Peptide targeting ocular cells or tissues, and viral capsid protein and viral vector comprising same

Abstract

The present invention relates to a peptide targeting ocular cells or tissues, and a modified capsid protein and viral vector comprising same. When the peptide according to the present invention is used, ocular cells or tissues can be effectively targeted, and when a capsid protein or viral vector comprising the peptide is used, a gene can be effectively delivered to and expressed in the ocular cell or tissue.

Description

Peptides targeting ocular cells or tissues and viral capsid proteins and viral vectors comprising the same

[0001] The present invention was made with the support of the Ministry of Science and ICT, the Ministry of Trade, Industry and Energy, and the Ministry of Health and Welfare of the Republic of Korea under project number 1711199341, and the research management specialized institution of the project is the National Drug Development Foundation, the research project name is "National New Drug Development Project (Ministry of Science and ICT, Ministry of Welfare, Ministry of Trade, Industry and Energy)", the research project name is "Research and development of adeno-associated virus-based ocular cell / tissue targeting technology and therapeutic candidate for development of X-linked retinitis pigmentosa gene therapy", the main institution is ENCELL Co., Ltd., and the research period is from 2023.06.01 to 2023.12.31.

[0002] This patent application claims priority to Republic of Korea Patent Application No. 10-2024-0084872, filed with the Korean Intellectual Property Office on June 27, 2024, the disclosure of which is incorporated herein by reference.

[0003] This patent application claims priority to Republic of Korea Patent Application No. 10-2025-0009114, filed with the Korean Intellectual Property Office on January 21, 2025, the disclosure of which is incorporated herein by reference.

[0004] The present invention relates to a peptide targeting an ocular cell or tissue, a modified capsid protein comprising the same, and a viral vector.

[0005]

[0006] Adeno-associated virus (AAV) is a nonpathogenic virus containing a small, single-stranded DNA molecule, attracting considerable attention as an efficient and safe vector for gene transfer. Because AAV vectors can infect both dividing and non-dividing cells, clinical trials are underway for brain-related diseases beyond ocular and muscle-related diseases.

[0007] Since the FDA's approval of Luxturna in 2017, Zolgensma (2019), Hemgenix (2022), Elevudys (2023), and Roctavian (2023) have been additionally approved, bringing the total number of AAV vector-based gene therapies currently on the market in 2023 to five, with over 150 ongoing clinical trials.

[0008] In particular, following the success of Luxturna and Zolgensma, many companies are actively investing in securing AAV vector platform technology. According to the Korea Health Industry Development Institute, 40-50% of gene therapy products utilize AAV vectors. Furthermore, the gene therapy market is projected to grow rapidly from $2.039 billion in 2023 to $4.3 billion in 2028.

[0009] The core of AAV vector development is the development of a cassette for effective gene expression and a capsid to enhance delivery efficiency. Natural AAV is surrounded by capsid proteins, which can cause adverse effects such as immune responses and liver toxicity. Capsid development strategies aim to address these side effects and enhance tropism through capsid modification. The development of modified capsids for effective gene delivery is urgently needed.

[0010]

[0011] The present inventors have conducted extensive research to develop a viral vector capable of effectively delivering genes. As a result, they discovered that using a viral vector containing a viral capsid protein with an exogenous peptide of a specific sequence can enhance the efficiency of gene delivery and expression into ocular cells or tissues, leading to the completion of the present invention.

[0012] Accordingly, it is an object of the present invention to provide a peptide that targets ocular cells or tissues.

[0013] Another object of the present invention is to provide a nucleic acid molecule encoding the peptide.

[0014] Another object of the present invention is to provide a viral capsid protein comprising the above peptide.

[0015] Another object of the present invention is to provide a nucleic acid molecule encoding the viral capsid protein.

[0016] Another object of the present invention is to provide a viral vector comprising the viral capsid protein.

[0017] Other objects and advantages of the present invention will become more apparent from the detailed description, claims and drawings below.

[0018]

[0019] The present invention provides the following inventions 1 to 21.

[0020] 1. A peptide targeting an ocular cell or tissue, comprising an amino acid sequence selected from the group consisting of sequence number 1, sequence number 2, sequence number 3, sequence number 4, sequence number 5, and sequence number 6.

[0021] 2. A peptide according to 1, wherein the peptide binds to retinal pigment epithelium (RPE).

[0022] 3. A nucleic acid molecule comprising a nucleotide sequence encoding a peptide of 1 or 2.

[0023] 4. A nucleic acid molecule in which the nucleotide sequence in 3 is composed of a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0024] 5. A viral capsid protein comprising a peptide consisting of an amino acid sequence selected from the group consisting of sequence number 1, sequence number 2, sequence number 3, sequence number 4, sequence number 5, and sequence number 6.

[0025] 6. A viral capsid protein, wherein the peptide in 5 is inserted into the VP (viral protein) domain of the viral capsid protein.

[0026] 7. In 5 or 6, the peptide is inserted into the HSPG (heparan sulfate proteoglycan) binding motif of the VP (viral protein) domain of the viral capsid protein.

[0027] 8. A capsid protein, wherein the peptide in any one of 5 to 7 is inserted into a heparan sulfate proteoglycan (HSPG) binding motif of a VP (viral protein) domain of the viral capsid protein.

[0028] 9. A capsid protein according to any one of 6 to 8, wherein the VP is VP1, VP2 or VP3.

[0029] 10. In any one of 5 to 9, the peptide is inserted between two adjacent amino acids located at amino acids 570-610, amino acids 580-600, amino acids 570-575, amino acids 575-580, amino acids 580-585, amino acids 585-590, amino acids 590-600, or amino acids 600-614 of VP1. For example, the insertion site may be between amino acids 580 and 581, amino acids 581 and 582, amino acids 583 and 584, amino acids 584 and 585, amino acids 585 and 586, amino acids 586 and 587, amino acids 587 and 588, amino acids 588 and 589, or amino acids 589 and 590. The insertion site may be between amino acids 575 and 576, amino acids 576 and 577, amino acids 577 and 578, amino acids 578 and 579, or amino acids 579 and 580. The insertion site may be between amino acids 590 and 591, amino acids 591 and 592, amino acids 592 and 593, amino acids 593 and 594, amino acids 594 and 595, amino acids 595 and 596, amino acids 596 and 597, amino acids 597 and 598, amino acids 598 and 599, or amino acids 599 and 600.

[0030] 11. A capsid protein according to any one of claims 5 to 10, wherein the capsid protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, and SEQ ID NO: 52.

[0031] 12. A nucleic acid molecule encoding any one of the capsid proteins 5 to 11.

[0032] 13. A nucleic acid molecule according to claim 12, wherein the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, and SEQ ID NO: 59.

[0033] 14. A viral vector comprising any one of the capsid proteins 5 to 11.

[0034] 15. A viral vector according to claim 14, wherein the virus is an adeno-associated virus (AAV).

[0035] 16. A viral vector according to 15, wherein the serotype of the adeno-associated virus (AAV) is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10¸ AAV11, AAV12¸ or AAV13.

[0036] 17. A viral vector according to any one of claims 14 to 16, wherein the viral vector targets ocular cells or tissues.

[0037] 18. In any one of 14 to 16, the viral vector further comprises a target gene nucleic acid sequence.

[0038] 19. A method for delivering a target gene, comprising administering to a subject any one of the viral vectors of 14 to 18.

[0039] 20. A method for delivering a target gene, wherein the target gene is delivered to an ocular cell or tissue.

[0040] 21. A peptide, nucleic acid molecule, capsid protein, viral vector, or target gene delivery method, wherein the eye cell in any one of 1 to 20 is a photoreceptor cell (e.g., rod cell or cone cell), horizontal cell, bipolar cell, amacrine cell, ganglion cell, Müller cell (Müller glial cell), amacrine cell, retinal pigment epithelial cell (RPE), lens epithelial cell, lens fiber cell, uveal cell, or a combination thereof.

[0041]

[0042] In one aspect of the present invention, the present invention provides a peptide targeting an ocular cell or tissue, comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0043] The present inventors have conducted extensive research to develop a viral vector capable of effectively delivering genes. As a result, they discovered that using a viral vector containing a viral capsid protein incorporating an exogenous peptide of a specific sequence can enhance the efficiency of gene delivery and expression into ocular cells or tissues.

[0044] The term “target” as used herein means that a virus, such as a peptide, a capsid protein comprising a peptide sequence, or a virus comprising the same, preferentially binds to a particular type of tissue (e.g., an ocular cell or tissue including a retinal cell) over another type of cell or tissue (e.g., brain tissue).

[0045] The terms "protein," "peptide," and "polypeptide" are used interchangeably herein and refer in their broadest sense to a compound of two or more subunit amino acids, amino acid analogs, or peptidomimetics. The terms also encompass modified amino acid polymers; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling moiety.

[0046] The term "amino acid" as used herein refers to natural and / or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.

[0047] As used herein, the peptide may comprise at least one additional amino acid at the C-terminus and / or N-terminus of the peptide. The additional amino acid residues may be added individually or collectively for purposes such as improving productivity, purification, stabilization in vivo or in vitro, coupling, or detection of the complex. For example, the peptide may additionally comprise a cysteine ​​residue at the C-terminus and / or N-terminus of the peptide. The additional amino acid residue may provide a "tag" for purification or detection of the peptide, for example, for interaction of the tag with a specific antibody. In the case of a His6 tag, a tag such as a His6 tag, a (HisGlu)3 tag ("HEHEHE" tag), a "myc" (c-myc) tag, or a "FLAG" tag may be provided for immobilized metal affinity chromatography (IMAC).

[0048] As used herein, the term ocular cells or tissues refers to cells and collections of cells that make up the eye. Ocular cells may be, but are not limited to, photoreceptor cells (e.g., rod cells or cone cells), horizontal cells, bipolar cells, amacrine cells, ganglion cells, Müller cells (Müller glial cells), amacrine cells, retinal pigment epithelial cells (RPE), lens epithelial cells, lens fiber cells, or uveal cells.

[0049] The peptide of the present invention, which is composed of an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, is interpreted to include an amino acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, and also includes a sequence that exhibits substantial identity with the sequence. The substantial identity refers to a sequence that, when the sequence of the present invention and any other sequence are aligned to the greatest extent possible and the aligned sequence is analyzed using an algorithm commonly used in the art, preferably exhibits at least 80% homology, more preferably at least 85% homology, even more preferably at least 90% homology, and most preferably at least 95% homology. Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Smith and Waterman, Adv. Appl. Math. 2:482 (1981); Needleman and Wunsch, J. Mol. Bio. 48:443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al., Nuc. Acids Res. 16:10881-90 (1988); Huang et al., Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al., Meth. Mol. Biol. 24:307-31 (1994). NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol.215:403-10(1990)) is accessible from NCBI (National Center for Biological Information) and can be used in conjunction with sequence analysis programs such as blastp, blastn, blastx, tblastn, and tblastx on the Internet.

[0050] As a peptide used in the present invention, a biologically functional equivalent, which is an amino acid sequence variant that exhibits the same biological activity as a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6 of the present invention, may also be used. Such amino acid mutations are made based on the relative similarity of amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, etc. Analysis of the size, shape, and type of amino acid side chain substituents reveals that arginine, lysine, and histidine are all positively charged residues; alanine, glycine, and serine have similar sizes; and phenylalanine, tryptophan, and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine, and histidine; alanine, glycine, and serine; And phenylalanine, tryptophan, and tyrosine are biologically functional equivalents.

[0051] When introducing mutations, the hydrophobicity index of an amino acid can be considered. Each amino acid is assigned a hydrophobicity index based on its hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cysteine ​​(+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5). The hydrophobic amino acid index is crucial for imparting interactive biological functions to proteins. It is well known that amino acids with similar hydrophobic indices must be substituted to retain similar biological activity. When introducing mutations based on hydrophobic indices, substitutions are preferably made between amino acids with a difference in hydrophobicity index of ±2, more preferably ±1, or even ±0.5.

[0052] Meanwhile, it is also well known that substitutions between amino acids having similar hydrophilicity values ​​result in proteins with equivalent biological activity. As disclosed in U.S. Patent No. 4,554,101, the following hydrophilicity values ​​are assigned to each amino acid residue: arginine (+3.0); lysine (+3.0); aspartate (+3.0±1); glutamate (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5±1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); Phenylalanine (-2.5); Tryptophan (-3.4). When introducing mutations with reference to hydrophilicity values, substitutions are preferably made between amino acids that exhibit a difference in hydrophilicity values ​​of within ± 2, more preferably within ± 1, and even more preferably within ± 0.5.

[0053] Amino acid exchanges in proteins that do not alter the overall activity of the molecule are well known in the art (H.Neurath, RLHill, The Proteins, Academic Press, New York, 1979). The most common exchanges are between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, Asp / Gly.

[0054] In one embodiment of the present invention, the peptide binds to retinal pigment epithelium (RPE).

[0055]

[0056] In one aspect of the present invention, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding the peptide.

[0057] In this specification, the term "nucleic acid molecule" has a meaning that comprehensively includes DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are the basic structural units in nucleic acid molecules, include not only natural nucleotides but also analogues in which the sugar or base portion is modified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).

[0058] It is sufficient for the nucleotide sequence encoding the polypeptide of the present invention to be a nucleotide sequence encoding the amino acid sequence of the peptide, and it is obvious to those skilled in the art that it is not limited to any specific nucleotide sequence.

[0059] This is because even if a mutation occurs in the nucleotide sequence, when the mutated nucleotide sequence is expressed as a protein, there are cases where the protein sequence does not change. This is called codon degeneracy. Therefore, the nucleotide sequence includes a nucleotide sequence that includes functionally equivalent codons, codons that encode the same amino acid (for example, due to codon degeneracy, there are six codons for arginine or serine), or codons that encode biologically equivalent amino acids.

[0060] According to a specific embodiment of the present invention, the sequence of the peptide of the present invention and the nucleotide encoding the peptide are included in the sequence listing attached to this specification.

[0061] A nucleic acid molecule comprising a nucleotide sequence encoding the above peptide is interpreted to also include a nucleotide sequence that exhibits substantial identity to the above nucleotide sequence. The substantial identity refers to a nucleotide sequence that exhibits at least 80% homology, more preferably at least 90% homology, and most preferably at least 95%, 97%, 98%, or 99% homology when the nucleotide sequence of the present invention is aligned with any other sequence to the greatest extent possible and the aligned sequence is analyzed using an algorithm commonly used in the art.

[0062] Considering the variants having biological equivalent activity described above, a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of the peptide of the present invention is interpreted to also include a sequence showing substantial identity with the sequence listed in the sequence listing. The substantial identity means a sequence showing at least 61% homology, more preferably 70% homology, even more preferably 80% homology, and most preferably 90% homology when the sequence of the present invention is aligned with any other sequence to the greatest extent possible and the aligned sequence is analyzed using an algorithm commonly used in the art.

[0063] In one embodiment of the present invention, the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0064]

[0065] In one aspect of the present invention, the present invention provides a viral capsid protein comprising a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0066] The term "viral capsid protein" as used herein refers to the protein shell that encases a viral particle. Capsid proteins play a crucial role in protecting the viral genetic material and facilitating its entry into host cells. The capsid is composed of various protein subunits, which are arranged in a repetitive manner to form a stable structure.

[0067] The structure and properties of the capsid protein of each virus can vary depending on the virus. For example, the structure of the viral capsid protein can be, but is not limited to, a helical capsid, an icosahedral capsid, a complex capsid, a spherical capsid, a helical capsid, a complex symmetric capsid, or a cubic capsid.

[0068] In one embodiment of the present invention, the peptide is inserted into the VP (viral protein) domain of the viral capsid protein.

[0069] The term "VP (Viral Protein)" used herein refers to a structural protein of a virus particle. Each VP is designated by a different number, and each protein forms a specific part of the viral capsid or performs a specific function.

[0070] In one embodiment of the present invention, the peptide is inserted into a heparan sulfate proteoglycan (HSPG) binding motif of a VP (viral protein) domain of a viral capsid protein.

[0071] The term "HSPG (Heparan Sulfate Proteoglycan) binding motif" as used herein refers to a specific amino acid sequence that plays a crucial role in the process of viral binding to and invasion of host cells. HSPG is a glycoprotein present on the cell surface, and various viruses recognize it as a receptor and bind to it, initiating infection.

[0072] In one embodiment of the present invention, the VP is VP1, VP2 or VP3.

[0073] In one embodiment of the present invention, the insertion site of the peptide is a single insertion site between two adjacent amino acids located between amino acids 570-614 of VP1, for example, the insertion site is between two adjacent amino acids located between amino acids 570-610, amino acids 580-600, amino acids 570-575, amino acids 575-580, amino acids 580-585, amino acids 585-590, amino acids 590-600, or amino acids 600-614 of VP1. For example, the insertion site may be between amino acids 580 and 581, amino acids 581 and 582, amino acids 583 and 584, amino acids 584 and 585, amino acids 585 and 586, amino acids 586 and 587, amino acids 587 and 588, amino acids 588 and 589, or amino acids 589 and 590. The insertion site may be between amino acids 575 and 576, amino acids 576 and 577, amino acids 577 and 578, amino acids 578 and 579, or amino acids 579 and 580. The insertion site may be between amino acids 590 and 591, amino acids 591 and 592, amino acids 592 and 593, amino acids 593 and 594, amino acids 594 and 595, amino acids 595 and 596, amino acids 596 and 597, amino acids 597 and 598, amino acids 598 and 599, or amino acids 599 and 600.

[0074] In one embodiment of the present invention, the insertion site of the peptide is the common VP3 region of VP1. The entire sequence of the VP3 protein is also included in VP1 and VP2. Amino acids 202 to 735 of VP1, 65 to 598 of VP2, and 1 to 533 of VP3 have the same sequence. Since this region can be exposed to the outside while maintaining the structural integrity of the capsid protein, it may be a suitable location for inserting the peptide, and it is a site where the inserted peptide is exposed on the surface of the capsid protein and can affect the infectivity of target cells.

[0075] In one embodiment of the present invention, the capsid protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, and SEQ ID NO: 52.

[0076] In one aspect of the present invention, the present invention provides a nucleic acid molecule encoding the capsid protein.

[0077] In the description of nucleic acid molecules, any description that overlaps with the description of nucleic acid molecules encoding the peptides described above is omitted to avoid excessive duplication.

[0078] The modified capsid proteins disclosed herein can be isolated, e.g., purified. In some embodiments, the modified capsids disclosed herein are comprised in a viral vector or viral virion (e.g., recombinant AAV virion rAAV). Viral vectors and / or viral variant virions comprising the modified capsids disclosed herein can be used in vivo or ex vivo methods for treating ocular diseases in primate retinas, e.g., human retinas.

[0079] Also disclosed herein are methods for preparing modified capsid proteins from WT capsid proteins. Exemplary methods for preparing modified capsids are described in Examples 1 and 2 herein.

[0080] In one embodiment of the present invention, the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, and SEQ ID NO: 59.

[0081] In one embodiment of the present invention, the modified capsid protein of the present invention, when present in a viral vector or viral virion, preferably when comprised in an AAV virus, confers increased transduction efficiency of cells to ocular cells or tissues.

[0082]

[0083] In one aspect of the present invention, the present invention provides a viral vector comprising the capsid protein.

[0084] In the present invention, the viral vector has something in common with the peptide or capsid protein in that it includes a peptide or capsid protein that targets the ocular cells or tissues, so description thereof is omitted to avoid excessive duplication of the specification.

[0085] As used herein, the term "viral vector" refers to a gene delivery vehicle developed using the characteristics of a virus. Viral vectors are used in gene therapy, genetic research, vaccine development, and other fields, and utilize the viral infection mechanism to deliver a target gene to specific cells. These vectors are designed to safely deliver genes while eliminating or minimizing the pathogenicity of the virus.

[0086] In one embodiment of the present invention, the viral vector further contains a nucleic acid sequence of a target gene. In a specific embodiment, the target gene encodes a therapeutic agent. In a specific embodiment, the therapeutic agent is an enzyme or an RNAi molecule (e.g., an siRNA, shRNA, or miRNA molecule). In certain embodiments, the therapeutic agent may be, but is not limited to, ataxin 7 mirRNA, RPE65, a VEGF inhibitor or soluble VEGF receptor 1 (sFifl), REP1, L-opsin, Rho, PDE6ß, ABCA4, LRAT, RDS / peripherin, MERTK, IMPDH1, GUCY2D, RDS / peripherin, AIPL1, ABCA4, RPGRIP1, IMPDH1, AIPL1, GUCY2D, LRAT, MERTK, RPGRIP1, RPE65, ABCA4, GNAT2, CNGB3, Rsl, OA1, (OCAI) tyrosinase, P21 WAF-1 / Cipl, PDGF, endostatin, angiostatin, arylsulfatase B, or ß-glucuronidase.

[0087] In the vector of the present invention, the nucleic acid molecule containing the target gene nucleotide sequence is operatively linked to the promoter of the vector.

[0088] As used herein, the term "operably linked" means a functional linkage between a nucleic acid expression regulatory sequence (e.g., a promoter, a signal sequence, or an array of transcription factor binding sites) and another nucleic acid sequence, whereby the regulatory sequence regulates transcription and / or translation of the other nucleic acid sequence.

[0089] The recombinant vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are disclosed in Sambrook et al., Molecular Cloning, Laboratory Manual, Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.

[0090] The vector of the present invention can typically be constructed as a vector for gene transfer, a vector for gene cloning, or a vector for protein expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host.

[0091] For example, when the vector of the present invention uses a eukaryotic cell as a host, a promoter derived from the genome of a mammalian cell (e.g., metallothionine promoter, beta actin promoter, human hemoglobin promoter, and human muscle creatine promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus (CMV) promoter, tk promoter of HSV, mouse mammary tumor virus (MMTV) promoter, LTR promoter of HIV, promoter of Moloney virus, promoter of Epstein-Barr virus (EBV), and promoter of Rous sarcoma virus (RSV)) can be used, which generally have a polyadenylation sequence as a transcription termination sequence.

[0092] In one specific embodiment of the present invention, the transgene, which is the target gene to be delivered, is contained in a vector in the form of a transgene cassette, and the transgene cassette is composed of a promoter-target gene-post-transcriptional regulatory sequence. The post-transcriptional regulatory sequence serves to increase gene expression and enhance the stability of mRNA. The transgene cassette may include a poly A (e.g., bGH poly A) sequence. In one embodiment of the present invention, the promoter is CMV, and the post-transcriptional regulatory sequence is WPRE. Each CMV sequence and WPRE sequence are described in the sequence listing attached to the present specification. In one specific embodiment of the present invention, when the viral vector is an AAV vector, the transgene cassette is flanked within an ITR (Inverted Terminal Repeat) sequence.

[0093] The vector of the present invention may be fused with other sequences to facilitate the purification of polypeptides or proteins expressed therefrom. Examples of such fusion sequences include glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA), and 6-His (hexahistidine; Qiagen, USA).

[0094] Meanwhile, the vector of the present invention includes an antibiotic resistance gene commonly used in the art as a selectable marker, for example, a resistance gene for ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin, and tetracycline.

[0095] The viral vector may be, but is not limited to, for example, retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors (AAV), herpes simplex virus vectors (HSV), or baculovirus vectors.

[0096] In one embodiment of the present invention, the virus is an adeno-associated virus (AAV).

[0097] The term "AAV", "AAV construct", or "recombinant AAV" or "AAV" as used herein refers to an adeno-associated virus of any of the known serotypes, including AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, or scAAV, rhlO, chimeric or hybrid AAV, or any combination, derivative, or variant thereof.

[0098] AAVs are small, non-enveloped, single-stranded DNA viruses. They are non-pathogenic parvoviruses and may require helper viruses such as adenovirus, herpes simplex virus, vaccinia virus, and CMV for replication. Wild-type AAV is common in the general population and is not associated with any known pathology. Hybrid AAVs are AAVs that contain capsid proteins from one AAV serotype and genomic material from another AAV serotype. Chimeric AAVs contain genes and / or protein sequences from two or more AAV serotypes, and may contain mutations in the genetic sequences of those two or more AAV serotypes. An exemplary chimeric AAV may comprise a chimeric AAV capsid, for example, a capsid protein having one or more amino acid regions from two or more AAV serotypes. An AAV variant is an AAV that comprises at least one amino acid mutation in its genome or protein compared to its parent AAV, for example, at least one amino acid mutation in its capsid protein compared to its parent AAV. As used herein, AAV includes avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV, wherein primate AAV refers to AAV that infects non-primates, and wherein non-primate AAV refers to AAV that infects non-primate animals, such as avian AAV that infects avian animals. In some cases, wild-type AAV contains rep and cap genes, wherein the rep gene is required for viral replication and the cap gene is required for synthesis of the capsid protein. The terms "recombinant AAV" and "rAAV" are used interchangeably herein.

[0099] As used herein, the term "recombinant AAV vector" or "AAV vector" or "AAV vector" refers to a vector derived from any of the aforementioned AAV serotypes. In some cases, the AAV vector may comprise, in whole or in part, one or more of the AAV wild-type genes, such as the rep and / or cap genes, and contain functional elements required for packaging and use of AAV viruses for gene therapy. For example, functional inverted terminal repeats or ITR sequences flanking the open reading frame or exogenous sequences cloned therein are known to be important for replication and packaging of AAV virions, but the ITR sequences can be modified, including insertions, deletions, or substitutions of nucleotides from the wild-type nucleotide sequence, such that the AAV is suitable for use in the embodiments described herein, such as gene therapy or a gene delivery system. In some aspects, the disclosure of Wu, Hum Gene Ther. As described in [2007, 18(2):171-82], self-complementary vectors (sc), such as self-complementary AAV vectors, can be used, which can bypass the requirement for viral second-strand DNA synthesis and can lead to higher expression of transgene proteins. In some aspects, AAV vectors can be generated to allow for selection of optimal serotypes, promoters, and transgenes. In some cases, the vectors can be targeted vectors or modified vectors that selectively bind to or infect immune cells. Modified adeno-associated virus (AAV) capsid-containing compositions and methods of using the same are provided herein. The modified AAV capsids can comprise exogenous sequences compared to unmodified AAV capsids. The exogenous sequences can refer to exogenous peptide sequences.AAV capsids can be modified to impart this, and any compositions and / or methods utilizing this can have improved functionality, resulting in better therapeutics, particularly for ocular use.

[0100] The AAV wild-type (WT) genome contains at least three genes: rep, cap, and X. The X gene is located at the 3' end of the genome (nucleotides 3929-4393 in AAV2) and is known to encode proteins with supporting functions in genome replication. The rep gene is located in the first half of the AAV WT genome and encodes a family of non-structural proteins (Rep proteins) required for viral transcription control and replication, as well as for packaging of the viral genome into the newly formed pre-assembled capsid. The second half of the AAV genome contains the cap gene, which encodes the viral proteins (VPs), VP1, VP2, and VP3, and the assembly-activating protein (AAP). Transcription of all VPs, which are capsid monomers, is controlled by a single promoter (p40 in the case of AAV2), resulting in the production of a single mRNA. Splicing (VP1) and an unconventional translation initiation codon (VP2) result in approximately 10-fold lower abundance of VP1 and VP2 compared to VP3. As expected, when encoded by a single gene, AAV VPs share most of their amino acids. Specifically, the entire VP3 sequence is also contained within VP2 and VP1 (the "common VP3 region"), and VP2 and VP1 also share approximately 65 amino acids (the "common VP1 / VP2 region"). Only VP1 contains a unique sequence at its N-terminus (approximately 138 amino acids, unique to VP1). AAP was identified in 2010 as a 23 kD protein encoded by an alternative cap ORF. It is used to stabilize newly produced VP proteins and transport them from the cytoplasm into the cell nucleus. Interestingly, AAV serotypes 1-3, 6-9, and rh10 failed to produce capsids in the absence of AAP, whereas low but detectable capsid production was reported for AAV4 and AAV5.

[0101] In one embodiment of the invention, the AAV may comprise a modification. The modification may be a modification of a polypeptide sequence encoded by rep, cap, and / or X of the AAV. In some cases, the modification may be a modification of the cap polypeptide. The cap polypeptide may have any one of the VP domains modified, for example, VP1, VP2, VP3, or a combination thereof. Other combinations are contemplated, such as modifications in Rep and Cap, Cap and X, Rep and X, and / or Rep, Cap, and X. Any combination of domains may be modified, such as any of the aforementioned VP modifications in combination with Rep and / or X modifications.

[0102] In one embodiment of the present invention, the modification comprises a modification of the AAV capsid. The capsid of an AAV serotype is assembled from 60 VP monomers, each having approximately 50 copies of VP3, 5 copies of VP2, and 5 copies of VP1. The capsid surface structure is composed of five pores or "channel-like structures," each having two depressions, and three protrusions surrounding each three-fold axis of symmetry. The pores allow for exchange between the interior and exterior of the capsid. The depressions, more precisely, the floor of each two-fold axis, are the thinnest portion of the viral capsid. The protrusions around the three-fold axis contain five of the nine so-called variable regions (VRs). Specifically, VRs IV, V, and VIII form loops (loops 1-4) at the top of the protrusions, while VRs VI and VII are found at their base. VR differs between serotypes and is responsible for serotype-specific variations in antibody and receptor binding.

[0103] In one embodiment of the present invention, the modification of an AAV capsid may refer to the insertion of an exogenous peptide sequence. The modification may also refer to the modification of at least one amino acid residue, either canonical or non-canonical, in the polypeptide sequence. The insertion may comprise inserting at least one exogenous amino acid residue into the sequence encoding the AAV capsid.

[0104] In one embodiment of the present invention, the AAV vector comprises a chimeric AAV capsid. The chimeric capsid comprises polypeptide sequences from at least two AAV serotypes. The chimeric capsid may comprise a combination of sequences selected from serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and / or AAV13.

[0105] In one embodiment of the present invention, the AAV vector comprises inverted terminal repeats (ITRs), Rep, Cap, AAP, and X sequences. Typically, the AAV viral genome is flanked by ITRs, which serve as packaging signals and replication origins. The rep gene encodes a family of multifunctional proteins (Rep proteins) responsible for controlling viral transcription, replication, packaging, and integration in AAVS1. For AAV2, four Rep proteins have been described. Expression of Rep78 and Rep68 is controlled by the AAV2-specific p5 promoter, while p19 controls expression of smaller Rep proteins (Rep52 and Rep40). Rep68 and Rep40 are splice variants of Rep78 and Rep52, respectively. Numbers indicate molecular weights. Expression of AAP and the viral capsid proteins VP1 (90 kDa), VP2 (72 kDa), and VP3 (60 kDa), all encoded by the cap gene, is controlled by the p40 promoter. The X gene is located at the 3' end of the genome within a region shared with the cap gene and has its own promoter (p81). The X protein appears to promote viral replication, whereas AAP is essential for capsid assembly. The three different VPs contribute to the icosahedral AAV2 capsid in a ratio of 1 (VP1):1 (VP2):10 (VP3).

[0106] An AAV vector comprising the modified capsid protein can be obtained by inserting an AAV genome comprising the modified cap sequence into a plasmid, transfecting a suitable target host cell (e.g., 293 cells and / or ARPE-19 cells), and then collecting viral particles (e.g., AAV particles) produced by the host cell. An example of a method for producing an AAV vector is described in Example 2 herein.

[0107] In one embodiment of the present invention, the serotype of the adeno-associated virus (AAV) is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10¸ AAV11, AAV12¸ or AAV13.

[0108] In one embodiment of the present invention, the viral vector targets ocular cells or tissues.

[0109] Modifications to AAV provided herein may confer enhanced activity to the modified AAV compared to otherwise unmodified or wild-type AAV. Modifications provided herein may improve cell transduction, tropism, and / or reduce capsid-associated immunogenicity.

[0110] In one embodiment of the present invention, the modifications provided herein enhance cell transduction. Cell transduction may refer to the ability of an AAV to infect a cell (either in vivo or in vitro) and / or deliver a transgene into the cell.

[0111] In one embodiment of the present invention, the modifications provided herein enhance tropism. Enhanced tropism refers to the ability to transduce cells via an extra receptor, compared to otherwise unmodified AAV. In some aspects, enhanced tropism may improve gene therapy using modified AAV by enhancing the infectivity of ocular cells.

[0112] As used herein, the terms "transformed", "transduced" or "transfected" refer to a process by which an exogenous nucleic acid is transferred or introduced into a host cell. A "transformed", "transduced" or "transfected" cell is a cell that has been transformed, transduced or transfected with an exogenous nucleic acid, and the cell includes the cell and progeny cells resulting from passage thereof.

[0113]

[0114] The features and advantages of the present invention are summarized as follows:

[0115] (a) The present invention provides a peptide that targets ocular cells or tissues.

[0116] (b) The present invention provides a nucleic acid molecule encoding the peptide.

[0117] (c) The present invention provides a viral capsid protein comprising the above peptide.

[0118] (d) The present invention provides a nucleic acid molecule encoding the viral capsid protein.

[0119] (e) The present invention provides a viral vector comprising the viral capsid protein.

[0120] (f) When the peptide of the present invention is used, ocular cells or tissues can be effectively targeted, and when a capsid protein or viral vector containing the same is used, genes can be effectively delivered and expressed into ocular cells or tissues.

[0121]

[0122] Figure 1 shows a schematic diagram of the AAV capsid and peptide insertion.

[0123] Figure 2 shows the results of verifying the mRNA expression level of eGFP after 24 to 120 hours of observation of AAV treatment including the peptide of the present invention.

[0124] Figures 3 to 7 show the results of verification of the mRNA expression level of eGFP at 24 hours, 48 ​​hours, 72 hours, 96 hours, and 120 hours after AAV transduction, respectively.

[0125] Figure 8 shows the results of ELISA for verifying the protein expression level of eGFP at 120 hours after AAV transduction.

[0126] Figure 9 is an image showing the results of AAV transduction (120 hours, MOI 1,000).

[0127]

[0128] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0129]

[0130] Example

[0131] Example 1: Peptide screening for capsid protein insertion

[0132] The process for selecting peptides to be used in the production of modified capsid proteins with high gene transfer efficiency was carried out as follows and is shown in Figure 2.

[0133]

[0134] 1.1 Phage Display

[0135] In the present invention, a Ph.D. based on M13 phage is produced to produce a modified capsid protein exhibiting high gene transfer efficiency targeting ocular cells or tissues. TM -Peptides for capsid protein insertion were screened using the C7C phage display library kit (New England Biolabs, E8212). In this study, biopanning was performed over five rounds targeting ARPE-19, a cell line representative of the human eye.

[0136] After removing the culture medium from the ARPE-19 cell line, the cells were washed twice with culture medium from which serum had been removed. Blocking was performed for 30 minutes at 4°C with blocking medium containing 1% bovine serum albumin in the culture medium from which serum had been removed. In round 1, 10 11 As for plaque forming units (PFU), rounds 2 through 5 were 10 11The M13 phage library was added in an amount equivalent to the gene copy number and cultured at 4°C for 1 hour, followed by three washes with DPBS. Afterwards, the M13 phage library was eluted with 1 ml of elution buffer (0.2 M Glycine pH 2.2 with 1 mg / mL BSA) at 4°C for 10 minutes, mixed with 150 μL of neutralization buffer (1 M Tris-HCl pH 9.0), and then recovered. The recovered M13 phage library was mixed with ER2738 E. coli and cultured for 4 hours and 30 minutes at 37°C and 200 rpm. After centrifugation at 12,000 g and 4°C for 10 minutes, the supernatant was collected, and the M13 phage library was precipitated using 20% ​​PEG / 2.5 M NaCl. Afterwards, the precipitated M13 phage library was recovered by centrifugation at 12,000 g and 4°C for 15 minutes and dissolved in TBS. After re-precipitation using 20% ​​PEG / 2.5 M NaCl for 1 hour, the M13 phage library was recovered by centrifugation at 14,000 rpm and 4°C for 10 minutes and stored in TBS.

[0137]

[0138] 1.2 ssDNA extraction, purification, and titer calculation

[0139] Single-stranded DNA extraction and purification from the M13 phage library were performed according to the QIAgen QIAprep M13 Handbook (version 04 / 2012). To calculate the titer of the M13 phage library, the concentration of single-stranded DNA was measured, and the gene copy number was calculated using the following formula.

[0140]

[0141]

[0142] 1.3 Next generation sequencing (NGS) library creation

[0143] For peptide sequence analysis, M13 phage single-stranded DNA was extracted and amplified around the library variable region. This amplification was performed using primers 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGCAATTCCTTTAGTGGTACC-3' (SEQ ID NO: 13) and 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTTCAACAGTTTCGGCCGA-3' (SEQ ID NO: 14) and 25 cycles of 98°C for 10 s, 57°C for 10 s, and 68°C for 30 s, recovering 165 bp of phage genes surrounding and including the 21 bp variable region. The recovered genes were further amplified using 25 cycles of 98°C for 10 s, 57°C for 10 s, and 68°C for 30 s to add adapters for Illumina next-generation sequencing, and primers (SEQ ID NOs: 15 to 34) were combined and used. The 234 bp amplicon was sent to Macrogen after PCR purification and submitted for NGS.

[0144]

[0145] 1.4 NGS analysis

[0146] Raw fastq files obtained from NGS runs were processed using a custom-made template and compared to the native M13 phage single-stranded DNA sequence to refine the 21-bp variable region. The refined sequences underwent additional refinement processes, including removal of mismatched data, amino acid sequence conversion, and summation of duplicate sequences, to obtain the top 20 peptide sequences for each round.

[0147]

[0148] 1.5 Site-directed mutagenesis cloning

[0149] Based on the obtained sequence, a modified capsid plasmid was constructed by site-specific mutagenesis-induced cloning. To insert the 21-bp nucleotide sequence secured between amino acids 587 and 588 into the AAV2 native capsid, primers (SEQ ID NOs: 35 to 44) were used. 25 cycles of 98°C for 10 s, 57°C for 10 s, and 68°C for 4 min were used to obtain a modified cap gene plasmid amplicon. The native plasmid used as a template was removed by DpnI treatment. Afterwards, a modified capsid gene plasmid encoding the VP1 protein with a heptapeptide consisting of a seven-amino acid sequence inserted between amino acid positions 587 and 588 was constructed according to the standard transduction protocol.

[0150]

[0151] Example 2: Production of recombinant AAV

[0152] 2.1 Plasmid construction

[0153] Three plasmid vectors were triple-transfected into HEK293T cells using TransIT-VirusGEN® Transfection Reagent (Takara, MIR 6700) according to the manufacturer's recommended transfection protocol.

[0154] The first vector contains a transgene cassette flanked by inverted terminal repeat (ITR) sequences from a parental AAV virus. The transgene cassette has the structure CMV-EGFP-WPRE (SEQ ID NOs: 60-63) and has a promoter sequence that drives transcription and protein translation of a nucleic acid encoding the fluorescent protein EGFP in the nucleus of a target cell.

[0155] The second vector consists of the AAV Rep gene (SEQ ID NO: 45) and a modified Cap gene (SEQ ID NO: 54-59). The modified Cap gene encodes the VP1 protein with a heptapeptide consisting of a seven-amino acid sequence inserted between amino acid positions 587 and 588.

[0156] The third vector contains genes encoding helper virus proteins required for virus assembly and gene packaging into the modified capsid structure.

[0157]

[0158] 2.2 Virus production

[0159] Viruses were recovered from the medium and cells 72 hours after transfection. Viruses present in the medium were concentrated by precipitation with poly(ethylene glycol) and 500 mM sodium chloride, collected by centrifugation, and resuspended in PBS. Viruses present in the cells were collected by cell lysis. Virus purification was performed using POROS. TM CaptureSelect TM AAVX Affinity Resin (ThermoFisher Scientific, A36741) was used. The AAVX resin was buffer exchanged with 0.1 M NaCl solution, equilibrated with PBS, mixed with the harvested virus, and allowed to settle. After washing five times with PBS, the virus was eluted with elution buffer (0.1 M glycine HCl pH 2.2), and then collected by mixing with neutralization buffer (1 M Tris-HCl pH 9.0). The virus was concentrated and resuspended in PBS. The virus titer was determined by measuring vector genome copies (VG) using the AAVpro® Titration Kit (for Real Time PCR) (Takara, 6233) according to the manufacturer's recommended protocol.

[0160]

[0161] Example 3: Characterization of manufactured AAV capsid variants

[0162] Through screening, we identified AAV capsid variants with superior tropism for ARPE-19 compared to native AAV2. ARPE-19 cells were transduced with AAV2 viruses harboring different mutant capsids, each expressing eGFP under the control of a CMV promoter, at an MOI of 1,000 vg / cell, and eGFP expression was monitored daily until day 5.

[0163]

[0164] 3.1 RT-qPCR

[0165] Five days after transfection, RNA was extracted from ARPE-19 cells using Trizol according to a standard protocol. cDNA was synthesized using SuperScript IV reverse transcriptase (Thermo Fisher Scientific, 18090010) according to the manufacturer's recommended protocol. The introduced genes were then quantified using qPCR. The eGFP gene was amplified using 40 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 30 s using primers 5'-GAACCGCATCGAGCTGAA-3' (SEQ ID NO: 66) and 5'- TGCTTGTCGGCCATGATATAG-3' (SEQ ID NO: 67), and the hGAPDH gene was amplified using 40 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 30 s using primers 5'-AAACCCATCACCATCTTCCAG-3' (SEQ ID NO: 68) and 5'- AGGGGCCATCCACAGTCTTCT-3' (SEQ ID NO: 69), and quantification of the eGFP gene was performed.

[0166]

[0167] 3.2 ELISA

[0168] Five days after transfection, proteins were recovered from ARPE-19 cells using RIPA buffer according to a standard protocol. eGFP was quantified using an eGFP ELISA kit (Abcam, ab171581) according to the manufacturer's recommended protocol. Protein quantification was performed using a BCA kit (ThermoFisher Scientific, 23225) according to the manufacturer's recommended protocol to quantify the level of eGFP expression induced by the virus.

[0169] The results are shown in Figures 2 to 9.

[0170] As shown in Figures 2 to 9, the expression patterns of the 30 candidate groups screened showed similar patterns in all results. In particular, AAV2 containing a modified capsid protein introduced with peptides 3, 4, 6, 16, 19, and 21 (SEQ ID NOs: 1 to 6) showed higher transduction efficiency than the native AAV2 capsid. AAV2 introduced with peptide 3 (SEQ ID NO: 1) transduced genes with approximately 4 times greater efficiency and showed approximately 3 times higher expression than wild-type AAV2. AAV2 introduced with peptides 4 or 6 (SEQ ID NOs: 2, 3) transduced genes with approximately 5 times greater efficiency and showed approximately 6 times higher expression than wild-type AAV2. AAV2 introduced with peptide 16 (SEQ ID NO: 4) transduced genes with approximately 28-fold greater efficiency and showed approximately 8-fold higher expression than wild-type AAV2. AAV2 introduced with peptide 19 (SEQ ID NO: 5) transduced genes with approximately 5-fold greater efficiency and showed approximately 3-fold higher expression than wild-type AAV2. AAV2 introduced with peptide 21 (SEQ ID NO: 6) transduced genes with approximately 6-fold greater efficiency and showed approximately 3-fold higher expression than wild-type AAV2.

Claims

1. A peptide targeting an ocular cell or tissue, comprising an amino acid sequence selected from the group consisting of sequence number 1, sequence number 2, sequence number 3, sequence number 4, sequence number 5, and sequence number 6.

2. A peptide according to claim 1, wherein the peptide binds to retinal pigment epithelium (RPE).

3. A nucleic acid molecule comprising a nucleotide sequence encoding the peptide of claim 1 or 2.

4. A nucleic acid molecule in the third paragraph, wherein the nucleotide sequence is composed of a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO:

12.

5. A viral capsid protein comprising a peptide consisting of an amino acid sequence selected from the group consisting of sequence number 1, sequence number 2, sequence number 3, sequence number 4, sequence number 5, and sequence number 6.

6. A viral capsid protein, wherein the peptide in paragraph 5 is inserted into the VP (viral protein) domain of the viral capsid protein.

7. A capsid protein in which the peptide in paragraph 5 is inserted into a HSPG (heparan sulfate proteoglycan) binding motif of a VP (viral protein) domain of the viral capsid protein.

8. A capsid protein according to claim 7, wherein the VP is VP1, VP2 or VP3.

9. In the fifth paragraph, the capsid protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, and SEQ ID NO:

52.

10. A nucleic acid molecule encoding the capsid protein of any one of claims 5 to 9.

11. A nucleic acid molecule according to claim 10, wherein the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, and SEQ ID NO:

59.

12. A viral vector comprising the capsid protein of any one of claims 5 to 9.

13. A viral vector according to claim 12, wherein the virus is an adeno-associated virus (AAV).

14. A viral vector according to claim 13, wherein the serotype of the adeno-associated virus (AAV) is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10¸ AAV11, AAV12¸ or AAV13.

15. A viral vector according to claim 12, wherein the viral vector targets ocular cells or tissues.

Images