Novel antioxidant and Anti-aging peptide, and use thereof

Abstract

The present invention relates to a novel anti-aging peptide. It has been experimentally identified that the anti-aging peptide according to the present invention has high skin permeability and has remarkable antioxidant activity, reduces skin wrinkles, improves skin elasticity, and inhibits collagenase or hyaluronidase. Therefore, the anti-aging peptide of the present invention has excellent anti-aging activity, and thus can be variously used as a functional material in the fields of pharmaceuticals, medicinal products, cosmetics and food.

Description

Novel antioxidant / anti-aging peptides and their uses

[0001] The present invention relates to a novel anti-aging peptide.

[0002] Reactive oxygen species (ROS), generated during the human body's metabolic processes, can damage cell membranes, proteins, and DNA, contributing to aging and disease. Free radicals and other reactive oxygen species (ROS) can be produced as byproducts of oxidation in living organisms. Prolonged oxidative stress is implicated in the development of various diseases, including cardiovascular disease and cancer. Oxidative damage to DNA, proteins, and other macromolecules is known to constitute a major type of endogenous damage that leads to aging.

[0003] Antioxidants are substances that inhibit oxidation reactions, and are a general term for substances that eliminate or attenuate the action of oxidizing substances, including hydroxyl radicals, superoxide anions, and hydrogen peroxide, also known as reactive oxygen species or oxygen free radicals. Synthetic antioxidants such as BHA (butylated hydroxy-anisole) and BHT (butylated hydroxytoluene) are commercially available and in use, but DNA damage and toxicity caused by these derivatives have recently been discovered.

[0004] Accordingly, interest in and demand for natural antioxidants that are harmless to the human body are increasing, and exploration of various antioxidants derived from natural products is underway.

[0005] Accordingly, the inventors of the present invention completed the present invention by developing peptides NGT2 and NGT3 while searching for novel anti-aging substances and experimentally confirming their anti-aging activity.

[0006] Therefore, the purpose of the present invention is to provide a novel anti-aging peptide and an anti-aging composition comprising the same.

[0007] In order to achieve the above object, the present invention provides a peptide composed of 60 to 150 amino acids and including an antioxidant amino acid, wherein the antioxidant amino acid is at least one selected from the group consisting of tyrosine (Tyr, Y), cysteine ​​(Cys, C), valine (Val, V), phenylalanine (Phe, F), lysine (Lys, K), histidine (His, H), arginine (Arg, R), valine (Val, V), phenylalanine (Phe, F), and methionine (Met, M), and wherein tyrosine (Tyr, Y), tryptophan (Trp, W) and cysteine ​​(Cys, C) account for 33% or more of the total amino acids, and valine (Val, V) and phenylalanine (Phe, F) account for 4% or less, and the ratio of the total antioxidant amino acids is 54% or more of the total amino acids of the peptide.

[0008] In addition, the present invention provides a peptide comprising an amino acid sequence represented by SEQ ID NO: 13, excluding a signal peptide sequence, and consisting of 60 to 150 amino acids, wherein the peptide comprises tyrosine (Tyr, Y), tryptophan (Trp, W) and cysteine ​​(Cys, C) at 33% or more of the total amino acids, and valine (Val, V) and phenylalanine (Phe, F) at 4% or less.

[0009] The present invention also provides a polynucleotide encoding the peptide.

[0010] The present invention also provides a recombinant vector comprising the polynucleotide; and a transformed cell into which the recombinant vector has been introduced.

[0011] The present invention also provides an anti-aging composition comprising the peptide.

[0012] The present invention also provides a cosmetic composition comprising the peptide.

[0013] The present invention also provides a food composition comprising the peptide.

[0014] The present invention also provides a pharmaceutical composition for preventing or treating a disease caused by oxidative stress, comprising the peptide.

[0015] The present invention also provides a method for treating a disease caused by oxidative stress, comprising a step of administering the peptide to a subject in need thereof.

[0016] The anti-aging peptide of the present invention not only exhibits high skin penetration ability, but also experimentally demonstrates significant antioxidant, wrinkle-improving, skin elasticity-enhancing, and collagenase- and hyaluronic acid-decomposing enzyme-inhibiting effects. This demonstrates that the anti-aging peptide of the present invention possesses superior anti-aging activity, making it a versatile functional material for use in various fields, including pharmaceuticals, medicines, cosmetics, and food.

[0017] FIG. 1 is a diagram showing vector maps of recombinant vectors pET-NGT1, pET-NGT2, pET-NGT3 and pET-NGT4 for expressing recombinant polypeptides NGT1, NGT2, NGT3 and NGT4 according to the present invention.

[0018] FIG. 2A is a diagram showing the expression pattern and purification results of recombinant polypeptides NGT1 and NGT4 and NGT2 and NGT3 according to the present invention in E. coli BL21 (DE3) strain (S; soluble fraction, IS; insoluble fraction, FT; flow through purification resin, W; resin wash fraction, P; purified elution fraction, WC; whole cell, arrow; recombinant polypeptide).

[0019] FIG. 2B is a diagram showing the expression pattern and purification results of recombinant polypeptides NGT2 and NGT3 according to the present invention in E. coli Origami B (DE3) strain (S; soluble fraction, IS; insoluble fraction, FT; flow through purification resin, W; resin wash fraction, P; purified elution fraction, arrow; recombinant polypeptide).

[0020] Figure 3 is a diagram showing the results of confirming the antioxidant activity of recombinant polypeptides NGT1, NGT2, NGT3, and NGT4 according to the present invention through ABTS assay and DPPH assay.

[0021] Figure 4 is a diagram showing the results of evaluating the skin penetration ability of recombinant polypeptides NGT1, NGT2, NGT3, and NGT4 according to the present invention through a Franz cell diffusion assay.

[0022] Figure 5 is a diagram showing the results of analyzing the amino acid composition of the recombinant polypeptide NGT2 according to the present invention.

[0023] Figure 6 is a diagram showing the results of analyzing the amino acid composition of the recombinant polypeptide NGT3 according to the present invention.

[0024] Hereinafter, the present invention will be described in detail.

[0025] According to an aspect of the present invention, the present invention provides a peptide consisting of 60 to 150 amino acids; and a polynucleotide encoding the same.

[0026] The above peptide is composed of 60 to 150 amino acids and is a peptide including an antioxidant amino acid, wherein the antioxidant amino acid is at least one selected from the group consisting of tyrosine (Tyr, Y), cysteine ​​(Cys, C), valine (Val, V), phenylalanine (Phe, F), lysine (Lys, K), histidine (His, H), arginine (Arg, R), valine (Val, V), phenylalanine (Phe, F), and methionine (Met, M), and tyrosine (Tyr, Y), tryptophan (Trp, W) and cysteine ​​(Cys, C) are included at 33% or more of the total amino acids, and valine (Val, V) and phenylalanine (Phe, F) are included at 4% or less, and the proportion of the total antioxidant amino acids may be 54% or more of the total amino acids of the peptide.

[0027] In addition, the peptide may be a peptide comprising an amino acid sequence represented by SEQ ID NO: 13, excluding a signal peptide sequence, and consisting of 60 to 150 amino acids, and comprising tyrosine (Tyr, Y), tryptophan (Trp, W) and cysteine ​​(Cys, C) at 33% or more of the total amino acids, and valine (Val, V) and phenylalanine (Phe, F) at 4% or less.

[0028] In the present invention, a peptide refers to a linear molecule formed by amino acid residues linked together by peptide bonds. The peptide may be manufactured using chemical synthesis methods known in the art, preferably using solid-phase synthesis techniques, but is not limited thereto.

[0029] In a preferred embodiment of the present invention, the peptide may preferably consist of 60 to 130 amino acids, and preferably 63 or 124 amino acids.

[0030] In a specific embodiment of the present invention, the peptide may be a soluble peptide.

[0031] In the present invention, the antioxidant amino acid refers to an amino acid that has antioxidant activity itself. Antioxidant amino acids include tyrosine (Tyr, Y), tryptophan (Trp, W), cysteine ​​(Cys, C), lysine (Lys, K), histidine (His, H), arginine (Arg, R), valine (Val, V), phenylalanine (Phe, F), and methionine (Met, M). In particular, tyrosine and cysteine ​​exhibit strong antioxidant activity on their own.

[0032] In a specific embodiment of the present invention, the peptide comprises an amino acid sequence represented by SEQ ID NO: 13.

[0033] In a specific embodiment of the present invention, it is preferred that the peptide does not include a signal peptide sequence. The signal peptide is composed of 'YKLVVLTLVCLCFVQ (SEQ ID NO: 14)'.

[0034] In a specific example of the present invention, the peptide is composed of an amino acid sequence represented by SEQ ID NO: 2 or 3, and these are named 'NGT2 (SEQ ID NO: 2)' and 'NGT3 (SEQ ID NO: 3)', respectively.

[0035] In a specific embodiment of the present invention, the peptide may be linked to a cell penetrating peptide (CPP) or an expression enhancing tag at the N-terminus or C-terminus.

[0036] In the present invention, the cell-penetrating peptide is a short peptide that promotes cellular uptake and absorption of molecules, and is utilized to deliver compounds into cells for research and pharmaceutical purposes.

[0037] In the present invention, the expression enhancement tag refers to a protein tag for protein expression, separation and purification, etc. Examples of expression enhancement tags include polyhistidine tag, 6xHis tag, GST (Glutathione-S-Transferase), HiBiT Peptide Tag, etc.

[0038] In a specific embodiment of the present invention, the peptide preferably possesses anti-aging activity. The aging may be skin aging, and preferably photoaging or natural aging. Examples of the anti-aging activity include antioxidant activity, wrinkle improvement, skin elasticity improvement, collagenase inhibition, or hyaluronic acid decomposition enzyme inhibition, but the scope of the present invention is not limited thereto.

[0039] In the present invention, 'improvement' means any action that at least reduces the degree of symptoms, for example, a parameter related to alleviation or treatment of a condition.

[0040] In the present invention, ‘improvement of skin wrinkles’ or ‘improvement of skin elasticity’ means any action that increases the total amount of collagen or hyaluronic acid (or suppresses a decrease in the total amount) by inhibiting collagen decomposition enzyme or hyaluronic acid decomposition enzyme.

[0041] The scope of the present invention includes functional equivalents of the peptide represented by the amino acid sequence of SEQ ID NO: 2 or 3.

[0042] In the present invention, a functional equivalent refers to a peptide having at least 80%, preferably 90%, and more preferably 95% sequence homology (i.e., identity) with the amino acid sequence represented by SEQ ID NO: 2 or 3 as a result of addition, substitution, or deletion of amino acids, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology, and exhibiting substantially the same physiological activity as the peptide represented by the amino acid sequence of SEQ ID NO: 2 or 3. In addition, the peptide represented by the amino acid sequence of SEQ ID NO: 2 or 3 of the present invention includes not only a protein having its native amino acid sequence but also an amino acid sequence variant thereof within the scope of the present invention. A variant of the peptide represented by the amino acid sequence of SEQ ID NO: 2 or 3 refers to a peptide having a sequence that differs from the native amino acid sequence of the peptide by deletion, insertion, non-conservative or conservative substitution of one or more amino acid residues, or a combination thereof. Amino acid exchanges in proteins and peptides that do not alter the overall activity of the molecule are well known in the art. The peptide represented by the amino acid sequence of SEQ ID NO: 2 or 3 or a variant thereof may be extracted from nature, synthesized, or produced by a genetic recombination method based on a DNA sequence.

[0043] Furthermore, the sequence homology can be determined by standard methods commonly used to compare similar portions of the amino acid sequences that make up peptides. Computer programs such as BLAST or FASTA align two or more proteins so that the amino acids that make up each protein optimally match (along the full-length sequence of one or both sequences or along predicted portions of one or both sequences). The programs provide default opening penalties and default gap penalties, and provide scoring matrices such as PAM250 (a standard scoring matrix) that can be used in conjunction with the computer program. For example, sequence homology expressed as a percentage can be calculated as follows: the total number of indentical matches is multiplied by 100, and then divided by the sum of the length of the longer sequence within the corresponding span and the number of gaps introduced into the longer sequence to align the two sequences.

[0044] In the present invention, substantially homogeneous physiological activity means anti-aging activity, and more specifically, it means at least one activity selected from the group consisting of antioxidant activity, skin wrinkle improvement activity, skin elasticity improvement activity, collagen decomposition enzyme inhibition, and hyaluronic acid decomposition enzyme inhibition.

[0045] Additionally, the scope of the above functional equivalents includes derivatives in which the basic backbone of the peptide represented by the amino acid sequence of SEQ ID NO. 2 or 3 and some of the chemical structures of the constituent amino acids are modified while maintaining anti-aging activity. For example, this includes structural modifications to alter the stability, storability, volatility, or solubility of the protein.

[0046] In a specific embodiment of the present invention, the polynucleotide preferably consists of a base sequence of SEQ ID NO: 5 or 6. The base sequence of SEQ ID NO: 5 encodes NGT2 (SEQ ID NO: 2), and the base sequence of SEQ ID NO: 6 encodes NGT3 (SEQ ID NO: 3).

[0047] The scope of the present invention includes variants of the above base sequence. Specifically, the gene refers to a sequence that has a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more with the base sequence of SEQ ID NO: 5 or 6, and exhibits substantially the same physiological activity as the base sequence represented by SEQ ID NO: 5 or 6. The "% of sequence homology" for a polynucleotide is determined by comparing a comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to a reference sequence (which does not include additions or deletions) for the optimal alignment of the two sequences.

[0048]

[0049] According to another aspect of the present invention, the present invention provides a recombinant vector comprising the polynucleotide; and a transformed cell into which the recombinant vector has been introduced.

[0050] In the present invention, the 'vector' refers to a means for expressing a target gene in a host cell. Examples thereof include plasmid vectors, cosmid vectors, and viral vectors such as bacteriophage vectors, adenovirus vectors, retrovirus vectors, and adeno-associated virus vectors. Vectors that can be used as the above recombinant vectors can be produced by manipulating plasmids frequently used in the art (e.g., pGLS, pSC101, pGV1106, pACYC177, ColE1, pKT230, ME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, and pUC19, etc.), phages (e.g., λgt4λB, λCharon, λΔz1, and M13, etc.), or viruses (e.g., CMV, SV40, etc.).

[0051] In the above recombinant vector, the polynucleotides encoding CYP3A4, CYP1A2, CYP2B6, CYP2D6, CYP2C9, CYP2C19, CYP2E1 and CYP2A6 can be operably linked to a promoter. The term "operably linked" refers to a functional linkage between a nucleotide expression regulatory sequence (e.g., a promoter sequence) and another nucleotide sequence. Thus, the regulatory sequence can regulate transcription and / or translation of the other nucleotide sequence.

[0052] The recombinant vector may be constructed typically as a cloning vector or an expression vector. The expression vector may be any vector commonly used in the art to express foreign proteins in plants, animals, or microorganisms. The recombinant vector may be constructed using various methods known in the art.

[0053] The above recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when a eukaryotic cell is used as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, the CMV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionine promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus (CMV) promoter, and a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0054] In a preferred embodiment of the present invention, the recombinant vector of the present invention can be represented as the vector map of Fig. 1.

[0055] Any host cell known in the art can be used as the host cell, and as a prokaryotic cell, for example, E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. Bacillus strains such as coliW3110, Bacillus subtilis, and Bacillus thuringiensis, and enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species, and in the case of transformation into eukaryotic cells, yeast (Saccharomyce cerevisiae), insect cells, plant cells, and animal cells, for example, SP2 / 0, CHO (Chinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS-7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines can be used as host cells.

[0056]

[0057] According to another aspect of the present invention, the present invention provides an anti-aging composition comprising the peptide. The anti-aging composition may be a pharmaceutical, food, or cosmetic composition.

[0058] In a specific embodiment of the present invention, the anti-aging may be antioxidant, skin wrinkle improvement, skin elasticity improvement, collagen decomposition enzyme inhibition, or hyaluronic acid decomposition enzyme inhibition.

[0059] The anti-aging composition of the present invention may further include one or more known ingredients having anti-aging activity, and may further include a substance for preserving, maintaining, and promoting the activity of the peptide, which is an effective ingredient.

[0060]

[0061] According to another aspect of the present invention, the present invention provides a cosmetic composition comprising the peptide. The cosmetic composition may be an anti-aging cosmetic composition.

[0062] In addition to the above-described effective ingredients, the cosmetic composition of the present invention may further include conventional auxiliary ingredients and carriers, such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances, which are commonly used in cosmetic compositions. For example, the cosmetic composition may further include auxiliary ingredients, such as glycerin, butylene glycol, polyoxyethylene hydrogenated castor oil, tocopheryl acetate, polydeoxyribonucleotide, hyaluronic acid, citric acid, panthenol, squalane, sodium citrate, and allantoin.

[0063] Since the cosmetic composition of the present invention is basically applied to the skin, it can be manufactured into any formulation that is commonly manufactured with reference to cosmetic compositions in the art. For example, it can be formulated into a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited thereto. More specifically, it can be manufactured into the formulation of a flexible toner, a nourishing toner, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, cleansing water, a mask pack, a spray, or a powder.

[0064] When the formulation of the present invention is a paste, cream or gel, the carrier component may include animal oil, vegetable oil, wax, paraffin, petrolatum, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc.

[0065] When the formulation of the present invention is a powder or spray, the carrier component may include lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, etc., and in particular, when it is a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, dimethyl ether, etc.

[0066] When the formulation of the present invention is a solution or emulsion, the carrier component may include a solvent, a solubilizer, an emulsifier, etc., and specifically, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, fatty acid ester of sorbitan, etc.

[0067] When the formulation of the present invention is a suspension, the carrier component may include a liquid diluent such as water, ethanol, or propylene glycol; a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, or polyoxyethylene sorbitan ester; microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tragacanth.

[0068] When the formulation of the present invention is a surfactant-containing cleansing agent, the carrier component may include fatty alcohol sulfate, fatty alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, ethoxylated glycerol fatty acid ester, etc.

[0069]

[0070] According to another aspect of the present invention, the present invention provides a food composition comprising the peptide. The food composition may be an anti-aging food composition.

[0071] The food composition according to the present invention can be used as a health functional food, food additive or dietary supplement.

[0072] When the peptide represented by the amino acid sequence of the above sequence number 2 or 3 is used as a food additive, it can be used appropriately according to a conventional method, such as adding the mixture as is or mixing it with other foods or food ingredients.

[0073] In addition, the amount of the peptide represented by the amino acid sequence of the above sequence number 2 or 3 may be suitably changed depending on the purpose of use (prevention, health or therapeutic treatment), and it is preferably included in an amount of 0.01 to 95 wt% based on the total weight of the food composition, and more preferably in an amount of 1 to 80 wt%. If the content is less than 0.01 wt%, the antioxidant or anti-inflammatory effect may be minimal, and if it exceeds 95 wt%, the effect increase rate compared to the amount used may be low, which may be uneconomical.

[0074] As a specific example, when manufacturing food or beverage, the peptide represented by the amino acid sequence of SEQ ID NO: 2 or 3 of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw material. However, when consumed for long periods of time for the purpose of health and hygiene or health control, the peptide may be added in an amount below the above range, and since there are no safety issues, the active ingredient may also be used in an amount above the above range.

[0075] There is no particular limitation on the type of the above food, but examples of foods to which the peptide represented by the amino acid sequence of sequence number 2 or 3 of the present invention can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and include all health foods in the conventional sense.

[0076] When the food composition of the present invention is manufactured into a beverage, it may contain various flavoring agents or additional ingredients such as natural carbohydrates, as in conventional beverages. The natural carbohydrates may include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; natural sweeteners such as dextrin and cyclodextrin; and synthetic sweeteners such as saccharin and aspartame. The natural carbohydrates are contained in an amount of 0.01 to 10 wt%, preferably 0.01 to 0.1 wt%, based on the total weight of the food composition of the present invention.

[0077] The food composition of the present invention may include various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., and may include fruit pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages, but is not limited thereto. These components may be used independently or in combination. The proportion of the above additives is not particularly limited, but is preferably included within the range of 0.01 to 0.1 wt% with respect to the total weight of the food composition of the present invention.

[0078] In the case of long-term consumption for the purpose of health and hygiene or health control, the food composition of the present invention can be taken for a long period of time because there is no problem in terms of safety.

[0079]

[0080] According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating a disease caused by oxidative stress, comprising the peptide.

[0081] In the present invention, the term "prevention" means any act of suppressing or delaying the symptoms of a disease caused by oxidative stress by administering the pharmaceutical composition of the present invention, and the term "treatment" means any act of improving or beneficially changing a disease caused by oxidative stress by the pharmaceutical composition of the present invention.

[0082] In the present invention, the 'oxidative stress' is caused by an imbalance between the generation of reactive oxygen species (ROS), such as free radicals such as superoxide, peroxide, and hydroxyradicals, and the removal of reactive oxygen species and the regeneration of damaged complex substances. Oxidative stress induces various cellular harmful reactions, such as lipid peroxidation and cell death.

[0083] In a specific example of the present invention, the disease caused by oxidative stress may be a disease caused by the production of reactive oxygen species or the removal of reactive oxygen species, and examples thereof include osteomyelitis, acquired immunodeficiency syndrome, cardiovascular disease, cancer, coronary artery disease, Alzheimer's disease, Parkinson's disease, Huntington's disease, chronic kidney disease, alcoholic liver disease, obstructive pulmonary disease, insulin resistance syndrome, or diabetes, but the scope of the present invention is not limited thereto.

[0084] The pharmaceutical composition of the present invention can be formulated and used in various forms according to conventional methods. For example, it can be formulated in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, and syrups, and can be formulated and used in the form of topical preparations, suppositories, and sterile injectable solutions. Specifically, it can be used in the form of liquids, ointments, creams, lotions, sprays, patches, gels, or aerosols.

[0085] In addition, it may further include pharmaceutically acceptable carriers, excipients, and diluents depending on each formulation. In addition, it may be formulated and used in the form of external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. and sterile injection solutions according to conventional methods, and preferably may have a cream, gel, patch, spray, ointment, oral preparation, lotion, liniment, paste, or cataplasma preparation. For example, in the case of external preparations for skin used locally on the relevant area, it may include conventional additives such as preservatives, solvents that assist drug penetration, and emollients in the case of ointments and creams, and may contain conventional carriers such as ethanol or oleyl alcohol. Suitable formulations known in the relevant technical field are preferably those disclosed in the literature, but are not limited thereto.

[0086] The carrier, excipient and diluent include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, polydeoxyribonucleotide, hyaluronic acid, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, etc. When formulating or formulating the pharmaceutical composition, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are prepared by mixing the composition with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, etc. Non-aqueous solvents and suspending agents may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases may include witepsol, macrogol, Tween 61, cocoa butter, laurin, and glycerogelatin. These ingredients may be added independently or in combination with the active ingredient.

[0087] In the present invention, administration means providing the pharmaceutical composition of the present invention to a subject by any appropriate method.

[0088] The pharmaceutical composition of the present invention may be administered in a therapeutically effective amount, which is an amount of the active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue, animal, or human, as considered by a researcher, veterinarian, physician, or other clinician, i.e., an amount that induces alleviation of the symptoms of the disease or disorder being treated. It will be apparent to those skilled in the art that the therapeutically effective dosage and frequency of administration of the pharmaceutical composition of the present invention will vary depending on the desired effect. Therefore, the optimal dosage to be administered can be readily determined by those skilled in the art, and can be adjusted according to various factors, including the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of formulation, the patient's age, weight, general health, sex, and diet, the time of administration, the route of administration, and the excretion rate of the composition, the treatment period, and concurrently used drugs.

[0089] The pharmaceutical composition of the present invention can be administered in an amount of 1 to 10,000 mg / kg / day, preferably 1 to 200 mg / kg / day, and can be administered once a day or divided into several doses.

[0090]

[0091] According to another aspect of the present invention, a method for treating a disease caused by oxidative stress is provided, comprising the step of administering the peptide to a subject in need thereof.

[0092] In a specific example of the present invention, the subject may be, but is not limited to, a subject expected to develop a disease caused by oxidative stress; a subject that has developed the disease; or a subject that has been judged to be cured.

[0093] In a specific example of the present invention, the disease caused by oxidative stress may be a disease caused by the production of reactive oxygen species or the removal of reactive oxygen species, and examples thereof include osteomyelitis, acquired immunodeficiency syndrome, cardiovascular disease, cancer, coronary artery disease, Alzheimer's disease, Parkinson's disease, Huntington's disease, chronic kidney disease, alcoholic liver disease, obstructive pulmonary disease, insulin resistance syndrome, or diabetes, but the scope of the present invention is not limited thereto.

[0094]

[0095] Duplicate contents are omitted in consideration of the complexity of this specification, and terms not otherwise defined in this specification have meanings commonly used in the technical field to which the present invention belongs.

[0096] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0097]

[0098] Example 1. Production of recombinant polypeptide

[0099] 1-1. Gene synthesis and expression vector cloning for the production of recombinant polypeptides NGT1 and NGT4.

[0100] The present inventors designed recombinant polypeptides NGT1 and NGT4. The designed recombinant polypeptides NGT1 and NGT4 are represented by the amino acid sequences of SEQ ID NOs: 1 and 4, respectively.

[0101] Specifically, NGT4 was synthesized by PCR from a fragment gene from NGT1 to optimize the entire sequence (GenBank accession no. Q27409) for production in E. coli, and the NGT4 gene (SEQ ID NO: 8) was produced. NdeI-XhoI restriction enzyme sequences were added to the 5' and 3' ends, respectively, and the synthesized gene was cloned into the pET-22b(+) vector treated with the same restriction enzymes, NdeI and XhoI, and the completed vector was named pET-NGT4. The NGT4 gene (SEQ ID NO: 8) was a fragment designed from NGT1, and the amplified DNA fragment was obtained by PCR using the primers in Table 1 below and cloned into the vector pET-22b(+). The completed vectors were named 'pET-NGT1' and 'pET-NGT4', respectively, and their vector maps are shown in Fig. 1.

[0102] Primer name Primer sequence (5' → 3') NGT4_F (SEQ ID NO: 11) FGGGCATATGGCGAAACCGAGCTATCCGNGT4_R (SEQ ID NO: 12) RGGGCTCGAGTTTGTATGTCGGCGGGTAAGACG

[0103] 1-2. Gene synthesis and expression vector cloning for the production of recombinant polypeptides NGT2 and NGT3.

[0104] The entire sequence (GenBank accession no. KF318692) was modified and synthesized to optimize production in E. coli, producing the NGT2 gene (SEQ ID NO: 5). The NGT2 gene was synthesized by adding NdeI-6xHis XhoI restriction enzyme sequences to the 5' and 3' ends, respectively. The synthesized gene was cloned into the pET-22b(+) vector treated with the same restriction enzymes, NdeI and XhoI, and the completed vector was named pET-NGT2.

[0105] The NGT3 gene (SEQ ID NO: 6) is a fragment designed from NGT2, and a DNA fragment amplified through PCR using the primers in Table 2 below was obtained.

[0106] Primer name Primer sequence (5' → 3') NGT3_F (SEQ ID NO: 9) FAGAAGCATATGTGTCGTAACGGCGGCACCTGTAAAAAACGCNGT3-His_R (SEQ ID NO: 10) RAAAACTCGAGTCAGTGGTGGTGGTGGTGGTGGTGGTAGTAACCGTACGGGCAAGAGCATTTATAGTACGGG

[0107] The amplified DNA fragment has NdeI-6xHis XhoI restriction enzyme sequences at the 5' and 3' ends. The amplified DNA fragment was treated with restriction enzymes NdeI and XhoI and cloned into the expression vector pET-22b(+), and the completed vector was named pET-NGT3. The vector maps of the completed vectors pET-NGT2 and pET-NGT3 are shown in Fig. 1.

[0108]

[0109] 1-3. Strain cultivation

[0110] For vector construction of Figure 1, Escherichia coli DH5a strain was used, and for polypeptide expression, Escherichia coli BL21(DE3) and Origami B(DE3) strains were used. E. coli was cultured in TB (terrific broth) medium at 37°C and 200 rpm, and the culture medium contained 100 ug / mL of ampicillin. For protein expression, IPTG (isopropyl-β-D-thiogalactopyranoside) was added, and the temperature was lowered to 25°C if necessary for culture.

[0111]

[0112] 1-4. Protein expression and cell fractionation

[0113] The four recombinant vectors produced in Examples 1-1 and 1-2 were transformed into E. coli BL21 (DE3) and origami B (DE3) strains, respectively. The transformed E. coli were cultured at 37°C and 200 rpm. The cell concentration was OD 600When it reached 0.6 to 0.8, 1 mM IPTG (isopropyl-β-D-thiogalactopyranoside) was added and cultured at 37°C for 12 hours. In addition, 0.1 mM IPTG was added for soluble expression and cultured at 25°C for 12 hours.

[0114] OD based on final volume of 10 mL after culture 600 The solution was diluted to 1.0 and centrifuged at 4°C and 4,500×g for 10 minutes to harvest the cells. The harvested cells were resuspended using lysis buffer (50 mM Tris, 300 mM NaCl, 10 mM imidazole, pH 8.0). The resuspended cells were disrupted by ultrasonication in ice-water. The lysate was centrifuged at 4°C and 10,000×g for 10 minutes to obtain the supernatant and pellet. The obtained supernatant was named the soluble fraction (S), and the pellet was resuspended in the same volume of lysis buffer and named the insoluble fraction (IS).

[0115]

[0116] 1-5. Purification of recombinant polypeptides

[0117] Ni-NTA resin (QIAGEN, Germany) was added to the soluble fraction obtained from the above soluble fraction (S) and reacted. In addition, to minimize nonspecific binding, the protein was washed with wash buffer (50 mM sodium phosphate, 300 mM NaCl, 60 mM imidazole, pH 8.0), and then purified using elution buffer (50 mM sodium phosphate, 300 mM NaCl, 300 mM imidazole, pH 8.0). Each purified product (P) was subjected to SDS-PAGE for identification. For the insoluble fraction (IS) corresponding to NGT1, the protein was purified through an SP column after acetic acid extraction.

[0118] In addition, a large amount of polypeptide powder was produced by purifying in bulk using FPLC (fast protein liquid chromatography) under the conditions described above, dialyzing (0.1% acetic acid), and then freeze-drying.

[0119] The recombinant polypeptides NGT1 and NGT4 obtained in this example are represented by the amino acid sequences of SEQ ID NOs: 1 and 4, respectively, and NGT2 and NGT3 are represented by the amino acid sequences of SEQ ID NOs: 2 and 3, respectively. In addition, the recombinant polypeptides NGT2 and NGT3 include a conserved sequence represented by the amino acid sequence of SEQ ID NO: 13.

[0120]

[0121] Example 2. Expression analysis of recombinant polypeptides

[0122] The cell fraction of Example 1 was separated using SDS-PAGE (Sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The separated proteins were then stained with Coomassie blue to analyze the expression patterns of four recombinant polypeptides (NGT1, NGT2, NGT3, NGT4) according to the culture time (16 or 18 hours). In addition, the cell fraction of Example 1 was purified. The expression patterns of the four recombinant polypeptides (NGT1, NGT2, NGT3, NGT4) of Example 1 and the purification results in the E. coli BL21 (DE3) strain are shown in Fig. 2A. In addition, the expression patterns of the two recombinant polypeptides (NGT2, NGT3) of Example 1 and the purification results in the E. coli Origami B (DE3) strain are shown in Fig. 2B.

[0123] As shown in Figure 2A, when NGT1 (approximately 22.6 kDa), NGT4 (approximately 8 kDa), NGT2 (approximately 15 kDa), and NGT3 (approximately 8 kDa) were expressed in E. coli BL21 (DE3) (1 mM IPTG, 37°C conditions), it was confirmed that NGT1 was expressed in the insoluble fraction (IS), NGT4 was expressed in the soluble fraction (S), and NGT2 and NGT3 were expressed in the insoluble fraction (IS).

[0124] As shown in Figure 2B, when NGT2 and NGT3 were expressed in E. coli origami B (DE3) (0.1 mM IPTG, 25°C), it was confirmed that both were expressed as soluble fractions (S).

[0125] The above results indicate that all four recombinant polypeptides of Example 1 are well expressed in E. coli, and that the expression pattern can be controlled according to the intended use to obtain a structural or amorphous polypeptide.

[0126]

[0127] Example 3. Evaluation of antioxidant activity of recombinant polypeptides

[0128] In this example, the antioxidant activity of the recombinant polypeptide manufactured in Example 1 was evaluated. Trolox, Ascorbic acid, GSH, NAC, Tocopherol, Resveratrol, Retinol, Nicotanic acid, and Coenzyme Q10, which are known as antioxidant substances in the art, were used as controls in this experiment.

[0129]

[0130] - ABTS assay

[0131] ABTS cationic radical (ABTS) *+ ), 7.4 mM ABTS (2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt) solution was mixed with 2.6 mM potassium persulfate (final concentration) and reacted in a dark room at room temperature for 12 to 16 hours. ABTS *+ The solution was adjusted to an absorbance of 0.70±0.03 at 734 nm using PBS buffer (pH 7.4) before use. 50 μL of each sample and ABTS *+ 950 μL of the solution was mixed and reacted in a dark place at 25°C for 6 minutes. After the reaction, the absorbance was measured at 734 nm using a UV-vis spectrophotometer (Genesys 10S, Thermo scientific, US). The ABTS radical scavenging activity (%) of each sample was calculated using the following equation.

[0132]

[0133] ABTS Scavenging activity(%)= [(ABTS blank -ABTS 샘플 ) / ABTS blank ]X100

[0134]

[0135] - DPPH assay

[0136] A 0.1 mM DPPH (2,2-Diphenyl-1-picrylhydrazyl) reagent was prepared using 100% methanol. The prepared DPPH reagent was used after adjusting the absorbance at 517 nm to 0.98±0.03 before testing. Fifty microliters of each sample and 150 microliters of DPPH reagent were added and reacted at 25°C for 30 minutes. After the reaction, the absorbance was measured at 517 nm using a UV-vis spectrophotometer (Genesys 10S, Thermo scientific, US). The DPPH radical scavenging activity (%) of each sample was calculated using the following equation.

[0137]

[0138] DPPH Scavenging activity(%)= [(DPPH blank -DPPH 샘플 ) / DPPH blank ]X100

[0139]

[0140] - FRAP assay

[0141] To confirm the reducing power of the recombinant polypeptide, a Ferric Reducing Antioxidant Power (FRAP) assay was performed. Specifically, 2.5 mL, 25 mL, and 2.5 mL of a 40 mM HCl solution of 10 mM TPTZ (2,4,6-tripyridyl-s-triazine), a 300 mM Acetate solution (pH 3.6), and a 20 mM FeCl3 solution were mixed to prepare a FRAP reagent. The prepared FRAP reagent was used after incubation at 37°C for 10 minutes. 150 μL of the FRAP reagent and 50 μL of each sample were mixed and incubated at 37°C for 30 minutes. After the reaction, the absorbance was measured at 593 nm using a UV-vis spectrophotometer (Genesys 10S, Thermo scientific, USA). The reducing power of each sample was calculated and expressed as follows based on the slope of the Trolox standard substance, and this is used as an indicator to determine how many times the reducing power is compared to Trolox.

[0142]

[0143] FRAP(TE)= sample slope / Trolox slope

[0144]

[0145] -Experimental results

[0146] All experiments were repeated three times under the above conditions. The experimental results were prepared as a standard curve and the IC50 was confirmed. The antioxidant activity was expressed as TEAC (Trolox equivalent antioxidant capacity, TE IC50 / sample IC50) to quantitatively compare the antioxidant capacity with the IC50 value of the sample, which is the same as the IC50 value of the standard substance Trolox.

[0147] The results of ABTS assay, DPPH assay, and FRAP assay are shown in Table 3 and Fig. 4.

[0148] Sample Anti oxidant activity(IC50, μM)ABTSDPPHFRAP(TE)ControlTrolox9.9919.841Ascorbic acid14.2820.67-GSH12.1723.90.07NAC5.19469.30.38Tocopherol9.0014.15-Resveratrol4.5210.5-RetinolN.D2750-Nicotanic acidN.DN.D-Coenzyme Q10N.DN.D-Experimental groupNGT10.36N.D0.08NGT21.215.662.82NGT33.5212.49-NGT41.17N.D0.04N.D: Not detected

[0149] As shown in Table 3, the IC50 values ​​of the recombinant polypeptides NGT1, NGT2, NGT3, and NGT4 were confirmed to be very low compared to the control group. In particular, the recombinant polypeptide NGT2 was confirmed to have a reducing power 2.82 times higher than that of Trolox. As shown in Figure 3, the ABTS radical scavenging activities of the recombinant polypeptides NGT1, NGT2, NGT3, and NGT4 were confirmed to be 27.76, 9.08, 2.84, and 8.54 times higher than that of Trolox, respectively. In addition, the DPPH radical scavenging activities of the recombinant polypeptides NGT2 and NGT3 were confirmed to be 3.5 and 1.6 times higher than that of Trolox, respectively.

[0150] The above results indicate that recombinant polypeptides NGT1, NGT2, NGT3 and NGT4 have superior antioxidant properties than the standard substance Trolox and the control group.

[0151]

[0152] Example 4. Evaluation of anti-aging activity of recombinant polypeptides

[0153] The anti-aging activity of the recombinant polypeptide prepared in Example 1 was evaluated by measuring collagenase and hyaluronidase inhibitory activity. Epigallocatechin gallate, oleanolic acid, and ursolic acid, which are known as anti-aging substances in the art, were used as controls in this experiment.

[0154]

[0155] To measure collagenase inhibitory activity, 10 μL of collagenase (2 U / mL, Sigma Aldrich C8051, USA); 60 μL of Tricine buffer (50 mM Tricine, 10 mM CaCl2, 400 mM NaCl, pH 7.5); and 10 μL of sample (0 - 1 mM) were mixed. Afterwards, 20 μL of N-[3-(2-Furyl)acryloyl]-leu-gly-pro-ala (1 mM in Tricine buffer, sigma aldrich F5135, USA) substrate solution was added and the mixture was incubated at 37°C for 20 minutes. After the reaction, the absorbance was measured at 335 nm. The collagenase inhibitory activity (%) of each sample was calculated using the following equation, and the IC50 value was confirmed by creating a standard curve.

[0156]

[0157] Collagenase inhibitory activity (%)=(1-Abs. blank / Abs. 샘플 )X100

[0158]

[0159] To measure hyaluronidase inhibition activity, samples (0-500 μM); hyaluronidase (0.4 U / mL, Sigma Aldrich H3506, USA, in 20 mM phosphate buffer, 77 mM NaCl, 0.01% BSA, pH 7.0); 300 mM phosphate buffer (pH 5.35); 0.03% hyaluronic acid substrate solution (720 kDa, Hyundai Bioland Co., Ltd., Republic of Korea, in 300 mM phosphate buffer, pH 5.35); and reaction stop buffer (24 mM sodium acetate, 79 mM acetic acid, 0.1% BSA) were prepared. 25 μL of sample and 3 μL of hyaluronidase were mixed and incubated at 37°C for 10 minutes. After adding 12 μL of 300 mM phosphate buffer to the above reaction solution, the reaction was performed at 37°C for 10 minutes, and 10 μL of 0.03% hyaluronic acid substrate solution was further added, mixed, and incubated (37°C, 45 minutes). After completion of incubation, 100 μL of reaction stop buffer was added, and the reaction was performed for an additional 10 minutes at room temperature, and the absorbance was measured at 600 nm. Hyaluronidase inhibitory activity (%) of each sample was calculated using the following formula, and the IC50 value was confirmed by creating a standard curve.

[0160]

[0161] Hyaluronidase inhibitory activity (%)=(1-Abs. blank / Abs. 샘플 )X100

[0162]

[0163] The results of measuring the collagenase and hyaluronidase inhibitory activities of the recombinant polypeptide manufactured in Example 1 are shown in Table 4.

[0164] SampleAnti-aging activity(IC50, uM)CollagenaseHyaluronidaseControl groupEGCG182.49-Oleanolic acid926.05451.14Ursolic acid-428.07Experimental groupNGT1749.3338.07NGT240.406.05NGT3185.0433.25NGT41970.331010.81

[0165] As shown in Table 4, the collagenase inhibitory activity of recombinant polypeptides NGT2 and NGT3 was confirmed to be significantly higher than that of the control group. In particular, the collagenase inhibitory activity of recombinant polypeptide NGT2 was approximately 23 times higher than that of oleanolic acid. In addition, the hyaluronidase inhibitory activity of recombinant polypeptides NGT1, NGT2, and NGT3 was confirmed to be significantly higher than that of the control group. In particular, the hyaluronidase inhibitory activity of recombinant polypeptide NGT1 was approximately 55.8 times higher than that of oleanolic acid, and the hyaluronidase inhibitory activity of NGT2 was approximately 74.5 times higher than that of oleanolic acid.

[0166] The above results indicate that the recombinant polypeptide prepared in Example 1 has a superior anti-aging effect than anti-aging materials known in the art.

[0167]

[0168] Example 5. Evaluation of skin penetration ability of recombinant polypeptides

[0169] The skin penetration ability of the recombinant polypeptide prepared in Example 1 was evaluated using a Franz cell diffusion assay. Vitamin A, vitamin B3, vitamin E, resveratrol, EGF, collagen, and hyaluronic acid were used as controls in this experiment.

[0170] Specifically, the Franz cell diffusion assay used a supercapacitor comprising a donor chamber for loading a sample; a receptor chamber for positioning the permeated sample, and a sampling port. The Franz cell diffusion assay was performed at room temperature for 16 hours, and 4 mL of a sample with a concentration of 0.2% (2 mg / mL) was loaded into the donor chamber. 10 mL of PBS (Phosphate Buffer Saline) was loaded into the receptor chamber. The membrane for confirming the permeability was cadaver skin (DermaLab TM , Female, 62 years old, Back, Seed group, Republic of Korea) were used. Each sample was quantified, and a standard calibration curve was created. The skin permeability of the quantified samples was measured, and the skin permeability of the test group was calculated using the following equation.

[0171]

[0172] Skin permeability(%)=(Receptor cell sample conc. x 10 / Donor cell sample conc. x 4)X100

[0173]

[0174]

[0175] The results of evaluating the skin penetration ability of the recombinant polypeptide manufactured in Example 1 are shown in Fig. 4.

[0176] As shown in Fig. 4, it was confirmed that the recombinant polypeptides NGT1, NGT2, NGT3, and NGT4 had high skin permeability.

[0177]

[0178] Example 6. Analysis of amino acid composition of recombinant polypeptides NGT2 and NGT3

[0179] The antioxidant amino acid composition within the sequences of recombinant polypeptides NGT2 and NGT3 was analyzed. The amino acid composition analysis was performed using the Expasy-ProtParam (web.expasy.org) web program. Furthermore, amino acids with strong antioxidant activity (Cys, Tyr, Trp) are colored red, and those with weak antioxidant activity (Arg, His, Lys, Phe, Val, Met) are colored green. The results of analyzing the amino acid compositions of recombinant polypeptides NGT2 and NGT3 are shown in Figures 5 and 6, respectively. Furthermore, the antioxidant amino acid ratios of recombinant polypeptides NGT2 and NGT3 are shown in Table 5.

[0180] NGT2NGT3Total length 12463 Number ratio (%) Number ratio (%) Amino acids showing strong antioxidant strength Tyr (Y) 2419.41320.6 Trp (W) 00.000.0 Cys (C) 1814.51015.9 Amino acids showing weak antioxidant strength Lys (K) 118.969.5 His (H) 10.800.0 Arg (R) 75.634.8 Val (V) 32.411.6 Phe (F) 21.611.6 Met (M) 10.811.6 Total antioxidant amino acids 6754.03555.6

[0181] As shown in Fig. 5 and Table 5, the recombinant polypeptide NGT2 was confirmed to have an antioxidant amino acid ratio of 54.0%. In addition, the recombinant polypeptide NGT2 was confirmed to have a ratio of amino acids (Tyr, Trp, Cys) showing strong antioxidant strength of 33.9%. As shown in Fig. 6 and Table 5, the recombinant polypeptide NGT3 was confirmed to have a total antioxidant amino acid ratio of 55.6%. In addition, the recombinant polypeptide NGT3 was confirmed to have a ratio of amino acids (Tyr, Trp, Cys) showing strong antioxidant strength of 36.5%.

[0182] The above results imply that the antioxidant capacity of recombinant polypeptides NGT2 and NGT3 is based on antioxidant amino acids.

[0183]

[0184] While specific aspects of the present invention have been described in detail, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

A peptide consisting of 1.60 to 150 amino acids and containing antioxidant amino acids. The above antioxidant amino acid is at least one selected from the group consisting of tyrosine (Tyr, Y), cysteine ​​(Cys, C), valine (Val, V), phenylalanine (Phe, F), lysine (Lys, K), histidine (His, H), arginine (Arg, R), valine (Val, V), phenylalanine (Phe, F), and methionine (Met, M). The peptide contains tyrosine (Tyr, Y), tryptophan (Trp, W) and cysteine ​​(Cys, C) at 33% or more of the total amino acids, valine (Val, V) and phenylalanine (Phe, F) at 4% or less, and the proportion of total antioxidant amino acids is 54% or more of the total amino acids of the peptide. Peptide.

2. In the first paragraph, the peptide comprises an amino acid sequence represented by SEQ ID NO:

13.

3. A peptide according to claim 1, wherein the peptide does not include a signal peptide sequence.

4. A peptide comprising an amino acid sequence represented by SEQ ID NO: 13, excluding a signal peptide sequence, and consisting of 60 to 150 amino acids, Containing tyrosine (Tyr, Y), tryptophan (Trp, W) and cysteine ​​(Cys, C) at 33% or more of the total amino acids, and valine (Val, V) and phenylalanine (Phe, F) at 4% or less. Peptide.

5. A peptide according to claim 1 or 4, wherein the peptide is composed of an amino acid sequence represented by sequence number 2 or 3.

6. A peptide according to claim 1 or 4, wherein the peptide has a cell penetrating peptide (CPP) or an expression enhancing tag bound to the N-terminus or C-terminus.

7. A peptide according to claim 1 or 4, wherein the peptide has anti-aging activity.

8. A peptide according to claim 7, wherein the anti-aging activity is antioxidant activity, skin wrinkle improvement, skin elasticity improvement, collagen decomposition enzyme inhibition, or hyaluronic acid decomposition enzyme inhibition.

9. A polynucleotide encoding the peptide of claim 1 or claim 4.

10. In the 9th paragraph, the polynucleotide is a polynucleotide consisting of a base sequence of sequence number 5 or 6.

11. A recombinant vector comprising the polynucleotide of Article 9.

12. A transformed cell into which the recombinant vector of clause 11 has been introduced.

13. An anti-aging composition comprising the peptide of claim 1 or claim 4.

14. A composition according to claim 13, wherein the anti-aging is antioxidant, skin wrinkle improvement, skin elasticity improvement, collagen decomposition enzyme inhibition, or hyaluronic acid decomposition enzyme inhibition.

15. A cosmetic composition comprising the peptide of claim 1 or claim 4.

16. A food composition comprising the peptide of claim 1 or claim 4.

17. A pharmaceutical composition for preventing or treating a disease caused by oxidative stress, comprising the peptide of claim 1 or claim 4.

18. A method for treating a disease caused by oxidative stress, comprising administering the peptide of claim 1 or claim 4 to a subject in need thereof.

Images