration. In another embodiment, a method for producing a Helianthus plant or plant part resistant10 to broomrape comprises the following step:a. genotyping a Helianthus plant using markers located within the chromosomalinterval between markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ IDNO:1; b. selecting a Helianthus plant comprising one or more nucleotide polymorphisms15 (SNPs) associated to the resistance allele within said chromosomal interval;c. crossing said first Helianthus plant with a second Helianthus plant;d. collecting the F1 hybrid seed;e. obtaining homozygous plants or plant part from the F1 plants;f. genotyping said one or more nucleotide polymorphisms (SNPs) associated to the20 resistance allele within the chromosomal interval between markers HS249258 ofSEQ ID NO:15 and HS405261 of SEQ ID NO:1 in the hybrid seed and / or at eachgeneration. In another embodiment, the present disclosure relates to a method for producing aHelianthus plant or plant part resistant to broomrape, said method comprising the following step:25 a. providing a first Helianthus plant comprising one or more nucleotidepolymorphisms (SNPs) associated to the resistance allele within thechromosomal interval between markers HS249258 of SEQ ID NO:15 andHS405261 of SEQ ID NO:1;b. crossing said first Helianthus plant with a second Helianthus plant;30 c. collecting the F1 hybrid seed;d. obtaining homozygous plants from the F1 plants;e. genotyping said one or more nucleotide polymorphisms (SNPs) associated to theresistance allele within the chromosomal interval between markers HS249258 of 79 SEQ ID NO:15 and HS405261 of SEQ ID NO:1 in the hybrid seed and / or at eachgeneration. In another embodiment, the present disclosure relates to a method for producing aHelianthus plant or plant part resistant to broomrape, said method comprising the following steps:5 a. crossing a first Helianthus plant comprising one or more nucleotidepolymorphisms (SNPs) associated to the resistance allele within thechromosomal interval between markers HS249258 of SEQ ID NO:15 andHS405261 of SEQ ID NO:1 with a second Helianthus (sunflower) plant; therebyobtaining a F1 hybrid plant;10 b. backcrossing said F1 hybrid with the second Helianthus plant;c. selecting the Helianthus plant resistant to broomrape among the Helianthus plantobtained in step b) by genotyping one or more nucleotide polymorphisms (SNPs)associated to the resistance allele within the chromosomal interval betweenmarkers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1.15 In a specific embodiment of the above-mentioned methods, the step of genotyping one ormore nucleotide polymorphisms (SNPs) associated to the resistance allele is a step of genotypingone or more of SNPs associated to the resistance allele as described in Table 1 in the hybridseed and / or at each generation, for example all said SNPs associated to the resistance allele asdescribed in Table 1. Preferably, the step of genotyping one or more of SNPs associated to the20 resistance allele is a step of detecting the following genotype: “G” of SNP1, “A” of SNP2, “G” ofSNP3, “C” of SNP4, “G” of SNP5, “G” of SNP6, “G” of SNP7, “G” of SNP8, “A” of SNP9, “T” ofSNP10, “C” of SNP11, “A” of SNP12, “C” of SNP13, “T” of SNP14 “C” of SNP15, as described inTable 1.In a specific embodiment of the above-mentioned methods, the first plant and / or the25 second plant is a plant obtained from representative sample of the seeds as deposited at NCIMBcollection under the number NCIMB 44327.In a specific embodiment of the above-mentioned methods, said method further comprisesone or more steps of backcrossing the Helianthus plant selected in step c) with the secondHelianthus plant and further selecting the Helianthus plant resistant to broomrape among the30 obtained Helianthus plant by genotyping one or more nucleotide polymorphisms (SNPs)associated to the resistance allele within the chromosomal interval between markers HS249258of SEQ ID NO: 15 and HS405261 of SEQ ID NO: 1. 80 Another aspect of the present disclosure relates to the use of the above-described nucleicacids (corresponding to candidate resistance genes) for producing transgenic Helianthus plantsexhibiting resistance against broomrape.The term "transgenic plant" refers to a plant comprising such a transgene. A "transgenic5 plant" includes a plant, plant part, a plant cell, a plant tissue or seed whose genome has beenaltered by the stable integration of recombinant DNA. A transgenic plant includes a plantregenerated from an originally-transformed plant cell and progeny transgenic plants from latergenerations or crosses of a transformed plant. As a result of such genomic alteration, thetransgenic plant is distinctly different from the related wild-type plant. An example of a transgenic10 plant is a plant described herein as comprising one or more of the nucleic acids chosen amongSEQ ID NO: 70 to SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%,97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO: 103, typically as transgenicelements. For example, the transgenic plant includes one or more nucleic acids chosen amongSEQ ID NO: 70 to SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%,15 97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO: 103, as transgene, insertedat loci different from the native locus of the corresponding gene(s).In a specific embodiment, it is herein disclosed a method for producing a Helianthustransgenic plant, wherein the method comprises the steps of:(i) transforming a parent Helianthus plant with one or more nucleic acid(s) chosen among20 SEQ ID NO: 70 to SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%,97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO: 103,(ii) selecting a plant, comprising said one or more nucleic acid(s) as transgene(s),(iii) regenerating and(iv) growing said Helianthus transgenic plant.25 For transformation methods of a plant cell, one can cite methods of direct transfer of DNAsuch as direct micro-injection into plant embryos, vacuum infiltration or electroporation, directprecipitation by means of PEG or the bombardment by gun of particles covered with the plasmidDNA of interest.30 It is preferred to transform the plant cell with a bacterial strain, in particular Agrobacterium,in particular Agrobacterium tumefaciens. Descriptions of Agrobacterium vector systems andmethods for Agrobacterium-mediated gene transfer are provided by Moloney et al., Plant CellReports 8:238 (1989). See also, U.S. Pat. No. 5,591,616 issued Jan. 7, 1997. 81 Alternatively, direct gene transfer may be used. A generally applicable method of planttransformation is microprojectile-mediated transformation wherein DNA is carried on the surfaceof microprojectiles measuring 1 to 4 micron. The expression vector is introduced into plant tissueswith a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m / s which is5 sufficient to penetrate plant cell walls and membranes. Sanford et al., Part. Sci. Technol. 5:27(1987), Sanford, J. C., Trends Biotech. 6:299 (1988), Klein et al., BioTechnology 6:559-563(1988), Sanford, J. C., Physiol Plant 7:206 (1990), Klein et al., BioTechnology 10:268 (1992).Several target tissues can be bombarded with DNA-coated microprojectiles in order to producetransgenic plants, including, for example, callus (Type I or Type II), immature embryos, and10 meristematic tissue.Following transformation of Helianthus target tissues, expression of the selectable markergenes allows for preferential selection of transformed cells, tissues and / or plants, usingregeneration and selection methods now well known in the art.The foregoing methods for transformation would typically be used for producing a15 transgenic plant including one or more nucleic acids chosen among SEQ ID NO: 70 to SEQ IDNO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to said SEQ ID NO: 70-SEQ ID NO: 103, as transgenic element(s).The transgenic plant could then be crossed, with another (non-transformed ortransformed) plant to transmit the transgenic trait to progeny generations. Thus, in particular, said20 progeny comprises a transgene corresponding to a broomrape resistance allele as abovedescribed. Alternatively, a transgenetic trait which has been engineered into a particular line usingthe foregoing transformation techniques could be moved into another line using traditionalbackcrossing techniques that are well known in the plant breeding arts. For example, a25 backcrossing approach could be used to move an engineered trait from a public, non-elite inbredline into an elite inbred line, or from an inbred line containing a foreign gene in its genome into aninbred line or lines which do not contain that gene. As used herein, “crossing” can refer to a simpleX by Y cross, or the process of backcrossing, depending on the context.When the term transgenic Helianthus plant is used in the context of the present disclosure,30 this also includes any Helianthus plant including, as a transgenic element, one or more nucleicacids chosen among SEQ ID NO: 70 to SEQ ID NO: 103 or a nucleic acid having at least 95%identity, preferably 96%, 97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO:103, and wherein one or more desired traits have further been introduced through backcrossingmethods, whether such trait is a naturally occurring one or a transgenic one. Backcrossing 82 methods can be used with the present invention to improve or introduce one or morecharacteristic(s) into the inbred. The term backcrossing as used herein refers to the repeatedcrossing of a hybrid progeny back to one of the parental Helianthus lines. The parental Helianthusplant which contributes the gene or the genes for the desired characteristic is termed the non-5 recurrent or donor parent. This terminology refers to the fact that the non-recurrent parent is usedone time in the backcross protocol and therefore does not recur. The parental Helianthus plant towhich the gene or genes from the non-recurrent parent are transferred is known as the recurrentparent as it is used for several rounds in the backcrossing protocol.In a typical backcross protocol, the recurrent parent is crossed to a second non-recurrent10 parent that carries the gene or genes of interest to be transferred. The resulting progeny from thiscross are then crossed again to the recurrent parent and the process is repeated until a Helianthusplant is obtained wherein all the desired morphological and physiological characteristics of therecurrent parent are recovered in the converted plant in addition to the gene or genes of interesttransferred from the non-recurrent parent.15 Transgenesis in sunflower has been described in the following publications and thedescribed methods can be used to obtain transgenic plants according to the present disclosure.- Müller, A., Iser, M. & Hess, D. Stable transformation of sunflower (Helianthus annuus L.)using a non-meristematic regeneration protocol and green fluorescent protein as a vitalmarker. Transgenic Res 10, 435–444 (2001). https: / / doi.org / 10.1023 / A:101202903257220 - K. SANKARA RAO, V. K. ROHINI, Agrobacterium -mediated Transformation ofSunflower (Helianthus annuus L.): A Simple Protocol, Annals of Botany, Volume 83, Issue 4, April1999, Pages 347–354, https: / / doi.org / 10.1006 / anbo.1998.0828- Knittel, N., Gruber, V., Hahne, G. et al. Transformation of sunflower (Helianthusannuus L.): a reliable protocol. Plant Cell Reports 14, 81–86 (1994).25 https: / / doi.org / 10.1007 / BF00233766 -Hewezi, T., Alibert, G., Kallerhoff, J. (2004). Genetic Transformation of Sunflower(Helianthus Annuus L.). In: Curtis, I.S. (eds) Transgenic Crops of the World. Springer, Dordrecht.https: / / doi.org / 10.1007 / 978-1-4020-2333-0_32 -Liu, H., Xie, X.J., Sun, S., Zhu, W., Ji, J., & Wang, G. (2011). Optimization of30 Agrobacterium-mediated transformation of sunflower (Helianthus annuus L.) immatureembryos. Australian Journal of Crop Science, 5, 1616-1621.- Weber, S., Friedt, W., Landes, N. et al. Improved Agrobacterium -mediatedtransformation of sunflower (Helianthus annuus L.): assessment of macerating enzymes andsonication. Plant Cell Rep 21, 475–482 (2003). https: / / doi.org / 10.1007 / s00299-002-0548-7 83 -Sujatha, M., Vijay, S., Vasavi, S. et al. Agrobacterium-mediated transformation ofcotyledons of mature seeds of multiple genotypes of sunflower (Helianthus annuus L.). Plant CellTiss Organ Cult 110, 275–287 (2012). https: / / doi.org / 10.1007 / s11240-012-0149-25 Plant obtained according to the present disclosureA sample of seeds of the Helianthus plant disclosed herein, with said resistance againstbroomrape, has been deposited under the Budapest treaty, at NCIMB collection under the numberNCIMB 44327 on January 18, 2024 by Innolea (whose address is Domaine de Sandreau, 31700Mondonville, France). International depositary authority is NCIMB Ltd. Wellheads Place,10 Aberdeen, Dyce, AB217GB Scotland).Therefore, the present disclosure also relates to seeds, hybrid plants and progeny of plantobtained from representative sample of the seeds as deposited at NCIMB collection under thenumber NCIMB 44327.Another aspect of the present disclosure relates to a Helianthus plant or plant part or15 progeny of the plant as obtained by the method described previously. In particular, said progenycomprises a transgene corresponding to a broomrape resistance allele as above described.The transgenic plants of the present disclosure may advantageously be used as parentplant in order to produce another transgenic Helianthus plant. In a specific embodiment, atransgenic Helianthus plant according to the present disclosure comprises a combination of at20 least two different transgenic elements selected from the group consisting of one or more nucleicacid chosen among SEQ ID NO: 70 to SEQ ID NO: 103 or a nucleic acid having at least 95%identity, preferably 96%, 97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO:103. The transgenic Helianthus plant as disclosed herein may express such resistance gene(s)25 together as the result of the transgene’s expression and may additionally express other resistancegene(s), as the result of naturally occurring alleles.In one embodiment, said combination of one or more nucleic acid chosen among SEQ IDNO: 70 to SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to said SEQ ID NO: 70-SEQ ID NO: 103 is found in the same locus30 in the genome of the transgenic plant. In other embodiments, the corresponding nucleic acids ofthe combination are located in distinct loci. In one specific embodiment, said combination may beobtained by crossing transgenic plants of the present disclosure each bearing one nucleic acid ofthe combination as a transgene at a distinct locus. 84 In a specific embodiment, the Helianthus plant or plant part of the invention has abroomrape resistance which is higher than a parent Helianthus (sunflower) plant.Means for detecting SNP markers5 More generally, it is disclosed herein the specific means for detecting the resistancebroomrape allele of the in a plant, more specifically a Helianthus plant.Said means include any means for genotyping one or more nucleotide polymorphisms(SNPs) associated to broomrape resistance in a Helianthus (sunflower) plant or plant part withinone or more of the following markers: SEQ ID NO:1 to SEQ ID NO:15. Preferably, said means10 include any means suitable for detecting the above-mentioned SNPs (as depicted in Tables 1 or2) within one or more of the following markers: SEQ ID NO:1-15.In specific embodiment, the means consists of a nucleic acid probe, a primer or a set ofprimers or combinations thereof.Any method known in the art may be used in the art to assess the presence or absence15 of a SNP. Some suitable methods include, but are not limited to, sequencing, hybridizationassays, polymerase chain reaction (PCR), ligase chain reaction (LCR), and genotyping-by-sequence (GBS), or combinations thereof.Different PCR based methods are available to the person skilled of the art. One can usethe RT-PCR method or the Kaspar method from KBioscience (LGC Group, Teddington,20 Middlesex, UK).The KASP™ genotyping system uses three target specific primers: two primers, each ofthem being specific of each allelic form of the SNPs (Single Nucleotide Polymorpshism) and oneother primer to achieve reverse amplification, which is shared by both allelic form. Each targetspecific primer also presents a tail sequence that corresponds with one of two FRET probes: one25 label with FAM® dye and the other with HEX® dye.Successive PCR reactions are performed, the last one presence of the probesamplification. The nature of the emitted fluorescence is used to identify the allelic form or formspresent in the mix from the studied DNA.The primers identified in Table 4 are particularly suitable for use with the KASP™30 genotyping system. Of course, the skilled person may use variant primers or nucleic acid probesof the primers as identified in Table 4, said variant primers or nucleic acid probes having at least90%, and preferably 95% sequence identity with any one of the primers as identified in Table 4,or with the DNA genomic fragment amplified by the corresponding set of primers as identified inTable 4. 85 As used herein, a primer encompasses any nucleic acid that is capable of priming thesynthesis of a nascent nucleic acid in a template-dependent process, such as PCR. Typically,primers are oligonucleotides from 10 to 30 nucleotides, but longer sequences can be employed.Primers may be provided in double-stranded form though single-stranded form is preferred.5 Alternatively, nucleic acid probe can be used. Nucleic acid probe encompasses any nucleic acidof at least 30 nucleotides and which can specifically hybridizes under standard stringentconditions with a defined nucleic acid. Standard stringent conditions as used herein refers toconditions for hybridization described for example in Sambrook et al 1989 which can comprise 1)immobilizing plant genomic DNA fragments or library DNA on a filter 2) prehybridizing the filter for10 1 to 2 hours at 65°C in 6x SSC 5x Denhardt’s reagent, 0.5% SDS and 20mg / ml denatured carrierDNA 3) adding the probe (labeled) 4) incubating for 16 to 24 hours 5) washing the filter once for30min at 68°C in 6x SSC, 0.1% SDS 6) washing the filter three times (two times for 30min in 30mland once for 10 min in 500ml) at 68°C in 2x SSC 0.1% SDS.In a specific embodiment, the means according to the present disclosure consist of one15 or more primers including any one of: SEQ ID NO: 16 to SEQ ID NO:69. In a specific embodiment,said primers for detecting the SNP markers of the present disclosure are as listed in the followingTable 4.In a specific embodiment, the disclosure also provides a genotyping kit for detecting oneor more nucleotide polymorphisms (SNPs) associated to a broomrape resistance allele, as20 mentioned in Table 1, the kit comprising SEQ ID NO: 16 to SEQ ID NO: 69. Each SNP can beidentified using three primers, respectively SEQ ID NO: 16 to SEQ ID NO: 18; SEQ ID NO: 19 toSEQ ID NO: 21; SEQ ID NO: 22 to SEQ ID NO: 24; SEQ ID NO: 25 to SEQ ID NO: 27; SEQ IDNO; 28 to SEQ ID NO: 30; SEQ ID NO: 31 to SEQ ID NO: 33; SEQ ID NO: 34 to SEQ ID NO: 36;SEQ ID NO; 37 to SEQ ID NO: 39; SEQ ID NO: 40 to SEQ ID NO: 42; SEQ ID NO: 43 to SEQ ID25 NO: 45; SEQ ID NO: 46 to SEQ ID NO: 48; SEQ ID NO; 49 to SEQ ID NO: 51; SEQ ID NO: 52 toSEQ ID NO: 54; SEQ ID NO: 55 to SEQ ID NO: 57; SEQ ID NO: 58 to SEQ ID NO: 60; SEQ IDNO; 61 to SEQ ID NO: 63; SEQ ID NO: 64 to SEQ ID NO: 66; and / or SEQ ID NO: 67 to SEQ IDNO: 69.The disclosure also pertains to the use of said genotyping kit, for following the30 introgression of a quantitative trait locus for broomrape resistance in a line, wherein said locus islocated in a chromosomal region which includes the markers HS249258 of SEQ ID NO: 15 andHS405261 of SEQ ID NO: 1. This kit is then useful to follow the introgression of the QTL of interesteach time a new line is obtained. Said kit can also be used for following intogression in a line 86 which already contains at least one locus of resistance to others race of orobanche (such as Or5,Or7 or OrDeb2).In a specific embodiment, the disclosure also provides a diagnostic kit comprising SEQID NO; 28 to SEQ ID NO: 30 and / or SEQ ID NO: 52 to SEQ ID NO: 54. Such diagnostic kit can5 be used for the diagnosis of the broomrape resistance allele disclosed herein in breedingpopulations of sunflower. The disclosure also pertains to the use of said diagnostic kit to identitythe resistance allele against broomrape in homozygous and / or heterozygous plants.Table 4: Primers for use in detecting broomrape resistance SNP markers of the invention (as10 indicated in the primer name) 87 88 The present disclosure also pertains to the use of a Helianthus plant or plant part accordingas mentioned above, identified according to any one of the methods as mentioned above, orobtained by the above-mentioned methods for food application, for feed application or for5 breeding application.Helianthus plants disclosed herein are further useful for example for producing oils. Seedsharvested from plants described herein can be used to make a crude oil or a refined, bleached,deodorized (RBD) oil. Harvested seed can be crushed by techniques known in the art.The Helianthus plants or their oil are also useful as food compositions, for human or10 animal. The oil may also be used in biofuel.Stacking of resistanceThe present disclosure also pertains to a method of identifying a Helianthus plantcomprising at least the resistance locus of Or5 and the locus disclosed herein, located within the15 chromosomal interval between markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ IDNO:1. The present disclosure also pertains to a method of identifying a plant comprising at leastthe resistance locus of Or7 and the locus disclosed herein, located within the chromosomalinterval between markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1. 89 The present disclosure also pertains to a method of identifying a plant comprising at leastthe resistance locus of OrDeb2 and the locus disclosed herein, located within the chromosomalinterval between markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1.The present disclosure also pertains to a method of identifying a plant comprising at least5 the resistance locus of Or5, the resistance locus of Or7, the resistance locus of OrDeb2 and thelocus disclosed herein, located within the chromosomal interval between markers HS249258 ofSEQ ID NO:15 and HS405261 of SEQ ID NO:1.The present disclosure also pertains to a Helianthus plant comprising at least theresistance locus of Or5 and one or more nucleic acid chosen among SEQ ID NO: 70 to SEQ ID10 NO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%identity to said SEQ ID NO: 70-SEQ ID NO: 103.The present disclosure also pertains to a Helianthus plant comprising at least theresistance locus of Or7 and one or more nucleic acid chosen among SEQ ID NO: 70 to SEQ IDNO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or 100%15 identity to said SEQ ID NO: 70-SEQ ID NO: 103.The present disclosure also pertains to a Helianthus plant comprising at least theresistance locus of OrDeb2 and one or more nucleic acid chosen among SEQ ID NO: 70 to SEQID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%, 98%, 99% or100% identity to said SEQ ID NO: 70-SEQ ID NO: 103.20 The present disclosure also pertains to a Helianthus plant comprising at least theresistance locus of Or5, the resistance locus of Or7, the resistance locus of OrDeb2 and one ormore nucleic acid chosen among SEQ ID NO: 70 to SEQ ID NO: 103 or a nucleic acid having atleast 95% identity, preferably 96%, 97%, 98%, 99% or 100% identity to said SEQ ID NO: 70-SEQID NO: 103.25 Use of SNPs and primers for quality control of seedsThe present disclosure also deals with methods of quality control of seeds in order toretain seeds that contain the locus of interest, i. e. the locus located in a chromosomal regionwhich includes the markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1.30 In a particular aspect, the present disclosure deals with the use of one or more of theSNPs herein described in SEQ ID NO:1 to SEQ ID NO: 15, as well as primers to detect at leastone of these SNPs, for quality control of batches of seeds, in order to select the seeds comprisingthe quantitative trait loci (QTL) associated to broomrape resistance. 90 In particular, each SNP can be identified using three primers, respectively SEQ ID NO: 16to SEQ ID NO: 18; SEQ ID NO: 19 to SEQ ID NO: 21; SEQ ID NO: 22 to SEQ ID NO: 24; SEQID NO: 25 to SEQ ID NO: 27; SEQ ID NO; 28 to SEQ ID NO: 30; SEQ ID NO: 31 to SEQ ID NO:33; SEQ ID NO: 34 to SEQ ID NO: 36; SEQ ID NO; 37 to SEQ ID NO: 39; SEQ ID NO: 40 to SEQ5 ID NO: 42; SEQ ID NO: 43 to SEQ ID NO: 45; SEQ ID NO: 46 to SEQ ID NO: 48; SEQ ID NO;49 to SEQ ID NO: 51; SEQ ID NO: 52 to SEQ ID NO: 54; SEQ ID NO: 55 to SEQ ID NO: 57; SEQID NO: 58 to SEQ ID NO: 60; SEQ ID NO; 61 to SEQ ID NO: 63; SEQ ID NO: 64 to SEQ ID NO:66; and / or SEQ ID NO: 67 to SEQ ID NO: 69.10 Application WO2020 / 025554 describes methods that make it possible to carry out a qualitycontrol of seed lots, on several different traits (varietal purity, specific purity, agronomiccharacteristics contamination by pathogens), in a single step, and by quantifying the presence ofsome of the unwanted traits or contaminants.Control quality may be carried out by detecting the presence of contaminants,15 characterized by the absence of the locus of interest, and / of by detecting the presence of thelocus of interest in the seeds.In particular, the present disclosure relates to a method for determining the presence ofsaid QTL associated to broomrape resistance in a seeds lot of Helianthus plant, characterized in20 that: a) the seeds of a seed lot are grouped by sub-lots of at least 10 seeds, the number ofsub-lots thus obtained being greater than or equal to 10b) a targeted sequencing is carried out for each sub-lot for at least the region of the seedgenome containing the locus of interest,25 c) the presence of said QTL is qualitatively determined for each sub-lot,d) the quantity of QTL in the overall batch is determined by the compilation of thequalitative results obtained for all of the sub-lots.In particular, the sequencing of step b) is carried out on the DNA extracted from the seeds30 present in a sublot, the region of the genome of the seeds containing the locus of interest beingoptionally amplified.In particular, a batch is declared as containing said QTL if one observes the presence ofone or more of said SNPs at the locus of interest. 91 In particular, the batch is considered to be compliant if the line frequency is greater than90% in the seed batch.Application WO2015110472A1 and patent EP3097398B1 describe such methods of5 sampling and analyzing seed tissue.In particular, said samples of seeds are obtained from a method of sampling and analyzingseed tissue, comprising the steps of:- have one or more seeds to analyze,- optionally soak the seed with water so as to soften it and allow the next step,10 - manually or semi-automatically collecting a determined volume of sample of the seed(s),using an outline cutter designed to cut, carry away and then release a determined volumeof tissue, this volume being determined to allow the analysis of at least one constituent ofthe seed(s).Then, the tissue sample of a single seed or several seeds is placed in an identified and15 traceable well, and step b), c) and d) of the above method are performed. Genotyping analysis iscarried on the contents of the wells.It is thus possible to determine the sample(s) with the desired genomic trait(s), andoptionally sow the selected seed(s) corresponding to those samples that have the desiredgenomic trait(s).20 In particular, said sample of the seed is from the albumen or cotyledon of the seed(s).EXAMPLES25 identification of a new QTL for resistance to broomrape1 Materials and Methods1.1 QTL mapping30 Plant Materials. An F2 mapping population consisting of 300 individuals was developed startingfrom a cross between parental lines 2603 and. LT_98MOL_MLG_010_43 (LT_98MOL).LT_98MOL is a fixed line derived from a plant resistant to race F (Cordoba region, Spain) selectedfrom the genetic pool referred to as “98MOL” that was developed by INRAE Montpellier in 1998by the interspecific crosses between H. annuus ssp. annuus (CmsHA89, 90HR15), Helianthus 92 mollis (CL11) and Helianthus argophyllus (AA7.2.4). This pool is maintained and distributed bythe French genetic resources collection at INRAE Toulouse (CRB) (crb.tournesol-toulouse@inrae.fr). Parental line 2603 is susceptible to all broomrape races currently observedin Europe (Fernandez-Martinez et al. (2012); Molinero-Ruiz et al. (2014); Fernandez-Martinez et5 al. (2006); Alcantara et al. (2006)) and is also maintained by the CRB.The broomrape populations (Br0075 and Br0080) used in this study were collected in southernSpain, Cordoba region in 2012 and 2019. The virulence profile of the population has beenevaluated in controlled conditions using a differential set of host genotypes carrying knownresistance genes (Fernandez-Melero et al. (2023); Nabloussi et al. (2023); Calderon-Gonzalez et10 al. (2023). The differential set used in this study was composed of the fully susceptible controlline LT_S, line LT_IS carrying the Or5 resistance gene that confers resistance to race E; LT_Or7carrying Or7 conferring resistance to race F and LT_32 carrying Or5 in combination with Or7 thatis resistant to race G (Figure 1). The levels of resistance are presumed to be cumulative,suggesting that resistance to race G also provides protection to less virulent races such as race15 E and F. Based on the virulence profiles observed on the differential set, both populations Br0075and Br0080 have been classified as race F.According to the assays conducted in this study, the host genotypes composing the differentialset were included as controls supplemented with line LT-DEB2 that is resistant to race G by virtueof the Deb02 resistance gene.20 Phenotyping in controlled conditions. The F2 population (n=300) was evaluated for broomraperesistance against isolate Br0075 under controlled conditions on the proprietary screeningplatform referred to as Oroscreen® (Besset, Porqueras, (2016).Artificial inoculation with broomrape was achieved by planting 2 days old seedling in tube pots of25 100 ml containing a mixture of sieved potting soil and 60 mg of broomrape per liter substrate.Plants were grown at 25°C / 18°C (day / night) with 16h of photoperiod. Checks consisted of controlline LT_S, LT_IS and LT-32.Five weeks after sowing the plants were uprooted to assess the presence and the size ofbroomrape nodules attached to the roots based on a 0 to 5 scale (Figure 2). Several disease30 indicators were recorded such as the total number of nodules attached (Total tubercules: TT), thenumber of necrosed nodules (Necrosed Tubercules: NT) and the minimum (Stage Minimum:Smin), maximum (Stage Maximum: Smax) and most observed (Stage most frequent: Sfreq)nodule size. Additional variables like the number of healthy tubercules (Healthy tubercules: HT)and the aggressivity of infection (NOTE.AGRESSIVITY) were calculated as follow: 93 HT = TT − NT (1)NOTE. AGRESSIVITY = Sfreq ∗ HT (2)The maximum count of TT for the most sensitive plants was fixed at 20 for convenience of scoring. 5 Genotyping. Genomic DNA was extracted from leaf tissue using the DNeasy 96 plant extractionkit from Qiagen ©. The genotyping experiments were performed using a proprietary AXIOM arrayfrom Affymetrix (11927 SNPs) and following the supplier’s instructions.The obtained genotypes were filtered according to the following criteria: (a) monomorphic SNPs;10 (b) SNPs showing more than 10% missing data; (c) SNPs showing heterozygous genotypes inadequation to an F2 segregating population that is between 40 to 60%. Thirteen F2 individualswere removed from the analysis due to abnormal percentages of heterozygous markers (below10%). Finally, 4489 SNPs and 286 F2 individuals were used for further analysis.The genetic map was calculated using the Minimum Spanning Tree (MST) algorithm (Wu et al.15 (2008)) included in the AsMap R package (Taylor et al. (2017)). To separate markers into linkagegroups, a threshold of 1x10-15 was applied for the p-value. The Kosambi mapping function wasused to transform recombination frequencies between markers into centimorgans (cM). The finalgenetic map contains 4459 markers on 17 linkage groups and a total size of 1655 cM. Eachchromosome displays about 260 markers with a mean distance of 0.74 cM. For the QTL analysis20 a subset of 2232 loci were selected by consolidating co-locating markers.QTL Mapping. The QTL detection was performed using MCQTL (Jourjon et al. (2005)) on 6 ofthe variables previously cited: TT, HT, Sfreq, Smin, Smax, NOTE.AGRESSIVITY. The genome-wide LOD thresholds level were obtained using a type error rate of 1 % and running 100025 permutations for each trait. Biomercator (Arcade et al. (2004)) was used to visualize the QTLs.1.2 Fine-Mapping of the QTL on LG14Fine-mapping. For the purpose of fine-mapping 11113 additional F2 individuals were produced30 for the cross between 2603 and LT_98MOL.Successive rounds of genotyping with a selection ofmarkers mapping to the QTL interval resulted in the identification of a large number ofrecombinant F2 plants. In total 177 recombination events were selected for their distribution orposition across the QTL interval and the corresponding F2 plants were selfed to produce F3offspring. For each F3 family 12 plants were genotyped with a selection of markers from the QTL 94 interval and evaluated for resistance to broomrape on the proprietary Oroscreen® platform asdescribed before.SNP discovery and Marker Development. Polymorphic SNPs mapping to the QTL interval as5 defined by the genetic map obtained using the Axiom genotyping data were converted to Kasparassays using routine protocols. The complete genomes of both parents were sequenced bymeans of the PacBio HiFi sequencing technology (3 SMRTCell) and a Bionano optical map (oneSaphyr flowcell). The average coverage was calculated at 17X and 28X for 2603 and LT_98MOLrespectively. The assembly of the genomes was achieved using the HiFiasm assembly pipeline10 and the Bionano Access hybrid-scaffolding pipeline yielding a total genome size of 3.01 and 3.03Gbp respectively and a N50 of 176.73 Mbp and 176.36 Mbp respectively. Variant calling using theLongshot (Edge, Bansal (2019)) and SyRI (Synteny and Rearrangement Identifier) (Goel et al.(2019)) software packages allowed for the discovery of additional SNPs and PAVs that likewisewere converted to Kaspar assays to increase the marker density at the QTL interval.15 Genomic characterization and Gene annotations. Genetic markers from the QTL interval werephysically mapped on the LT_98MOL genome using a 90% cut-off value for sequence identityand 80% for the covering threshold of the corresponding footprints of approximately 200 bp inlength. Structural and functional annotations of both the 2603 and the LT_MOL98 genome were20 obtained using the AUGUSTUS (Stanke M, Morgenstern B (2005)) and eggNOG softwarerespectively (Huerta-Cepas et al. (2019)). For the detection of structural variations betweenLT_98MOL and reference genomes, the genome sequences were aligned using NUCMER(Marçais et al. (2018)) and the resulting alignments filtered for a minimal length of 100 bp and aminimal identity of 80%. Structural variations were identified using SyRI Goel et al. (2019)).25 Phenotypic characterization of the resistance conferred by the QTL on LG14 BC3S2 introgressionlines homozygous for the QTL on LG14 were developed starting from F1 individuals derived fromtwo crosses LT_S and LT_98MOL, and 2603 and LT_98MOL and using LT_S and 2603 asrecurrent parent respectively. The presence of the favorable allele from LT_98MOL wasmonitored using 9 diagnostic SNPs from the QTL interval. Four Near Isogenic Lines (NILs) with30 2603 background were selected and crossed with tester lines LT_Or7 and LT_DEB02 to producehybrids heterozygous for complementary resistance loci. Lines derived from the same BC3population but carrying the susceptible allele from 2603 were used as a negative control inphenotyping analyses. 95 The NILs and their derived hybrids were evaluated for resistance to broomrape in the field and onthe Oroscreen® platform against race F (Br0080). Lines LT_S, LT_IS or an equivalent lineLT_Or5, LT_98MOL and LT_Or7 were used as checks in both experimental designs. Hybridswere phenotyped in a field in the Rostov region in Russia infested with a very aggressive5 broomrape population classified as race G. When available, hybrid combinations between thechecks LT_S, LT_Or7 and LT_DEB02 were used as controls. In the field, broomrape infectionswere scored as the percentage of plants showing emerged broomrapes at their stem at maturityin rows comprising 25 plants in total.The resistance mechanism associated with the expression of QTL LG14 was assessed by10 rhizotron phenotyping as in Le Ru et al. (2021) with some modification. The evaluated materialincludes the donor line LT_98MOL and one NIL on LT_S background, along with control linesLT_S. For each rhizotron, 10 mg of O. cumana seeds (Br0080) were sterilized by dipping in 10ml of bleach water and then rinsed three times with sterile water. The seeds are spread on asterile glass fiber paper inside a petri dish and conserved one week at 21°C. In the meantime, the15 sunflower seeds are immersed in bleach water for 20 minutes and rinsed three times with sterilewater. Seeds are sown in corning tubes containing glass beads and sterile water, they areconserved at 23°C,8h light for 7 days. One week later, the glass fiber paper with broomrape seedsspread on it is placed on water-soaked autoclaved rockwool into the rhizotron which is a 12 x 12cm home-maid Plexiglas boxes. The sunflower seedlings are transferred to the fiber paper,20 distributing the roots as widely as possible. The rhizotrons were placed vertically in a growthchamber at 23°C with 60% humidity (16 h day) and watered with Long Ashton nutrient solution.About 10 rhizotrons per accessions were evaluated. Percentage of broomrape seeds germination(Pc_Germination) was evaluated at 14 day after infection (dai). Compatible (CA) or incompatibleattachments (IA) and the number of healthy (HT) were counted using a binocular at 14, 21, 2825 dai, 35 dai and 42 dai. The number of necrotic tubercules (NT) was evaluated at 35 and 42 dai.2 Results2.1 Mapping of the LG14 QTL onto chromosome 1430 QTL Mapping reveals one major QTL on LG14. Five weeks after inoculation, the susceptiblecontrols LT-S and LT-IS showed the expected susceptible reaction to race F with 13 respectively 19 tubercules on average and scored as stage 3 (Figure 3A & 3B) (Figure 1). Conversely, lineLT_32 did not show any tubercules attached to the roots which is consistent with its resistant phenotype due to the presence of Or7. (Figure 3B) No necrotic tubercules were observed on any 96 of the checks (Figure 3B). The F2 population showed a continuous quantitative resistance profile including highly susceptible (76 F2 with HT ≥ 10) and highly resistant (162 F2 with HT< 2) individuals (Figure 3C). The most frequent stage of nodule development for all F2 individuals was between 1 and 2. Contrary to the controls, necrotic tubercules were observed in 50% of the F2 5 plants showing broomrape attachment. Phenotypic and genotypic data were available for 286 F2 individuals. QTLs on 1 different linkagegroup was found to control the resistance to O. cumana race F (Figure 4A).The QTL on LG14 was detected for all traits explaining between 45 to 65% of the phenotypicvariability. The marker-trait association seems to indicate a dominant profile. Using XRQ (v2) as10 reference, the flanking markers embrace a region of 7,7 Mb ranging from 165239201 bp(HS123008) to 172978736 (HS190086), as indicated in the Table 5 below.

[0007]

[0008] 98Fine Mapping of the QTL on chromosome 14. For the purpose of recombinant mapping theAxiom assays mapping to the QTL region were converted to Kaspar assays. To further increasethe marker density a set of 7 novel assays was developed targeting polymorphic SNPs discoveredby the sequence comparison of the genomic sequence from both parents. Fine mapping involvingapproximately 2000 F3 plants representing 117 recombination events and using 15 SNPs (Table1) that cover the QTL region of about 14 cM allowed reducing the confidence interval of the QTLto only 2,1 cM representing 2.6 Mb as delimited by flanking markers markers HS405261(166040728 bp) and HS249258 (168719909 bp) (Figure 5B). The highest p-value was obtainedfor marker HS405341 (p= 7,61x10-108) which is a dominant marker absent in XRQ. Calculatingthe linkage disequilibrium for all pairs of the 15 markers in the final interval resulted in D’ scoresbetween 0.83 to 0.94, illustrating the strong linkage between all markers and hindering thepossibility of further reducing the interval by recombination.Genotyping of a panel of approximately 300 accessions representative of the European gene poolof cultivated sunflower with all 15 markers present in the final interval resulted in the identificationof two SNPs that showed a perfect correlation with the resistance allele: HS405268 andHS405335 (Figure 10). The genotypes obtained for each of these two diagnostic markers allowfor the positive identification of the resistance allele in both homozygous and heterozygous plantsas typically present in breeding populations of sunflower (Table 9) 99 100 101 102 Table 9: Genotypes obtained for Kaspar markers HS405268 and HS405335 across a panel ofapproximately 300 accessions representative of the European gene pool of cultivated sunflowerthat allow for the positive identification of the resistance allele from 98MOL.Genomic analysis and annotation of the QTL. The sequence analysis and assembly of the fullgenome of resistant parent LT_98MOL allowed for the genomic characterization and annotationof the QTL region on the bottom of LG14. Surprisingly, the physical size of the QTL interval 103embraced by the flanking markers markers HS405261 and HS249258 is much larger inLT_98MOL measuring 6.24 Mb in length compared to 2,6 Mbp in XRQ. Comparison of thegenomic sequences of the QTL region and its surroundings at the end of LG14 between XRQand LT_98MOL revealed relatively poor conservation in comparison to the rest of thechromosome. LT_98MOL shows a substantial expansion of the genomic sequence due tomultiple insertions estimated at a total length of 20 Mbp and resulting in a reduced density ofsyntenic regions between both genomes.A total number of 283 predicted gene were identified in the interval of 6.24 Mbp on LT_98MOL,62 of which carry protein motifs well-known for resistance genes such as Leucine-Rich Repeats(LRR) or kinase domains. Within the 62 genes, a selection of 34 most promising genes forconferring resistance was obtained based on sequence size and the presence of both LRR andkinase motifs (Table 6). In contrast, only 184 genes were predicted in the 2.6 Mbp region in XRQ(v2) including 32 genes carrying LRR motifs or annotated as kinases (Figure 6, Table 6).Comparable outcomes were achieved when evaluating the QTL genomic region betweenLT_98MOL and the susceptible line 2603, although the specific data is not presented here.Table 6. List of the most promising candidate genes in the chromosome 14 QTL region. Thecandidate genes positions and annotations between the QTL flanking markers HS405261 andHS249258 on the referent genomes LT_98MOL_MLG_010_43.

[0009]

[0010]

[0011] 106Complementation of resistance genes with 98MOL. All statistics on the phenotypic datameasured in controlled conditions on Oroscreen® and in field are available on Table 7 below.Table 7. Quantitative data of the phenotyping in controlled conditions and field for LT_98MOL andNILs lines and hybrids with testers carrying resistant major genes. The mean (Mean) and standarderror of the mean (SE) for the total number of nodules attached (TT), the number of necrosednodules (NT), the minimum (Smin), maximum (Smax) and most observed (Sfreq) nodule size, thenumber of healthy tubercules (HT) and the aggressivity of infection (NOTE.AGRESSIVITY)phenotyped in controlled conditions on Oroscreen® platform. The mean (Mean) and standarderror of the mean (SE) for the number of infected plant in a row of 25 plants (pc_infected_plt) infield in Sapin,Cordoba and Russia, Rostov. The letters in the GROUP column portray the pairwisedifference between accessions using Tukey’s HSD method. The pvalue_PEDIGREE representsthe effect of the genotype on trait variability.

[0012]

[0013] 108Donor line LT_98MOL showed high levels of resistance to race F in controlled conditions on theOroscreen® platform showing no or very few healthy nodules attached to the roots, equivalent tothe resistant control LT_Or7 (Figure 7A-1). Susceptible controls showed 17, or more nodules perplant. As expected, NILs carrying the resistant allele for the QTL from LT_98MOL on LG14exhibited a similar phenotype showing up to 2 nodules on average, significantly less than thecorresponding lines carrying the susceptible allele with an average of 15.6 healthy nodules(Figure 6A -1). Eventually, the few nodules that developed on the NILs and LT_98MOL oftenshowed signs of necrosis suggestive of incompatible interactions, a phenotype that was onlyrarely observed for nodules on susceptible controls (Figure 7A-2). In field conditions thepercentage of infected plants was variable between the NILs ranging from 25 to 48 %, but inoverall, the NILs remain significantly more resistant than the susceptible controls that consistentlyreached nearly 100% infection (Figure 7B).Hybrids derived from LT_98MOL and heterozygous for the resistance QTLs detected inLT_98MOL revealed highly susceptible to race G in field conditions in Rostov, Russia.Conversely, hybrids obtained by crossing LT_98MOL to lines carrying alternative resistancegenes DEB02 or Or7 exhibited strong resistance with only 2 to 10% of the plants showingemerged broomrapes at their stems. Hybrids carrying only DEB2 or Or7 or a combination of bothshowed substantially higher percentages of infection of 25% or more illustrating the potential ofLT_98MOL to complement existing the resistance sources. (Figure 8A).Similar complementation studies for resistance against race G in Rostov were performed usinghybrids derived from the NILs for the QTL on LG14. Hybrids carrying the favorable allele incombination with Or7 showed a high percentage of infected plants ranging from 57 to 91%superior to the control hybrid obtained by the cross between LT_Or7 and LT_98MOL, whichapproximately 28% of infected plants (Figure 8B). By contrast, NILs carrying the favorable allelein combination with LT_DEB02 showed a higher resistance level compared to the correspondinghybrids carrying the susceptible allele. However, the hybrids displayed highly variable phenotypesranging from 18 to 43% of infected plants and except for the hybrids derived from NIL_4_FAV,they tend to be more susceptible than the control hybrids heterozygous for DEB02.Phenotyping of the early stages of infection reveals a post-haustorial mechanism ofresistance. Rhizotron experiments are an effective method to evaluate the early developmentalstages of the interaction between broomrape and its host (Figure 9A-B). At 14 dai the induction of the broomrape seeds germination was significantly lower for the NIL and LT_98MOL with a 109 percentage of germination of 66 and 62% compared to the control LT_S with a percentage of germination of 90% (Table 8).Table 8. Quantitative data of the phenotyping in rhizotrons of 3 accessions LT_S, LT_98MOL andone NIL carrying the resistant allele on chromosome 14, using the broomrape race F from Cordoba region, Spain. The mean (Mean) and standard error of the mean (SE) for the percentage of germination (Pcgermination) at 14 dai, the number total of attachment (TA), the number of compatible (CA) and incompatible attachment (IA) and the percentage of incompatible attachment (PcIA) at 14, 21, 28, 35 and 42 dai the total number of tubercules (TT), the number of necrotic (NT) and healthy tubercules (HT) at 21, 28, 35 and 42 dai and the percentage of necrotic tubercules (PcNT) at 35 and 42 dai. The column represents the statistic model results using the date of notation (suffix. NOTATION_DATE) or the PEDIGREE (suffix. PEDIGREE) as explanation factors of the trait variation. The letters in the GROUP columns portray the pairwise test between notation dates (NOTATION_DATE) and between pedigree (PEDIGREE° respectively and using the Tukey’s HSD method. The p_value _NOTATION_DATE and pvalue_PEDIGREE represents respectively the effect of the date of notation and the pedigree on trait variability.

[0014]

[0015] ʼnll 114 With respect to the total number of attachments (TA) the susceptible control, and the NILs showed substantial numbers of infections with about between 13 to 16 attachments at 35dai (Figure 9- C1). The donor LT_98MOL showed the lowest number of 7 attachments on average. The resistant phenotype becomes manifest when considering the percentage of necrotic attachments illustrative for the incompatible interaction between the host and the parasite (PcIA). Contrary to the susceptible control that does not show any signs of necrosis at the attachments, LT_98MOL and NIL_5_FAV show significant percentages of incompatible interactions from 28 dai reaching 24 and 54 % respectively at 42 dai (Figure 9-C2). In order to monitor the resistance response over time the total number of tubercules (TT) were calculated at 21, 28, 35 and 42 dai and the percentage of necrotic tubercules (PcNT) was calculated only at 35 and 42 dai. LT_S and NIL_5_FAV shows the highest number of tubercules starting from 4 and 5 TT at 28 dai to 8 and 9 TT at 42 dai (Figure 9-C3). LT_98MOL show the lowest level of infection with less than 2 tubercules attached even after 42 dai. With regards to the number of necrotic tubercules, LT_S did not show necrotic tubercules (Figure 9-C4). Conversely, the few attachments on LT_98MOL were almost all necrotic at 35 and 42 dai whereas for the NIL about one-fourth of the tubercules were necrotic at 42 dai. BIBLIOGRAPHY -Fernández-Martínez JM, Velasco L, Pérez-Vich B (2012) Progress in Research onBreeding for Resistance to Sunflower Broomrape. HELIA 35:47–56. https: / / doi.org / 10.2298 / hel1257047f -Molinero-Ruiz L, García-Carneros AB, Collado-Romero M, et al (2014) Pathogenic andmolecular diversity in highly virulent populations of the parasitic weed Orobanche cumana (sunflower broomrape) from Europe. Weed Res 54:87–96. https: / / doi.org / 10.1111 / wre.12056 Fernández-Martínez J, Pérez-Vich B, Velasco L (2015) Sunflower Broomrape (Orobanche cumana Wallr.). pp 129–155 -Alcántara E, Morales-García M, Díaz-Sánchez J (2006) Effects of Broom-rapeParasitism on Sunflower Plants: Growth, Development, and Mineral Nutrition. J Plant Nutr 29:1199–1206. https: / / doi.org / 10.1080 / 01904160600767351 -Domínguez J (1996) R-41, a sunflower restorer inbred line, carrying two genes forresistance against a highly virulent Spanish population of Orobanche cer-nua. Plant Breed 115:203–204. https: / / doi.org / 10.1111 / j.1439-0523.1996.tb00904.x -Tan S, Evans RR, Dahmer ML, et al (2005) Imidazolinone-tolerant crops: history, currentstatus and future. Pest Manag Sci 61:246–257. https: / / doi.org / 10.1002 / ps.993 115 -Demurin YaN, Perstenyeva AA (2010) Effect of imidazolinones on broomrape tuberclesin sunflower. https: / / doi.org / Proceedings of the International Symposium; Krasnodar, Russia June 23-24, 2010 -Ma Y, Jia J, An Y, et al (2013) Potential of Some Hybrid Maize Lines to InduceGermination of Sunflower Broomrape. Crop Sci 53:260–270. https: / / doi.org / 10.2135 / cropsci2012.03.0197 -Ye X, Zhang M, Zhang M, Ma Y (2020) Assessing the Performance of Maize (Zea maysL.) as Trap Crops for the Management of Sunflower Broomrape (Orobanche cumana Wallr.). Agronomy 10:100. https: / / doi.org / 10.3390 / agronomy10010100 -Louarn J, Boniface M-C, Pouilly N, et al (2016) Sunflower Resistance to Broomrape(Orobanche cumana) Is Controlled by Specific QTLs for Different Parasitism Stages. Front Plant Sci 7:. https: / / doi.org / 10.3389 / fpls.2016.00590 -Shabana YM, Müller-Stöver D, Sauerborn J (2003) Granular Pesta formulation ofFusarium oxysporum f. sp. orthoceras for biological control of sunflower broomrape: efficacy and shelf-life. Biol Control 26:189–201. https: / / doi.org / 10.1016 / S1049-9644(02)00130-5 -Fernández-Martínez JM, Velasco L, Pérez-Vich B (2012) Progress in Research onBreeding for Resistance to Sunflower Broomrape. HELIA 35:47–56. https: / / doi.org / 10.2298 / hel1257047f Velasco L, Pérez-Vich B, Fernández-Martínez JM (2016) Research on resistance to sunflower broomrape: an integrated vision. OCL 23:D203. https: / / doi.org / 10.1051 / ocl / 2016002 -Kaya Y (2014) The situation of broomrape infestation, control methods in sunflowerproduction areas in Turkey -Cvejić S, Radanović A, Dedić B, et al (2020) Genetic and Genomic Tools in SunflowerBreeding for Broomrape Resistance. Genes 11:152. https: / / doi.org / 10.3390 / genes11020152 -Fernández-Martínez J, Pérez-Vich B, Velasco L (2015) Sunflower Broomrape(Orobanche cumana Wallr.). pp 129–155 -Imerovski I, Dimitrijević A, Miladinović D, et al (2016) Mapping of a new gene forresistance to broomrape races higher than F. Euphytica 209:281–289. https: / / doi.org / 10.1007 / s10681-015-1597-7 -Calderón-González Á, Pérez-Vich B, Pouilly N, et al (2023) Association mapping forbroomrape resistance in sunflower. Front Plant Sci 13:20 p. https: / / doi.org / 10.3389 / fpls.2022.1056231 116 -Pérez-Vich B, Akhtouch B, Knapp SJ, et al (2004) Quantitative trait loci for broomrape(Orobanche cumana Wallr.) resistance in sunflower. Theor Appl Genet 109:92–102. https: / / doi.org / 10.1007 / s00122-004-1599-7 -Bellone S, Boubée de Gramont C, Hernandez M, et al (2023) Genetic diversity analysisof broomrape (Orobanche Cumana) populations in sunflower growing areas in Europe. Int Congr Plant Pathol Lyon Fr 20-25 August -Ruso, Sukno S, Domínguez-Gimenez, et al (1996) Screening of Wild Helianthus speciesand derived lines for resistance to several populations of Orobanche cernua. Plant Dis 80: -Jocković M, Jocić S, Cvejić S, et al (2018) HELIANTHUS SPECIES AS A SOURCESFOR BROOMRAPE RESISTANCE -Chabaud M, Auriac M-C, Boniface M-C, et al (2022) Wild Helianthus species: A reservoirof resistance genes for sustainable pyramidal resistance to broomrape in sunflower. Front Plant Sci 13:1038684. https: / / doi.org / 10.3389 / fpls.2022.1038684 -Fernández-Melero B, Martín-Sanz A, del Moral L, et al (2023) A novel sunflowerbroomrape race with unusual virulence potentially caused by a mutation. Front Plant Sci 14: -Nabloussi A, Pérez-Vich B, Velasco L (2023) Virulence, genetic diversity, and putativegeographical origin of sunflower broomrape populations in Morocco. Phytopathol Mediterr 62:65– 72. https: / / doi.org / 10.36253 / phyto-13948 -Labrousse P (2001) Several Mechanisms are Involved in Resistance of Helianthus toOrobanche cumana Wallr. Ann Bot 88:859–868. https: / / doi.org / 10.1006 / anbo.2001.1520 -Louarn J, Carbonne F, Delavault P, et al (2012) Reduced Germination of Orobanchecumana Seeds in the Presence of Arbuscular Mycorrhizal Fungi or Their Exudates. PloS ONE 7:e49273. https: / / doi.org / 10.1371 / journal.pone.0049273 -Auger B, Pouvreau J-B, Pouponneau K, et al (2012) Germination Stimulants ofPhelipanche 116ggnog in the Rhizosphere of Brassica napus Are Derived from the Glucosinolate Pathway. Mol Plant-Microbe Interactions® 25:993–1004. https: / / doi.org / 10.1094 / MPMI-01-12- 0006-R -Galindo JCG, de Luque AP, Jorrín J, Macías FA (2002) SAR studies of sesquiterpenelactones as Orobanche cumana seed germination stimulants. J Agric Food Chem 50:1911–1917. https: / / doi.org / 10.1021 / jf0110809 -Pérez de Luque A, Galindo JC, Macías FA, Jorrín J (2000) Sunflower sesquiterpenelactone models induce Orobanche cumana seed germination. Phytochemistry 53:45–50. https: / / doi.org / 10.1016 / s0031-9422(99)00485-9 117 -Pacureanu M, Veronesi C, Raranciuc S, Stanciu D (2004) Parasite-host plant interactionof Orobanche cumana Wallr. Orobanche Cernua 171–177 -Duriez P, Vautrin S, Auriac M-C, et al (2019) A receptor-like kinase enhances sunflowerresistance to Orobanche cumana. Nat Plants 5:1211–1215. https: / / doi.org / 10.1038 / s41477-019- 0556-z -Imerovski I, Dedić B, Cvejić S, et al (2019) BSA-seq mapping reveals major QTL forbroomrape resistance in four sunflower lines. Mol Breed 39:41. https: / / doi.org / 10.1007 / s11032- 019-0948-9 -Martín-Sanz A, Pérez-Vich B, Rueda S, et al (2020) Characterization of post-haustorialresistance to sunflower broomrape. Crop Sci 60:1188–1198. https: / / doi.org / 10.1002 / csc2.20002 -Fernández-Aparicio M, del Moral L, Muños S, et al (2022) Genetic and physiologicalcharacterization of sunflower resistance provided by the wild-derived OrDeb2 gene against highly virulent races of Orobanche cumana Wallr. Theor Appl Genet 135:501–525. https: / / doi.org / 10.1007 / s00122-021-03979-9 -Akhtouch B, Muñoz-Ruz J, Melero-Vara J, et al (2002) Inheritance of resistance to raceF of broomrape in sunflower lines of different origins. Plant Breed 121:266–268. https: / / doi.org / 10.1046 / j.1439-0523.2002.00701.x -Cvejić S, Jocić S, Dedić B, et al (2018) Inheritance of resistance to broomrape insunflower inbred line LIV-17. Proc 4thInt Symp Broomrape Sunflower Buchar Rom 2-4 July 2018 -Sisou D, Tadmor Y, Plakhine D, et al (2021) Biological and TranscriptomicCharacterization of Pre-Haustorial Resistance to Sunflower Broomrape (Orobanche cumana W.) in Sunflowers (Helianthus annuus). Plants 10:1810. https: / / doi.org / 10.3390 / plants10091810 -BESSET BG, George P, PORQUERAS J-L (2016) Plant biotic agent phenotypingplatform and process of phenotyping -Wu Y, Bhat PR, Close TJ, Lonardi S (2008) Efficient and Accurate Construction ofGenetic Linkage Maps from the Minimum Spanning Tree of a Graph. PloS Genet 4:e1000212. https: / / doi.org / 10.1371 / journal.pgen.1000212 Taylor J, Butler D (2017) R Package ASMap: Efficient Genetic Linkage Map Construction and Diagnosis. J Stat Softw 79:. https: / / doi.org / 10.18637 / jss.v079.i06 -Jourjon M-F, Jasson S, Marcel J, et al (2005) MCQTL: multi-allelic QTL mapping in multi-cross design. Bioinformatics 21:128–130. https: / / doi.org / 10.1093 / bioinformatics / bth481 -Arcade A, Labourdette A, Falque M, et al (2004) BioMercator: integrating genetic mapsand QTL towards discovery of candidate genes. Bioinformatics 20:2324–2326. https: / / doi.org / 10.1093 / bioinformatics / bth230 118 -Edge P, Bansal V (2019) Longshot enables accurate variant calling in diploid genomesfrom single-molecule long read sequencing. Nat Commun 10:4660. https: / / doi.org / 10.1038 / s41467-019-12493-y -Goel M, Sun H, Jiao W-B, Schneeberger K (2019) SyRI: finding genomic rearrangementsand local sequence differences from whole-genome assemblies. Genome Biol 20:277. https: / / doi.org / 10.1186 / s13059-019-1911-0 -Stanke M, Morgenstern B (2005) AUGUSTUS: a web server for gene prediction ineukaryotes that allows user-defined constraints. Nucleic Acids Res 33:W465-467. https: / / doi.org / 10.1093 / nar / gki458 -Huerta-Cepas J, Szklarczyk D, Heller D, et al (2019) eggNOG 5.0: a hierarchical,functionally and phylogenetically annotated orthology resource based on 5090 organisms and 2502 viruses. Nucleic Acids Res 47:D309–D314. https: / / doi.org / 10.1093 / nar / gky1085 -Marçais G, Delcher AL, Phillippy AM, et al (2018) MUMmer4: A fast and versatile genomealignment system. PLOS Comput Biol 14:e1005944. https: / / doi.org / 10.1371 / journal.pcbi.1005944 -Le Ru A, Ibarcq G, Boniface M-C, et al (2021) Image analysis for the automaticphenotyping of Orobanche cumana tubercles on sunflower roots. Plant Methods 17:80. https: / / doi.org / 10.1186 / s13007-021-00779-6

Claims

1. 119 CLAIMS1. A method of identifying a Helianthus plant or plant part comprising a locus for broomraperesistance, said locus is located within the chromosomal interval between markersHS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1., wherein said Helianthusplant or plant part is identified by genotyping one or more nucleotide polymorphisms(SNPs) associated to the resistance allele within said locus.

2. The method of identifying a Helianthus plant or plant part according to claim 1, whereinthe SNPs associated to the resistance allele is located within the chromosomal intervalbetween markers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1 consistsof one or more of SNPs as described in Table below, preferably all the SNPs as describedin Table below:

3. The method of identifying a Helianthus plant or plant part according to any one of claims1-2, wherein said locus is characterized by the genotype “G” of SNP1, “A” of SNP2, “G”of SNP3, “C” of SNP4, “G” of SNP5, “G” of SNP6, “G” of SNP7, “G” of SNP8, “A” of SNP9,120 “T” of SNP10, “C” of SNP11, “A” of SNP12, “C” of SNP13, “T” of SNP14 and “C” of SNP15,as described in Table of claim 3.

4. The method of identifying a Helianthus plant or plant part having broomrape resistanceaccording to any one of claims 1 to 3, wherein said plant or plant part is identified bydetecting the presence of one or more of the following nucleic acids:- SEQ ID NO: 70 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 70;- SEQ ID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 71;- SEQ ID NO: 72 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 72;- SEQ ID NO: 73 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 73;- SEQ ID NO: 74 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 74;- SEQ ID NO: 75 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 75;- SEQ ID NO: 76 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 76;- SEQ ID NO: 77 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 77;- SEQ ID NO: 78 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 78;- SEQ ID NO: 79 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 79;- SEQ ID NO: 80 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 80;- SEQ ID NO: 81 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 81;- SEQ ID NO: 82 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 82;- SEQ ID NO: 83 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 83;121- SEQ ID NO: 84 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 84;- SEQ ID NO: 85 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 85;- SEQ ID NO: 86 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 86;- SEQ ID NO: 87 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 87;- SEQ ID NO: 88 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 88;- SEQ ID NO: 89 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 89;- SEQ ID NO: 90 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 90;- SEQ ID NO: 91 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 91;- SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 92;- SEQ ID NO: 93 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 93;- SEQ ID NO: 94 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 94;- SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 95;- SEQ ID NO: 96 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 96;- SEQ ID NO: 97 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 97;- SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 98;- SEQ ID NO: 99 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 99;- SEQ ID NO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 100;122 -SEQ ID NO: 101 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 101;- SEQ ID NO: 102 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 102; and / or- SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 103.

5. A transgenic Helianthus plant or plant part comprising at least one the following nucleicacids as transgenic element(s):- SEQ ID NO: 70 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 70;- SEQ ID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 71;- SEQ ID NO: 72 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 72;- SEQ ID NO: 73 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 73;- SEQ ID NO: 74 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 74;- SEQ ID NO: 75 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 75;- SEQ ID NO: 76 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 76;- SEQ ID NO: 77 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 77;- SEQ ID NO: 78 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 78;- SEQ ID NO: 79 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 79;- SEQ ID NO: 80 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 80;- SEQ ID NO: 81 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 81;123- SEQ ID NO: 82 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 82;- SEQ ID NO: 83 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 83;- SEQ ID NO: 84 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 84;- SEQ ID NO: 85 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 85;- SEQ ID NO: 86 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 86;- SEQ ID NO: 87 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 87;- SEQ ID NO: 88 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 88;- SEQ ID NO: 89 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 89;- SEQ ID NO: 90 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 90;- SEQ ID NO: 91 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 91;- SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 92;- SEQ ID NO: 93 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 93;- SEQ ID NO: 94 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 94;- SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 95;- SEQ ID NO: 96 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 96;- SEQ ID NO: 97 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 97;- SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 98;124 -SEQ ID NO: 99 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 99;- SEQ ID NO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 100;- SEQ ID NO: 101 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 101;- SEQ ID NO: 102 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 102; and / or- SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 103.

6. A method for producing a transgenic Helianthus plant according to claim 5, wherein themethod comprises the steps of transforming a parent Helianthus plant with one or morenucleic acids of resistance, selecting a plant comprising said one or more nucleic acid(s)as transgene(s), regenerating and growing said Helianthus transgenic plant, wherein saidnucleic acids are chosen among:- SEQ ID NO: 70 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 70;- SEQ ID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 71;- SEQ ID NO: 72 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 72;- SEQ ID NO: 73 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 73;- SEQ ID NO: 74 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 74;- SEQ ID NO: 75 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 75;- SEQ ID NO: 76 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 76;- SEQ ID NO: 77 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 77;- SEQ ID NO: 78 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 78;125- SEQ ID NO: 79 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 79;- SEQ ID NO: 80 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 80;- SEQ ID NO: 81 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 81;- SEQ ID NO: 82 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 82;- SEQ ID NO: 83 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 83;- SEQ ID NO: 84 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 84;- SEQ ID NO: 85 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 85;- SEQ ID NO: 86 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 86;- SEQ ID NO: 87 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 87;- SEQ ID NO: 88 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 88;- SEQ ID NO: 89 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 89;- SEQ ID NO: 90 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 90;- SEQ ID NO: 91 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 91;- SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 92;- SEQ ID NO: 93 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 93;- SEQ ID NO: 94 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 94;- SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 95;126 -SEQ ID NO: 96 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 96;- SEQ ID NO: 97 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 97;- SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 98;- SEQ ID NO: 99 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 99;- SEQ ID NO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 100;- SEQ ID NO: 101 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 101;- SEQ ID NO: 102 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 102; and / or- SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 103.

7. A Helianthus plant or plant part or progeny of the plant as obtained by the method of claim6, said progeny comprising a transgene corresponding to a broomrape resistance allele.

8. Seeds, hybrid plants and progeny of plant obtained from representative sample of theseeds as deposited at NCIMB collection under the number NCIMB 44327, said progenycomprising a transgene corresponding to a broomrape resistance allele.

9. Means for genotyping one or more SNPs associated to broomrape resistance in aHelianthus plant or plant part with one or more of the following markers: SEQ ID NO:1 toSEQ ID NO:15.

10. The means according to claim 9, which consists of a nucleic acid probe, a primer or a setof primers or combinations thereof.

11. The means according to any one of claims 9-10 consisting of one or more primersincluding any one of SEQ ID NO:16 to SEQ ID NO:69.12712. A genotyping kit for detecting nucleotide polymorphisms (SNPs) associated to abroomrape resistance allele, as mentioned in the following Table:said kit comprising SEQ ID NO; 16 to SEQ ID NO: 18; SEQ ID NO: 19 to SEQ ID NO: 21;SEQ ID NO: 22 to SEQ ID NO: 24; SEQ ID NO: 25 to SEQ ID NO: 27; SEQ ID NO; 28 toSEQ ID NO: 30; SEQ ID NO: 31 to SEQ ID NO: 33; SEQ ID NO: 34 to SEQ ID NO: 36;SEQ ID NO; 37 to SEQ ID NO: 39; SEQ ID NO: 40 to SEQ ID NO: 42; SEQ ID NO: 43 toSEQ ID NO: 45; SEQ ID NO: 46 to SEQ ID NO: 48; SEQ ID NO; 49 to SEQ ID NO: 51;SEQ ID NO: 52 to SEQ ID NO: 54; SEQ ID NO: 55 to SEQ ID NO: 57; SEQ ID NO: 58 toSEQ ID NO: 60; SEQ ID NO; 61 to SEQ ID NO: 63; SEQ ID NO: 64 to SEQ ID NO: 66;and / or SEQ ID NO: 67 to SEQ ID NO: 69.

13. Use of a genotyping kit according to claim 12, for following introgression of a quantitativetrait locus for broomrape resistance in a line, wherein said locus is located in achromosomal region which includes the markers HS249258 of SEQ ID NO: 15 andHS405261 of SEQ ID NO: 1.

14. Use of a genotyping kit according to claim 13, wherein the line already contains at leastone locus of resistance to others race of orobanche.12815. A diagnostic kit comprising SEQ ID NO: 28 to SEQ ID NO: 30 and / or SEQ ID NO: 52 toSEQ ID NO: 54.

16. Use of a diagnostic kit according to claim 15 to identity the resistance allele againstbroomrape in homozygous and / or heterozygous plants.

17. Use of a Helianthus plant or plant part for food application, for feed application or forbreeding application, wherein said plant or plant part:- comprises a locus for broomrape resistance within the chromosomal interval betweenmarkers HS249258 of SEQ ID NO:15 and HS405261 of SEQ ID NO:1,- is identified according to the methods of any one of claims 1 to 4,- is a transgenic plant or plant part according to claim 5,- is obtained by the method of claim 6.

18. Isolated nucleic acid corresponding to a resistance gene against broomrape, wherein saidgene is chosen among:- SEQ ID NO: 70 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 70;- SEQ ID NO: 71 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 71;- SEQ ID NO: 72 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 72;- SEQ ID NO: 73 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 73;- SEQ ID NO: 74 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 74;- SEQ ID NO: 75 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 75;- SEQ ID NO: 76 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 76;- SEQ ID NO: 77 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 77;- SEQ ID NO: 78 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 78;129- SEQ ID NO: 79 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 79;- SEQ ID NO: 80 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 80;- SEQ ID NO: 81 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 81;- SEQ ID NO: 82 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 82;- SEQ ID NO: 83 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 83;- SEQ ID NO: 84 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 84;- SEQ ID NO: 85 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 85;- SEQ ID NO: 86 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 86;- SEQ ID NO: 87 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 87;- SEQ ID NO: 88 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 88;- SEQ ID NO: 89 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 89;- SEQ ID NO: 90 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 90;- SEQ ID NO: 91 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 91;- SEQ ID NO: 92 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 92;- SEQ ID NO: 93 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 93;- SEQ ID NO: 94 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 94;- SEQ ID NO: 95 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 95;130 -SEQ ID NO: 96 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 96;- SEQ ID NO: 97 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 97;- SEQ ID NO: 98 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 98;- SEQ ID NO: 99 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 99;- SEQ ID NO: 100 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 100;- SEQ ID NO: 101 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 101;- SEQ ID NO: 102 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 102; and / or- SEQ ID NO: 103 or a nucleic acid having at least 95% identity, preferably 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 103.

19. A vector comprising at least one isolated nucleic acid according to claim 18.

Images